METHODS, CELLS & ORGANISMS

20170275611 · 2017-09-28

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to an approach for introducing one or more desired insertions and/or deletions of known sizes into one or more predefined locations in a nucleic acid (e.g., in a cell or organism genome). They developed techniques to do this either in a sequential fashion or by inserting a discrete DNA fragment of defined size into the genome precisely in a predefined location or carrying out a discrete deletion of a defined size at a precise location. The technique is based on the observation that DNA single-stranded breaks are preferentially repaired through the HDR pathway, and this reduces the chances of indels (e.g., produced by NHEJ) in the present invention and thus is more efficient than prior art techniques. The invention also provides sequential insertion and/or deletions using single- or double-stranded DNA cutting.

Claims

1. An in vitro method for modifying a genome at a genomic locus of interest in a mouse ES cell, the method comprising: contacting the mouse ES cell with: a Cas9 endonuclease; a CRISPR RNA that hybridizes to a CRISPR target sequence at the genomic locus of interest; a tracrRNA; and an incoming nucleic acid sequence that is flanked by: (i) a 5′ homology arm that is homologous to a 5′ target sequence at the genomic locus of interest; and (ii) a 3′ homolog arm that is homologous to a 3′ target sequence at the genomic locus of interest; wherein the incoming nucleic acid sequence is at least 10 kb in size; wherein, following the contacting step, the genome of the mouse ES cell is modified to comprise a targeted genetic modification comprising: deletion of a region of the genomic locus of interest wherein the deletion is at least 20 kb; and/or insertion of the incoming nucleic acid at the genomic locus of interest wherein the insertion is at least 20 kb.

2. The method of claim 1, wherein the incoming nucleic acid sequence is at least 20 kb in size.

3. The method of claim 1, wherein the incoming nucleic acid sequence is at least 50 kb in size.

4. The method of claim 1, wherein the incoming nucleic acid sequence is at least 100 kb in size.

5. The method of claim 1, wherein the deletion and/or insertion is at least 50 kb in size.

6. The method of claim 1, wherein the deletion and/or insertion is at least 100 kb in size.

7. The method of claim 1, wherein the CRISPR RNA and the tracrRNA are introduced as a single nucleic acid molecule comprising the CRISPR RNA and the tracrRNA.

8. The method of claim 7, wherein the single nucleic acid molecule comprises the CRISPR RNA and the tracrRNA fused together in the form of a single guide RNA (sgRNA).

9. The method of claim 1, wherein the CRISPR RNA and the tracrRNA are introduced separately.

10. The method of claim 1, wherein: (a) the Cas9 endonuclease is introduced in the form of a protein, a messenger RNA (mRNA) encoding the Cas9 endonuclease, or a DNA encoding the Cas9 endonuclease; (b) the CRISPR RNA is introduced in the form of an RNA or a DNA encoding the CRISPR RNA; and (c) the tracrRNA is introduced in the form of an RNA or a DNA encoding the tracrRNA.

11. The method of claim 1, wherein the targeted genetic modification comprises simultaneous deletion of an endogenous nucleic acid sequence at the genomic locus of interest and insertion of the incoming nucleic acid at the genomic locus of interest.

12. The method of claim 1, wherein the targeted genetic modification is a biallelic genetic modification.

13. The method of claim 1, wherein the region of the genomic locus of interest deleted is at least 20 kb, and the incoming nucleic acid is at least 20 kb, at least 50 kb, or at least 100 kb.

14. The method of claim 1, wherein the CRISPR target sequence is immediately flanked by a Protospacer Adjacent Motif (PAM) sequence.

15. The method of claim 1, wherein the targeted genetic modification comprises: (a) replacement of an endogenous nucleic acid sequence with a homologous or an orthologous nucleic acid sequence; (b) deletion of an endogenous nucleic acid sequence; (c) insertion of an exogenous nucleic acid sequence; (d) insertion of an exogenous nucleic acid sequence comprising a homologous or an orthologous nucleic acid sequence; (e) insertion of a selectable marker; or (f) a combination thereof.

16. The method of claim 15, wherein the targeted genetic modification comprises insertion of one or more human antibody heavy chain variable domains: one or more human kappa light chain variable domains; or one or more lambda light chain variable domains.

17. The method of claim 1, wherein the region of the genomic locus of interest deleted is at least 20 kb, and the inserted incoming nucleic acid is at least 20 kb.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0140] FIG. 1A. Precise DNA Insertion in a Predefined Location (KI): gRNA designed against a predefined location can induce DNA nick using Cas9 D10A nickase 5′ of the PAM sequence (shown as solid black box). Alternatively, gRNA can be used together with Cas9 wild-type nuclease to induce double-stranded DNA breaks 5′ of the PAM sequence. The addition of a donor oligo or a donor DNA fragment (single or double stranded) with homology around the breakpoint region containing any form of DNA alterations including addition of endogenous or exogenous DNA can be precisely inserted at the breakpoint junction where the DNA is repaired through HDR.

[0141] FIG. 1B. Precise DNA Insertion in a Predefined Location (KI): This figure shows a more detailed description of the mechanism described in FIG. 1A. sgRNA designed against a predefined location can induce DNA nick using Cas9 D10A nickase 5′ of the PAM sequence (shown as solid black box). Alternatively, sgRNA can be used together with Cas9 wild-type nuclease to induce double-stranded DNA breaks 5′ of the PAM sequence. The addition of a donor oligo or a donor DNA fragment (single or double stranded) with homology arms (HA) around the breakpoint region containing any form of DNA alterations including addition of endogenous or exogenous DNA, can be precisely inserted at the breakpoint junction where the DNA is repaired through HDR.

[0142] FIG. 2A. Precise DNA Deletion (KO): gRNAs targeting flanking region of interest can induce two DNA nicks using Cas9 D10A nickase in predefine locations containing the desired PAM sequences (shown as solid black box). Alternatively, gRNAs can be used with Cas9 wild-type nuclease to induce two DSB flanking the region of interest. Addition of a donor oligo or a donor DNA fragment (single or double stranded) with homology to region 5′ of PAM 1 and 3′ of PAM 2 sequence will guide DNA repair in a precise manner via HDR. DNA repair via HDR will reduce the risk of indel formation at the breakpoint junctions and avoid DNA repair through NHEJ and in doing so, it will delete out the region flanked by the PAM sequence and carry out DNA repair in a pre-determined and pre-defined manner.

[0143] FIG. 2B, Precise DNA Deletion (KO): This figure shows a more detailed description of the mechanism described in FIG. 2A. sgRNAs targeting flanking region of interest can induce two DNA nicks using Cas9 D10A nickase in predefine locations containing the desired PAM sequences (shown as solid black box). Note. The PAMs can be located in opposite DNA strands as suppose to the example depicted in the figure where both PAMs are on the same DNA strand. Alternatively, sgRNAs can he used with Cas9 wild-type nuclease to induce two DSB flanking the region of interest. Addition of a donor oligo or a donor DNA fragment (single or double stranded) with homology to region 5′ of PAM 1 and 3′ of PAM 2 sequence will guide DNA repair in a precise manner via HDR. DNA repair via HDR will reduce the risk of indel formation at the breakpoint junctions and avoid DNA repair through NHEJ and in doing so, it will delete out the region flanked by the PAM sequence and carry out DNA repair in a pre-determined and pre-defined manner.

[0144] FIG. 3A: Precise DNA Deletion and Insertion (KO.fwdarw.KI): gRNAs targeting flanking region of interest can induce two DNA nicks using Cas9 D10A nickase in predefine locations containing the desired PAM sequences (shown as solid black box). Alternatively, gRNAs can be used with Cas9 wild-type nuclease to induce two DSB flanking the region of interest. Addition of a donor oligo or a donor DNA fragment (single or double stranded) with homology to region 5′ of PAM 1 and 3′ to PAM 2 with inclusion of additional endogenous or exogenous DNA, will guide DNA repair in a precise manner via HDR with the concomitant deletion of the region flanked by DSB or nick and the insertion of DNA of interest.

[0145] FIG. 3B: Precise DNA Deletion and Insertion (KO.fwdarw.KI): s This figure shows a more detailed description of the mechanism described in FIG. 3A. gRNAs targeting flanking region of interest can induce two DNA nicks using Cas9 D10A nickase in predefine locations containing the desired PAM sequences (shown as solid black box). Alternatively, sgRNAs can be used with Cas9 wild-type nuclease to induce two DSB flanking the region of interest. Addition of a donor oligo or a donor DNA fragment (single or double stranded) with homology to region 5′ of PAM 1 and 3′ to PAM 2 with inclusion of additional endogenous or exogenous DNA (DNA insert), will guide DNA repair in a precise manner via HDR with the concomitant deletion of the region flanked by DSB or nick and the insertion of DNA of interest. Note. Once again, the PAMs can be located in opposite DNA strands as suppose to the example depicted in the figure where both PAMs are on the same DNA strand

[0146] FIG. 4A: Recycling PAM For Sequential Genome Editing (Deletions): gRNAs targeting flanking region of interest can induce two DNA nicks using Cas9 D10A nickase in predefine locations containing the desired PAM sequences (shown as solid black box). Alternatively, gRNAs can be used with Cas9 wild-type nuclease to induce two DSB flanking the region of interest. Addition of a donor oligo or a donor DNA fragment (single or double stranded) with homology to region 5′ of PAM 2 and 3′ of PAM 3 will guide DNA repair in a precise manner via HDR and in doing so, it will delete out the region between PAM 2 and PAM3. This deletion will retain PAM 3 and thus acts as a site for carrying out another round of CRISPR/Cas mediated genome editing. Another PAM site (e.g., PAM 1) can be used in conjunction with PAM 3 sequence to carry out another round of deletion as described above. Using this PAM recycling approach, many rounds of deletions can be performed in a stepwise deletion fashion, where PAM 3 is recycled after each round. This approach can be used also for the stepwise addition of endogenous or exogenous DNA.

[0147] FIG. 4B: Recycling PAM For Sequential Genome Editing (Deletions): This figure shows a more detailed description of the mechanism described in FIG. 4B. sgRNAs targeting flanking region of interest can induce two DNA nicks using Cas9 D10A nickase in predefine locations containing the desired PAM sequences. Alternatively, sgRNAs can be used with Cas9 wild-type nuclease to induce two DSB flanking the region of interest. Addition of a donor oligo or a donor DNA fragment (single or double stranded) with homology to region 5′ of PAM 1 (clear PAM box) and 3′ of PAM 2 (black PAM box) will guide DNA repair in a precise manner via HDR and in doing so, it will delete out the region between PAM I and PAM 2. PAM sequence together with unique gRNA can he included in the intruding DNA and targeted back into the site of editing. In this, PAM 1 sequence for example can be recycled and thus acts as a site for carrying out another round of CRISPR/Cas mediated genome editing. Another PAM site (eg. PAM 3, grey PAM box) can be used in conjunction with the recycled PAM 1 sequence to carry out another round of editing (i.e. Insertion) as described above. Using this PAM recycling approach, many rounds of genome editing can be performed in a stepwise fashion, where PAM 1 is recycled after each round. This approach can be used also for the stepwise addition of endogenous or exogenous DNA.

[0148] FIG. 5A: CRISPR/Cas mediated Lox Insertion to facilitate RMCE: gRNAs targeting flanking region of interest can induce two DNA nicks using Cas9 D 10A nickase in predefine locations containing the desired PAM sequences (shown as solid black box). Alternatively, gRNAs can be used with Cas9 wild-type nuclease to induce two DSB flanking the region of interest. Addition of two donor oligos or donor DNA fragments (single or double stranded) with homology to regions 5′ and 3′ of each PAM sequence where the donor DNA contains recombinase recognition sequence (RRS) such as loxP and lox5171 will guide DNA repair in a precise manner via HDR with the inclusion of these RRS. The introduced RRS can be used as a landing pad for inserting any DNA of interest with high efficiency and precisely using recombinase mediated cassette exchange (RMCE). The retained PAM 2 site can be recycled for another round of CRISPR/Cas mediated genome editing for deleting or inserting DNA of interest. Note, the inserted DNA of interest could contain selection marker such as PGK-Puro flanked by PiggyBac LTR to allow for the initial selection and upon successful integration into DNA of interest, the selection marker can be removed conveniently by expressing hyperPbase transposase.

