A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

The present invention covers means and methods to increase the efficiency of recombinant protein expression, in particular to optimize the industrial production of recombinant proteins in insect pupae, particularly in Trichoplusia ni (T. ni) pupae. Moreover, the present invention is also directed to the pupae itself comprising baculovirus, pupae infected, transformed, transduced or transfected with baculovirases or bacmids, as well as devices suitable for performing the methods of the present invention.

The present invention provides a primary cell culture which combines a cell culture medium and cells derived from a hypertrophied androgenic gland (AG) of a decapod crustacean. The invention also provides methods for obtaining an all-female progeny by initially injecting/transplanting the primary cell culture to a genetic-female to obtain a male-Neo-male.

The present invention relates to genetically edited swine which produce CD163 protein in which the scavenger receptor cysteine-rich 5 (SRCR5) domain (also known as CD163 domain 5) has been deleted. Such swine have been found to be healthy and do not exhibit negative properties, and are resistant to PRRSV infection. CD163 expressed in the edited swine also demonstrates retention of the ability to function as a haemoglobin-haptoglobin scavenger. Methods of producing such swine are also provided.

Methods, uses, and compositions for manipulating genomic DNA. Some of the embodiments of the invention provide for making a founder animal that is completely free of all unplanned genetic modifications. Some embodiments are directed to removing genetic faults in established breeds without making other alterations to the genome. Other embodiments are directed to particular tools or processes such as TALENs or CRISPR with a preferred truncation. One embodiment involves introducing a targeted targeting endonuclease system and a HDR template into a cell (optionally with a mismatch in the binding of the targeting endonuclease and the targeted site). Another embodiment includes processes of making a genetically modified livestock animal comprising a genome that comprises inactivation of a neuroendocrine gene selective for sexual maturation, with the inactivation of the gene preventing the animal from becoming sexually mature. One embodiment includes compositions and methods for making livestock with a polled allele, including migrating a polled allele into a bovine species without changing other genes or chromosomal portions.

Methods, uses, and compositions for manipulating genomic DNA. Some of the embodiments of the invention provide for making a founder animal that is completely free of all unplanned genetic modifications. Some embodiments are directed to removing genetic faults in established breeds without making other alterations to the genome. Other embodiments are directed to particular tools or processes such as TALENs or CRISPR with a preferred truncation. One embodiment involves introducing a targeted targeting endonuclease system and a HDR template into a cell (optionally with a mismatch in the binding of the targeting endonuclease and the targeted site). Another embodiment includes processes of making a genetically modified livestock animal comprising a genome that comprises inactivation of a neuroendocrine gene selective for sexual maturation, with the inactivation of the gene preventing the animal from becoming sexually mature. One embodiment includes compositions and methods for making livestock with a polled allele, including migrating a polled allele into a bovine species without changing other genes or chromosomal portions.

Mice that comprise a replacement of endogenous mouse IL-6 and/or IL-6 receptor genes are described, and methods for making and using the mice. Mice comprising a replacement at an endogenous IL-6R locus of mouse ectodomain-encoding sequence with human ectodomain-encoding sequence is provided. Mice comprising a human IL-6 gene under control of mouse IL-6 regulatory elements is also provided, including mice that have a replacement of mouse IL-6-encoding sequence with human IL-6-encoding sequence at an endogenous mouse IL-6 locus.

A genetically modified cat produced through gene editing with a phenotype characterized by the substantial absence of the major cat allergen, Fel d I. The phenotype is conferred in the genetically modified cat by targeting either the gene sequence of the Fel d I locus or sequences flanking the coding sequence of the two contiguous Fel d I genes with specialized gene editing constructs. The genotype and phenotype of the genetically modified cat is transmissible to its offspring.

A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

Described herein are compositions and methods for generating a viable cell that expresses at least one or more woolly mammoth genes. Also described herein are compositions and methods for generating an embryo, blastula, oocyte, or non-human organism that expresses one or more woolly mammoth genes.