Disclosed is a process of having mRNA selectively adsorbed and expressed in cardiomyocytes, by coupling an aptamer which selectively targets lipid nanoparticles containing the mRNA to cardiomyocytes and does not bind to fibroblasts, to lipid nanoparticles containing the mRNA; and administering the aptamer coupled to the lipid nanoparticles containing the mRNA to a host animal under conditions suitable for expression of the mRNA in cardiomyocytes. One preferred sequence for such an aptamer is: AGCCGTTCTGGGGGGTCGACGTTGCATCGTCA (SEQ ID NO:20), and wherein the mRNA encodes Stemin and/or YAP1(5SA).

Several embodiments of the present disclosure relate to glycotargeting therapeutics that are useful in the treatment of transplant rejection, autoimmune disease, food allergy, and immune response against a therapeutic agent. In several embodiments, the compositions are configured to target the liver and deliver antigens to which tolerance is desired. Methods and uses of the compositions for induction of immune tolerance are also disclosed herein.

The present invention provides a Pro-cyclic dinucleotide (Pro-CDN) comprising a STING agonist cyclic dinucleotide which is coupled to a linker system. The Pro-CDNs of the present invention can be metabolized at a targeted site into CDNs and exert their full immunomodulatory effects at said targeted site. The present invention also provides conjugates wherein a Pro-CDN is conjugated to a Biologically Active Molecule (BAM) such as e.g. a cytotoxic molecule, a lipid, a protein, a peptide, a nucleic acid, a sugar or a PRR ligand. The invention provides also methods related to the use of such compounds to perform their activities at their targeted sites, to exert cytotoxic, cytostatic or immunomodulatory effects, to treat or to prevent diseases such as cancers, immunological disorders or infections.

The invention provides certain nucleic acids (e.g., double stranded siRNA molecules), as well as conjugates that comprise a targeting moiety, a double stranded siRNA, and optional linking groups. Certain embodiments also provide synthetic methods useful for preparing the conjugates. The conjugates are useful to target therapeutic double stranded siRNA to the liver and to treat liver diseases including hepatitis (e.g. hepatitis B and hepatitis D).

The present invention relates to a novel compound and application thereof in the inhibition of HBV gene expression. The structure of the compound comprises an interfering nucleic acid for inhibiting HBV gene expression, transition points, and delivery chains of the interfering nucleic acid. By means of the delivery chains, two or three N-acetylgalactosamines can be introduced to an antisense strand 3′ end of such siRNA, and two or one N-acetylgalactosamine can be correspondingly introduced to a sense strand 5′ end, the total number of the introduced N-acetylgalactosamines being four. In vitro and in vivo pharmacological experiments prove that such a novel compound can continuously and efficiently inhibit HBV gene expression.

Provided are a method for preparing an mRNA-GalNAc targeting molecule, an in vivo delivery system therefor and use thereof. The mRNA-GalNAc targeting molecule comprises an mRNA molecule that is linked to PolyA modified with an N-acetylgalactosamine at 3′-end, wherein a sequence of the mRNA molecule comprises a 5′ cap and a target gene sequence. By directly linking the mRNA molecule expressing the target gene to the polyA sequence coupled with GalNAc, an mRNA molecule with GalNAc at 3′-end is synthesized to realize the aim of targeted drug delivery in liver. The method is simpler and more reliable, and solves existing problems in coupling between mRNA and N-acetylgalactosamine.

The present disclosure relates to methods of administering, subcutaneously, to a subject, multimeric oligonucleotides having monomeric subunits joined by covalent linkers. The multimeric oligonucleotides have a molecular weight and/or size configured to increase in vivo activity of one or more subunits within the multimeric oligonucleotide relative to in vivo activity of the same subunit when administered in monomeric form of at least about 45 kD and other characteristics, such that their clearance due to glomerular filtration is reduced. The present disclosure also relates to such multimeric oligonucleotides and methods of synthesizing such multimeric oligonucleotides.

The invention provides synthetic processes and synthetic intermediate compounds that can be used to prepare therapeutic conjugates. The invention also provides methods for treating HBV and/or HDV infection in a human by administering a therapeutic conjugate prepared by the synthetic methods of the invention.

The disclosure provides methods and compositions for delivering RNA constructs to cells for functional expression and/or activity. In some aspects, the disclosure provides a composition comprising a multi-functionalized nanoparticle. The multi-functionalized nanoparticles comprise a core functionalized with at least one RNA molecule, at least one cell penetrating peptide (CPP), and at least one positively charged moiety, each of which is independently attached to the core, optionally with linker moieties. In some embodiments, the RNA molecule is an uncapped mRNA molecule with the 5′ end attached to a linker moiety that is attached to the core. The multi-functionalized nanoparticle is substantially neutral, negatively or positively charged. The multi-functionalized nanoparticle can be used in methods of delivering and causing the expression of polypeptides of interest in a cell for various purposes, including vaccination, cancer treatment, extension of telomeres, modification of cellular signaling pathways, and the like.

The present invention provides an antisense oligomer having the base sequence depicted in SEQ ID NO: 26, an antisense oligomer having a base sequence resulting from substitution, deletion, insertion, or addition of 1 to 6 bases in the base sequence depicted in SEQ ID NO: 26, a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable hydrate thereof, an oligonucleotide conjugate in which the antisense oligomer is bound with a molecule capable of binding to an asialoglycoprotein receptor, and a pharmaceutical composition containing the same.