A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

A method for creating an animal model of indirect traumatic optic neuropathy, including fully exposing an internal segment of an optic canal as well as adjacent anterior skull base, posterior ethmoid sinus and lateral sphenoid sinus walls through an ethmoid sinus-sphenoid sinus operation pathway under an endoscope, and impacting different sites of the internal segment of the optic canal with controllable impact force to cause optic nerve injury so as to prepare a controllable and quantifiable ITON bionic elastic injury animal model reflecting contusion to an internal segment of an optic canal in a human ITON clinical injury state. With less intracranial combined injury to the animal, the survival rate is high. Different sites of the optic canal are impacted with quantifiable elastic force for the quantitative and qualitative purposes with respect to the injured parts and the injury degree.

Genetically modified non-human animals comprising a humanized interleukin-15 (IL-15) gene. Cells, embryos, and non-human animals comprising a human IL-15 gene. Rodents that express humanized or human IL-15 protein.

The present invention provides compositions and methods for the treatment or prevention of a neurological disease or disorder of the central nervous system (e.g., a storage disorder, lysosomal storage disorder, neurodegenerative disease, etc.) by reconstitution of brain myeloid cell and microglia upon transplantation of hematopoietic cells enriched in microglia reconstitution potential. The invention also provides compositions and methods for ablating and reconstituting microglia.

Mice that comprise a replacement of endogenous mouse IL-6 and/or IL-6 receptor genes are described, and methods for making and using the mice. Mice comprising a replacement at an endogenous IL-6R locus of mouse ectodomain-encoding sequence with human ectodomain-encoding sequence is provided. Mice comprising a human IL-6 gene under control of mouse IL-6 regulatory elements is also provided, including mice that have a replacement of mouse IL-6-encoding sequence with human IL-6-encoding sequence at an endogenous mouse IL-6 locus.

A genetically modified cat produced through gene editing with a phenotype characterized by the substantial absence of the major cat allergen, Fel d I. The phenotype is conferred in the genetically modified cat by targeting either the gene sequence of the Fel d I locus or sequences flanking the coding sequence of the two contiguous Fel d I genes with specialized gene editing constructs. The genotype and phenotype of the genetically modified cat is transmissible to its offspring.

A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

The invention relates to methods for identifying a Doberman pinscher dog as having familial dilated cardiomyopathy (DCM) or having an increased risk of developing familial DCM, comprising detecting in nucleic acid from the Doberman pinscher dog a missense mutation in the titin gene (TTN) (DCM2 mutation). The invention further provides methods for treating DCM and methods for delaying the onset or progression of DCM and/or delaying the development of symptoms of DCM in a Doberman pinscher dog.

Described herein are compositions and methods for generating a viable cell that expresses at least one or more woolly mammoth genes. Also described herein are compositions and methods for generating an embryo, blastula, oocyte, or non-human organism that expresses one or more woolly mammoth genes.

Genetically modified rodents such as mice and rats, and methods and compositions for making and using the same, are provided. The rodents comprise a humanization of at least one endogenous rodent Tmprss gene, such as an endogenous rodent Tmprss2, Tmprss4, or Tmprss11d gene.