NOVEL METHOD FOR SIMULTANEOUS DETECTION AND DISCRIMINATION OF BACTERIAL, FUNGAL, PARASITIC AND VIRAL INFECTIONS OF EYE AND CENTRAL NERVOUS SYSTEM
20170275710 · 2017-09-28
Assignee
Inventors
- CHINTALAGIRI MOHAN RAO (Hyderabad, IN)
- KUNCHALA SRIDHAR RAO (Hyderabad, IN)
- PUPPALA VENKAT RAMCHANDER (Bhubaneswar, IN)
- HAJIB NARAHARIRAO MADHAVAN (Chennai, IN)
- SAVITRI SHARMA (Hyderabad, IN)
- GITA SATPATHY (New Delhi, IN)
- VENKATA BANDA RAVI KUMAR (Bangalore, IN)
Cpc classification
C12Q1/705
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to the diagnostic methods for identification of the single causative agent or more than one causative agent of ocular and nervous system infections among many probable pathogens, which can cause the infection. All the pathogens affecting a discrete area of eye or nervous system generally cause same clinical manifestations or syndromes. The present invention relates to detection and discrimination of the pathogen among the set of probable pathogens in a single test without resorting to a battery of tests each being directed at detection of one pathogen. The current invention aims at the syndrome based diagnostic replacing the diagnostics based on detection of individual
Claims
1-18. (canceled)
19. A combination of pathogen specific probe DNA sequences for detection of specific pathogens, wherein said probe DNA sequences are selected from the group consisting of TABLE-US-00007 (SEQ ID NO: 45) cgcttggtttcggatgggaggcaactgtgctatccccatcacggtcatgg agtacaccgaatgctcctacaacaagtctctgggggc; (SEQ ID NO: 46) ggcaatcgtgtacgtcgtccgcacatcacagtcgcggcagcgtcatcggc ggtaacgcaagacccccccg; (SEQ ID NO: 47) caagctgacggacatttacaaggtccccctggacgggtacggccgcatga acggccggggcgtgtttcgcgtgtgggac; (SEQ ID NO: 48) ttccggctcatggcgttaaccaggtagaaactgtgtgtacagttgcgttg tgcgtaacgtaaaagcagggcg; (SEQ ID NO: 49) cggcgacgacgacgataaagaatacaaagccgcagtgtcgtccagaggat tacgcgaccagattg; (SEQ ID NO: 50) gggcacgtcctcgcagaaggactccaggtacaccttgacgtactggtcac ctatcacctgcatcttgg; (SEQ ID NO: 51) ggtcttgccggagctggtattaccttaaaactcactaccagtcatttcta tccatctgtctttgtctttcacggaggca; (SEQ ID NO: 52) tccatttaacgttgcatcattttgtgttatcatagaactgcgtaaacact cggcaagtaatacagataactcgctaccggaacgt; (SEQ ID NO: 53) cgccgccaacatgctctaccctatacccgccaacgctaccaacgtgccca tatccatcccctcccgcaac; (SEQ ID NO: 54) tgggctacacacgtgctacaatggtcggtacagagggtcgccaaaccgcg aggtggagctaatctcacaaaaccgatcgtagtccg; (SEQ ID NO: 55) ggcctaacacatgcaagtcgagcggatgaaaggagcttgctcctggattc agcggcggacgggtgagtaatgc ctaggaatctgcc; (SEQ ID NO: 56) acgtcaaatcatcatgcccccttatgacctgggctacacacgtgctacaa tggacggtacaaagggctgca; (SEQ ID NO: 57) gcggaacgtgggaccaatacctgggttgggccggctgcttcgggcagcaa ctcccccgggttgaagaagaaaatcaccccgtcg; (SEQ ID NO: 58) aacttttttgactgccagacacactattgggctttgagacaacaggcccg tgccccttttggggggtggcatcc; (SEQ ID NO: 59) tggttactcgcttggtgaatatgttttataaatcctgtccaccccgtgga taggtagtcggcaaaacgtc; (SEQ ID NO: 60) cccctctgctggcgaaaagtgaaattcatgagtatctgtgcaactttggt gtattcgcagattggtcgcc; (SEQ ID NO: 61) aatcgtatctcgggttaatgttgcatgatgctttatcaaatgacaagctt agatccgtttctcatacggttttcctcga; (SEQ ID NO: 62) gctgggactgaggactgcgacgtaagtcaaggatgctggcataatggtta tgccgcccgtcttgaa; (SEQ ID NO: 63) tggcgaacgggtgagtaacacgtgagtaacctgcccttgactttgggata acttcaggaaactggggctaataccgg; (SEQ ID NO: 64) cggcggcaagttcgacgacaacacctacaaggtgtccggcggcttgcacg gtgtgggcgtctcggtgg; (SEQ ID NO: 65) ccaggtcggcggagaagccgaggcaggcgaggtccttcagttcgtcgcgg gtcatcgggccggtgg and (SEQ ID NO: 66) gccgccctgaccaccttcatcagcctggccggccgttacctggtgctgat gccgaacaacccgc.
20. The combination of pathogen specific DNA probe sequences as claimed in claim 19, wherein said DNA probes are labeled at 5′ end using a biotin moiety resulting in detection by formation of coloured product; or wherein said DNA probes are labeled by fluorescent labels selected from organic fluorescent labels selected from a group consisting of Fluorescene isothiocyanate FITC, and inorganic fluorescent nano-particles, Quantum Dots™, Cy3, and Cy5.
21. A combination of target DNA sequences wherein the combination comprises target DNA sequences selected from the group consisting of: TABLE-US-00008 (SEQ ID NO: 67) 5′gcaactgtgctatcccccatcacggtcatggagtacaccgaatgct 3′; (SEQ ID NO: 68) 5′cacatcacagtcgcggcagcgtcatcggcg 3′; (SEQ ID NO: 69) 5′tccccctggacgggtacggccgcatgaacggccgggg 3′; (SEQ ID NO: 70) 5′aggtagaaactgtgtgtacagttgcgttgtg 3′; (SEQ ID NO: 71) 5′aatacaaagccgcagtgtcgtc 3′; (SEQ ID NO: 72) 5′gactccaggtacaccttgacgtactg 3′; (SEQ ID NO: 73) 5′cttaaaactcactaccagtcatttctatccatc 3′; (SEQ ID NO: 74) 5′ttatcatagaactgcgtaaacactcggcaagtaata 3′; (SEQ ID NO: 75) 5′ ctatacccgccaacgctaccaacgtgccca 3′; (SEQ ID NO: 76) 5′tcggtacagagggtcgccaaaccgcgaggtggagctaa 3′; (SEQ ID NO: 77) 5′ggatgaaaggagcttgctcctggattcagcggcggacg 3′; (SEQ ID NO: 78) 5′ gacctgggctacacacgtgctaca 3′; (SEQ ID NO: 79) 5′ctgggttgggccggctgcttcgggcagcaactcccccgggtt 3′; (SEQ ID NO: 80) 5′ ggctttgagacaacaggcccgtgccc 3′; (SEQ ID NO: 81) 5′ tttataaatcctgtccaccccgt 3′; (SEQ ID NO 82) 5′ aaattcatgagtatctgtgcaactttg 3′; (SEQ ID NO: 83) 5′ atgatgctttatcaaatgacaagcttagatcc 3′; (SEQ ID NO: 84) 5′ gtaagtcaaggatgctggcataatg 3′; (SEQ ID NO: 85) 5′ gcttcagcgccgtcagcgaggataac 3′; (SEQ ID NO: 86) 5′ aacacctacaaggtgtccggcggcttgcac 3′; (SEQ ID NO 87) 5′ cgaggcaggcgaggtccttcagttcgtcgcg 3′ and (SEQ ID NO: 88) 5′ atcagcctggccggccgttacctggtg 3′.
22. A kit for the simultaneous detection of pathogens causing external ocular infection, endophthalmitis, uveitis, retinitis or meningoencephalitis comprising: a) a pool of forward and reverse primers of primer set 1 to 22 (SEQ ID NO: 1 to SEQ ID NO:44), b) a matrix comprising DNA sequences of SEQ ID NO:67 to SEQ ID NO:88 immobilized on a solid phase, c) standard reagents required for the amplification of DNA by polymerase chain reaction, d) standard reagents required for hybridizing the PCR amplified products to the matrix of DNA sequences immobilized on the solid phase, and e) standard reagents required for detecting and discriminating the final hybridized product.
