Patent classifications
C12N2310/16
BIFUNCTIONAL MOLECULES AND METHODS OF USING THEREOF
The present disclosure relates generally to compositions of synthetic bifunctional molecules comprising a first domain that specifically binds to a target ribonucleic acid and a second domain that specifically binds to a target polypeptide, and uses thereof.
CIRCULAR BIFUNCTIONAL APTAMERS AND TRIFUNCTIONAL APTAMERS TARGETING Tau
The lack of blood-brain barrier (BBB) penetrating ability has hindered the delivery of many therapeutic agents for tauopathy therapeutic treatment. A circular bifunctional aptamer reported here has been able to enhance the in vivo BBB penetration for improved therapy. The circular aptamer includes one transferrin receptor (TfR) aptamer to facilitate TfR-aptamer recognition-induced transcytosis across BBB endothelial cells, and one Tau protein aptamer selected to inhibit Tau phosphorylation and other tauopathy-related pathological events in the brain. This bispecific construct exhibits strong specificity towards Tau and enhanced plasma stability in comparison to linear Tau aptamer. In vivo administration of circular Tau-TfR aptamer results in a rapid uptake into relevant brain regions after crossing the BBB, such as hippocampus and cortex. A Y-shaped trispecific aptamer including one aptamer for L1CAM, one aptamer for Tau and one aptamer for TfR reported here has enhanced BBB and neuron cell membrane permeation. Bispecific and trispecific Tau aptamer coupled to a signaling moiety (such as dodecane tetraacetic acid (DOTA) or DOTA complexed to Gd+3) for neuroimaging, and bispecific or trispecific Tau aptamer coupled to protein aggregate binding moiety (such as methylene blue) for enhanced ability to disrupt tau aggregation are also contemplated in this invention.
Targeting Technology to Selectively Express mRNAs in Cardiomyocytes While Avoiding Stimulation of Cardiac Fibroblasts
Disclosed is a process of having mRNA selectively adsorbed and expressed in cardiomyocytes, by coupling an aptamer which selectively targets lipid nanoparticles containing the mRNA to cardiomyocytes and does not bind to fibroblasts, to lipid nanoparticles containing the mRNA; and administering the aptamer coupled to the lipid nanoparticles containing the mRNA to a host animal under conditions suitable for expression of the mRNA in cardiomyocytes. One preferred sequence for such an aptamer is: AGCCGTTCTGGGGGGTCGACGTTGCATCGTCA (SEQ ID NO:20), and wherein the mRNA encodes Stemin and/or YAP1(5SA).
CRISPR EPIGENETIC THERAPEUTICS FOR PAIN MANAGEMENT
Disclosed are effective, specific, and durable pain management therapies using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR-based) epigenetic modulation of endogenous pathways involved in pain.
FUNCTIONAL LIGANDS TO TARGET MOLECULES
The present invention relates functional ligands to target molecules, particularly to functional nucleic acids and modifications thereof, and to methods for simultaneously generating, for example, numerous different functional biomolecules, particularly to methods for generating numerous different functional nucleic acids against multiple target molecules simultaneously. The present invention further relates to functional ligands which bind with affinity to target molecules, such as vitamin C or malaria histidine-rich protein II (HRP2).
OVULATION MONITORING PLATFORM
Provided herein are devices and methods for monitoring biofluids related to ovulation. Such devices include the use of electrochemical aptamer-based (EAB) sensors.
Nucleic acid compounds for binding to complement component 3 protein
Described herein are aptamers capable of binding to human complement component 3 (C3) protein; compositions comprising a C3 binding aptamer with a C3-Protein; and methods of making and using the same.
RNA-modulating agents
The instant disclosure provides RNA-modulating agents that function to recruit one or more small regulatory RNA molecules (e.g., miRNA molecules, Y RNAs, and siRNAs) to a target mRNA thereby modulating (e.g., inhibiting) the translation of the target mRNA or destabilizing the mRNA. Also provided are miRNA inhibitors and diagnostic agents that have improved binding affinity for their target miRNAs. Methods for using the RNA-modulating agents, miRNA inhibitors and diagnostic agents are also provided.
Stem-loop compositions and methods for inhibiting factor D
The application discloses methods and compositions for the inhibition of the alternative complement pathway. The methods and compositions involve the use of aptamers for inhibiting complement Factor D. The application further provides anti-Factor D aptamers for the treatment of dry age-related macular degeneration, geographic atrophy, wet age-related macular degeneration or Stargardt disease. In some cases, stem-loop aptamers are provided for the inhibition of Factor D.
Use of aptamers in proteomics
The present invention is a method for measuring the amount of at least one molecule in a biological sample, the method comprising a) combining the sample, or a derivative thereof, with one or more aptamers and allowing one or more molecules in the sample to bind to the aptamer(s); b) separating bound from unbound molecules; and c) quantifying the molecule(s) bound to the or each aptamer, wherein quantification of the bound molecule(s) is carried out by sequencing at least part of the or each aptamer. Uses of and products derived from the method are also contemplated.