[0149] FIG. 5B: CRISPR/Cas mediated Lox Insertion to facilitate RMCE: This figure shows a more detailed description of the mechanism described in FIG. 5A. sgRNAs targeting flanking region of interest can induce two DNA nicks using Cas9 D10A nickase in predefine locations containing the desired PAM sequences (shown as solid black box). Alternatively, sgRNAs can be used with Cas9 wild-type nuclease to induce two DSB flanking the region of interest. Addition of two donor oligos or donor DNA fragments (single or double stranded) with homology to regions 5′ and 3′ of each PAM sequences where the donor DNA contains recombinase recognition sequence (RRS) such as loxP and lox5171 will guide DNA repair in a precise manner via HDR with the inclusion of these RRS, Note. The targeting of the lox sites can be done sequentially or as a pool in a single step process. The introduced RRS can be used as a landing pad for inserting any DNA of interest with high efficiency and precisely using recombinase mediated cassette exchange (RMCE). As detailed in FIG. 4, the PAM sequence can be recycled for another round of CRISPR/Cas mediated genome editing for deleting or inserting DNA of interest. As an option, the inserted DNA of interest could contain selection marker such as PGK-Puro flanked by PiggyBac LTR to allow for the initial selection and upon successful integration into DNA of interest, the selection marker can be removed conveniently by expressing hyperPbase transposase.

[0150] FIGS. 6A and 6B: Genome modification to produce transposon-excisable Cas9 and gRNA

[0151] FIG. 6C: Single copy Cas9 Expression: A landing pad initially can be targeted into any locus of choice in mouse ES cells or any other eukaryotic cell line. The landing pad will typically contain PiggyBac 5′ and 3′ LTR, selection marker such as neo for example floxed and a gene less promoter such as PGK in the general configuration shown. Targeting is done by homologous recombination and clones are selected on G418. The next step will involve RMCE to insert Cas9 linked via a T2A sequence to Puro-delta-tk with the option to insert single or multiple guide RNA using the unique restriction sites (RS). The orientation of the lox sites are positioned in a manner that only once the intruding DNA containing the Cas9 is inserted into the landing pad, the PGK promoter on the landing pad can activate the transcription and thus the expression of the puromycin and via the T2A transcribe and expression Cas9 production. Using this approach a single stable expression of Cas9 can be achieved. Following 4-6 days of selection on puromycin, the entire Cas9 and guide RNA floxed cassette can be excised using PiggyBac transposase (Phase) and individual clones can be analysed for genome editing resulting from the introduced guide RNA. As an option, a stable bank cell line expressing Cas9 can be generated from which multiple engineered cell lines can be generated. To do this, only Cas9-T2A-Puro-delta-tk will be inserted and no gRNA at the stage of RMCE. This will produce a general single copy Cas9 expressing cell line where its genome can be edited by transfecting single or multiple gRNA.

[0152] FIG. 7: Schematic representing the gRNA position with respect to gene X, the structure of the targeting vector and the oligo pair used for genotyping the resulting targeted clones.

[0153] FIG. 8: A gel image showing the genotyping results following Cas9 nuclease mediated double stranded DNA break and the subsequent DNA targeting. The genotyping shows PCR product (880 bp) specific for the 5′targeted homology arm using oligo pair HAP341/HAP334. The left hand gels show genotyping data from 96 ES cell clones transfected with gRNA, human Cas9 nuclease and either a circular targeting vector (plate 1) or a linear targeting vector (Plate 2). The right hand side gels shows 96 ES cell clones transfected with gRNA and either a circular targeting vector (plate 3) or a linear targeting vector (Plate 4) but with no human Cas9 nuclease. The percentage of the clones correctly targeted is shown for each transfection.

[0154] FIG. 9: Schematic showing the position of the gRNAs on a gene to allow for a define deletion of the region in between the two gRNA. The oligo pair primer 1 and 2 was used to detect ES clones containing the specific 55 bp deletion.

[0155] FIG. 10: A 3% agarose gel containing PCR products amplified from 96 ES clones transfected with gRNA 1 and 2, Primers 1 and 2 was used to amplify around the two gRNA and any clones containing the define deletion can be seen as a smaller PCR product, which are highlighted by an asterix.

[0156] FIG. 11 PCR genotyping by amplifying the 5′ (top gel) and 3′ (bottom gel) targeted homology arms within the Rosa26 gene located on chromosome 6. Correctly targeted clones yielding PCR product for both 5′ and 3′ junctions are marked with an asterix.

[0157] FIG. 12: Genotyping for the correct insertion of the Cas9 DNA cassette by PCR amplifying the 5′ (top gel) and 3′ (bottom gel) arm of the inserted DNA cassette.

[0158] FIG. 13: PCR genotyping by amplifying the region around the guide RNA and assessing the PCR product for the presence of indels. Larger indels can be seen directly from the gel as they yielded PCR product shorter than the expected WT DNA suggesting significant deletion. For the positive control, genomic DNA from mouse AB2.1 was used to size the corresponding WT PCR product. The negative control was a no DNA water control.

[0159] FIG. 14: PCR amplification of the region flanking the guide RNA using DNA extracted from pups following zygote Cas9/guide mRNA injection for analysing indel formation. Lane 14 shows a gross deletion in that mouse and those lanes marked with an asterix indicate these mice contain smaller indels.

[0160] FIG. 15: Summary of the sequencing data from the 8 mice analysed and the details of the indels detected are shown. The number refers to the frequency of that particular indel identified in the clones analysed and the description of the indels are shown in brackets.

DETAILED DESCRIPTION OF THE INVENTION

[0161] The inventors addressed the need for improved nucleic acid modification techniques. An example of a technique for nucleic acid modification is the application of the CRISPR/Cas system. This system has been shown thus far to be the most advanced genome editing system available due, inter alia, to its broad application, the relative speed at which genomes can be edited to create mutations and its ease of use. The inventors, however, believed that this technology can be advanced for even broader applications than are apparent from the state of the art.

[0162] The inventors realised that an important aspect to achieve this would be to find a way of improving the fidelity of nucleic acid modifications beyond that contemplated by the CRISPR/Cas methods known in the art.

[0163] Additionally, the inventors realised that only modest nucleic acid modifications had been reported to date. It would be desirable to effect relatively large predefined and precise DNA deletions or insertions using the CRISPR/Cas system.

[0164] The inventors have devised an approach for introducing one or more desired insertions and/or deletions of known sizes into one or more predefined locations in a nucleic acid (e.g., in a cell or organism genome). They developed techniques to do this either in a sequential fashion or by inserting a discrete DNA fragment of defined size into the genome precisely in a predefined location or carrying out a discrete deletion of a defined size at a precise location. The technique is based on the observation that DNA single-stranded breaks are preferentially repaired through the HDR pathway, and this reduces the chances of indels (e.g., produced by NHEJ) in the present invention and thus is more efficient than prior art techniques.

[0165] To this end, the invention provides:

[0166] A method of nucleic acid recombination, the method comprising providing double stranded DNA (dsDNA) comprising first and second strands and [0167] (a) using nucleic acid cleavage to create 5′ and 3′ cut ends in the first strand; and [0168] (b) using homologous recombination to insert a nucleotide sequence between the ends, thereby producing a modified first strand; thereby producing DNA wherein the first strand has been modified by said recombination but the second strand has not been modified.

[0169] Optionally, the method further comprises replicating the modified first strand to produce a progeny dsDNA wherein each strand thereof comprises a copy of the insert nucleotide sequence. Optionally, the method comprises (c) isolating the progeny dsDNA, e.g., by obtaining a cell containing said progeny dsDNA. Replication can be effected, for example in a cell. For example, steps (a) and (b) are carried out in a cell and the cell is replicated, wherein the machinery of the cell replicates the modified first strand, e.g., to produce a dsDNA progeny in which each strand comprises the modification.

[0170] Optionally, in any configuration, aspect, example or embodiment of the invention, the modified DNA strand resulting from step (b) is isolated.

[0171] Optionally, in any configuration, aspect, example or embodiment of the invention, the method is carried out in vitro. For example, the method is carried out in a cell or cell population in vitro.

[0172] Alternatively, optionally, in any configuration, aspect, example or embodiment of the invention, the method is carried out to modify the genome of a virus.

[0173] Alternatively, optionally, in any configuration, aspect, example or embodiment of the invention, the method is carried out in vivo in an organism. In an example, the organism is a non-human organism. In an example, it is a plant or an animal or an insect or a bacterium or a yeast. For example, the method is practised on a vertebrate (e.g., a human patient or a non-human vertebrate (e.g., a bird, e.g., a chicken) or non-human mammal such as a mouse, a rat or a rabbit).

[0174] Optionally, in any configuration, aspect, example or embodiment of the invention, the method is a method of cosmetic treatment of a human or a non-therapeutic, non-surgical, non-diagnostic method, e.g., practised on a human or a non-human vertebrate or mammal (e.g., a mouse or a rat).

[0175] The invention also provides:

[0176] A method of nucleic acid recombination, the method comprising [0177] (a) using nucleic acid cleavage to create 5′ and 3′ cut ends in a single nucleic acid strand; [0178] (b) using homologous recombination to insert a nucleotide sequence between the ends, wherein the insert sequence comprises a regulatory clement or encodes all or part of a protein; and [0179] (c) Optionally obtaining the nucleic acid strand modified in step (b) or a progeny nucleic strand comprising the inserted nucleotide sequence, e.g., by obtaining a cell containing said progeny nucleic acid strand,

[0180] In an example the progeny strand is a product of the replication of the strand produced by step (b). The progeny strand is, for example, produced by nucleic acid replication in a cell. For example, steps (a) and (b) are carried out in a cell and the cell is replicated, wherein the machinery of the cell replicates the modified strand produced in step (b), e.g., to produce a dsDNA progeny in which each strand comprises the modification.

[0181] In an example, the single nucleic acid strand is a DNA or RNA strand.

[0182] In an example, the regulatory element is a promoter or enhancer.

[0183] Optionally, in any configuration, aspect, example or embodiment of the invention, the inserted nucleotide sequence is a plant, animal, vertebrate or mammalian sequence, e.g, a human sequence. For example, the sequence encodes a complete protein, polypeptide, peptide, domain or a plurality (e.g. one, two or more) of any one of these. In an example, the inserted sequence confers a resistance property to a cell comprising the modified nucleic acid produced by the method of the invention (e.g., herbicide, viral or bacterial resistance). In an example, the inserted sequence encodes an interleukin receptor (e.g., a cell surface receptor), growth factor, hormone, antibody (or variable domain or binding site thereof), antagonist, agonist; e.g., a human version of any of these. In an example, the inserted sequence is an exon.

[0184] Optionally, in any configuration, aspect, example or embodiment of the invention, the inserted nucleotide sequence replaces an orthologous or homologous sequence of the strand (e.g., the insert is a human sequence that replaces a plant, human or mouse sequence). For example, the method is carried out in a mouse or mouse cell (such as an ES cell) and the insert replaces an orthologous or homologous mouse sequence (e.g., a mouse biological target protein implicated in disease). For example, the method is carried out (e.g., in vitro) in a human cell and the insert replaces an orthologous or homologous human sequence (e.g., a human biological target protein implicated in disease, e.g., a mutated form of a sequence is replaced with a different (e.g., wild-type) human sequence, which may be useful for correcting a gene defect in the cell. In this embodiment, the cell may be a human ES or iPS or totipotent or pluripotent stem cell and may be subsequently introduced into a human patient in a method of gene therapy to treat and/or prevent a medical disease or condition in the patient).