23. A kit for detection of pathogens in a sample, said kit comprising primer set 1 to 22 (SEQ ID NO: 1 to SEQ ID NO 44), wherein the pathogens are Herpes simplex viruses 1 and 2, cytomegaloviruses, Varicella Zoster virus, Adenovirnses, Eubacteria, Gram positive bacteria, Gram negative bacteria, Fungi, Mycobacterium tuberculosis, Mycobacterium chelonei, Mycobacterium fortuitum, Toxoplasma gondii and Chlamydia trachomatis.
24. A matrix immobilized with target DNA sequences having nucleotide sequence of SEQ ID NO:67 to SEQ ID NO:88.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
DETAILED DESCRIPTION OF THE INVENTION
[0092] Design of Unique PCR Primers Suitable for Multiplex PCR of Pathogen(s) DNA from Clinical Sample of Patients Suffering with Eye Infections.
[0093] The following genes from the various known pathogens causing eye infections were chosen based on known information available from the literature. [0094] 1. Herpes simplex virus 1 & 2 glycoprotein D [0095] 2. Herpes simplex virus 1 & 2 UL 44 gene [0096] 3. Herpes simplex virus 1 & 2 DNA polymerase gene [0097] 4. Cytomegalovirus Glycoprotein O gene [0098] 5. Cytomegalovirus Morphological transformation gene [0099] 6. Cytomegalovirus UL 88 gene [0100] 7. Varicella zoster ORF 29 [0101] 8. Varicella zoster DNA polymerase gene [0102] 9. Adenoviruses Hexon Gene [0103] 10. Eubacterial 16s ribosomal RNA gene I [0104] 11. Eubacterial 16s ribosomal RNA gene region II [0105] 12. Gram +ve bacterial specific portion of 16s ribosomal RNA gene [0106] 13. Mycobacterium tuberculosis MPB 64 gene [0107] 14. Mycobacterium fortuitum 16s-23s RNA gene [0108] 15. Mycobacterium chelonei 16s-23 s RNA gene [0109] 16. Toxoplasma gondii B 1 gene [0110] 17. Chlamydia trachomatis polymorphic protein II [0111] 18. Fungal specific portion of 28s ribosomal RNA gene [0112] 19. Propionibacterium acnes specific portion of 16s-23s ribosomal RNA gene [0113] 20. Gram −ve bacterial specific portion of gyr B gene [0114] 21. Gram −ve bacterial aconitate hydratase gene [0115] 22. Gram −ve ribonuclease 1 gene
[0116] To further improve certainty of detection of some of the organisms such as Herpes simplex 1 and 2, Cytomegalovirus, Varicella Zoster and Gram-negative bacteria more than one gene of each organism was chosen for amplification purposes. In case of Herpes simplex 1 and 2 and Cytomegalovirus three different genes for each organism were chosen while two genes were chosen for Varicella zoster.
[0117] DNA polymerase gene of Herpes viruses is one gene that confers sensitivity to PCR and was used in different studies. In the first study 179 bp product was amplified using thermal cycling conditions of denaturation at 95° C. for 45 sec, annealing at 64° C. for 45 sec and extension at 72° C. for 45 sec. Madhavan H N et al, Detection of herpes simplex virus (HSV) using polymerase chain reaction (PCR) in clinical samples Comparison of PCR with standard laboratory methods for the detection of HSV, J. Clin. Virol. 14:145-151 (1999). While in another study 469 and 391 bp region of the same gene was amplified using different set of primers and thermal cycling conditions of denaturation at 95° C. for 45 sec, annealing at 60° C. for 45 sec and extension at 72° C. for 45 sec. Madhavan H N et al, Phenotypic and Genotypic methods for the detection of herpes simplex virus serotypes. J. Virol. Methods, 108: 97-102. (2003). While detecting different viruses any way different thermal conditions are used as in the case of PCR for HSV, CMV and VZV for identification ocular infections. Priya K et al, Association of herpes viruses in aqueous humour of patients with serpigenous choroiditis: a polymerase chain reaction based study, Ocular Immunology and Inflammation 9:1-9 (2003). In this study the reaction conditions and the concentrations of primers were different for different viruses. It is therefore obvious that it is difficult to design primers and the specific target sequences for a set of known pathogens in order to be able to perform a single tube multiplex PCR reaction that enables a rapid detection and discrimination of one or more pathogen in the given clinical sample.
[0118] It was therefore considered necessary to explore the possibility of designing suitable PCR primers and target DNA sequences that are complementary to the product of PCR amplification using known bioinformatic methods.
[0119] In order to achieve this objective, the inventors first fixed the following conditions that were preferred for performing multiplex PCR reactions for detection of HSV, CMV and VZV i.e. denaturation at 95° C. followed by annealing at 58° C.-65° C., then followed by extension at 72° C. The optimum temperature of hybridization of the PCR amplified product thus obtained to its specific target DNA sequence for each pathogen immobilized on a solid phase matrix was fixed at 48° C. to 55° C. It was therefore considered necessary to design the set of target DNA sequence for each pathogen in question such that the specific PCR amplified product hybridized to its complementary target DNA sequence at a uniform temperature without resulting in non-specific binding of DNA sequences.
[0120] The most difficult element in designing the primers for a multiplex PCR reaction is to design primers in such a way that all of them have same melting temperatures so as to enable amplification of all genes under the same thermal cycling conditions.
[0121] The primer sets for amplification were chosen from the above mentioned gene sequences such that all the primers have annealing temperatures in the range of 58-65° C. so that all the 23 genes can be amplified using PCR in the same tube are present invariably in all strains or serotypes of the specific pathogen in question.
[0122] Amplicons of different sizes may interefere with the efficiencyof multiplex amplification by PCR method. Therefore the second criterion for choosing primers was fixed as uniform size of amplicon within a range of 66-90 nucleotides All the genes mentioned in the above section were selected for a region containing 66-90 bp length (including of primer sequences).
[0123] In order to keep melting temperatures uniform, the primer lengths were varied between 17 to 29 base pairs.
[0124] Further, in a multiplex reaction, loop formation in the primers or cross hybridization due to the presence of complementary regions, can interfere with the PCR amplification itself. To avoid all such complications, all the primers were carefully designed to completely eliminate the loop formation or cross hybridization of primers amongst themselves. Care was taken to avoid any non-specific (cross-) amplification by the primer sets i.e. the primers of one organism/gene should not react with the genes of any other organism/gene in the reaction mix.
[0125] All the primers are designed in such a way that they match all the nucleotide bases of the pathogen gene in general. However if there is mismatch in some of the strains or species as in the case of primers designed to amplify Gram-positive, gram-negative bacteria and fungi the mismatch is limited to maximum of two nucleotides in the middle of the primer. It was ensured that the 3′ end of each primer had always had a perfect match in all the strains of the species being diagnosed.
[0126] Criteria described are in addition to the standard criteria described in the art for choosing primer sequences mentioned in detail disclosed here by reference. Molecular cloning: A laboratory manual, Vol 2, Sambrook. J, Russell D W (Eds) Cold Spring Harbor Laboratory Press NY (2001). These criteria being 3′ end being G or C avoiding tandem GC repeats and not generally terminating any primer with a T etc.
[0127] After design, the primers were used individually and in multiplex format to verify the sensitivity and specificity using standard DNA sequences (genes) of all the pathogens listed. Wherever the sensitivity has fallen short of what was reported in prior art viz., Madhavan H N, et al, Detection of herpes simplex virus (HSV) using polymerase chain reaction (PCR) in clinical samples Comparison of PCR with standard laboratory methods for the detection of HSV, J. Clin. Virol. 14:145-151 (1999); Malathi. J et al. A hospital based study on prevalence of conjunctivitis due to Chlamydia trachomatis Ind. J. Medical research, 117:71-75 (2003); Anand A R et al Use of polymerase chain reaction (PCR) and DNA probe hybridization to determine the gram reaction of the interacting bacterium in the intraocular fluids of patients with endophthalmitis. Journal of Infection, 41:221-226 (2000); Anand A R et al. Use of polymerase Chain reaction in fungal endophthalmitis Ophthalmology 108: 326-330 (2001) recognizing a few organisms or viral particles, a different set of primers were selected using the same criterion. Even though some of the primers anneal at 58° C., it was ensured experimentally that all primers gave good amplification at 60° C.
