Patent classifications
A61K47/6925
HIV-1 ENV FUSION PEPTIDE NANOPARTICLE CARRIER CONJUGATES AND THEIR USE
Embodiments of immunogenic conjugates including the HIV-1 Env fusion peptide and methods of their use and production are disclosed. In several embodiments, the immunogenic conjugates can be used to generate an immune response to HIV-1 Env in a subject, for example, to treat or prevent an HIV-1 infection in the subject.
CROSS-LINKED SUPRAMOLECULAR NANOPARTICLES FOR CONTROLLED RELEASE OF ANTIFUNGAL DRUGS AND STEROIDS - A NEW THERAPEUTIC APPROACH FOR ONYCHOMYCOSIS AND KELOID
Compositions for delivering a drug to a subject having: a plurality of self-assembled supramolecular nanoparticles (SMNPs), each of the plurality of self-assembled supramolecular nanoparticles (SMNPs) having: a plurality of binding components, each having a plurality of binding regions; a plurality of cores that are suitable to at least provide some mechanical structure to the plurality of self-assembled supramolecular nanoparticles (SMNPs), the plurality of cores comprising at least one core binding element adapted to bind to the binding regions to form a first inclusion complex; a plurality of terminating components, each having a single terminating binding element that binds to remaining binding regions of one of said plurality of binding components by forming a second inclusion complex; the drug; and a reporter agent, and methods of use thereof.
Treatment of primary ciliary dyskinesia with synthetic messenger RNA
Polynucleotides encoding peptides, proteins, enzymes, and functional fragments thereof are disclosed. The polynucleotides of the disclosure can be effectively delivered to an organ, such as the lung, and expressed within cells of the organ. The polyribonucleotides of the disclosure can be used to treat a disease or condition associated with cilia maintenance and function, impaired function of the axoneme, such as DNAI1 or DNAH5.
Fibrin particles and methods of making the same
Disclosed herein are low density particles comprising polymerized fibrin that are micrometer or nanometer sized in diameter. The particles can further include at least one therapeutic agent. The particles may be used to treat wounds, by administration directly or systemically to the site of the wound. Exemplary wounds that may be treated with the fibrin particles include a trauma wound, a surgical wound, a burn wound, or an ulcer wound. Also disclosed herein are methods for preparing the particles using a shearing process.
Capsule for drug delivery systems of targeted tissue-specific delivery type using carbosilane dendrimer
The present invention relates to a targeting-type capsule for drug delivery systems. The present invention addresses the problem of providing a capsule for drug delivery systems by utilizing the reactivity of a thiol with an alkyl halide, wherein the capsule comprises a silole-containing carbosilane dendrimer and a labeling protein containing a target recognition site (e.g., green fluorescent protein), can include a biological polymer or another molecule therein, and can deliver the biological polymer or the like selectively into a target cell.
Preparation of size-controlled microvesicles
A method for preparing a suspension of “size-controlled” gas-filled microvesicles by microfluidic manufacturing techniques, which comprises using a gaseous flow comprising a first gas having high solubility in water and a second gas having low 5 solubility in water.
Targeting technology to selectively express mRNAs in cardiomyocytes while avoiding stimulation of cardiac fibroblasts
Disclosed is a process of having mRNA selectively adsorbed and expressed in cardiomyocytes, by coupling an aptamer which selectively targets lipid nanoparticles containing the mRNA to cardiomyocytes and does not bind to fibroblasts, to lipid nanoparticles containing the mRNA; and administering the aptamer coupled to the lipid nanoparticles containing the mRNA to a host animal under conditions suitable for expression of the mRNA in cardiomyocytes. One preferred sequence for such an aptamer is: AGCCGTTCTGGGGGGTCGACGTTGCATCGTCA (SEQ ID NO:20), and wherein the mRNA encodes Stemin and/or YAP1(5SA).
Method of treating urolithiasis
The present disclosure provides phospholipid-containing compounds, pharmaceutical compositions and microspheres that exhibit high affinity for mineralized metals. The present disclosure also provides strategies for using said compounds, compositions and microspheres in the treatment of nephrolithiasis or kidney stone disease, and methods of manufacturing and preparing said compounds and compositions.
Methods of manufacturing microspheres
The present disclosure provides phospholipid-containing compounds, pharmaceutical compositions and microspheres that exhibit high affinity for mineralized metals. The present disclosure also provides strategies for using said compounds, compositions and microspheres in the treatment of nephrolithiasis or kidney stone disease, and methods of manufacturing and preparing said compounds and compositions.
Nanobubbles
The present invention provides oxygenized nanobubbles and their uses in imaging and cancer treatment when combined with therapeutic drugs and precise ultrasound beam steering.