[0185] Optionally, in any configuration, aspect, example or embodiment of the invention, the inserted nucleotide sequence is at least 10 nucleotides long, e.g., at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 300, 400, 500, 600, 700, 800 or 900 nucleotides, or at least 1, 2, 3, 5, 10, 20, 50 or 100 kb long.

[0186] Optionally, in any configuration, aspect, example or embodiment of the invention, the insert sequence comprises a site specific recombination site, e.g., a lox, frt or rox site. For example, the site can be a loxP, lox511 or lox2272 site.

[0187] The invention also provides:

[0188] A method of nucleic acid recombination, the method comprising [0189] (a) using nucleic acid cleavage to create first and second breaks in a nucleic acid strand, thereby creating and 3′ cut ends and a nucleotide sequence between the ends; [0190] (b) using homologous recombination to delete the nucleotide sequence; and [0191] (c) optionally obtaining the nucleic acid strand modified in step (b) or a progeny nucleic strand comprising the deletion.

[0192] In an example, the progeny strand is a product of the replication of the strand produced by step (h). The progeny strand is, for example, produced by nucleic acid replication in a cell. For example, steps (a) and (b) are carried out in a cell and the cell is replicated, wherein the machinery of the cell replicates the modified strand produced in step (b), e.g., to produce a dsDNA progeny in which each strand comprises the modification.

[0193] In an example, the single nucleic acid strand is a DNA or RNA strand.

[0194] In an example, the deleted sequence comprises a regulatory element or encodes all or part of a protein. In an embodiment, the deleted regulatory element is a promoter or enhancer.

[0195] Optionally, in any configuration, aspect, example or embodiment of the invention, the deleted nucleotide sequence is a plant, animal, vertebrate or mammalian sequence, e.g., a human sequence. For example, the sequence encodes a complete protein, polypeptide, peptide, domain or a plurality (e.g. one, two or more) of any one of these. In an example, the deleted sequence encodes an interleukin, receptor (e.g., a cell surface receptor), growth factor, hormone, antibody (or variable domain or binding site thereof), antagonist, agonist; e.g., a non-human version of any of these. In an example, the deleted sequence is an exon.

[0196] Optionally, in any configuration, aspect, example or embodiment of the invention, the deleted nucleotide sequence is replaced by an orthologous or homologous sequence of a different: species or strain (e.g., a human sequence replaces an orthologous or homologous plant, human or mouse sequence). For example, the method is carried out in a mouse or mouse cell and the insert replaces an orthologous or homologous mouse sequence (e.g., a mouse biological target protein implicated in disease). For example, the method is carried out (e.g., in vitro) in a human cell and the insert replaces an orthologous or homologous human sequence (e.g., a human biological target protein implicated in disease, e.g., a mutated form of a sequence is replaced with a different (e.g., wild-type) human sequence, which may be useful for correcting a gene defect in the cell. In this embodiment, the cell may be a human ES or iPS or totipotent or pluripotent stern cell and may be subsequently introduced into a human patient in a method of gene therapy to treat and/or prevent a medical disease or condition in the patient).

[0197] Optionally, in any configuration, aspect, example or embodiment of the invention, the deleted nucleotide sequence is at least 10 nucleotides long, e.g., at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 300, 400, 500, 600, 700, 800 or 900 nucleotides, or at least 1, 2, 3, 5, 10, 20, 50 or 100 kb long.

[0198] Optionally, in any configuration, aspect, example or embodiment of the invention, step (c) is performed by isolating a cell comprising the modified first strand, or by obtaining a non-human vertebrate in which the method has been performed or a progeny thereof.

[0199] Optionally, in any configuration, aspect, example or embodiment of the invention, the product of the method comprises a nucleic acid strand comprising a PAM motif 3′ of the insertion or deletion. In an example, the PAM motif is within 10, 9, 8, 7 6, 5, 4 or 3 nucleotides of the insertion or deletion. This is useful to enable serial insertions and/or deletions according to the method as explained further below.

[0200] Optionally, in any configuration, aspect, example or embodiment of the invention, the product of the method comprises a nucleic acid strand comprising a PAM motif 5′ of the insertion or deletion. In an example, the PAM motif is within 10, 9, 8, 7 6, 5, 4 or 3 nucleotides of the insertion or deletion. This is useful to enable serial insertions and/or deletions according to the method as explained further below.

[0201] Optionally, in any configuration, aspect, example or embodiment of the invention, step (b) is performed by carrying out homologous recombination between an incoming nucleic acid comprising first and second homology arms, wherein the homology arms are substantially homologous respectively to a sequence extending 5′ from the 5′ end and a sequence extending 3′ from the 3′ end. The skilled person will be familiar with constructing vectors and DNA molecules for use in homologous recombination, including considerations such as homology arm size and sequence and the inclusion of selection markers between the arms. For example, the incoming nucleic acid comprises first and second homology arms, and the insert sequence and an optional selection marker sequence (e.g., neo nucleotide sequence). The arms may be at least 20, 30, 40, 50, 100 or 150 nucleotides in length, for example. Where deletion is required, the insert is omitted (although an optional selection marker sequence may or may not he included between the arms).

[0202] Thus, in an embodiment of the invention, step (b) is performed by carrying out homologous recombination between an incoming nucleic acid comprising an insert nucleotide sequence flanked by the first and second homology arms, wherein the insert nucleotide sequence is inserted between the 5′ and 3′ ends.

[0203] In another embodiment of the invention, the insert is between the homology arms and there is no further sequence between the arms.

[0204] In an example, each homology arm is at least 20, 30, 40, 50, 100 or 150 nucleotides long.

[0205] Optionally, in any configuration, aspect, example or embodiment of the invention, step (a) is carried out using an endonuclease, e.g., a nickase. Nickases cut in a single strand of dsDNA only. For example, the endonuclease is an endonuclease of a CRISPR/Cas system, e.g, a Cas9 or Cys4 endonuclease (e.g., a Cas9 or Cys4 nickase). In an example, the endonuclease recognises a PAM listed in Table 1 below, for example, the endonuclease is a Cas endonuclease that recognises a PAM selected from CCN, TCN, TTC, AWG, CC, NNAGNN, NGGNG GG, NGG, WGG, CWT, CFI and GAA. In an example, the Cas endonuclease is a S pyogenes endonuclease, e.g., a S pyogenes Cas9 endonuclease. In an example, a S. pyogenes PAM sequence or Streptococcus thermophilus LMD-9 PAM sequence is used.

[0206] In an example, the endonuclease is a Group 1 Cas endonuclease. In an example, the endonuclease is a Group 2 Cas endonuclease. In an example, the endonuclease is a Group 3 Cas endonuclease. In an example, the endonuclease is a Group 4 Cas endonuclease. In an example, the endonuclease is a Group 7 Cas endonuclease. In an example, the endonuclease is a Group 10 Cas endonuclease.

[0207] In an example, the endonuclease recognises a CRISPR/Cas Group 1 PAM. In an example, the endonuclease recognises a CRISPR/Cas Group 2 PAM. In an example, the endonuclease recognises a CRISPR/Cas Group 3 PAM. In an example, the endonuclease recognises a CRISPR/Cas Group 4 PAM, in an example, the endonuclease recognises a CRISPR/Cas Group 7 PAM. In an example, the endonuclease recognises a CRISPR/Cas Group 10 PAM.

[0208] In an example, Gas endonuclease-mediated cleavage is used in step (a); optionally by recognition of a GG or NGG PAM motif.

[0209] In an example, the first and/or second homology arm comprises a PAM motif. This is useful to enable serial insertions and/or deletions according to the method as explained further below.

[0210] An example of a suitable nickase is S pyogenes Cas9 D10A nickase (see Cong et al. and the Examples section below).

[0211] Optionally, in any configuration, aspect, example or embodiment of the invention, steps (a) and (h) of the method is carried out in a cell, e.g. a bacterial, yeast, eukaryotic cell, plant, animal, mammal, vertebrate, non-human animal, rodent, rat, mouse, rabbit, fish, bird or chicken cell. For example, the cell is an E coli cell or CHO or HEK293 or Picchia or Saccharomyces cell. In an example, the cell is a human cell in vitro. In one embodiment, the cell is an embryonic stem cell (ES cell, e.g., a human or non-human ES cell, such as a mouse ES cell) or an induced pluripotent stem cell (iPS cell; e.g., a human, rodent, rat or mouse IPS cell) or a pluripotent or totipotent cell. Optionally, the cell is not an embryonic cell, e.g. wherein the cell is not a human embryonic cell. Optionally, the cell is not a pluripotent or totipotent cell. In an example, the method is used to produce a human stem cell for human therapy (e.g., an iPS cell generated from a cell of a patient for reintroduction into the patient after the method of the invention has been performed on the cell), wherein the stem cell comprises a nucleotide sequence or gene sequence inserted by the method of the invention. The features of the examples in this paragraph can be combined.

[0212] In an example, the method is carried out in a mammalian cell. For example, the cell is a human cell in vitro or a non-human mammalian cell. For example, a non-human (e.g., rodent, rat or mouse) zygote. For example, a single-cell non-human zygote.

[0213] In an example, the method is carried out in a plant or non-human mammal, e.g. a rodent, mouse or rat or rabbit, or a tissue or organ thereof (e.g., in vitro).

[0214] In an example, the 3′ or each cleavage site is flanked 3′ by PAM motif (e.g., a motif disclosed herein, such as NGG or NGGNG sequence, wherein N is any base and G is a guanine). For example, one or more or all cleavage sites are flanked 3′ by the sequence 5′-TGGTG-3′. Unlike dsDNA, the PAM is not absolutely required for ssDNA binding and cleavage: A single-stranded oligodeoxynucleotide containing a protospacer with or without a PAM sequence is bound nearly as well as dsDNA and may be used in the invention wherein a single strand of DNA is modified. Moreover, in the presence of Me.sup.2+ ions, Cas9 cuts ssDNA bound to the crRNA using its HMI active site independently of PAM.

[0215] Optionally, in any configuration, aspect, example or embodiment of the invention, step (a) is carried out by cleavage in one single strand of dsDNA or in ssDNA.

[0216] Optionally, in any configuration, aspect, example or embodiment of the invention, step (a) is carried out by combining in a cell the nucleic acid strand, a Cas endonuclease, a crRNA and a tracrRNA (e.g., provided by one or more gRNAs) for targeting the endonuclease to carry out the cleavage, and optionally an insert sequence for homologous recombination with the nucleic acid strand. Instead of an insert sequence, one can use an incoming sequence containing homology arms but no insert sequence, to effect deletion as described above. In an example, the Gas endonuclease is encoded by a nucleotide sequence that has been introduced into the cell. In an example, the gRNA is encoded by a DNA sequence that has been introduced into the cell.

[0217] In an example, the method is carried out in the presence of Mg.sup.2+.

[0218] Optionally, in any configuration, aspect, example or embodiment of the invention, step (b) is performed by carrying out homologous recombination with an incoming nucleic acid comprising first and second homology arms, wherein the homology arms are substantially homologous respectively to a sequence extending 5′ from the 5′ end and a sequence extending 3′ from the 3′ end, wherein the second homology arm comprises a PAM sequence such that homologous recombination between the second homology arm and the sequence extending 3′ from the 3′ end produces a sequence comprising a PAM motif in the product of the method. The PAM can be any PAM sequence disclosed herein, for example. Thus, the method produces a modified nucleic acid strand comprising a PAM that can be used for a subsequent nucleic acid modification according to any configuration, aspect, example or embodiment of the invention, wherein a Gas endonuclease is used to cut the nucleic acid. This is useful, for example, for performing sequential endonuclease-mediated homology directed recombination (sEHDR) according to the invention, more particularly sCHDR described below.

