Provided herein, in some embodiments, are artificial secretion peptides capable of directing secretion from Lactobacillus for use, for example, in producing heterologous proteins, including therapeutic proteins.

Provided herein are B7-H3 antibodies, fragments of such antibodies, and compositions comprising the same. The antibodies, antibody fragments and compositions are useful in a number of analytical methods, including immunohistochemical and immunocytochemical detection and analysis of B7-H3. Also provided herein are isolated peptides and fusion proteins containing immunogenic determinants for said B7-H3 antibodies, animals immunized with the peptides and fusion proteins, isolated B cells obtained from the animals, and hybridomas made from the isolated B cells.

Engineered pH-dependent anti-CD3 binding domains and antibodies and/or antigen-binding domains comprising same, including multispecific antibodies, with, inter alia, desirable T-cell activation and (re)directed target cell killing potency and developability, profiles are provided, as well as methods for their identification, isolation, and generation, and methods for their preparation and use.

The present invention provides compositions and methods for immunotherapy, which include shelf-stable pharmaceutical compositions for inducing antigen-specific T cells. Such compositions are employed as components of an artificial antigen presenting cell (aAPC), to provide a patient with complexes for presentation of an antigen (e.g., a tumor antigen) and/or a T cell co-stimulatory molecule.

Antibody formulations are described comprising a mixture of a non-reducing sugar, an anti-α4β7 antibody and at least one amino acid. The disclosed formulations have improved stability, reduced aggregate formation, and may retard degradation of the anti-α4β7 antibody therein or exhibit any combinations thereof. The present invention further provides a safe dosing regimen of these antibody formulations that is easy to follow, and which results in a therapeutically effective amount of the anti-α4β7 antibody in vivo.

The invention provides antibodies that specifically bind tau. The antibodies inhibit or delay tau-associated pathologies and associated symptomatic deterioration.

Herein is reported a nucleic acid comprising in 5′ to 3′ direction i) a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon, ii) a second nucleic acid fragment operably linked to said first nucleic acid fragment which is beginning with the 5′ splice donor site of an immunoglobulin heavy chain CH3 or CH4 domain and which is terminated by the 3′ splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1 and which comprises in frame translational stop codon and a polyadenylation signal, and iii) a third nucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane domain, wherein the second nucleic acid fragment has at its 3′ terminus the nucleotide sequence CTACCACCCCCTTCCTGTCCAG (SEQ ID NO: 29) or TGACCACGCCAATCGTGTCCAG (SEQ ID NO: 14) or CTACCACGCCAATCGTGTCCAG (SEQ ID NO: 31).

The present invention provides compositions comprising a Fc-containing protein wherein substantially all the Fc domains have a C-terminal lysine. Further provided are host cell for producing said compositions, methods of making said host cells and compositions, and method of use thereof.

Provided herein are antigen-binding proteins (ABPs) that selectively bind to TIGIT and its isoforms and homologs, and compositions comprising the ABPs. Also provided are methods of using the ABPs, such as therapeutic and diagnostic methods.

The present invention comprises conjugates comprising a monoclonal antibody conjugated to a cyclic PYY peptide. The invention also relates to pharmaceutical compositions and methods for use thereof. The novel conjugates are useful for preventing, treating or ameliorating diseases and disorders disclosed herein.