Human pluripotent stem cells (hPSCs) have dual value as microphysiological laboratory models and regenerative therapeutics. hPSCs are epithelial cells, but the extent to which hPSCs and descendant epithelia can reconstitute lineage-specific functions remains poorly understood. Here the Inventors show that hPSCs in three-dimensional cultures and their differentiated descendants can functionally recapitulate tissue-specific epithelial morphogenesis, physiology, and disease.

Provided herein are stem cells and methods for producing a culture of stem cells from urine. The stem cells may be differentiated into an osteogenic, chondrogenic, adipogenic, endothelial, neurogenic or myogenic lineage. Methods of use of the cells are provided, including methods of treating a subject in need of a cell based therapy.

An object of the present invention is to a new method of producing a kidney organoid. The method for producing a kidney organoid is characterized by comprising culturing an early kidney organoid with a medium containing an RXR agonist and a PPAR agonist, wherein the kidney organoid includes matured proximal tubule cells.

Disclosed are a cell population of human urine-derived cells positive for CD90, a cell population of myotubes induced from the cell population of the human urine-derived cells positive for CD90, and a method for producing a myotube derived from the human urine-derived cell, comprising a step of separating the human urine-derived cells positive for CD90.

The present disclosure relates to an exosome isolation method, more specifically, a method of isolating exosomes with high efficiency and high purity, including deproteinization, exosome aggregation, exosome binding, and exosome isolation. The method of isolating exosomes according to the present disclosure may be applied to all samples, such as body fluids and cell culture fluids, and thus, is characterized as a technique applicable to samples universally, and since total time required for exosome isolation is within 40 minutes, the method is time efficient, and since the method is capable of isolating 25 times more exosomes or greater than ultracentrifugation, the method may isolate exosomes with high efficiency and high purity. Therefore, the isolation method of the present disclosure and the exosomes isolated by the method are expected to be widely applicable in research on diagnosis or treatment methods requiring high-purity exosomes.

Embodiments of the present disclosure provide compositions and methods for making a genetically modified pluripotent stem cell, wherein the genetically modified pluripotent stem cell lacks cilia. Embodiments of the present disclosure also provide compositions and methods for using the genetically modified pluripotent stem cell to generate genetically modified organoids, wherein the genetically modified organoids lack cilia.

TABLE-US-00001 Knockout Isogenic Gene guideRNA Mutants Controls KIF3A CATATGGACAAACCGGAAC 7 7 KIF3B TTCGCTGTCGGCCCATGAA 3 3 TACACCATGGAAGGAATCCG 4 2

Provided herein are methods of treating a subject in need of treatment for a urological condition including administering urine stem cells to said subject in a treatment effective amount; and, in conjunction therewith, administering growth factors to said subject in an amount effective to promote differentiation of said stem cells into skeletal muscle cells. Compositions useful for the same are also provided.

Disclosed are renal tissues and arrays thereof that include a layer of renal interstitial tissue, the renal interstitial tissue comprising renal fibroblasts and endothelial cells; and a layer of renal epithelial tissue, the renal epithelial tissue comprising renal tubular epithelial cells, the renal epithelial tissue in contact with the layer of renal interstitial tissue to form a three-dimensional, engineered, biological renal tissue. Also disclosed are methods of fabricating and using the same.

Provided is a method for efficiently proliferating an influenza virus serving as a material for vaccine in a host. A method for proliferating an influenza virus in a host, comprising a step of inhibiting transfer of Bax in a host cell to the inner mitochondrial membrane.

The present invention relates to a culture medium for isolating and culturing urine-derived stem cells, a method for isolating and culturing urine-derived stem cells using the culture medium, urine-derived stem cells cultured in the culture medium, and a cell therapy product composition containing same.