Sequential Endonuclease-Mediated Homology Directed Recombination (sEHDR)
The invention further provides:

[0219] A method of sequential endonuclease-mediated homology directed recombination (sEHDR) comprising carrying out the method of any preceding configuration, aspect, example or embodiment of the invention a first time and a second time, wherein endonuclease-mediated cleavage is used in each step (a); wherein the product of the first time is used for endonuclease-mediated cleavage the second time, whereby either (i) first and second nucleotide sequences are deleted the first time and the second times respectively; (ii) a first nucleotide sequence is deleted the first time and a second nucleotide sequence is inserted the second time; (iii) a first nucleotide sequence is inserted the first time and a second nucleotide sequence is deleted the second time; or (iv) first and second nucleotide sequences are inserted the first and second times respectively; optionally wherein the nucleic acid strand modification the second time is within 20, 10, 5, 4, 3, 2 or 1 or less nucleotides of the nucleic acid strand modification the first time or directly adjacent to the nucleic acid strand modification the first time.

[0220] For example, the first and second nucleotide sequences are inserted so that they are contiguous after the insertion the second time. Alternatively, the first and second deletions are such that a contiguous sequence has been deleted after the first and second deletions have been performed.

[0221] In an embodiment of sEHDR, the invention uses a Cas endonuclease. Thus, there is provided:

[0222] A method of sequential Cas-mediated homology directed recombination (sCHDR) comprising carrying out the method of any preceding claim a first time and a second time, wherein Cas endonuclease-mediated cleavage is used in each step (a); wherein step (b) of the first time is carried out performing homologous recombination with an incoming nucleic acid comprising first and second homology arms, wherein the homology arms are substantially homologous respectively to a sequence extending 5′ from the 5′ end and a sequence extending 3′ from the 3′ end, wherein the second homology arm comprises a PAM sequence such that homologous recombination between the second homology arm and the sequence extending 3′ from the 3′ end produces a sequence comprising a PAM motif in the product of the method; wherein the PAM motif of the product of the first time is used for Cas endonuclease-mediated cleavage the second time, whereby either (i) first and second nucleotide sequences are deleted the first time and the second times respectively; (ii) a first nucleotide sequence is deleted the first time and a second nucleotide sequence is inserted the second time; (iii) a first :nucleotide sequence is inserted the first time and a second nucleotide sequence is deleted the second time; or (iv) first and second nucleotide sequences are inserted the first and second times respectively; optionally wherein the nucleic acid strand modification the second time is within 20, 10, 5, 4, 3, 2 or 1 or less nucleotides of the nucleic acid strand modification the first time or directly adjacent to the nucleic acid strand modification the first time.

[0223] For example, the first and second nucleotide sequences are inserted so that they are contiguous after the insertion the second time. Alternatively, the first and second deletions are such that a contiguous sequence has been deleted after the first and second deletions have been performed.

[0224] In an embodiment (First Embodiment) the first time is carried out according to the third configuration of the invention, wherein the incoming nucleic acid comprises no sequence between the first and second homology arms, wherein sequence between the 5′ and 3′ ends is deleted by homologous recombination; and/or the second time is carried out according to the third configuration of the invention, wherein step (b) is performed by carrying out homologous recombination between an incoming nucleic acid comprising first and second homology arms, wherein the homology arms are substantially homologous respectively to a sequence extending 5′ from the 5′ end and a sequence extending 3′ from the 3′ end, wherein the incoming nucleic acid comprises no sequence between the first and second homology arms such that sequence between the 5′ and 3′ ends is deleted by homologous recombination; optionally wherein the second arm comprises a PAM motif such that the product of the second time comprises a PAM motif for use in a subsequent Cas endonuclease-mediated method according to any configuration, aspect, example or embodiment of the invention.

[0225] In an embodiment (Second Embodiment), the first time is carried out according to the first or second configuration of the invention, wherein the incoming nucleic acid comprises the insert sequence between the first and second homology arms, wherein the insert sequence is inserted between the 5′ and 3′ ends by homologous recombination; and/or the second time is carried out according to the first or second configuration of the invention, wherein step (b) is performed by carrying out homologous recombination between an incoming nucleic acid comprising first and second homology arms, wherein the homology arms are substantially homologous respectively to a sequence extending 5′ from the 5′ end and a sequence extending 3′ from the 3′ end, wherein the insert sequence is inserted between the 5′ and 3′ ends by homologous recombination; optionally wherein the second arm comprises a PAM motif such that the product of the second time comprises a PAM motif for use in a subsequent Cas endonuclease-mediated method according to any configuration, aspect, example or embodiment of the invention.

[0226] In an example, one of said first and second times is carried out as specified in the First Embodiment and the other time is carried out as specified in the Second Embodiment, wherein at least one sequence deletion and at least one sequence insertion is performed.

[0227] Optionally, in any configuration, aspect, example or embodiment of the invention, step (a) is carried out by Cas endonuclease-mediated cleavage using a Cas endonuclease, one or more crRNAs and a tracrRNA. For example, the method is carried out in a cell and the crRNA and tracrRNA is introduced into the cell as RNA molecules. For example, the method is carried out in a zygote (e.g., a non-human zygote, e.g, a rodent, rat or mouse zygote) and the crRNA and tracrRNA is injected into zygote. In another embodiment, the crRNA and tracrRNA are encoded by DNA within a cell or organism and are transcribed inside the cell (e.g., an ES cell, e.g., a non-human ES cell, e.g., a rodent, rat or mouse ES cell) or organism to produce the crRNA and tracrRNA. The organism is, for example, a non-human animal or plant or bacterium or yeast or insect. In an embodiment, the tracrRNA is in this way encoded by DNA but one or more crRNAs are introduced as RNA nucleic acid into the cell or organism to effect the method of the invention.

[0228] Additionally or alternatively to these examples, the endonuclease may be introduced as a protein or a vector encoding the endonuclease may be introduced into the cell or organism to effect the method of the invention. In another example, the endonuclease is encoded by DNA that is genomically integrated into the cell or organism and is transcribed and translated inside the cell or organism.

[0229] In an example, the method of the invention is carried out in an ES cell (e.g., a non-human ES cell, e.g., a rodent, rat or mouse ES cell) that has been pre-engineered to comprise an expressible genomically-integrated Cas endonuclease sequence (or a vector carrying this has been include in the cell). It would be possible to introduce (or encode) a tracrRNA. By introducing a crRNA with a guiding oligo sequence to target the desired area of the cell genome, one can then carry out modifications in the cell genome as per the invention. In an example, a gRNA as described herein is introduced into the ES cell. The genomically-integrated expressible Cas endonuclease sequence can, for example, be constitutively expressed or inducibly expressible. Alternatively or additionally, the sequence may be expressible in a tissue-specific manner in a progeny organism (e.g., a rodent) developed using the ES cell.

[0230] The initial ES cell comprising a genomically-integrated expressible Cas endonuclease sequence can be used, via standard techniques, to produce a progeny non-human animal that contains the expressible Cas endonuclease sequence. Thus, the invention provides:

[0231] A non-human animal (e.g., a vertebrate, mammal, fish or bird), animal cell, insect, insect cell, plant or plant cell comprising a genomically-integrated expressible Cas endonuclease nucleotide sequence and optionally a tracrRNA and or a nucleotide sequence encoding a tracrRNA. The Gas endonuclease is, for example, Cas9 or Cys4. In an example, the animal, insect or plant genome comprises a chromosomal DNA sequence flanked by site-specific recombination sites and/or transposon elements (e.g., piggyBac transposon repeat elements), wherein the sequence encodes the endonuclease and optionally one or more gRNAs. As described in the Examples below, recombinase-mediated cassette exchange (RMCE) can be used to insert such a sequence. The transposon elements can be used to excise the sequence from the genome once the endonuclease has been used to perform recombination. The RMCE and/or transposon-mediated excision can be performed in a cell (e.g., an ES cell) that later is used to derive a progeny animal or plant comprising the desired genomic modification.

[0232] The invention also provides an ES cell derived or derivable from such an animal, wherein the ES cell comprises a genomically-integrated expressible Cas endonuclease nucleotide sequence. In an example, the ES cell is a rodent, e.g., a mouse or rat ES cell, or is a rabbit, dog, pig, cat, cow, non-human primate, fish, amphibian or bird ES cell.

[0233] The invention also provides a method of isolating an ES cell, the method comprising deriving an ES cell from an animal (e.g., a non-human animal, e.g, a rodent, e.g., a rat or a mouse), wherein the animal comprises a genomically-integrated expressible Cas endonuclease nucleotide sequence, as described herein.

[0234] In any of these aspects, instead of an ES cell, the cell may be an iPS cell or a totipotent or pluripotent cell. Thus, an iPS or stem cell can be derived from (e.g., a somatic cell of) a human, engineered in vitro to comprise a genomically-integrated expressible Cas endonuclease nucleotide sequence and optionally one or more DNA sequences encoding a tracrRNA or gRNA. The invention, thus, also relates to such a method and to a human iPS or stem cell comprising a genomically-integrated expressible Gas endonuclease nucleotide sequence and optionally one or more DNA sequences encoding a tracrRNA or gRNA. This cell can be used in a method of the invention to carry out genome modification (e.g., to correct a genetic defect, e.g., by replacement of defective sequence with a desired sequence, optionally with subsequent transposon-mediated excision of the endonuclease-encoding sequence). After optional excision of the Gas endonuclease sequence, the iPS cell or stem cell can be introduced into the donor human (or a different human, e.g., a genetic relative thereof) to carry out genetic therapy or prophylaxis. In the alternative, a totipotent or pluripotent human cell is used and then subsequently developed into human tissue or an organ or part thereof. This is useful for providing material for human therapy or prophylaxis or for producing assay materials (e.g., for implantation into model non-human animals) or for use in in vitro testing (e.g., of drugs).

[0235] In an example, the method uses a single guided. RNA (gRNA or sgRNA) comprising a crRNA and a tracrRNA. The crRNA comprises an oligonucleotide sequence (“X” in the structure 5′-X-Y-3′ mentioned below) that is chosen to target a desired part of the nucleic acid or genome to be modified. The skilled person will be able readily to select appropriate oligo sequence(s). In an example, the sequence is from 3 to 100 nucleotides long, e.g., from 3 to 50, 40, 30, 25, 20, 15 or 10 nucleotides long, e.g., from or 5, 10, 15 or 20 to 100 nucleotides long, e.g., from 5, 10, 15 or 20 to 50 nucleotides long.

[0236] For example, the gRNA is a single nucleic acid comprising both the crRNA and the tracrRNA. An example of a gRNA comprises the sequence 5′-[oligo]-[UUUUAGAGCUA (S NIUUUUAN2N3GCUA)]-[LINKER]-[UAGCAAGUUAAAA (SEQ ID NO:2)1-3′, wherein the LINKER comprises a plurality (e.g., 4 or more, e.g., 4, 5 or 6) nucleotides (e.g., 5′-GAAA-3′).

[0237] For example, the crRNA has the structure 5′-X-Y-3′, wherein X is an RNA nucleotide sequence (optionally, at least 5 nucleotides long) and Y is a crRNA sequence comprising a nucleotide motif that hybridises with a motif comprised by the tracrRNA, wherein X is capable of hybridising with a nucleotide sequence 5′ of the desired site of the 5′ cut end, e.g., extending 5′ from the desired site of the 5′ cut.

