The present invention relates to a composition for the differentiation of dental pulp stem cells into odontoblasts and an IgG or IgM type monoclonal antibody that specifically binds to the surface of odontoblasts differentiated from the stem cells. According to the present invention, BMP2 and BMP4 are optimally combined to significantly increase the differentiation efficiency of dental pulp stem cells into odontoblasts, to induce the mineralization of the matrix, and to improve the differentiation ability of odontoblasts into dentin. Further, the IgG or IgM monoclonal antibody that specifically binds to the surface of odontoblasts of the present invention is used to effectively isolate and purify odontoblasts, which can be useful for tissue regeneration and differentiation.

A method is provided for producing a live cartilaginous material useful for implantation into a patient. A method of treating a patient comprising implanting a cartilaginous material prepared according to the provided method in an anatomical site in a patient also is provided.

The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.

There is provided inter alia according to the invention an ex vivo method of obtaining tolerogenic antigen presenting cells (APCs) that have the capability to induce tolerance in the immune system to an antigen, the method comprising (a) isolating monocytes from a sample obtained from a mammal; and (b) culturing the isolated monocytes in a cell culture to induce differentiation of the monocytes into antigen presenting cells having a tolerogenic phenotype, wherein the cell culture comprises (i) retinoic acid and TGFbeta, (ii) retinoic acid, TGFbeta and an AhR agonist or (iii) retinoic acid and an AhR agonist.

The present invention relates to a platelet lysate foam obtained from blood derivative (allogenic or autologous) which retains the biological properties of the platelet lysate and has optimal properties, in particular mechanical but also storage, which allow sale thereof and make handling thereof easier.

The present invention also relates to the use of a platelet lysate foam for therapeutic purposes, cell culture and cell therapy.

The present invention also relates to a process for getting a platelet lysate foam by a process of drying in a supercritical CO.sub.2 atmosphere.

Well-defined, xeno-free culture media which comprise a TGF-beta isoform or the chimera formed between IL6 and the soluble IL6 receptor (IL6RIL6), which are capable of maintaining stem cells, and particularly, human embryonic stem cells, in an undifferentiated state are provided. Also provided are cell cultures comprising the culture media and the stem cells and methods of expanding and deriving embryonic stem cells in such well-defined, xeno-free culture media. In addition, the present invention provides methods of differentiating ESCs or EBs formed therefrom for the generation of lineage specific cells.

The present invention provides a cell culture having a cartilage-like tissue forming property, including a cell population in which the expression intensity of at least one cell surface marker selected from the group consisting of CD166, CD165, CD99, GD2, STRO-1, CD108, CD164, CD6, CD106, and CD107b is not higher than the threshold for each cell surface marker, and/or, the expression intensity of at least one cell surface marker selected from the group consisting of CD26, CD73, CD105, CD44, CD120a, CD201, EGFR, CD146, CD140a, and CD90 is not lower than the threshold for each cell surface marker.

The present invention provides a chromosome-stabilizing agent for stem cells containing a β-nicotinamide mononucleotide or a pharmaceutically acceptable salt thereof, or a solvate thereof, as an active ingredient. The present invention also provides a culture method for stem cells, including culturing stem cells in a culture medium containing a β-nicotinamide mononucleotide or a pharmaceutically acceptable salt thereof, or a solvate thereof.

The present disclosure provides a method for inducing transdifferentiation of somatic cells into mammary epithelial cells in vitro using a small molecule compound. The method includes: inhibiting an expression of TGFbeta R1 and related sites thereof, to induce the transdifferentiation of the somatic cells into the mammary epithelial cells in vitro. The present disclosure fills a gap in the technology of inducing the transdifferentiation of fibroblasts to the mammary epithelial cells using the small molecule compound; the present disclosure also provides a research platform for in vitro researches on a mammary gland bioreactor, mammary gland development and differentiation, breast cancer, and transdifferentiation of the fibroblasts into other types of functional cells.

The invention provides a bioactive substance composition, a serum-free medium comprising the composition and the uses thereof. The bioactive substance composition is used for serum-free medium and/or composition and the preparation thereof; The serum-free medium and/or composition can be used for primary culture and secondary culture of cells and/or tissues. The cells are selected from any one or more of tendon and/or ligament derived cells, chondrocytes, meniscus stem cells, mesenchymal stem cells, skeleton stem cells, and muscle stem cells. The tissue is the musculoskeletal system tissue. The bioactive substance composition and/or serum-free medium and/or the composition can be used to prepare drugs for tissue and/or organ injury treatment; The tissue or organ injury is selected from the tissue or organ injury of the musculoskeletal system.