This disclosure relates to novel huntingtin targets. Novel oligonucleotides for the treatment of Huntington's disease are also provided.

Antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon 44 skipping are described.

The present disclosure provides miRNA mimics targeting CDK4 and/or CDK6, and compositions comprising the same. Methods for the treatment of tumors, including but not limited to colon cancer, comprising administering a modified oligonucleotide comprising a miRNA are also disclosed herein.

The present invention relates to a modified T regulatory cell (Treg) in which the level of microRNA miR-142-5p (CAUAAAGUAGAAAGCACUACU) or a variant thereof is increased or decreased. Therapeutic uses of said modified Tregs are also provided, in particular in the treatment of autoimmune diseases and cancer. Populations of said Tregs and methods of preparing such Tregs are also provided.

The invention features methods of diagnosis by assessing B7-H1 expression in a tissue from a subject that has, or is suspected of having, cancer, methods of treatment with agents that interfere with B7-H1-receptor interaction, methods of selecting candidate subjects likely to benefit from cancer immunotherapy, and methods of inhibiting expression of B7-H1.

Provided are compositions related to HSD17B13 variants, including isolated nucleic acids and proteins related to variants of HSD17B13, and cells comprising those nucleic acids and proteins. Also provided are methods related to HSD17B13 variants. Such methods include methods for modifying a cell through use of any combination of nuclease agents, exogenous donor sequences, transcriptional activators, transcriptional repressors, and expression vectors for expressing a recombinant HSD17B13 gene or a nucleic acid encoding an HSD17B13 protein. Also provided are therapeutic and prophylactic methods for treating a subject having or at risk of developing chronic liver disease.

Described herein are synthetic, modified RNAs for changing the phenotype of a cell, such as expressing a polypeptide or altering the developmental potential. Accordingly, provided herein are compositions, methods, and kits comprising synthetic, modified RNAs for changing the phenotype of a cell or cells. These methods, compositions, and kits comprising synthetic, modified RNAs can be used either to express a desired protein in a cell or tissue, or to change the differentiated phenotype of a cell to that of another, desired cell type.

The invention provides methods for treating or preventing microbial (eg, bacterial) infections and means for performing these methods. In particular, treatment of infections requiring rapid and durable therapy is made possible, such as for treating acute conditions such as septicemia, sepsis, SIRS or septic shock. The invention is particularly useful, for example, for treatment of microbes such as for environmental, food and beverage use. The invention relates inter alia to methods of controlling microbiologically influenced corrosion (MIC) or biofouling of a substrate or fluid in an industrial or domestic system. The invention also useful for the treatment of pathogenic bacterial infections in subjects receiving a treatment for a disease or condition, such as a transplant or a treatment for cancer, a viral infection or an autoimmune disease.

Molecules for inhibiting arachidonate 15-lipoxygenase (ALOX-15) gene products including dsRNA (dsRNA) agents such as small interfering RNAs (siRNAs) for therapeutic use, additionally, methods to inhibit the expression of a target gene by administering these agents for the treatment of diseases involving ALOX-15 gene products.

The methods and compositions of the disclosure provide for novel therapeutic compounds to treat obesity and aspects related thereto. Embodiments of the disclosure relate to oligonucleotide therapeutic (ONT) agents targeting miR-22 miRNA for the treatment of human obesity and related cardiometabolic disorders. Accordingly, aspects of the disclosure relate to modified nucleic acids, including locked nucleic acids, ethylene-bridged nucleotides, peptide nucleic acids, phosphorodiamidate morpholino oligonucleotides, and or a 5′(E)-vinyl-phosphonate modification.