[0238] In an example, Y is 5′-NIUUUUAN2N3GCUA-3′ (SEQ ID NO:3), wherein each of NI-3 is a A, U, C or G and/or the tracrRNA comprises the sequence (in 5′ to 3′ orientation) UAGCM1UAAAAM2 (SEQ ID NO:4), wherein M1 is spacer nucleotide sequence and M2 is a nucleotide; e.g., N1-G, N2=G and N3=A. The spacer sequence is, e.g., 5, 4, 3, 2 or 1 RNA nucleotides in length (e.g., AAG in 5′ to 3′ orientation). M2 is, for example, an A, U, C or G (e.g., M2 is a G). In an embodiment, a chimaeric gRNA is used which comprises a sequence 5′-X-Y-Z-3′, wherein X and. Y are as defined above and Z is a tracrRNA comprising the sequence (in 5′ to 3′ orientation) UAGCMIUUAAAAM2 (SEQ ID NO:4), wherein M1 is spacer nucleotide sequence and M2 is a nucleotide. In an example, Z comprises the sequence 5′-UAGCAAGUUAAAA-3′ (SEQ ID NO:2), e.g., Z is 5′-UAGCAAGUUAAAAUAAGGCUAGUCCG-3′ (SEQ ID .sup.-N0:5). In an example, the gRNA has the sequence:

TABLE-US-00001 (SEQ ID NO: 6) 5′-GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGC-3′

[0239] When it is desired to use the present invention to insert an exogenous sequence into the nucleic acid to he modified, the exogenous sequence can be provided on linear or circular nucleic acid (e.g., DNA). Typically, the exogenous sequence is flanked by homology arms that can undergo homologous recombination with sequences 5′ and 3′ respectively of the site where the exogenous sequence is to be inserted. The skilled person is familiar with choosing homology arms for homologous recombination.

[0240] The invention can be used in a method of producing a transgenic organism, e.g., any organism recited herein. For example, the organism can be a non-human organism used as an assay model to test a pharmaceutical drug or to express an exogenous protein or a part thereof (e.g., a human protein target knocked-in into a non-human animal assay organism). In another example, the invention has been used to knock-out an endogenous sequence (e.g., a target protein) in an organism, such as a non-human organism. This can be useful to assess the effect (phenotype) of the knock-out and thus to assess potential drug targets or proteins implicated in disease. In one example, the organism is a non-human animal (e.g., a vertebrate, mammal, bird, fish, rodent, mouse, rat or rabbit) in which a human target protein has been knocked-in using the invention. Optionally, the invention has been used to knock out an orthologous or homologous endogenous target of the organism (e.g., an endogenous target sequence has been replaced at the endogenous position by an orthologous or homologous human target sequence). In this way, an assay model can be produced for testing pharmaceutical drugs that act via the human target.

[0241] In an embodiment, the organism is a non-human vertebrate that expresses human antibody variable regions whose genome comprises a replacement of an endogenous target with an orthologous or homologous human sequence. In an example, the method of the invention is used to produce an Antibody Generating Vertebrate or Assay Vertebrate as disclosed in WO2013061078, the disclosure of which, and specifically including the disclosure of such Vertebrates, their composition, manufacture and use, is included specifically herein by reference as though herein reproduced in its entirety and for providing basis for claims herein.

[0242] In an example, an exogenous regulatory element is knocked-in using the method. For example, it is knocked-in to replace an endogenous regulatory element.

[0243] In one aspect, the invention provides a method of producing a cell or a transgenic non-human organism (e.g., any non-human organism recited herein), the method comprising:

[0244] (a) carrying out the method of any in any configuration, aspect, example or embodiment of the invention to (i) knock out a target nucleotide sequence in the genome of a first cell and/or (ii) knock in an insert nucleotide sequence into the genome of a first cell, optionally wherein the insert sequence replaces a target sequence in whole or in part at the endogenous location of the target sequence in the genome; wherein the cell or a progeny thereof can develop into a non-human organism or cell, and

[0245] (b) developing the cell or progeny into a non-human organism or a non-human cell.

[0246] In an example, the organism or cell is homozygous for the modification (i) and/or (ii).

[0247] In an example, the cell is an ES cell (such as a mouse ES iPS cell, totipotent cell or pluripotent cell. In an example, the cell is a non-human vertebrate cell or a human cell in vitro. In an example, the cell is a plant, yeast, insect or bacterial cell.

[0248] In an example, the cell or organism is a rodent (e.g., a mouse or rat) cell or a rabbit, bird, fish, chicken, non-human primate, monkey, pig, dog, Camelid, shark, sheep, cow or cat cell.

[0249] In an example, the target sequence is an endogenous sequence comprising all or part of a regulatory element or encoding all or part of a protein.

[0250] In an example, the insert sequence is a synthetic sequence; or comprises a sequence encoding all or part of a protein from a species other than the species from which the first cell is derived; or comprises a regulatory element from said first species. This is useful to combine genes with new regulatory elements.

[0251] In an example, the insert sequence encodes all or part of a human protein or a human protein subunit or domain. For example, the insert sequence encodes a cell membrane protein, secreted protein, intracellular protein, cytokine, receptor protein (e.g., Fe receptor protein, such as FcRn or a Fcγ′ receptor protein), protein of the human immune system or domain thereof (e.g., an Ig protein or domain, such as an antibody or TCR protein or domain, or a MHC protein), a hormone or growth factor.

[0252] The invention also provides:

[0253] A cell (e.g., an isolated or purified cell, e.g., a cell in vitro, or any cell disclosed herein) or a non-human organism (e.g., any organism disclosed herein, such as a mouse) whose genome comprises a modification comprising a non-endogenous nucleotide sequence flanked by endogenous nucleotide sequences, wherein the cell or organism is obtainable by the method of any configuration, aspect, example or embodiment of the invention, and wherein the non-endogenous sequence is flanked 3′ and/or 5′ by (e.g., within 20, 10, 5, 4, 3, 2 or 1 or less nucleotides of, or directly adjacent to) a Cas PAM motif; wherein the cell is not comprised by a human; and one, more or all of (a) to (d) applies (for example, (a); (b); (c); (d); (a) and (b); (a) and (c); (a) and (d); (b) and (c); (b) and (d); (c) and (d); (a), (b) and (c); (a), (b) and (d); (a), (c) and (d); (b), (c) and (d) or all of (a), (b), (c) and (d)). [0254] (a) the genome is homozygous for the modification; or comprises the modification at one allele and is unmodified by Cas-mediated homologous recombination at the other allele; [0255] (b) the non-endogenous sequence comprises all or part of a regulatory element or encodes all or part of a protein; [0256] (c) the non-endogenous sequence is at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 300, 400, 500, 600, 700, 800 or 900 nucleotides, or at least 1, 2, 3, 5, 10, 20, 50 or 100 kb long; [0257] (d) the non-endogenous sequence replaces an orthologous or homologous sequence in the genome.

[0258] The cell can he a human cell, or included in human tissue but not part of a human being. For example, the cell is a human cell in vitro.

[0259] In an example, the non-endogenous sequence is a human sequence.

[0260] In an example, the PAM motif is any PAM disclosed herein or comprises a sequence selected from CCN, TCN, TTC, AWG, CC, NNAGNN, NGGNG GG, NGG, WGG, CWT, CTT and GAA. For example, the motif is a Cas9 PAM motif. For example, the PAM is NGG. In another example, the PAM is GG.

[0261] In an example, there is a PAM motif no more than 10 nucleotides (e.g., 3 nucleotides) 3′ and/or 5′ of the non-endogenous sequence.

[0262] In an example, the PAM motif is recognised by a Streptococcus Cas9.

[0263] In an example, the cell or organism is a non-human vertebrate cell or a non-human vertebrate that expresses one or more human antibody heavy chain variable domains (and optionally no heavy chain variable domains of a non-human vertebrate species). For example, the organism is an Antibody-Generating Vertebrate or Assay Vertebrate disclosed in WO2013061078.

[0264] In an example, the cell or organism is a non-human vertebrate cell or a non-human vertebrate that expresses one or more human antibody kappa light chain variable domains (and optionally no kappa light chain variable domains of a non-human vertebrate species).

[0265] In an example, the cell or organism is a non-human vertebrate cell or a non-human vertebrate that expresses one or more human antibody lambda light chain variable domains (and optionally no kappa light chain variable domains of a non-human vertebrate species).

[0266] In an example, the non-endogenous sequence encodes a human Fe receptor protein or subunit or domain thereof (e.g., a human FeRn or Fcγ receptor protein, subunit or domain).

[0267] In an example, the non-endogenous sequence comprises one or more human antibody gene segments, an antibody variable region or an antibody constant region.

[0268] In an example, the insert sequence is a human sequence that replaces or supplements an orthologous non-human sequence.

[0269] The invention also provides: [0270] A monoclonal or polyclonal antibody prepared by immunisation of a vertebrate (e.g., mouse or rat) of the invention (or produced by a method of the invention) with an antigen.

[0271] The invention also provides: [0272] A method of isolating an antibody that binds a predetermined antigen, the method comprising: [0273] (a) providing a vertebrate (optionally a mouse or rat) of the invention (or produced by a method of the invention); [0274] (b) immunising said vertebrate with said antigen; [0275] (c) removing B lymphocytes from the vertebrate and selecting one or more B lymphocytes expressing antibodies that bind to the antigen; [0276] (d) optionally immortalising said selected B lymphocytes or progeny thereof, optionally by producing hybridomas therefrom; and [0277] (e) isolating an antibody (e.g., an IgG-type antibody) expressed by the B lymphocytes.

[0278] In an example, the method comprises the step of isolating from said B lymphocytes nucleic acid encoding said antibody that binds said antigen; optionally exchanging the heavy chain constant region nucleotide sequence of the antibody with a nucleotide sequence encoding a human or humanised heavy chain constant region and optionally affinity maturing the variable region of said antibody; and optionally inserting said nucleic acid into an expression vector and optionally a host.

[0279] In an example, the method comprises making a mutant or derivative of the antibody produced by the method.

[0280] The invention provides the use of an isolated, monoclonal or polyclonal antibody described herein, or a mutant or derivative antibody thereof that binds said antigen, in the manufacture of a composition for use as a medicament.

[0281] The invention provides the use of an isolated, monoclonal or polyclonal antibody described herein, or a mutant or derivative antibody thereof that binds said antigen for use in medicine.

[0282] The invention provides a method of treating a patient in need thereof (e.g., a human patient), comprising administering a therapeutically effective amount of an isolated, monoclonal or polyclonal antibody described herein, or a mutant or derivative antibody thereof which binds an antigen.

[0283] The invention provides a nucleotide sequence encoding an antibody described herein, optionally wherein the nucleotide sequence is part of a vector. The invention also provides a host cell comprising said nucleotide sequence.

[0284] The invention provides a pharmaceutical composition comprising the antibody or antibodies described herein and a diluent, excipient or carrier.

[0285] The invention provides an ES cell, a non-human animal or a non-human blastocyst comprising an expressible genomically-integrated nucleotide sequence encoding a Cas endonuclease (e.g., a Cas9 or Cys4) and optionally an expressible genomically-integrated nucleotide sequence encoding a tracrRNA or a gRNA. For example, the ES cell is any ES cell type described herein.

[0286] In an example of the cell, animal or blastocyst, the endonuclease sequence is constitutively expressible.

[0287] In an example of the cell, animal or blastocyst, the endonuclease sequence is inducibly expressible.

[0288] In an example of the cell, animal or blastocyst, the endonuclease sequence is expressible in a tissue-specific manner in the animal or a progeny thereof, or in a non-human animal that is a progeny of the cell or blastocyst.

[0289] In an example, the cell, animal or blastocyst comprises one or more gRNAs or an expressible nucleotide sequence encoding a gRNA or a plurality of expressible nucleotide sequences each encoding a different gRNA.

[0290] The invention provides the use of the cell, animal or blastocyst in a method according to any configuration, aspect, embodiment or example of the invention.

[0291] An aspect provides an antibody produced by the method of the invention, optionally for use in medicine, e.g., for treating and/or preventing (such as in a method of treating and/or preventing) a medical condition or disease in a patient, e.g., a human.

[0292] An aspect provides a nucleotide sequence encoding the antibody of the invention, optionally wherein the nucleotide sequence is part of a vector. Suitable vectors will be readily apparent to the skilled person, e.g., a conventional antibody expression vector comprising the nucleotide sequence together in operable linkage with one or more expression control elements.

[0293] An aspect provides a pharmaceutical composition comprising the antibody of the invention and a diluent, excipient or carrier, optionally wherein the composition is contained in an intravenous (IV) container (e.g., and IV bag) or a container connected to an IV syringe.

