Immunostimulatory fusion molecules that include an immune cell targeting moiety and a cytokine molecule, pharmaceutical and formulations thereof, and methods of using and making the same, are disclosed.

Disclosed are T regulatory cells endogenously occurring or generated in vitro which possess regenerative activity. In one embodiment said T regulatory cells are created by culture with derivatives of activated/enhanced mesenchymal stem cells. Said derivatives include apoptotic bodies, conditioned media, exosomes, microvesicles, proteins and various metabolites. In one embodiment said mesenchymal stem cells are activated with cytokines such as interferon gamma. In other embodiments are said mesenchymal stem cells are activated by ligation of toll like receptors. Cells of the invention are useful for treatment of autoimmune, degenerative, and combination of autoimmune and degenerative disease. Other uses of said regenerative T cells include treatment of heart failure, liver failure, stroke, and ischemic diseases.

This invention relates, inter alia, to compositions of low serum or serum free media and methods for the expansion of T cell populations and methods for using such populations of cells. In some aspects, the invention relates to compositions and methods for the selective expansion of T cell subpopulations.

The present disclosure concerns methods and compositions related to cancer treatment comprising targeting of SRC-3 in immune cells, including T cells such as T regulatory cells. The targeting of SRC-3 in T regulatory cells in particular is effective to eradicate tumors in mammals. In specific cases, the T regulatory cells are subjected to CRISPR ex vivo to produce cells suitable for adoptive cell transfer. In some cases, one or more agents that target SRC-3 are also administered to the individual and/or are exposed to the cells prior to administration.

The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.

Disclosed are means, methods, and compositions of matter useful for treatment of autoimmunity comprising exposing patient T cells fibroblasts possessing tolerogenic properties. In one embodiment peripheral blood mononuclear cells are cultured in the presence of CD73 selected fibroblasts alone or in the presence of interleukin-2, and/or IL-7, and/or TGF-beta, and/or PGE-2 for a period of time sufficient to endow tolerogenic properties. Said tolerogenic properties include ability to suppress adaptive or innate immune responses. In another embodiment the disclosure provides methods of generating antigen specific immune regulatory cells by culture of T cells together with fibroblasts in the presence of antigen to which specific immune regulation is desired.

The present disclosure provides methods and compositions for generating populations of auxotrophic cells and populations of differentiated cells and selecting populations of transfected cells using split auxotrophy.

Provided herein are populations of enriched ex vivo expanded umbilical cord blood-derived regulatory T cells. Also provided are methods of making and using the same.

Embodiments described herein generally provide for expanding cells in a cell expansion system. The cells may be grown in a bioreactor, and the cells may be activated by an activator (e.g., a soluble activator complex). Nutrient and gas exchange capabilities of a closed, automated cell expansion system may allow cells to be seeded at reduced cell seeding densities, for example. Parameters of the cell growth environment may be manipulated to load the cells into a particular position in the bioreactor for the efficient exchange of nutrients and gases. System parameters may be adjusted to shear any cell colonies that may form during the expansion phase. Metabolic concentrations may be controlled to improve cell growth and viability. Cell residence in the bioreactor may be controlled. In embodiments, the cells may include T cells. In further embodiments, the cells may include T cell subpopulations, including regulatory T cells (Tregs), for example.

The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.