[0128] In the present embodiment after a careful evaluation, the following unique primers were selected and used for detection and discrimination of pathogens. These sequences are unique and are not known in the art.
TABLE-US-00001 1. Herpes simplex virus 1 & 2 glycoprotein D gene amplified by the primer set 1 comprising of SEQ ID NO: 1 and 2 (SEQ ID NO: 1) FP: 5′ cgcttggtttcggatgggag 3′ & (SEQ ID NO: 2) RP: 5′ gcccccagagacttgttgtagg 3′ 2. Herpes simplex virus 1 & 2 UL 44 gene ampli- fied by the primer set 2 comprising of SEQ ID NO: 3 and 4 (SEQ ID NO: 3) FP: 5′ ggcaatcgtgtacgtcgtccg 3′ & (SEQ ID NO: 4) RP: 5′ cgggggggtcttgcgttac 3′ 3. Herpes simplex virus 1 & 2 DNA polymerase gene amplified by the primer set 3 comprising of SEQ ID NO: 5 and 6 (SEQ ID NO: 5) FP: 5′ caagctgacggacatttacaagg 3′ & (SEQ ID NO: 6) RP: 5′ gtcccacacgcgaaacacg 3′ 4. Cytomegalovirus Glycoprotein O gene amplified by the primer set 4 comprising of SEQ ID NO: 7 and 8 (SEQ ID NO: 7) FP: 5′ ttccggctcatggcgttaacc 3′ & (SEQ ID NO: 8) RP: 5′ cgccctgcttttacgttacgc 3′ 5 . Cytomegalovirus Morphological transformation gene amplified by the primer set 5 comprising of SEQ. ID NO: 9 and 10 (SEQ ID NO: 9) FP: 5′ cggcgacgacgacgataaag 3′ & (SEQ ID NO: 10) RP: 5′ caatctggtcgcgtaatcctctg 3′ 6. Cytomegalovirus UL 88 gene amplified by the primer set 6 comprising of SEQ ID NO: 11 and 12 (SEQ ID NO: 11) FP: 5′ gggcacgtcctcgcagaag 3′ & (SEQ ID NO: 12) RP: 5′ ccaagatgcaggtgataggtgac 3′ 7. Varicella zoster ORF 29 amplified by the primer set 7 comprising of SEQ ID NO: 13 and 14 (SEQ ID NO: 13) FP: 5′ ggtcttgccggagctggtattac 3′ & (SEQ ID NO: 14) RP: 5′ tgcctccgtgaaagacaaagaca 3′ 8. Varicella zoster DNA polymerase gene ampli- fied by the primer set 8 comprising of SEQ ID NO: 15 and 16 (SEQ ID NO: 15) FP: 5′ tccatttaacgttgcatcattttgtg 3′ & (SEQ ID NO: 16) RP: 5′ acgttccggtaacgagttatctg 3′ 9. Adenoviruses Hexon Gene amplified by the primer set 9 comprising of SEQ ID NO: 17 and 18 (SEQ ID NO: 17) FP: 5′ cgccgccaacatgactacc 3′ & (SEQ ID NO: 18) RP: 5′ gttgcgggaggggatggata 3′ 10. Eubacterial 16s ribosomal RNA gene region I amplified by the primer set 10 comprising of SEQ ID NO: 19 and 20 (SEQ ID NO: 19) FP: 5′ tgggctacacacgtgctacaatgg 3′ & (SEQ ID NO: 20) RP: 5′ cggactacgatcggttttgtgaga 3′. 11. Eubacterial 16s ribosomal RNA gene region II amplified by the primer set 11 comprising of SEQ ID NO: 21 and 22 (SEQ ID NO: 21) FP: 5′ ggcctaacacatgcaagtcgagc 3 & (SEQ ID NO: 22) RP: 5′ ggcagattcctaggcattactcacc 3 12. Gram + ve bacterial specific portion of 16s ribosomal RNA gene amplified by the primer set 12 comprising of SEQ ID NO: 23 and 24 (SEQ ID NO: 23) FP: 5′ acgtcaaatcatcatgcccccttat 3′ & (SEQ ID NO: 24) RP: 5′ tgcagccattgtaccgtccat 3′ 13. Mycobacterium tuberculosis MPB 64 gene ampli- fied by the primer set 13 comprising of SEQ ID NO: 25 and 26 (SEQ ID NO: 25) FP: 5′ gcggaacgtgggaccaatac 3′ & (SEQ ID NO: 26) RP: 5′ cgacggggtgattttcttcttc 3′ 14. Mycobacterium fortuitum 16s - 23s RNA gene amplified by the primer set 14 comprising of SEQ ID NO: 27 and 28 (SEQ ID NO: 27) FP: 5′ aacttttttgactgccagacacactattg 3′ & (SEQ ID NO: 28) RP: 5′ ggatgccaccccccaaaag 3′ 15. Mycobacterium chelonae 16s - 23 s RNA gene amplified by the primer set 15 comprising of SEQ ID NO: 29 and 30 (SEQ ID NO: 29) FP: 5′ tggttactcgcttggtgaatatgt 3′ & (SEQ ID NO: 30) RP: 5′ gacgttttgccgactacctatcc 3 16. Toxoplasma gondii B 1 gene amplified by the primer set 17 comprising of SEQ ID NO: 31 and 32 (SEQ ID NO: 31) FP: 5′ cccctctgctggcgaaaagtg 3′ & (SEQ ID NO: 32) RP: 5′ ggcgaccaatctgcgaatacac 3′ 17. Chlamydia trachomatis polymorphic protein II amplified by the primer set 18 comprising of SEQ ID NO: 33 and 34 (SEQ ID NO: 33) FP: 5′ aatcgtatctcgggttaatgagc 3′ & (SEQ ID NO: 34) RP: 5′ tcgaggaaaaccgtatgagaaac 3′ 18. Fungal specific portion of 28s ribosomal RNA gene amplified by the primer set 19 comprising of SEQ ID NO: 35 and 36 (SEQ ID NO: 35) FP: 5′ gctgggactgaggactgcgac 3′ & (SEQ ID NO: 36) RP: 5′ ttcaagacgggcggcatataac 3 19. Propionibacterium acnes specific portion of 16s-23s ribosomal RNA gene amplified by the primer set 20 comprising of SEQ ID NO: 37 and 38 (SEQ ID NO: 37) FP: 5′ tggcgaacgggtgagtaaca 3′ & (SEQ ID NO: 38) RP: 5′ ccggtattagccccagtttcc 3′ 20. Gram -ve bacterial specific portion of gyr B gene amplified by the primer set 21 comprising of SEQ ID NO: 39 and 40 (SEQ ID NO: 39) FP: 5′ cggcggcaagttcgacgac 3′ & (SEQ ID NO: 40) RP: 5′ ccaccgagacgcccacacc 3′ 21. Gram -ve bacterial aconitate hydratase gene amplified by the primer set 22 comprising of SEQ ID NO: 41 and 42 (SEQ ID NO: 41) FP: 5′ ccaggtcggcggagaagc 3′ & (SEQ ID NO: 42) RP: 5′ ccaccggcccgatgacc 3′ 22. Gram - ve ribonuclease 1 gene amplified by the primer set 23 comprising of SEQ ID NO: 43 and 44 (SEQ ID NO: 43) FP: 5′ gccgccctgaccaccttc 3′ & (SEQ ID NO: 44) RP: 5′ gcgggttgttcggcatcag 3′
[0129] In another embodiment of this invention the probe sequences with SEQ ID NO: 45 to 67 were obtained by computer programs used to design the primers for identification of specific gene segments that are unique to pathogens mentioned. The probe sequences vary in length from 66-90 nucleotides. The probes do not form hairpin loops within themselves. They share no homology with any other amplicons. The probes can be amplified from either of the strands of pathogen DNA.