[0294] An aspect provides the use of the antibody of the invention in the manufacture of a medicament for the treatment and/or prophylaxis of a disease or condition in a patient, e.g. a human.

[0295] In a further aspect, the invention relates to humanised antibodies and antibody chains produced according to the present invention, both in chimaeric and fully humanised form, and use of said antibodies in medicine. The invention also relates to a pharmaceutical composition comprising such an antibody and a pharmaceutically acceptable carrier or other excipient.

[0296] Antibody chains containing human sequences, such as chimaeric human-non human antibody chains, are considered humanised herein by virtue of the presence of the human protein coding regions region. Fully human antibodies may be produced starting from DNA encoding a chimaeric antibody chain of the invention using standard techniques.

[0297] Methods for the generation of both monoclonal and polyclonal antibodies are well known in the art, and the present invention relates to both polyclonal and monoclonal antibodies of chimeric or fully humanised antibodies produced in response to antigen challenge in non-human vertebrates of the present invention.

[0298] In a yet further aspect, chimaeric antibodies or antibody chains generated in the present invention may be manipulated, suitably at the DNA level, to generate molecules with antibody-like properties or structure, such as a human variable region from a heavy or light chain absent a constant region, for example a domain antibody; or a human variable region with any constant region from either heavy or light chain from the same or different species; or a human variable region with a non-naturally occurring constant region; or human variable region together with any other fusion partner. The invention relates to all such chimaeric antibody derivatives derived from chimaeric antibodies identified according to the present invention.

[0299] In a further aspect, the invention relates to use of animals of the present invention in the analysis of the likely effects of drugs and vaccines in the context of a quasi-human antibody repertoire.

[0300] The invention also relates to a method for identification or validation of a drug or vaccine, the method comprising delivering the vaccine or drug to a mammal of the invention and monitoring one or more of: the immune response, the safety profile; the effect on disease.

[0301] The invention also relates to a kit comprising an antibody or antibody derivative as disclosed herein and either instructions for use of such antibody or a suitable laboratory reagent, such as a buffer, antibody detection reagent.

[0302] It will be understood that particular embodiments described herein are shown by way of illustration and not as limitations of the invention. The principal features of this invention can be employed in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize, or be able to ascertain using no more than routine study, numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the claims. All publications and patent applications mentioned in the specification are indicative of the level of skill of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and/or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” The use of the term “or” in the claims is used to mean “and/or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and/or.” Throughout this application, the term “about” is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.

[0303] As used in this specification and claim(s), the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps

[0304] The term “or combinations thereof” as used herein refers to all permutations and combinations of the listed items preceding the term. For example. “A, B, C, or combinations thereof is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, MB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth. The skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context.

[0305] Any part of this disclosure may be read in combination with any other part of the disclosure, unless otherwise apparent from the context.

[0306] All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will he apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

REFERENCES

[0307] 1. Cong L, Ran F A, Cox D, Lin S, Barretto R, Habib N, Hsu. P D, Wu X, Jiang W, Marraffini L A et al: Multiplex genome engineering using CRISPR/Cas systems. Science 2013, 339(6121):819-823. [0308] 2. Wang H, Yang H, Shivalila C S, Dawlaty M M, Cheng A W, Zhang F, Jaenisch R: One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell 2013, 153(4):910-918. [0309] 3. Mali P, Yang L, Esvelt K M, Aach J, Guell M, DiCarlo J E, Norville J E, Church G M: RNA-guided human genome engineering via Cas9. Science 2013, 339(6121):823-826. [0310] 4. Gaj T, Gersbach C A, Barbas C F, 3rd: ZEN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol 2013, 31(7):397-405. [0311] 5. Perez-Pinera P, Ousterout D G, Gersbach C A: Advances in targeted genome editing. Curr Opin Chem Biol 2012, 16(3-4):268-277. [0312] 6. Shah S A, Erdmann S, Mojica F J, Garrett R A: Protospacer recognition motifs: Mixed identities and functional diversity. RNA Biol 2013, 10(5). [0313] 7. Haurwitz R E, Sternberg S H, Doudna J A: Csy4 relics on an unusual catalytic dyad to position and cleave CRISPR RNA. EMBO J 2012, 31(12):2824-2832. [0314] 5. Yusa K, Zhou L, Li M A, Bradley A, Craig N L: A hyperactive piggyBac transposase for mammalian applications. Proc Natl Acad Sci USA 2011, 108(4):1531-1536. [0315] 9. Qiao J, Ouniard A, Wegloehner W, Bode J: Novel tag-and-exchange (RMCE) strategies generate master cell clones with predictable and stable transgene expression properties. J Mol Biol 2009, 390(4):579-594. [0316] 10. Oumard A, Qiao J, Jostock T, Li J, Bode J: Recommended Method for Chromosome Exploitation: RMCE-based Cassette-exchange Systems in Animal Cell Biotechnology. Cytotechnology 2006, 50(1-3):93-108.

[0317] The present invention is described in more detail in the following non limiting exemplification.

