C12N2830/20

Cells genetically modified to comprise pancreatic islet glucokinase and uses thereof

The present invention relates generally to a population of cells genetically modified to produce insulin in a glucose responsive manner and uses thereof. More particularly, the present invention relates to a population of cells genetically modified to produce insulin in response to physiologically relevant levels of glucose and uses thereof. The cells of the present invention are useful in a wide variety of applications, in particular in the context of therapeutic and prophylactic regimes directed to the treatment of diabetes and/or the amelioration of symptoms associated with diabetes, based on the transplantation of the cells of the present invention into mammals requiring treatment. Also facilitated is the design of in vitro based screening systems for testing the therapeutic effectiveness and/or toxicity of potential adjunctive treatment regimes.

Method for selecting polypeptide producing cells
20200157189 · 2020-05-21 · ·

Herein is reported a nucleic acid comprising in 5 to 3 direction i) a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon, ii) a second nucleic acid fragment operably linked to said first nucleic acid fragment which is beginning with the 5 splice donor site of an immunoglobulin heavy chain CH3 or CH4 domain and which is terminated by the 3 splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1 and which comprises in frame translational stop codon and a polyadenylation signal, and iii) a third nucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane domain, wherein the second nucleic acid fragment has at its 3 terminus the nucleotide sequence CTACCACCCCCTTCCTGTCCAG (SEQ ID NO: 29) or TGACCACGCCAATCGTGTCCAG (SEQ ID NO: 14) or CTACCACGCCAATCGTGTCCAG (SEQ ID NO: 31).

SAFE LENTIVIRAL VECTORS FOR TARGETED DELIVERY OF MULTIPLE THERAPEUTIC MOLECULES
20200155590 · 2020-05-21 ·

The present application discloses a lentiviral transfer system which includes: (i) a self-inactivating transfer vector comprising: multiple gene units, wherein each gene unit includes a heterologous nucleic acid sequence operably linked to a regulatory nucleic acid sequence; and (ii) a helper construct which lacks a 5 LTR, wherein the 5 LTR has been replaced with a heterologous promoter, in which the helper construct further comprises: a lentiviral env nucleic acid sequence containing a deletion, wherein the deleted env nucleic acid sequence does not produce functional env protein; and a packaging signal contains a deletion, wherein the deleted packaging signal is nonfunctional.

Bicistronic AAV vector for RNA interference in ALS

The present invention relates to a bicistronic expression vector for silencing a gene specifically in astrocytes and neurons, comprising two expression cassettes comprising a first and a second silencer sequence, respectively, wherein the expression of said first silencer sequence within astrocytes is regulated by an astrocyte-specific promoter and the expression of said second silencer sequence within neurons is regulated by a neuron-specific promoter. In a preferred embodiment, said first and second silencer sequences are SOD1 silencer sequences. Pharmaceutical composition comprising said bicistronic vector and the use of the same in the treatment of motoneuron diseases are further described.

REAGENTS FOR TREATMENT OF OCULOPHARYNGEAL MUSCULAR DYSTROPHY (OPMD) AND USE THEREOF

The present disclosure relates to RNA interference (RNAi) reagents for treatment of oculopharyngeal muscular dystrophy (OPMD), compositions comprising same, and use thereof to treat individuals suffering from OPMD or which are predisposed thereto.

Stably maintained multiple copies of at least two ORF in the same orientation

The present invention relates to a method for constructing a host cell expressing a polypeptide of interest from at least two ORF's stably integrated onto the chromosome of the host cell comprising the steps of: a) providing the at least two ORF's encoding the same polypeptide, wherein the at least two DNA sequences of the ORF's differ in at least one position; b) integrating the at least two ORF's in the same orientation on the host cell chromosome.

SINGLE-VECTOR TYPE I VECTORS

The invention relates to the production and use of Cas-encoding sequences and vectors comprising these. Aspects of the invention provide products, vectors, delivery vehicles, uses and methods for producing Cas-encoding sequences in bacterial or archaeal cells.

VIRAL VECTORS FOR NUCLEAR REPROGRAMMING

This document provides materials and methods involved in making and using induced pluripotent stem cells (iPSCs). For example, measles virus vectors for reprogramming somatic cells into iPSCs, methods for obtaining iPSCs, and methods for using iPSCs are provided.

Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules

The present application discloses a lentiviral transfer system which includes: (i) a self-inactivating transfer vector comprising: multiple gene units, wherein each gene unit includes a heterologous nucleic acid sequence operably linked to a regulatory nucleic acid sequence; and (ii) a helper construct which lacks a 5 LTR, wherein the 5 LTR has been replaced with a heterologous promoter, in which the helper construct further comprises: a lentiviral env nucleic acid sequence containing a deletion, wherein the deleted env nucleic acid sequence does not produce functional env protein; and a packaging signal contains a deletion, wherein the deleted packaging signal is nonfunctional.

Antibody Delivery
20240100187 · 2024-03-28 ·

A vector comprises a polynucleotide encoding an antibody or antibody fragment for use in a method of treatment of a disease or disorder of the central nervous system (CNS) in a subject, wherein the vector transduces or transfects cells of the blood brain barrier (BBB) and the transduced or transfected BBB cells express the antibody or antibody fragment resulting in delivery of the antibody or antibody fragment into the CNS, preferably into the brain parenchyma. Expression cassettes useful in such vectors may comprise from 5 to 3: at least one promoter operably linked to a first gene encoding a light chain of an antibody or antibody fragment and to a second gene encoding a heavy chain of the antibody or antibody fragment and further comprise an IRES after the first gene encoding the light chain of the antibody or antibody fragment and before the second gene encoding the heavy chain of the antibody or antibody fragment or a first promoter operably linked to a first gene encoding a light chain of an antibody or antibody fragment and a second promoter operably linked to a second gene encoding a heavy chain of the antibody or antibody fragment. The antibodies and antibody fragments thus produced may be of higher quality, displaying lower levels of aggregation and unwanted immunogenicity.