[0130] The probe sequences are detailed as below:
TABLE-US-00002 1. Probe DNA sequence “cgcttggtttcggatgggaggcaactgtgctatccccatcacggtcatg gagtacaccgaatgctcctacaacaagtctctgggggc” (SEQ ID NO: 45) of Herpes simplex virus 1 & 2 glycoprotein D gene (amplified by the primer set 1 comprising of (SEQ ID NO: 1) FP: 5′ cgcttggtttcggatgggag 3′ & (SEQ ID NO: 2) RP: 5′ gcccccagagacttgttgtagg 3′) 2. Probe DNA sequence “ggcaatcgtgtacgtcgtccgcacatcacagtcgcggcagcgtcatcgg cggtaacgcaagacccccccg” (SEQ ID NO: 46) of Herpes simplex virus 1 & 2 UL 44 gene (amplified by the primer set 2 comprising of (SEQ ID NO: 3) FP: 5′ ggcaatcgtgtacgtcgtccg 3′ & (SEQ ID NO: 4) RP: 5′ cgggggggtcttgcgttac 3′ 3. Probe DNA sequence “caagctgacggacatttacaaggtcccccctggacgggtacggccgcat gaacggccggggcgtgtttcgcgtgtgggac” (SEQ ID NO: 47) of Herpes simplex virus 1 & 2 DNA polymerase gene (amplified by the primer set 3 comprising of (SEQ ID NO: 5) FP: 5′ caagctgacggacatttacaagg 3′ & (SEQ ID NO: 6) RP: 5′ gtcccacacgcgaaacacg 3′) 4. Probe DNA sequence “ttccggctcatggcgttaaccaggtagaaactgtgtgtacagttgcgtt gtgcgtaacgtaaaagcagggcg” (SEQ ID NO: 48) of Cytomegalovirus Glycoprotein O gene (amplified by the primer set 4 comprising of (SEQ ID NO: 7) FP: 5′ ttccggcctcatggcgttaacc 3′ & (SEQ ID NO: 8) RP: 5′ cgccctgatttttcgttacgc 3′) 5. Probe DNA sequence “cggcgacgacgacgataaagaatacaaagccgcagtgtcgtccagagga ttacgcgaccagattg” (SEQ ID NO: 49) of Cytomegalo- virus Morphological transforming region II gene amplified by the primer set 5 comprising of (SEQ ID NO: 9) FP: 5′ cggcgacgacgacgataaag 3′ & (SEQ ID NO: 10) RP: 5′ caatctggtcgcgtaatcctctg 3′ 6. Probe DNA sequence “gggcacgtcctcgcagaaggactccaggtacaccttgacgtactggtca cctatcacctgcatcttgg” (SEQ ID NO: 50) of Cytomega- lovirus UL 88 gene (amplified by the primer set 6 comprising of (SEQ ID NO: 11) FP: 5′ gggcacgtcctcgcagaag 3′ & (SEQ ID NO: 12) RP: 5′ ccaagatgcaggtgataggtgac 3′ 7. Probe DNA sequence “ggtcttgccggagctggtattaccttaaaactcactaccagtcatttct atccatctgtattgtctttcacggaggca” (SEQ ID NO: 51) of Varicella zoster ORF 29 (amplified by the primer set 7 comprising of (SEQ ID NO: 13) FP: 5′ ggtcttgccggagctggtattac 3′ & (SEQ ID NO: 14) RP: 5′ tgcctccgtgaaagacaaagaca 3′) 8. Probe DNA sequence “tccatttaacgttgcatcattttgtgttatcatagaactgcgtaaacac tcggcaagtaatacagataactcgctaccggaacgt” (SEQ ID NO: 52) Varicella zoster DNA polymerase gene (ampli- fied by the primer set 8 comprising of (SEQ ID NO: 15) FP: 5′ tccatttaacgttgcatcattttgtg 3′ & (SEQ ID NO: 16) RP: 5′ acgttccggtagcgagttatctg 3′) 9. Probe DNA sequence “cgccgccaacatgctctaccctatacccgccaacgctaccaacgtgccc atatccatcccctcccgcaac” (SEQ ID NO: 53) of Adeno- viruses Hexon Gene (amplified by the primer set 9 comprising of (SEQ ID NO: 17) FP: 5′ cgccgccaacatgactacc 3′ & (SEQ ID NO: 18) RP: 5′ gttgcgggaggggatggata 3′) 10. Probe DNA sequence “tgggctacacacgtgctacaatggtcggtacagagggtcgccaaaccgc gaggtggagcctaatctcacaaaaccgatcgtagtccg” (SEQ ID NO:54) of Eubacterial 16s ribosomal RNA gene region I (amplified by the primer set 10 comprising of (SEQ ID NO: 19) FP: 5′ tgggctacacacgtgctacaatgg 3′ & (SEQ ID NO: 20) RP: 5′ cggactacgatcggttttgtgaga 3′). 11. Probe DNA sequence “ggcctaacacatgcaagtcgagcggatgaaaggagcttgctcctggatt cagcggcggacgggtgagtaatgcctaggaatctgcc” (SEQ ID NO: 55) of Eubacterial 16s ribosomal RNA gene region II (amplified by the primer set 11 comprising of (SEQ ID NO: 21) FP: 5′ ggcctaacacatgcaagtcgagc 3 & (SEQ ID NO: 22) RP: 5′ ggcagattcctaggcattactcacc 3) 12. Probe DNA sequence “acgtcaaatcatcatgcccccttatgacctgggctacacacgtgctaca atggacggtacaaagggctgca” (SEQ ID NO: 56) of Gram + ve bacterial specific portion of 16s ribosomal RNA gene (amplified by the primer set 12 comprising of (SEQ ID NO: 23) FP: 5′ acgtcaaatcatcatgcccccttat 3′ & (SEQ ID NO: 24) RP: 5′ tgcagccctttgtaccgtccat 3′) 13. Probe DNA sequence gcgcggaacgtgggaccaatacctgggttgggccggctgcttcgggcagc aactcccccgggttgaagaagaaaatcaccccgtcg” (SEQ ID NO: 57) of Mycobacterium tuberculosis MPB 64 gene (amplified by the primer set 13 comprising of (SEQ ID NO: 25) FP: 5′ gcggaacgtgggaccaatac 3′ & (SEQ ID NO: 26) RP: 5′ cgacggggtgatttttcttcttc 3′) 14. Probe DNA sequence “aacttttttgactgccagacacactattgggctttgagacaacaggccc gtgccccttttggggggtggcatcc” (SEQ ID NO: 58) of Mycobacterium fortuitum 16s - 23s RNA gene (ampli- fied by the primer set 14 comprising of (SEQ ID NO: 27) FP: 5′ aacttttttgactgccagacacactattg 3′ & (SEQ ID NO: 28) RP: 5′ ggatgccaccccccaaaag 3′) 15. Probe DNA sequence “tggttactcgcttggtgaatatgttttataaatcctgtccaccccgtgg ataggtagtcggcaaaacgtc” (SEQ ID NO: 59) of Myco- bacterium chelonae 16s - 23 s RNA gene (amplified by the primer set 15 comprising of (SEQ ID NO: 29) FP: 5′ tggttactcgcttggtgaatatgt 3′ & (SEQ ID NO: 30) RP: 5′ gacgttttgccgactacctatcc 3) 16. Probe DNA sequence “cccctctgctggcgaaaagtgaaattcatgagtatctgtgcaactttgg tgtattcgcagattggtcgcc” (SEQ ID NO: 60) of Toxo- plasma gondii B 1 gene (amplified by the primer set 16 comprising of (SEQ ID NO: 31) FP: 5′ cccctctgctggcgaaaagtg 3′ & (SEQ ID NO: 32) RP: 5′ ggcgaccaatctocgaatacac 3′) 17. Probe DNA sequence “aatcgtatctcgggttaatgttgcatgatgctttatcaaatgacaagct tagatccgttctcatacggttttcctcga” (SEQ ID NO: 61) of Chlamydia trachomatis polymorphic protein II (amplified by the primer set 17 comprising of (SEQ ID NO: 33) FP: 5′ aatcgtatctcgggttaatgttgc 3′ & (SEQ ID NO: 34) RP: 5′ tcgaggaaaaccgtatgagaaac 3′) 18. Probe DNA sequence “gctgggactgaggactgcgacgtaagtcaaggatgcctggcataatggt tatatgccgcccgtcttgaa” (SEQ ID NO: 62) of Fungal specific portion of 28s ribosomal RNA gene (ampli- fied by the primer set 18 comprising of (SEQ ID NO: 35) FP: 5′ gctgggactgaggactgcgac 3′ & (SEQ ID NO: 36) RP: 5′ ttcaagacgggcggcatataac 3) 19. Probe DNA sequence “tggcgaacgggtgagtaacacgtgagtaacctgccccttgactttggga taacttcaggaaactggggctaataccgg” (SEQ ID NO: 63) of Propionibacterium acnes specific portion of 16s- 23s ribosomal RNA gene (amplified by the primer set 19 comprising of (SEQ ID NO: 37) FP: 5′ tggcgaacgggtgagtaaca 3′ & (SEQ ID NO: 38) RP: 5′ ccggtattagccccagtttcc 3′) 20. Probe DNA sequence “cggcggcaagttcgacgacaacacctacaaggtgtccggcggcttcacg gtgtgggcgtctcggtgg” (SEQ ID NO: 64) of Gram -ve bacterial specific portion of gyr B gene (ampli- fied by the primer set 20 comprising of (SEQ ID NO: 39) FP: 5′ cggcggcaagttcgacgac 3′ & (SEQ ID NO: 40) RP: 5′ ccaccgagacgcccacacc 3′) 21. Probe DNA sequence “ccaggtcggcggagaagccgaggcaggcgaggtccttcagttcgtcgcg ggtcatcgggccggtgg” (SEQ ID NO: 65) of Gram -ve bacterial aconitate hydratase gene (amplified by the primer set 21 comprising of (SEQ ID NO: 41) FP: 5′ ccaggtcggcggagaagc 3′ & (SEQ ID NO: 42) RP: 5′ ccaccggcccgatgacc 3′) 22. Probe DNA sequence “gccgccctgaccaccttcatcagcctggccggccgttacctggtgctga tgccgaacaacccgc” (SEQ ID NO: 66) of Gram - ve ribonuclease 1 (gene amplified by the primer set 22 comprising of (SEQ ID NO: 43) FP: 5′ gccgccctgaccaccttc 3′ & (SEQ ID NO: 44) RP: 5′ gcgggttgttcggcatcag 3′)