[0318] Some embodiments of the technology described herein can be defined according to any of the following numbered paragraphs: [0319] 1. A method of nucleic acid recombination, the method comprising [0320] (a) using Cas endonuclease-mediated nucleic acid cleavage to create first and second breaks in a nucleic acid strand, thereby creating 5′ and 3′ cut ends and a nucleotide sequence between the ends: [0321] (b) using homologous recombination to delete the nucleotide sequence; and [0322] (c) optionally obtaining the nucleic acid strand modified in step (b) or a progeny nucleic strand comprising the deletion. [0323] 2. The method of paragraph 1, wherein the deleted sequence comprises a regulatory element or encodes all or part of a protein. [0324] 3. The method of paragraph 2, wherein the deleted sequence comprises a protein subunit or domain. [0325] 4. The method of any one of paragraphs 1 to 3, wherein the deletion of step (b) is at least 20 nucleotides long. [0326] 5. The method of paragraph 1, further comprising a step of inserting a nucleotide sequence between the cut ends in (a). [0327] 6. The method of paragraph 5, wherein the insert nucleotide sequence comprises a PAM motif. [0328] 7. The method of paragraph 5 or paragraph 6, wherein the insert sequence is at least 10 nucleotides long. [0329] 8. The method of any one of paragraphs 5 to 7, wherein recombinase recognition sequences are used to insert the nucleotide sequence, e.g. loxP and/or a mutant lox, e.g., lox2272 or lox511 or frt. [0330] 9. The method of any one of paragraphs 5 to 7, wherein homologous recombination is used to insert the insert nucleotide sequence. [0331] 10. The method of any one of paragraphs 5 to 9, wherein the method is carried out in a cell and the insert sequence replaces an orthologous or homologous sequence in the cell. [0332] 11. The method of any preceding paragraph, wherein step (c) is performed by isolating a cell comprising the modified first strand, or by obtaining a non-human vertebrate in which the method has been performed or a progeny thereof. [0333] 12. The method of any preceding paragraph, wherein the nucleic acid strand or the first strand is a DNA strand. [0334] 13. The method of any preceding paragraph wherein the product of the method comprises a nucleic acid strand comprising a PAM motif 3′ of the insertion or deletion. [0335] 14. The method of paragraph 13, wherein the PAM motif is no more than 10 nucleotides 3′ of the deletion. [0336] 15. The method of any preceding paragraph, wherein step (h) is performed by carrying out homologous recombination between an incoming nucleic acid comprising first and second homology arms, wherein the homology arms are substantially homologous respectively to a sequence extending 5′ from the 5′ end and a sequence extending 3′ from the 3′ end. [0337] 16. The method of paragraph 15, wherein step (b) is performed by carrying out homologous recombination between an incoming nucleic acid comprising an insert nucleotide sequence flanked by the first and second homology aims, wherein the insert nucleotide sequence is inserted between the 5′ and 3′ ends. [0338] 17. The method of paragraph 15 or paragraph 16, wherein each homology arm is at least 20 contiguous nucleotides long. [0339] 18. The method of any one of paragraphs 15 to 17, wherein the first and/or second homology aim comprises a recombinase recognition sequence, such as a PAM motif. [0340] 19. The method of any preceding paragraph, wherein Cas endonuclease-mediated cleavage is used in step (a) and is carried out by recognition of a GG or NGG PAM motif. [0341] 20. The method of paragraph 19, wherein a nickase is used to cut in step (a), and optionally, wherein the nickase is a Cas nickase. [0342] 21. The method of any preceding paragraph, wherein the method is carried out in a cell, e.g. a eukaryotic cell. [0343] 22. The method of paragraph 21, wherein the method is carried out in a mammalian cell, e.g. rodent or mouse cell, e.g. a rodent (e.g., mouse) ES cell or zygote. [0344] 23. The method of any preceding paragraph, wherein the method is carried out in a non-human mammal, e.g. a mouse or rat or rabbit. [0345] 24. The method of any preceding paragraph, wherein each cleavage site is flanked by PAM motif (e.g., a NGG or NGGNG sequence, wherein N is any base and G is a guanine). [0346] 25. The method of any preceding paragraph, wherein the 3′ end is flanked 3′ by a PAM motif. [0347] 26. The method of any preceding paragraph, wherein step (a) is carried out by cleavage in one single strand of dsDNA. [0348] 27. The method of any preceding paragraph, wherein step (a) is carried out by combining in a cell the nucleic acid strand, a Cas endonuclease, a crRNA and a tracrRNA (e.g., provided by one or more gRNAs) for targeting the endonuclease to carry out the cleavage, and optionally an insert sequence for homologous recombination with the nucleic acid strand. [0349] 28. The method of any preceding paragraph, wherein step (b) is performed by carrying out homologous recombination with an incoming nucleic acid comprising first and second homology arms, wherein the homology arms are substantially homologous respectively to a sequence extending 5′ from the 5′ end and a sequence extending 3′ from the 3′ end, wherein the second homology arm comprises a PAM sequence such that homologous recombination between the second homology arm and the sequence extending 3′ from the 3′ end produces a sequence comprising a PAM motif in the product of the method. [0350] 29. A method of sequential endonuclease-mediated homology directed recombination (sEHDR) comprising carrying out the method of any preceding paragraph a first time and a second time, wherein the product of the first time is used for endonuclease-mediated cleavage the second time, whereby either (i) first and second nucleotide sequences are deleted the first time and the second times respectively; (ii) a first nucleotide sequence is deleted the first time and a second nucleotide sequence is inserted the second time; (iii) a first nucleotide sequence is inserted the first time and a second nucleotide sequence is deleted the second time; or (iv) first and second nucleotide sequences are inserted the first and second times respectively; optionally wherein the nucleic acid strand modification the second time is within 20 or less nucleotides of the nucleic acid strand modification the first time. [0351] 30. The method of paragraph 29, wherein the first time is carried out according to paragraph 1, wherein the incoming nucleic acid comprises no sequence between the first and second homology arms, wherein sequence between the 5′ and 3′ ends is deleted by homologous recombination; and/or the second time is carried out according to paragraph 1, wherein step (b) is performed by carrying out homologous recombination between an incoming nucleic acid comprising first and second homology anus, wherein the homology arms are substantially homologous respectively to a sequence extending 5′ from the 5′ end and a sequence extending 3′ from the 3′ end, wherein the incoming nucleic acid comprises no sequence between the first and second homology arms such that sequence between the 5′ and 3′ ends is deleted by homologous recombination; optionally wherein the second arm comprises a PAM motif such that the product of the second time comprises a PAM motif for use in a subsequent Cas endonuclease-mediated method according to any one of paragraphs 1 to 28. [0352] 31. The method of any preceding paragraph, wherein step (a) is carried out using Cas endonuclease-mediated cleavage and a gRNA comprising a crRNA and a tracrRNA. [0353] 32. The method of paragraph 27 or 31, wherein the crRNA has the structure 5′-X-Y-3′, wherein X is an RNA nucleotide sequence (optionally at least 5 nucleotides long) and Y is an RNA sequence comprising a nucleotide motif that hybridises with a motif comprised by the tracrRNA, wherein X is capable of hybridising with a nucleotide sequence extending 5′ from the desired site of the 5′ cut end. [0354] 33. The method of paragraph 27, 31 or 32, wherein Y is 5′-N.sub.1UUUUAN.sub.2N.sub.3GCUA-3′, wherein each of N.sub.1-3 is a A, U, C or G and/or the tracrRNA comprises the sequence (in 5′ to 3′ orientation) UAGCM.sub.1UUAAAAM.sub.2, wherein M.sub.1 is spacer nucleotide sequence and M2 is a nucleotide. [0355] 34. A method of nucleic acid recombination, the method comprising providing dsDNA comprising first and second strands and [0356] (a) using Cas endonuclease-mediated nucleic acid cleavage to create a cut end in the first strand 3′ of a PAM motif: [0357] (b) using Cas endonuclease-mediated nucleic acid cleavage to create a cut in the second strand at a position which corresponds to a position 3′ of the cut end of the strand of part (a), which cut is 3′ of the PAM motif; [0358] (c) providing a first gRNA which hybridises with a sequence 5′ to the PAM motif in the strand of part (a) [0359] (d) providing a second gRNA which hybridises with a sequence 5′ to the PAM motif in the strand of part (b)
wherein the :nucleic acid strands of part (a) and part (b) are repaired to produce a deletion of nucleic acid between the cuts. [0360] 35. A method of producing a cell or a transgenic non-human organism, the method comprising: [0361] (a) carrying out the method of any preceding paragraph to (i) knock out a target nucleotide sequence in the genome of a first cell and/or (ii) knock in an insert nucleotide sequence into the genome of a first cell, optionally wherein the insert sequence replaces a target sequence in whole or in part at the endogenous location of the target sequence in the genome; wherein the cell or a progeny thereof can develop into a non-human organism or cell; and [0362] (b) developing the cell or progeny into a non-human organism or a non-human cell. [0363] 36. The method of paragraph 35, wherein the organism or cell is homozygous for the modification (i) and/or (ii). [0364] 37. The method of paragraph 35 or 36, wherein the cell is an ES cell.sub.; iPS cell, totipotent cell or pluripotent cell, optionally a rodent (e.g., a mouse or rat) cell. [0365] 38. The method of any one of paragraphs 35 to 37, wherein the target sequence is an endogenous sequence comprising all or part of a regulatory element or encoding all or part of a protein. [0366] 39. The method of any one of paragraphs 35 to 38, wherein the insert sequence is a synthetic sequence; or comprises a sequence encoding all or part of a protein from a species other than the species from which the first cell is derived; or comprises a regulatory element from said first species. [0367] 40. The method of paragraph 39, wherein the insert sequence encodes all or part of a human protein or a human protein subunit or domain. [0368] 41. A cell or a non-human organism whose genome comprises a modification comprising a non-endogenous nucleotide sequence flanked by endogenous nucleotide sequences, wherein the cell or organism is obtainable by the method of any one of paragraphs 26 to 40 and wherein the non-endogenous sequence is flanked 3′ by a Cas PAM motif; wherein the cell is not comprised by a human; and one, more or all of (a) to (d) applies [0369] (a) the genome is homozygous for the modification; or comprises the modification at one allele and is unmodified by Cas-mediated homologous recombination at the other allele; [0370] (b) the non-endogenous sequence comprises all or part of a regulatory element or encodes all or part of a protein; [0371] (c) the non-endogenous sequence is at least 20 nucleotides long; [0372] (d) the non-endogenous sequence replaces an orthologous or homologous sequence in the genome. [0373] 42. The cell or organism of paragraph 41, wherein the non-endogenous sequence is a human sequence. [0374] 43. The cell or organism of paragraph 41 or 42, wherein the PAM motif comprises a sequence selected from CCN, TCN, TTC, AWG, CC, NNAGNN, NGGNG GG, NGG, WGG, CWT, CTT and GAA. [0375] 44. The cell or organism of any one of paragraphs 41 to 43, wherein there is a PAM motif no more than 10 nucleotides (e.g., 3 nucleotides) 3′ of the non-endogenous sequence. [0376] 45. The cell or organism of any one of paragraphs 41 to 44, wherein the PAM motif is recognised by a Streptococcus Cas9. [0377] 46. The cell or organism of any one of paragraphs 41 to 45, which is a non-human vertebrate cell or a non-human vertebrate that expresses one or more human antibody heavy chain variable domains (and optionally no heavy chain variable domains of a non-human vertebrate species). [0378] 47. The cell or organism of any one of paragraphs 41 to 46, which is a non-human vertebrate cell or a non-human vertebrate that expresses one or more human antibody kappa light chain variable domains (and optionally no kappa light chain variable domains of a non-human vertebrate species) or that expresses one or more human antibody lambda light chain variable domains (and optionally no kappa light chain variable domains of a non-human vertebrate species). [0379] 48. The cell or organism of any paragraph 46 or paragraph 47, wherein the non-endogenous sequence encodes a human Fc receptor protein or subunit or domain thereof (e.g., a human FcRn or Fcγ′ receptor protein, subunit or domain). [0380] 49. The cell or organism of any one of paragraphs 41 to 48, wherein the non-endogenous sequence comprises one or more human antibody gene segments, an antibody variable region or an antibody constant region. [0381] 50. The cell or organism of any one of paragraphs 41 to 49, wherein the insert sequence is a human sequence that replaces or supplements an orthologous non-human sequence. [0382] 51. A monoclonal or polyclonal antibody prepared by immunisation of a vertebrate (e.g., mouse or rat) according to any one of paragraphs 41 to 50 with an antigen. [0383] 52. A method of isolating an antibody that binds a predetermined antigen, the method comprising [0384] (a) providing a vertebrate (optionally a mouse or rat) according to any one of paragraphs 41 to 51; [0385] (b) immunising said vertebrate with said antigen; [0386] (c) removing B lymphocytes from the vertebrate and selecting one or more B lymphocytes expressing antibodies that bind to the antigen; [0387] (d) optionally immortalising said selected B lymphocytes or progeny thereof, optionally by producing hybridomas therefrom; and [0388] (e) isolating an antibody (e.g., and IgG-type antibody) expressed by the B lymphocytes. [0389] 53. The method of paragraph 52, comprising the step of isolating from said B lymphocytes nucleic acid encoding said antibody that binds said antigen; optionally exchanging the heavy chain constant region nucleotide sequence of the antibody with a nucleotide sequence encoding a human or humanised heavy chain constant region and optionally affinity maturing the variable region of said antibody; and optionally inserting said nucleic acid into an expression vector and optionally a host. [0390] 54. The method of paragraph 52 or 53, further comprising making a mutant or derivative of the antibody produced by the method of paragraph 52 or 53. [0391] 55. The use of an isolated, monoclonal or polyclonal antibody according to paragraph 51, or a mutant or derivative antibody thereof that binds said antigen, in the manufacture of a composition for use as a medicament. [0392] 56. The use of an isolated, monoclonal or polyclonal antibody according to paragraph 51, or a mutant or derivative antibody thereof that binds said antigen for use in medicine. [0393] 57. A nucleotide sequence encoding an antibody of paragraph 51, optionally wherein the nucleotide sequence is part of a vector. [0394] 58. A pharmaceutical composition comprising the antibody or antibodies of paragraph 51 and a diluent, excipient or carrier. [0395] 59. An ES cell, a eukaryotic cell, a mammalian cell, a non-human animal or a non-human blastocyst comprising an expressible genomically-integrated nucleotide sequence encoding a Cas endonuclease. [0396] 60. The cell, animal or blastocyst of paragraph 59, wherein the endonuclease sequence is constitutively expressible. [0397] 61. The cell, animal or blastocyst of paragraph 59, wherein the endonuclease sequence is inducibly expressible. [0398] 62. The cell, animal or blastocyst of paragraph 59, 60 or 61, wherein the endonuclease sequence is expressible in a tissue-specific or stage-specific manner in the animal or a progeny thereof, or in a non-human animal that is a progeny of the cell or blastocyst. [0399] 63. The cell or animal of paragraph 62, wherein the cell is a non-human embryo cell or the animal is a non-human embryo, wherein the endonuclease sequence is expressible or expressed in the cell or embryo. [0400] 64. The cell of animal paragraph 63, wherein the endonuclease is operatively linked to a promoter selected from the group consisting of an embryo-specific promoter (e.g., a Nanog promoter, a Pou5fl promoter or a SoxB promoter). [0401] 65. The cell, animal or blastocyst of any one of paragraphs 61 to 64, wherein the Cas endonuclease is at a Rosa 26 locus, and is optionally operably linked to a Rosa 26 promoter. [0402] 66. The cell, animal or blastocyst of any one of paragraphs 59 to 62, wherein the Cas endonuclease sequence is flanked 5′ and 3′ by transposon elements (e.g., inverted piggyBac terminal elements) or site-specific recombination sites (e.g., loxP and/or a mutant lox, e.g., lox2272 or lox511; or frt). [0403] 67. The cell, animal or blastocyst of paragraph 66, comprising one or more restriction endonuclease sites between the Cas endonuclease sequence and a transposon element. [0404] 68. The cell, animal or blastocyst of any one of paragraphs 59 to 67 comprising one or more gRNAs. [0405] 69. The cell, animal or blastocyst of paragraph 66, 67 or 68, wherein the gRNA(s) are flanked 5′ and 3′ by transposon elements (e.g., inverted. piggyBac terminal elements) or site-specific recombination sites (e.g., loxP and/or a mutant lox, e.g., lox2272 or lox511; or frt). [0406] 70. Use of the cell, animal or blastocyst of any one of paragraphs 59 to 69 in a method according to any one of paragraphs 1 to 50.

EXAMPLES

Example 1

Precise DNA Modifications

(a) Use of Nickase for HDR

[0407] It has been reported that the Cas9 nuclease can be converted into a nickase through the substitution of an aspartate to alanine (D10A) in the RuvCI domain of SpCas9 (Gong et al.). It is noteworthy that DNA single-stranded breaks are preferentially repaired through the HDR pathway. The Cas9 D10A nickase, when in a complex with mature crRNA:tracrRNA, can specifically induce DNA nicking at a precise location. With this in mind, we propose extending the application of the CRISPR/Cas system by creating a nick in a given location in a genome using Cas9 D10A nickase and then exploiting the HDR pathway for inserting a single-stranded DNA fragment (endogenous or exogenous) which will contain DNA homology (typically for recombineering, 50 bp is enough for efficient recombination) flanking the nicked DNA junction to bring in and insert a given DNA in a precision location; similar size homology will he used with the present example (FIG. 1A). Guide RNA (gRNA) will be design individually per target protospacer sequence or incorporated into a single CRISPR array encoding for 2 or more spacer sequences allowing multiplex genome editing from a single CRSPR array.

(b) Example of Precise DNA Deletion

[0408] To demonstrate precise deletion using Cas9 in association with gRNA and no targeting vector or donor DNA, we designed two gRNA within a gene, which were 55 bp apart. The two gRNA were on opposite DNA strands as shown in FIG. 9.

[0409] Mouse ES cells were transfected with human Cas9 nuclease and the two gRNAs. The transfection procedure was carried out as detailed above but the resulting clones were not selected. The transfected ES clones were genotyped using oligos pair spanning the two gRNA (Primer 1 & 2) to detect specific 55 bp deletion (FIG. 10).

[0410] Most of the clones did not show the specific 55 bp deletion, however, clones were clearly identified which contained the defined deletion. Out of the 384 clones analysed, approximately 4% of the clones were found to contain the specific 55 bp deletion. Note: Not all the genotyping data is shown. The clones containing the specific 55 bp deletion were further analysed by sequencing the PCR products as a final confirmation (data not shown). Furthermore, where we saw the specific deletion, we observed both alleles to contain the specific deletion. These data confirmed that when two gRNAs are used, a precise and specific deletion can be made without the requirement for a targeting vector. However we can assume the efficiency of the define deletion can be greatly enhance using the two gRNA combination together with a targeting vector or a donor DNA fragment containing homology arms flanking the intended deletion region.

