The present invention provides a method for preparing induced pluripotent stem cells through somatic cell reprogramming and induced pluripotent stem cells obtained therefrom. The present method comprises introducing the factors Oct4 and Nanog as reprogramming-inducing factors into somatic cells to perform reprogramming; followed by culturing the partially or fully reprogrammed somatic cells in a medium comprising specific chemical inducing agents to obtain induced pluripotent stem cells. In the present invention, the combination of different forms of reprogramming-inducing factors and three small-molecule compounds as chemical inducing agents can significantly improve the reprogramming efficiency of human somatic cells and reduce the tumorigenicity of the obtained induced pluripotent stem cells.

The method for producing a cell aggregate including glial progenitor cells according to the present invention comprises: (1) a step of subjecting pluripotent stem cells to suspension culture in an embryoid-body-forming culture medium containing one or more SMAD signaling inhibitors and one or more Wnt signaling activators in the absence of feeder cells for 5 days to 10 days, to form a cell aggregate; (2) a step of subjecting the cell aggregate obtained in (1) to suspension culture in an embryoid-body-forming culture medium containing retinoic acid; (3) a step of subjecting the cell aggregate obtained in (2) to suspension culture in an embryoid-body-forming culture medium or neuron-and-glia-proliferating culture medium containing retinoic acid and one or more SHH signaling activators; and (4) a step of subjecting the cell aggregate obtained in (3) to suspension culture in a neuron-and-glia-proliferating culture medium containing no retinoic acid and one or more SHH signaling activators.

Compositions and methods are provided for induction and maintenance of quiescence of stem cells.

The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.

The present invention provides a composition for treating ischemic diseases or neuroinflammatory diseases. PSA-NCAM-positive neural progenitor cells used in the present invention promote angiogenesis in injected tissue and inhibit an inflammatory response. The PSA-NCAM-positive neural progenitor cells can be simply isolated by using an anti-PSA-NCAM-antibody, and exhibit excellent angiogenic and anti-inflammatory activities compared with mesenchymal stem cells, and thus can be useful as a composition for effectively treating ischemic diseases caused by a vascular injury and nerve damage diseases caused by inflammation. In addition, a secretome of the neural progenitor cells of the present invention reduces the ischemic injury site and allows a neurological function to recover, and thus can be used as an agent for treating ischemic diseases and degenerative nervous system disorders such as nerve damage diseases caused by inflammation.

Methods are provided for the efficient differentiation of hPSCs into HSC-like cells and endothelial cells in defined, monolayer conditions solely using extracellular signals to guide differentiation. The instant disclosure also provides methods of screening for cellular responses of the generated hematopoietic stem cells, endothelial cells and derivatives thereof. Treatment methods making use of the generated hematopoietic stem cells and endothelial cells are also provided. The instant disclosure also provides systems, compositions, and kits for practicing the methods of the disclosure.

The present description provides improved methods for generating thymic epithelial progenitor (TEP) cells from pluripotent stem (PS) cells in vitro. Also provided are isolated invitro cell populations, compositions, and systems comprising TEP cells produced in vitro. Compositions and systems of cell populations of thymic epithelial cells and subpopulations thereof, as well as cells formed during different stages of differentiation of PS cells into thymic epithelial cells and subpopulations thereof are provided.

The present invention provides a method for producing dopaminergic neuron progenitor cells from pluripotent stem cells, which method comprises the steps of: (i) performing adherent culture of pluripotent stem cells on an extracellular matrix in a medium containing a reagent(s) selected from the group consisting of BMP inhibitor, TGFβ inhibitor, SHH signal-stimulating agent, FGF8, and GSK3β inhibitor; (ii) collecting Corin- and/or Lrtm1-positive cells from the cells obtained in Step (i) using a substance which binds to Corin and/or a substance which binds to Lrtm1; and (iii) performing suspension culture of the cells obtained in Step (ii) in a medium containing a neurotrophic factor.

Provided herein are blastoids and methods for producing the same that are obtained from an extended pluripotent stem (EPS) cell. The herein-disclosed methods provide a unique and highly malleable in vitro system for studying early preimplantation development. Also provided are EPS-blastoids derived from a somatic cell.

The disclosure relates to a method of producing bankable and subculturable mature microglia, and according to a method according to an aspect, subculture and banking are possible, and freeze storage and thawing are also possible, and thus, it is possible to simply isolate and use only mature microglia whenever necessary. In addition, it is possible to dramatically reduce the number of subjects required for an experiment, and therefore, the method may contribute economically to all research or industrial fields related to microglia.