[0131] It seems to be repetition
[0132] In another embodiment of this invention target sequences with SEQ ID NO:67 to SEQ ID NO:88 were generated from the probe sequences using computer programs. These targets are used for immobilization on inert matrices such as nylon and cross-linked using UV-radiation or chemical fixation. The targets were chosen according to the following criteria: [0133] 1. All the target sequences are pathogen specific and do not overlap with any other sequences of other pathogens, [0134] 2. All the target sequences are in the size range of 23 to 38 bases long, [0135] 3. All the targets have uniform melting temperatures in the range of 58.9° C.-88° C., [0136] 4. The target sequences reside in the amplicon region and do not contain forward or reverse primer sequences so that labeled probes (with SEQ ID NO:67 to SEQ ID NO:91) do not bind non-specifically to these targets, [0137] 5. All the targets are designed in such a way that they match all the nucleotide bases generally. However if there is mismatch in some of the probes the mismatch is limited to maximum of two nucleotides in the middle of the probe so as to ensure hybridization.
[0138] The target sequences are described in detail below:
TABLE-US-00003 (SEQ ID NO: 67) 1. 5′gcaactgtgctatccccatcacggtcatggagtacacc gaatgct3′ the target for HSV glycoprotein D amplified by the primer set 1 (SEQ ID NO: 68) 2. 5′cacatcacagtcgcggcagcgtcatcggccg 3′ the target for HSV UL 44 amplified by the primer set 2 (SEQ ID NO: 69) 3. 5′tccccctggacgggtacggccgcatgaacggccgggg 3′ the target for HSV polymerase gene amplified by the primer set 3 (SEQ ID NO: 70) 4. 5′aggtagaaactgtgtgtacagttgcgagtg 3′ the target for glycoprotein O of CMV ampli- fied by primer set 4 (SEQ ID NO: 71) 5. 5′aatacaaagccgcagtgtcgtc 3′ the target for morphological transforming gene II of Cytomegalovirus amplified by the primer set 5 (SEQ ID NO: 72) 6. 5′gactccaggtacaccttgacgtactg 3′ the target for UL 88 gene of Cytomegalovirus amplified by primer set 6 (SEQ ID NO: 73) 7. 5′cttaaaactcactaccagtcatactatcccatc 3′ the target for ORF 29 gene of Varicella zoster virus amplified by the primer set 7 (SEQ ID NO: 74) 8. 5′ttatcatagaactgcgtaaacactcggcaagtaata 3′ the target for DNA polymerase gene of Varicella zoster virus amplified by the primer set 8 (SEQ ID NO: 75) 9. 5′ ctatacccgccaacgctaccaacgtgccca 3′ the target for Hexon gene of Adeno- viruses amplified by primer set 9 (SEQ ID NO: 76) 10. 5′tcggtacagagggtcgccaaaccgcgaggtggagctaa 3′ the target for Eubacterial 16 s ribosomal gene region I amplified by the primer set 10 (SEQ ID NO: 77) 11. 5′ggatgaaaggagcttgcctcaggattcagcggccggacg 3′ the target for Eubacterial 16 s ribo- somal gene region II amplified by the primer set 11 (SEQ ID NO: 78) 12. 5′ gacctgggctacacacgtgctaca 3′ the target for the 16s ribosomal gene of gram- positive organisms amplified by the primer set 12 (SEQ ID NO: 79) 13. 5′ctgggttgggccggctgcttcgggcagcaactccccccg ggtt 3′ the target for the MPB 64 gene of Mycobacterium tuberculosis amplified by the primer set 13 (SEQ ID NO: 80) 14. 5′ ggctttgagacaacaggcccgtgccc 3′ the target for 16s-23s RNA gene of Myco- bacterium fortuitum amplified bthe primer set 14 (SEQ ID NO: 81) 15. 5′ tttataaatcctgtccaccccgt 3′ the target for the 16s-23s RNA gene of Mycobacterium chelonae amplified by the primer set 15 (SEQ ID NO: 82) 16. 5′ aaattcatgagtatctgtgcaactttg 3′ the target for B1 gene of Toxoplasma gondii amplified by the primer set 16 (SEQ ID NO: 83) 17. 5′ atgatgctttatcaaatgacaagcttagatcc 3′ the target for polymorphic protein II of Chlamydia trachomatis amplified by the primer set 17 (SEQ ID NO: 84) 18. 5′ gtaagtcaaggatgaggcataatg 3′ the target for the 28s ribosomal RNA gene of all fungi amplified by the primer set 18 (SEQ ID NO: 85) 19. 5′ gcttcagcgccgtcagcgaggataac 3′ the target for the 16s ribosomal RNA gene of Propionibacterium acnes amplified by the primer set 19 (SEQ ID NO: 86) 20. 5′ aacacctacaaggtgtccggcggcttgcac 3′ the target for gyrase gene of gram -ve organisms amplified by the primer set 20 (SEQ ID NO: 87) 21. 5′ cgaggcaggcgaggtccttcagttcgtcgcg 3′ the target for aconitate hydratase gene of gram -ve organisms amplified by the primer set 21 (SEQ ID NO: 88) 22. 5′ atcagcctggccggccgttacctggtg 3′ the target for the ribonuclease gene of gram -ve organisms amplified by the primer set 22
[0139] These oligonucleotides reported above and used for immobilization on inert matrix were confirmed (by sequence analyses) using products generated from standard DNA as well as clinical samples. These sequences are unique and not are not known or described for either multiplex or uniplex PCR.
[0140] In yet another embodiment of the present invention a multiplex PCR assay is provided using all or a few primer sets as aforesaid where in all the primers can be used together in a single tube using uniform thermal cycling conditions, comprising of a denaturing step of 94° C. for 5 minutes, followed by 40 cycles of 45 seconds at 60° C.-64° C., 45 seconds at 72° C. and 45 seconds at 94° C. followed by 10 minutes extension of the reaction at 72° C.
[0141] In a further embodiment, the set of primers, which are labeled at 5′ end using a biotin moiety enabling detection of coloured product.
