An object of the present invention is to provide a technique for stably, inexpensively, and safely culturing stem cells having a differentiation ability while maintaining an undifferentiated state. The present invention relates to a medium for culturing stem cells, comprising at least one or more compounds selected from the group consisting of a ROCK inhibitor, a PKC inhibitor, a histone methyltransferase inhibitor, and a retinoic acid receptor agonist, and not containing a growth factor or having a low growth factor concentration; a method for culturing stem cells using the medium; a growth promoter for stem cell; as well as a cell composition containing stem cells or differentiated cells therefrom; and a method for producing the cell composition.

The present invention is concerned with a composition and in vitro method for generating a desired cell type and/or tissue type from hair follicular stem cells. The composition and in vitro method are particularly suitable for generating an autologous desired cell type and/or tissue type. Furthermore, the composition and method are especially efficient and suitable for use in the context of cosmetic cell and/or tissue transplantation in recipient areas of a subject experiencing cell and/or tissue loss caused by, for example, a wound, scar, burn injury, tissue degeneration, and aging. The composition and in vitro method are also suitable to circumvent complications related to infections and/or immune rejection of a cosmetic cell and/or tissue implant or graft.

The invention relates to immuno-oncology mesodermal progenitor (ioMP) cells and their use in therapy.

The present invention provides methods and compositions for inducing pluripotency in differentiated mammalian cells. In particular, the methods include mechanically aggregating the cells into discrete masses or embryoid-like bodies and treated them with a small molecule compound. Provided herein are the compositions of the compounds which are derived from programin (e.g., reversine).

The present disclosure provides methods, compositions, and kits for high-throughput single-cell analysis, such as nucleic acid analysis. In some embodiments, methods, compositions and kits for indexing a plurality of samples are provided. In some embodiments, methods, compositions and kits for high-throughput single-cell nucleic acid analysis, such as RNA sequencing are provided. The present disclosure allows fast, efficient and convenient cell labeling and sample pooling without being limited by cell types.

The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method, and a composition for treating an autoimmune disease, the composition comprising the regulatory T cells.

A combination of: (a) at least one deoxyribonucleoside (dN) or a derivative thereof and cyclosporin H (CsH) or a derivative thereof: or (b) at least one pyrimidine precursor and cyclosporin H (CsH) or a derivative thereof.

The present invention relates to a method of transporting a stem cell population, the method comprising transporting the stem cell population contacted with a liquid carrier. In addition, the present invention concerns a method of treating a subject having a disease, the method comprising topically administering a defined mesenchymal stem cell population to the subject, wherein the mesenchymal stem cell population is administered within about 96 hours from the time point the mesenchymal stem cell population has been harvested. Also concerned is a unit dosage comprising about 20 million cells, of about 15 million cells, of about 10 million cells, of about 5 million cells, of about 4 million cells, of about 3 million cells, of about 2 million cells, of about 1 million cells, of about 0.5 million cells, of about 0.25 million cells or of less than 0.25 million cells of a defined mesenchymal stem cell population.

A method for differentiation of neural stem cells, neurons and GABAergic neurons from mesenchymal stem cells includes culturing the mesenchymal stem cells in a medium containing SB431542, Noggin and LDN193189. By this method, the mesenchymal stem cells are differentiated into neural stem cells, neurons and GABAergic neurons at a high transformation rate without gene manipulation.

The present invention provides compositions and methods for transferring phospholipids and other molecules between the leaflets of a cell membrane. The compositions comprise at least one nucleic acid or compound having a hydrophilic region, where the composition is able to form a nanostructure that forms a toroidal pore in a lipid membrane. The nucleic acid or hydrophilic region-containing compound further contains an attached molecule capable of inserting the nanostructure into the lipid membrane. The invention also provides methods for scrambling lipids and other molecules in a cell membrane, which can be used to alter the function of a selected cell or to facilitate the death of the cell. The scrambling activity of synthetic scramblases described herein outperforms previously known enzymatically active DNA nanostructures and naturally occurring scramblases, in some cases by several orders of magnitude.