The invention provides compositions, methods, and kits for increasing transport of GDNF across the blood brain barrier while allowing its activity to remain substantially intact. The GDNF is transported across the blood brain barrier via one or more endogenous receptor-mediated transport systems.

The present invention is directed to a fusion polypeptide, the polypeptide comprising: a. an interleukin-15 (IL-15); and b. an IL-15 activity-promoting sequence, wherein said sequence: is between 10 and 60 amino acid residues in length; and increases CD8+ T-cell proliferation 5 by the IL-15. Also provided are nucleic acids encoding the fusion polypeptide, associated methods of producing the fusion polypeptide, pharmaceutical compositions and kits comprising the same, and therapeutic uses thereof.

The disclosure describes novel systems, methods, and compositions for the manipulation of nucleic acids in a targeted fashion. The disclosure describes non-naturally occurring, engineered CRISPR systems, components, and methods for targeted modification of nucleic acids. Each system includes one or more protein components and one or more nucleic acid components that together target nucleic acids.

The present invention relates to improvement in the prevention and treatment of viral infectious diseases through the structural modification or improvement of a nano-perforator. According to the present invention, a nano-perforator, having modified structure, area, shape and membrane scaffold protein characteristics, has improved thermal stability and has maximized anti-viral activity through an increase in the efficiency of perforation activity, an increase in the stability of nano-perforator and the provision of virus specificity, and thus can be usable as a pharmaceutical composition for preventing or treating viral infectious diseases.

A reagent kit comprising a first polypeptide including a part in any one of amino acid sequences (A) to (C), and a second polypeptide including a part in any one of amino acid sequences (A) to (C), which are consistent of different sequences from a sequence of the first polypeptide; (A) an amino acid sequence in SEQ ID NO: 1 with deletion of an amino acid sequence from position 1 to 69 and an amino acid sequence from position 204 to 221, (B) an amino acid sequence in SEQ ID NO: 1 with deletion of an amino acid sequence from position 1 to 69 and deletion or substitution of at least one of amino acid residues at positions 146 to 156, (C) the amino acid sequence (A) or (B) with further deletion of at least one of amino acid residues at positions 70 to 74.

Herein is reported a nucleic acid comprising in 5′ to 3′ direction i) a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon, ii) a second nucleic acid fragment operably linked to said first nucleic acid fragment which is beginning with the 5′ splice donor site of an immunoglobulin heavy chain CH3 or CH4 domain and which is terminated by the 3′ splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1 and which comprises in frame translational stop codon and a polyadenylation signal, and iii) a third nucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane domain, wherein the second nucleic acid fragment has at its 3′ terminus the nucleotide sequence CTACCACCCCCTTCCTGTCCAG (SEQ ID NO: 29) or TGACCACGCCAATCGTGTCCAG (SEQ ID NO: 14) or CTACCACGCCAATCGTGTCCAG (SEQ ID NO: 31).

Described herein are methods and compositions for the targeted delivery of selective delivery molecule therapeutic agents and imaging agents.

Glycotargeting therapeutics are useful in the treatment of transplant rejection, autoimmune disease, food allergy, and immune response against a therapeutic agent.

The present disclosure relates generally to chimeric peptides composed of at least two domains connected by a linker. More specifically, the peptide domains may include an amphipathic helical domain and a targeting domain, which, in combination, allow the peptides to target and kill various viruses. The disclosed peptides may have a variety of beneficial agricultural properties and uses, for example, in the treatment of viruses that infect grapes, tobacco, tomatoes, citrus, and other commercially important crops.

Provided are an anti-IL-2 antibody, and an antigen-binding fragment thereof and the medical use thereof. Further provided are a complex (including a fusion protein) of the anti-IL-2 antibody, the antigen-binding fragment thereof and IL-2, and the use of the complex as a drug for treating autoimmune diseases and inflammatory diseases.