[0142] In still another embodiment, the said primers are labeled by fluorescent labels such as organic fluorescent labels e.g., Fluorescene isothiocyanate FITC or inorganic fluorescent nano-particles such as Quantum Dots™ or Cy3 or Cy5 enabling detection by any fluorescent scanning device or microscopy.
[0143] In another embodiment the present invention provides the use of the said pool of primers and probes wherein the assay is a real time PCR for detection of the pathogens.
[0144] In yet another embodiment the present invention provides the use of the said pool of primers and probes wherein the assay is a real time PCR for quantification of pathogen in a clinical sample for monitoring prognosis or therapy of the disease.
[0145] In still another embodiment the present invention provides the use of the said pool of primers wherein the detection of the amplified product could be in the form of a macroarray or a slot blot or line probe assay.
[0146] In a further embodiment the present invention provides a macroarray consisting of the said probes fixed to a solid phase comprising of nitrocellulose, nylon, charged nylon, glass, or polystyrene.
[0147] In another embodiment the present invention provides a method for the detection and discrimination of pathogens causing syndromes such as infectious endophthalmitis or keratitis or uveitis or retinitis or meningitis, wherein the pathogens to be detected are Herpes simplex viruses 1 and 2, cytomegaloviruses, Varicella Zoster virus, Adenoviruses, Eubacteria, Gram-positive organisms, Gram-negative bacteria, Fungi, Mycobacterium tuberculosis, Mycobacterium chelonei, Mycobacterium fortuitum. Toxoplasma gondii, Chlamvdia trachomatis.
[0148] In still another embodiment the present invention provides a method for the detection of an individual pathogen amongst a group of probable pathogens causing an eye or nervous system diseases with similar manifestations.
[0149] In yet another embodiment the present invention provides any multiplex PCR assay using a select few or all of the primers as aforesaid, wherein any clinical syndrome caused by a few or all of the said organisms is being investigated for the detection of any one individual pathogen or groups of pathogens present in the clinical specimen.
[0150] In a further embodiment the present invention provides a method for the simultaneous detection of all the pathogens causing external ocular infection, endophthalmitis or uveitis or retinitis or meningoencephalitis comprising: [0151] [a] obtaining a clinical sample from patient suffering from the said infections; [0152] [b] extracting DNA from a portion of or total sample as obtained in step [a]; [0153] [c] conducting a multiplex PCR for the DNA as obtained in claim [b] using a pool of primers as claimed in claim 1, labeled with biotin or fluorescent tracers and standard reagents of PCR; [0154] [d] denaturation of the PCR product as obtained from step [c]; [0155] [e] hybridizing the PCR products as obtained in step [d] with targets immobilized on a solid matrix; [0156] [f] detecting the DNA hybrids on the solid matrix as obtained in step [e] by enzymatic or fluorescent methods,
[0157] In another embodiment the present invention provides a kit for the simultaneous detection of all the pathogens causing external ocular infection, endophthalmitis or uveitis or retinitis or meningo-encephalitis comprising: [0158] a) pool of forward and reverse primers as aforesaid; [0159] b) a matrix of DNA targets as aforesaid immobilized on a suitable solid support; [0160] c) standard reagents required for the amplification of DNA by polymerase chain reaction; [0161] d) standard reagents required for hybridizing the PCR amplified products to the immobilized matrix of DNA probes; [0162] e) standard reagents required to detect the final hybridized products for the detection and discrimination of the specific causative pathogen(s).
[0163] In a further embodiment the present invention provides a method for the simultaneous detection of all the pathogens causing external ocular infection, endophthalmitis or uveitis or retinitis or meningoencephalitis comprising: [0164] [a] obtaining a clinical sample from patient suffering from the said infections; [0165] [b] extracting DNA from a portion of or total sample as obtained in step [a]; [0166] [c] conducting a multiplex PCR for the DNA as obtained in claim [b] using a pool of primers as aforesaid, labeled with biotin or fluorescent tracers and standard reagents of PCR; [0167] [d] denaturation of the PCR product as obtained from step [c]; [0168] [e] hybridizing the PCR products as obtained in step [d] with the targets as aforesaid immobilized on a solid matrix; [0169] [f] detecting the DNA hybrids on the solid matrix as obtained in step [e] by enzymatic or fluorescent methods.
EXAMPLES
[0170] The following examples are given by way of illustration of the present invention and therefore should not be construed to limit the scope of the present invention.
Example 1
[0171] A multiplex PCR was carried out with primer sets 9 and 18, which can amplify the hexon gene of adenoviruses and polymorphic protein II gene of Chlamydia trachomatis respectively. The PCR mix contained 10 to 20 pmoles each of the forward and reverse primers, 200 μM of each d-ATP, d-UTP, d-CTP and d-GTP, 2 units of Taq polymerase in 10 mM Tris-HCl pH 9.0, 1.5 mM MgCl.sub.2, 5 mM KCl, 0.01% gelatin, 1 mM EDTA and 1 unit of UDP glycosylase to prevent amplicon contamination. The cycling conditions are being incubation at 37° C. for 30 minutes for complete digestion of any amplicon contaminants, 2 minutes at 50° C., a denaturing step of 94° C. for 5 minutes, followed by 40 cycles of 45 seconds at 60° C., 45 seconds at 72° C. and 45 seconds at 94° C. followed by 10 minutes extension of the reaction at 72° C. The product was analysed by 6% agarose gel. As can be seen in
Example 2
[0172] A multiplex PCR was carried out with primer sets 1, 2 and 3, which can amplify the Glycoprotein D, UL 44 and DNA Polymerase genes respectively. The PCR mix contained 10 pmoles each of the forward and reverse primers, 200 μM of each d-ATP, d-UTP, d-CTP and d-GTP, 2 units of Taq polymerase in 10 mM Tris-HCl pH 7.5, 1.5 mM MgCl.sub.2, 5 mM KCl, 0.01% gelatin, 1 mM EDTA and 1 unit of UDP glycosylase to prevent amplicon contamination. The cycling conditions are being incubation at 37° C. for 30 minutes for complete digestion of any amplicon contaminants, 2 minutes at 50° C. a denaturing step of 94° C. for 5 minutes, followed by 40 cycles of 45 seconds at 60° C., 45 seconds at 72° C. and 45 seconds at 94° C. followed by 10 minutes extension of the reaction at 72° C. The product was analysed by 6% agarose gel. As can be seen in
Example 3
[0173] A multiplex PCR was carried out with primer sets 1, 2, 3, 9 and 17 which can amplify the Glycoprotein D gene, UL 44 gene and DNA Polymerase genes of HSV, hexon gene of adenoviruses and polymorphic protein II gene of Chlamydia trachomatis respectively. The PCR mix contained 10 pmoles each of the forward and reverse primers, 200 μM of each d-ATP, d-UTP, d-CTP and d-GTP, 2 units of Taq polymerase in 10 mM Tris-HCl pH 9.0, 1.5 mM MgCl.sub.2, 5 mM KCl, 0.01% gelatin, 1 mM EDTA and 1 unit of UDP glycosylase to prevent amplicon contamination. The cycling conditions are being incubation at 37° C. for 30 minutes for complete digestion of any amplicon contaminants, 2 mins at 50° C. and a denaturing step of 94° C. for 5 minutes, followed by 40 cycles of 45 seconds at 60° C., 45 seconds at 72° C. and 45 seconds at 94° C. followed by 10 minutes extension of the reaction at 72° C. Five tubes of the PCR mix mentioned above were incubated with the following DNA preparations where in the tube NC did not received any DNA tube 1 received 1 picogram of HSV DNA, tube 2 received 4 femtograms of C. trachomatis tube 3 received 10 picograms of adenoviral DNA and tube 4 received all three DNAs in the quantities mentioned. The product were analysed by 6% agarose gel. As can be seen in
[0174] MW—Hinf I digest of φ×174 DNANylon membranes each spotted with 100 p moles of targets with SEQ ID No. 67, 68, 69, 75 and 83 in 0.26 N NaOH (
[0175]
Example 4
[0176] A multiplex PCR was carried out with primer sets 13, 14, 15 and 16 which can amplify the MPB 64 gene of Mycobacterium tuberculosis, 16s-23s RNA gene of Mycobacterium fortuitum, 16s-23s RNA gene of Mycobacterium chelonae and BI gene of Toxoplasma gondii. The PCR mix contained 10 pmoles each of the forward and reverse primers, 200 μM of each d-ATP, d-UTP, d-CTP and d-GTP, 2 units of Taq polymerase in 50 mM Tris-HCl pH 9.0, 1.5 mM MgCl.sub.2, 5 mM KCl, 0.010% gelatin, 1 mM EDTA and 1 unit of UDP glycosylase to prevent amplicon contamination. The cycling conditions are being incubation at 37° C. for 30 minutes for complete digestion of any amplicon contaminants, 2 minutes at 50° C. and a denaturing step of 94° C. for 5 minutes, followed by 40 cycles of 45 seconds at 60° C., 45 seconds at 72° C. and 45 seconds at 94° C. followed by 10 minutes extension of the reaction at 72° C. Five tubes of the PCR mix mentioned above were incubated with the following DNA preparations where in the tube NC did not received any DNA, tube 1 received 1 femtograms of Mituberculosis DNA, tube 2 received 100 femtograms of M. fortuitum DNA tube 3 received 100 femtograms of M. chelonae DNA, tube 4 received 1 fgs of Toxoplasma gondii DNA.
