Dimer and monomer molecules according to general formulas (I) or (II) are useful as lipid switch molecules when incorporated into a membrane of a liposome.

##STR00001##

wherein R.sup.1 is a hydrophobic tail having at least 6 carbons and wherein R.sup.2 is selected from the group consisting of —NH.sub.2,

##STR00002##

wherein, for the dimer, the linker is a saturated carbon chain having 2 to 6 carbons or is a para-xylene linker; and when R.sup.2 is charged anions are present to render the charge neutral. These molecules can bind ATP or similar small phosphorylated molecules between R.sup.2 groups, which changes the shape of the molecule or the molecules orientation within the membrane thereby acting as a “switch” to release a therapeutic agent from the liposome.

Disclosed is a process of having mRNA selectively adsorbed and expressed in cardiomyocytes, by coupling an aptamer which selectively targets lipid nanoparticles containing the mRNA to cardiomyocytes and does not bind to fibroblasts, to lipid nanoparticles containing the mRNA; and administering the aptamer coupled to the lipid nanoparticles containing the mRNA to a host animal under conditions suitable for expression of the mRNA in cardiomyocytes. One preferred sequence for such an aptamer is: AGCCGTTCTGGGGGGTCGACGTTGCATCGTCA (SEQ ID NO:20), and wherein the mRNA encodes Stemin and/or YAP1(5SA).

The present invention generally relates to composition matters and methods useful for gene delivery and an option for therapeutic treatment of various diseases. Particularly, this disclosure relates to a plasmid vector comprising a fusion of a plurality of genes comprising a gene of a chemokine or a cytokine, a gene for a targeting polypeptide and genes for one or more polypeptide linkers. Methods of use and composition matters are within the scope of this disclosure.

The present disclosure provides phospholipid-containing compounds, pharmaceutical compositions and microspheres that exhibit high affinity for mineralized metals. The present disclosure also provides strategies for using said compounds, compositions and microspheres in the treatment of nephrolithiasis or kidney stone disease, and methods of manufacturing and preparing said compounds and compositions.

Disclosed in the present application is a use of a composition in treating atherosclerosis. Specifically, the present application relates to a use of a composition comprising microbubbles and copper ions in treating atherosclerosis.

Proposed are an ultrasound-assisted drug delivery carrier containing a ligand linked with a drug through an ester bond, a phospholipid, and a PEGylated phospholipid, a composition for drug delivery including the drug delivery carrier, and a method of preventing or treating a disease including administering the composition to an individual other than a human and releasing a drug by subjecting the site of administration of the composition to ultrasound irradiation. The ultrasound-assisted drug delivery carrier containing a ligand linked with a drug through an ester bond, a phospholipid, and a PEGylated phospholipid can be provided in the form of microbubbles or nanobubbles, and is capable of accelerating drug release due to collapse of the bubbles and promotion of hydrolysis of the ester bond during ultrasound irradiation, making it possible to deliver the drug to a desired site with high efficiency.

Polynucleotides encoding peptides, proteins, enzymes, and functional fragments thereof are disclosed. The polynucleotides of the disclosure can be effectively delivered to an organ, such as the lung, and expressed within cells of the organ. The polyribonucleotides of the disclosure can be used to treat a disease or condition associated with cilia maintenance and function, impaired function of the axoneme, such as DNAI1 or DNAH5.

Compositions or an assembly of a series of biomimetic compounds include chemical structures that mimic or structurally resemble a nucleic acid base pair. Complexes of nanotubes and agents are useful to deliver agents into the cells or bodily tissues of individuals for therapeutic and diagnostic purposes. Exemplary compounds include those of Formula (I), (III), (V) or (VII), or of Formula (II), (IV), (VI) or (VIII).

##STR00001##

Polynucleotides encoding peptides, proteins, enzymes, and functional fragments thereof are disclosed. The polynucleotides of the disclosure can be effectively delivered to an organ, such as the lung, and expressed within cells of the organ. The polyribonucleotides of the disclosure can be used to treat a disease or condition associated with cilia maintenance and function, impaired function of the axoneme, such as DNAI1 or DNAH5.

The invention relates to methods and materials for extending a circulating half-life of a protein. The method comprises conjugating a protein with a polymerizable acryloyl group and encapsulating the protein with a layer of poly(2-methacryloxyloxyethyl phosphorycholine) (pMPC). The layer of pMPC comprises a plurality of 2-methacryloxyloxyethyl phosphorycholine monomers (MPC) polymerized with a N,N′-methylenebisacrylamide (BIS) crosslinker.