[0177] As seen in
MBC—M. chelonae
TG—T. gondii.
[0178] Second is NC hybridized with negative control tube labeled as NC. Nylon membranes hybridized with amplicons obtained from Tube 1, 2, 3 and 4 are labeled as MBT, MBF, MBC and TG respectively
5. Example 5
[0179] A multiplex PCR was carried out with primer sets 1, 2, 3, 4, 5, 6, 7 and 8 which can amplify the Glycoprotein D gene, UL 44 gene and DNA Polymerase genes of HSV, Glycoprotein O gene, Morphological transformation and UL 88 genes of CMV and ORF29 gene and DNA polymerase gene of VZV respectively. The PCR mix contained 10 pmoles each of the forward and reverse primers, 200 μM of each d-ATP, d-UTP, d-CTP and d-GTP, 2 units of Taq polymerase in 10 mM Tris-HCl pH 9.0, 1.5 mM MgCl.sub.2, 5 mM KCl, 0.01% gelatin, 1 mM EDTA and 1 unit of UDP glycosylase to prevent amplicon contamination. The cycling conditions are being incubation at 37° C. for 30 minutes for complete digestion of any amplicon contaminants, 2 minutes at 50° C. and a denaturing step of 94° C. for 5 minutes, followed by 40 cycles of 45 seconds at 60° C., 45 seconds at 72° C. and 45 seconds at 94° C. followed by 10 minutes extension of the reaction at 72° C.
[0180] Four tubes of the PCR mix mentioned above were incubated with the following DNA preparations where in the tube NC did not received any DNA, tube 1 received 1 picogram of HSV DNA, tube 2 received 10 picogram of CMV DNA and tube 3 received Ipg of VZV DNA.
[0181]
[0182] CMV—Cytomegalovirus showing CMT=Morphological transforming gene II CGO=Cytomegalovirus glycoprotein O CUL=UL 83 gene 5.sup.th Comp=Complementary strand probe of CMT VZV—Varicella Zoster virus Showing VO=Varicella zoster ORF 29 gene VDP=Varicella zoster DNA polymerase:NC membrane hybridized with contents of tube labeled NC. HSV—Nylon membrane hybridized with amplicon obtained from tube No. 1; CMV—Nylon membrane hybridized with amplicon from tube No. 2 and VZV-Nylon membrane hybridized with contents of tube No. 3
Example 6
[0183] A multiplex PCR was carried out with primer sets 10, 11, 12, 18, 19, 20, 21 and 22 which can amplify 16s ribosomal RNA gene set I and II of eubacterial genome, 16s ribosomal RNA gene of Gram-positive, 28s RNA gene from all fungi, 16s ribosomal RNA gene of Propionibacterium acnes, gyr B gene, aconitate hydratase gene and ribonuclease gene of gram-negative bacteria. The PCR mix contained 10 to 20 pmoles each of the forward and reverse primers, 200 μM of each d-ATP, d-UTP, d-CTP and d-GTP, 2 units of Taq polymerase in 50 mM Tris-HCl pH 7.5, 5 mM MgCl.sub.2, 5 mM KCl, 1% bovine serum albumin, 1 mM EDTA and 1 unit of UDP glycosylase to prevent amplicon contamination. The cycling conditions are being incubation at 37° C. for 30 minutes for complete digestion of any amplicon contaminants, a denaturing step of 94° C. for 5 minutes, followed by 40 cycles of 45 seconds at 60° C., 45 seconds at 72° C. and 45 seconds at 94° C. followed by 10 minutes extension of the reaction at 72° C. Five tubes of the PCR mix mentioned above were incubated with the following DNA preparations where in the tube NC did not received any DNA tube no 1 received 5 fg of DNA from E. coli, tube 2 received 10 fg of S. aureus DNA, tube 3 received 10 fg of P. acnes DNA and tube 4 received 10fg of C. albicans DNA.
[0184] In
Example 7
[0185] Vitreous fluid collected at autopsy from 11 AIDS patients who presented as uveitis/retinitis before death were subjected to test on multiplex PCR followed by identification of amplicon on macroarray. DNA was extracted using QIAGEN DNA purification kits from 100 μl of each vitreous sample. The DNA was reconstituted in 50 μl of the elution buffer. A multiplex PCR was carried out with primer sets 1 to 23 which can amplify all the 23 genes of, Herpes simplex virus 1 & 2 glycoprotein D, Herpes simplex virus 1 & 2 UL 44 gene, Herpes simplex virus 1 & 2 DNA polymerase gene, Cytomegalovirus Glycoprotein O gene, Cytomegalovirus Morphological transformation gene, Cytomegalovirus UL 88 gene, Varicella zoster ORF 29, Varicella zoster DNA polymerase gene, Adenoviruses Hexon Gene, Eubacterial 16s ribosomal RNA gene I, Eubacterial 16s ribosomal RNA gene region II, Gram +ve bacterial specific portion of 16s ribosomal RNA gene, Mycobacterium tuberculosis MPB 64 gene, Mycobacterium fortuitum 16s-23s RNA gene, Mycobacterium chelonae 16s-23 s RNA gene, Toxoplasma gondii B 1 gene, Chlamydia trachomatis polymorphic protein II, Fungal specific portion of 28s ribosomal RNA gene, Propionibacterium acnes specific portion of 16s-23s ribosomal RNA gene, Gram −ve bacterial specific portion of gyr B gene, gram −ve bacterial aconitate hydratase gene, Gram −ve ribonuclease I gene
[0186] The PCR mix contained 10 to 20 pmoles each of the forward and reverse primers, 200 μM of each d-ATP, d-UTP, d-CTP and d-GTP, 2 units of Taq polymerase in 10 mM Tris-HCl pH 9.0, 1.5 mM MgCl.sub.2, 5 mM KCl, 0.01% gelatin, 1 mM EDTA and 1 unit of UDP glycosylase to prevent amplicon contamination and 10 μl of the DNA extracted from the sample. The cycling conditions are being incubation at 37° C. for 30 minutes for complete digestion of any amplicon contaminants, two minutes at 50° C. and a denaturing step of 94° C. for 5 minutes, followed by 40 cycles of 45 seconds at 60° C., 45 seconds at 72° C. and 45 seconds at 94° C. followed by 10 minutes extension of the reaction at 72° C.
[0187] The PCR was conducted as described above with 23 sets of primers comprising sequence ID No 1-46 at a concentration of 10-20 p moles/50 μl reaction mix. The PCR products of all samples were subjected to hybridization on membranes nylon spotted with probes of SEQ ID No. 47-71. Nylon membranes were each spotted with 100 p moles of targets with SEQ ID No. 67-88 in 0.26 N NaOH. The membranes was then blocked using 2×SSPE containing 0.1%/SDS and 1% BSA for one hour at 37° C. The amplicons were heated to 95° C. for 10 mins and mixed in 2×SSPE containing 0.1% SDS and hybridized for 2 hours at 52° C. After hybridization the membrane was washed five times for three minutes each in 1×SSPE containing 0.1% SDS. The membrane was incubated with Streptavidin peroxidase conjugate in 0.1 M Tris-HCl pH 7.4 containing 1% BSA, 150 mM NaCl and 0.3% tween-20. After 30 minutes at 37° C. the membrane was washed five times three minutes each with the same buffer. For development of color, the membrane was incubated for 10 minutes at 37° C. with 0.5 mg of Diaminobenzidine HCl per ml of phosphate buffered saline. The appearance of brown colored spots indicate the presence of specific pathogen.
[0188] The results obtained are summarized in Table 1. All 11 samples were identified as HSV retinitis and Uveitis by Mycobacterium tuberculosis while 10 of them in addition had Toxoplasma gondii in vitreous. The Multiplex PCR and DNA macro-array accurately identified all samples.
TABLE-US-00004 TABLE 1 Results of the simultaneous detection and discrimination of pathogens using multiplex PCR and hybridization on macro-array carried out on 11 autopsy samples vitreous fluid collected from AIDS patients Sample Identification No. Organisms positive A/39/06 HSV, Mycobacterium tuberculosis, Toxoplasma A/40/06 HSV, Mycobacterium tuberculosis, Toxoplasma A/05/06 HSV, Mycobacterium tuberculosis, Toxoplasma A/12/06 HSV, Mycobacterium tuberculosis, Toxoplasma A/36/06 HSV, Mycobacterium tuberculosis, Toxoplasma A/38/05 HSV, Mycobacterium tuberculosis, Toxoplasma A/14/06 HSV, Mycobacterium tuberculosis, Toxoplasma A/42/05 HSV, Mycobacterium tuberculosis, Toxoplasma A/43/05 HSV, Mycobacterium tuberculosis, Toxoplasma A/49/05 HSV, TB
Example 8
[0189] Six CSF samples collected at autopsy from AIDS patients were tested on a multiplex PC followed by macroarray. The cause of death was ascertained to be Central nervous system infection. The DNA extracted from 200 μl of samples using commercially available QIAGEN DNA extraction kits. The DNA was reconstituted in 50 μl of elution buffer. A multiplex PCR was carried out with primer sets 1 to 23 which can amplify all the 23 genes of Herpes simplex virus 1 & 2 glycoprotein D, Herpes simplex virus 1 & 2 UL 44 gene, Herpes simplex virus 1 & 2 DNA polymerase gene, Cytomegalovirus Glycoprotein O gene, Cytomegalovirus Morphological transformation gene, Cytomegalovirus UL 88 gene, Varicella zoster ORF 29, Varicella zoster DNA polymerase gene, Adenoviruses Hexon Gene, Eubacterial 16s ribosomal RNA gene I, Eubacterial 16s ribosomal RNA gene region II, Gram +ve bacterial specific portion of 16s ribosomal RNA gene, Mycobacterium tuberculosis MPB 64 gene. Mycobacterium fortuitum 16s-23s RNA gene, Mycobacterium chelonei 16s-23 s RNA gene, Toxoplasma gondii B 1 gene, Chlamydia trachomatis polymorphic protein II, Fungal specific portion of 28s ribosomal RNA gene, Propionibacterium acnes specific portion of 16s-23s ribosomal RNA gene, Gram −ve bacterial specific portion of gyr B gene, gram −ve bacterial aconitate hydratase gene, Gram −ve ribonuclease 1 gene.
[0190] The PCR mix contained 10 to 20 pmoles each of the forward and reverse primers, 200 μM of each d-ATP, d-UTP, d-CTP and d-GTP, 2 units of Taq polymerase in 10 mM Tris-HCl pH 9.0, 1.5 mM MgCl.sub.2, 5 mM KCl, 0.01% gelatin, 1 mM EDTA and 1 unit of UDP glycosylase to prevent amplicon contamination and 10 μl of the DNA extracted from the sample. The cycling conditions are being incubation at 37° C. for 30 minutes for complete digestion of any amplicon contaminants, two minutes at 50° C. and a denaturing step of 94° C. for 5 minutes, followed by 40 cycles of 45 seconds at 60° C., 45 seconds at 72° C. and 45 seconds at 94° C. followed by 10 minutes extension of the reaction at 72° C. The PCR was conducted as described above with 23 sets of primers comprising sequence ID Nos 1-46 at a concentration of 10-20 p moles/50 μl reaction mix. The PCR products of all samples were subjected to hybridization on nylon membranes spotted with 100 p moles of targets SEQ ID No. 67-88 in 0.26 N NaOH. The membrane was then blocked using 2×SSPE containing 0.1% SDS and 1% BSA for one hour at 37° C. The amplicons were heated to 95° C. for 10 mins and mixed in 2×SSPE containing 0.1% SDS and hybridized for 2 hours at 52° C. After hybridization the membrane was washed five times for three minutes each in 1×SSPE containing 0.1% SDS. The membrane was incubated with Streptavidin peroxidase conjugate in 0.1 M Tris-HCl pH 7.4 containing 1% BSA, 150 mM NaCl and 0.3% tween-20. After 30 minutes at 37° C. the membrane was washed five times three minutes each with the same buffer. For development of color, the membrane was incubated for 10 minutes at 37° C. with 0.5 mg of Diaminobenzidine HCl per ml of phosphate buffered saline. The appearance of brown colored spots indicate the presence of specific pathogen.
TABLE-US-00005 TABLE 2 Results of the simultaneous detection and discrimination of pathogens using multiplex PCR and hybridization on macro-array carried out on six autopsy samples of CSF collected from AIDS patients SAMPLE DIAGNOSIS No. Tested No. Positive HSV Encephalitis 4 4 CMV Encephalitis 2 2 VZV Encephalitis 2 2 Toxoplasma encephalitis 3 3 Tuberculous meningitis 3 3
Example 9
[0191] A series of 19 ocular specimen either aqueous humor or vitreous fluid were obtained with various clinical diagnoses. From about 50-100 μl sample DNA was extracted using commercially available DNA extraction kits and the DNA was reconstituted in 50 μl of water and 10 μl was used for multiplex PCR containing 10 p 20 p moles each of primer sets 1-23 comprising of SEQ ID No 1-46. The PCR reagent composition and the thermal cycling conditions are the same as described in example 6 & 7 above. The amplicon was hybridized with targets with SEQ ID No 67-88 as described in the above example. The results are summarized below which demonstrates the clinical utility of the primer sets and probes.
TABLE-US-00006 TABLE 3 Results of the simultaneous detection and discrimination of pathogens using multiplex PCR and hybridization on macro-array carried out on ocular samples of aqueous humor and vitreous fluid collected from patients. Sample No Clinical Diagnosis Result 1 Viral Retinitis CMV 2 Viral retinitis and Uveities M. tiuberculosis, M. chelonae and VZV 3 Infectious Endopthalmitis Eubacterial & Gram-positive 4 Viral Retinitis HSV 5 Infectious Endophthalmitis Eubacterial & Gram-positive 6 Infectious Endophthalmitis Eubacterial & Gram-positive 7 Infectious Endophthalmitis Eubacterial & Gram-positive 8 Infectious Endophthalmitis Eubacterial & Gram-positive 9 Infectious Endophthalmitis Eubacterial & Gram-positive 10 Infectious Endophthalmitis Eubacterial & Gram-positive 11 Infectious Endophthalmitis and Fungal infection Uveities 12 Infectious Endophthalmitis and Negative Uveities 13 Infectious Endophthalmitis Propionibacterium acnes 14 Infectious Endophthalmitis Eubacterial & Gram-positive 15 Infectious Endophthalmitis Eubacterial & Gram-positive 16 Infectious Endophthalmitis and Eubacterial & M. tuberculosis Uveities 17 Infectious Endophthalmitis Eubacterial &-Gram-positive 18 Infectious Endophthalmitis Negative 19 Infectious Endophthalmitis Eubacterial & Gram-positive
[0192] Advantages: [0193] 1. Highly efficient and time saving kit. [0194] 2. Identification of specific pathogen at very early stage of infection will help the physician to select the appropriate treatment regimen for spread of the disease and its cure. [0195] 3. Identification of multiple infections from the same samples will also be useful for a treatment using combination of drugs for effective therapy.