(c) Alternative Methodology for Deletion of DNA

[0411] In a separate setting, two gRNA or a single CRISPR array encoding multiple spacer sequence can be designed flanking a gene or a region of interest and with the association of Cas9 D10A nickase, two separate single-stranded breaks can be induced. This, in association with a single-stranded DNA fragment containing DNA homology to the 5′ breakpoint junction of the first DNA nick, and DNA homology to the 3′ breakpoint junction of the second nick, the region in between the two single stranded DNA nick can be precisely deleted (FIG. 2A).

(d) Alternative Methodology for Replacement of DNA

[0412] In an another setting, two separate gRNA or a multiplex single CRISPR array can be designed flanking a gene or a region of interest and with the association of Cas9 D10A nickase two separate single-stranded breaks can be induced. In this case the intruding single stranded DNA fragment (or double stranded DNA) can contain DNA sequence from either endogenous or exogenous source containing sequence for a known gene, regulatory element promoter etc. This single-stranded DNA fragment (or double stranded DNA) can be brought together to replace the DNA region of interest flanked by DNA nick by arming it with DNA homology from the 5′ region of the first nick and 3′ region from the second nick (FIG. 3A). Due to the high efficiency of the CRISPR/Cas system to cleave DNA, the above proposed strategy will not require introduction of any selection marker, thus creating exact seamless genome editing in a precise and defined manner. As an option, a selection marker can be included flanked by Piggy Bac LTRs to allow for the direct selection of correctly modified clones. Once the correct clones have been identified, the selection marker can be removed conveniently through the expression of hyperactive piggyBac transposase (Yusa K., Zhou. L., Li M. A., Bradley A., Craig N. L.: A hyperactive piggyBac transposase for mammalian applications., Proc. Natl. Acad. Sci. USA, 2011, 108(4):1531-1536). Furthermore, the above approaches can be applied to ES cells, mammalian cells, yeast cells, bacterial cells, plant cells as well as directly performing in zygotes to expedite the process of homozygeous genome engineering in record time. It would be also possible to multiplex this system to generate multiple simultaneous DNA insertions (KI), deletions (KO) and the sequential deletion and insertion (KO.fwdarw.KI).

(e) Example of DNA Deletion and Insertion in a Predefined Location (KO→KI)

[0413] To demonstrate a desired DNA region can be manipulated using Cas9, a single guide RNA (gRNA) was selected at a desired region (Exon 1 of gene X) FIG. 7. A targeting vector was also constructed, which contained approximately 300 bp homology arms (5′ and 3′ HA) flanking the gRNA. The homology arms will hybridise exactly in the defined region and thus delete a 50 bp region, which is intended for deletion. The targeting vector also allows for the insertion of any DNA sequence of interest. In this proof of concept experiment, we included an approximate 1.6 kb PGK-puromycin cassette. The guide RNA (0.5 ug) together with the targeting vector (1 ug) and Cas9 nuclease vector (1 ug) was transfected into ES cells and 96 clones were picked after selection on puromycin using the protocol described above. Note. As a test for targeting efficiency, we compared linear verses circular targeting vector. Also as a negative control, we did the same experiment using no Cas9 vector to compare targeting efficiency via homologous recombination with and without Cas9 expression.

[0414] All the selected clones were puromycin resistant and the 96 clones picked from each of the four transfections were genotyped using the oligo pair HAP341/HAP334. Correctly targeted clones yielded an 880 bp PCR product. The resulting genotyping data is shown in FIG. 8.

[0415] From the genotyping data of this experiment, it can be seen that Cas9 mediated double stranded DNA break greatly improves homologous recombination efficiency of the targeting vector as 62% and 49% of the clones using circular or linear targeting vector respectively were correctly targeted verse only a single targeted clone using circular targeting vector when no Cas9 was used. Also it can be seen from this data that the circular targeting vector yielded slightly better targeting efficiency than when linear vector was used but a general conclusion cannot be drawn from this single experiment but to say, both circular and linear targeting vector yielded greatly improved targeting efficiency when associated with Cas9 and a specific guide RNA. This experiment also demonstrated that using Cas9 to create a define DNA breakage can be used to delete out a defined DNA region and subsequently insert any DNA fragment of interest

Example 2

Recycling PAM for Sequential Insertions or Deletions

[0416] In certain settings it may be useful to edit a genome by chromosome walking. Using any of the three examples outlined above, it could be possible to carry out sequential genome editing in a stepwise fashion whereby the PAM sequence used in a previous round of CRISPR/Cas mediated genome editing, can be re-used to carry out multiple rounds of genome editing such as deletions, insertions or the simultaneous deletion and insertion. An example of sequential deletion whereby the PAM sequence :from the previous genome editing step is recycled is shown in FIG. 4A. Using the PAM recycling approach, it is possible to carry out sequential insertions as well as sequential simultaneous deletion and insertion.

[0417] The PAM sequence us recycled through reintroducing it via homologous recombination and as part of the homology arm. The PAM sequence can be optionally accompanied by a unique guide-RNA sequence creating a novel site within the host genome for further round of genome editing

Example 3

Rapid Insertion of Lox Sites Using CRISPR/Cas System

[0418] Targeting efficiency using conventional homologous recombination methods in ES cells is low. In a different setting, the CRISPR/Cas system can be used to rapidly and efficiently introduce lox sites or other recombinase recognition sequence such as Fri in a defined location to act as a landing pad for genome editing using recombinase mediated cassette exchange (RMCE) (Qiao J., Oumard A., Wegloehner W., Bode J.: Novel tag-and-exchange (RMCE) strategies generate master cell clones with predictable and stable transgene expression properties., J. Mol. Biol., 2009, 390(4):579-594; and Oumard A., Qiao J., Jostock T., Li J., Bode J.: Recommended Method for Chromosome Exploitation: RMCE-based Cassette-exchange Systems in Animal Cell Biotechnology., Cytotechnology, 2006, 50(1-3):93-108). Once the lox sites are introduced into the gnome, inversion, deletion or cassette exchange to delete and introduce DNA fragment varying in size at this site can be efficiently conducted via expression of Cre recombinase. An example of CRISPR/Cas mediated lox insertion followed by RMCE is shown in FIG. 5A. The RIvICE step can be used to invert the region flanked by lox site or to delete this region as well as to simultaneously delete and insert DNA of interest in this region. Furthermore, the RMCE step can be adapted for carrying out multiple sequential rounds of RMCE (sRMCE).

Example 4A

[0419] Reference is made to FIG. 6A. A piggyBac transposon harbouring a PGK. promoter-driven loxP/mutant lox-flanked neo.sup.R gene is targeted into an ES cell genome by standard homologous recombination. The targeted clones can be selected by G418. This provides a landing pad for the following recombinase-mediated cassette exchange (RMCE). Such an ES clone can be used a parental cells for any modification further. A cassette containing the loxP/mutant lox-flanked promoterless PuroΛTK-T2A-Cas9 and U6 polymerase III promoter-driven guide RNA (gRNA) genes are inserted into the landing pad through transient cre expression. The gRNA genes can be one or more than one which target to the same gene or different genes. The inserted clones can be selected with puromycin and confirmed by junction PCRs. During the selection, the expression of Cas9 and gRNAs from the inserted cassette results in more efficient gene targeting or modification than transient expression of the Cas9 and gRNA can achieve. Following 4-6 day selection, the whole modified cassette is excised by the transient expression of piggyBac transposase (PBase). The final ES cell clones would not contain any Cas9 or gRNA sequence. The clones with homozygous modified genes would be confirmed by PCR and sequence.

[0420] The main feature of this invention is to control the Cas9 and gRNA expression in certain time to be sufficient to generate efficient targeting rates.

Example 4B

Single Copy Cas9 Expression

[0421] As detailed in example 6, to demonstrate the single and stable expression of Cas9 from within the chromosome of a cell, we targeted a landing pad vector into Rosa26 allele on chromosome 6. DNA homology arms were used to target the landing pad vector in between exons 2 and 3 of Rosa26. The landing pad vector was targeted into ES cells using procedure described above. The transfected ES clones were selected on G418 and genotyped for correct targeting (FIG. 11) by PCR amplifying the 5′ and 3′ homology arm junctions.

[0422] Targeting of the landing pad yielded many targeted ES clones. A selection of the targeted clones were used to insert a DNA cassette containing Cas9 nuclease linked to Puro-delta-tk via a T2A sequence into the targeted landing pad via RMCE, which involved the expression of Crc recombinase. The corresponding loxP and lo2272 sites within both the landing pad and the incoming vector ensured correct orientation of insertion. Since the landing pad contained a geneless PGK promoter, correct insertion of the incoming vector DNA containing Cas9, activated expression of puromycin and thus clones were positively selected on puromycin. Non-specific targeting of this DNA cassette will not yield puromycin resistant clones due to the absence of a promoter driving the transcription of the promoterless puromycin gene in the inserted DNA cassette. The initial Cas9 vector inserted into the landing pad did not contain any guide RNA sequence. The puromycin resistant ES clones were genotyped by PCR for the correct insertion of Cas9 (FIG. 12).

[0423] As expected owing to the positive selection, most of the clones genotyped for insertion of the Cas9 vector were correctly targeted via RMCE based on the PCR genotyping results. Two of the correct clones (KHK1.6 Z2-24-27 and KliK1.10Z2-25-4 referred to as positive Z clones) which now contain the single copy Cas9 integrated into the Rosa26 gene as a single copy were used to test whether the Cas9 expression was sufficient enough to induce Cas9 mediated genome editing. Into the two positive Z clones, guide RNA against a gene referred to as gene Y was transfected using procedure described above. Following transfection and expansion of the resulting ES clones, 36 individual clones were isolated from each transfection and analysed initially by PCR using oligo flanking the guide RNA (FIG. 13).

[0424] Most of the clones yielded a PCR product of size equivalent to the positive control PCR where DNA from mouse AB2.1 ES cells was used. However, it can be seen clearly that some clones yielded a PCR product distinctively smaller than that of the positive control suggesting these clones contain a significant deletion via indel. To verify this and to check whether the rest of the PCR products though similar in size to the positive control did not contain indels, all the PCR products were purified using Qiagen gel extraction kit and analysed by sequencing. The sequencing data confirmed significant deletion for those PCR products that yielded shorter products than the positive control. It also highlighted, some of the other clones with similar PCR product size to the positive control to contain indels, which included various combinations of insertion and deletion (Sequencing data not shown). Out of the clones analysed, 18% of them contained an indel. These data clearly demonstrated that a single copy expression of Cas9 can be used to early out genome editing and these clones can now be used as a Cas9 host cells for carrying out a multitude of genome editing. These ES clones are now being used to generate transgenic mouse lines whereby we can carry out a one-step genome editing by injecting only guide mRNA directly into zygotes without the requirement for transcribing Cas9 mRNA to simplify the one-step genome editing protocol.

Example 5(A)

Methodology

A: Reconstructing CRISPR/Cas Vector System (Nuclease)

[0425] The CRISPR/Cas genome editing system has been reconstructed in vitro and exemplified in mouse embryonic stein cells using vector pX330 containing humanised S. pyogenes (hSpCsn1) (Cong et al). The CRISPR/Cas system can be reconstructed as described in Cong et al using synthetic DNA strings and DNA assembly. In the present example, the entire DNA assembly would constitute a 6006 bp fragment containing 45 bp homologyto pBlueScript KS+ vector 5′ to the EcoRV cutting site, Human U6 promoter, two BbsI restriction sites for cloning in the spacer sequence which fuses to a chimeric guided RNA sequence, chicken beta-actin promoter with 3 FLAG, nuclear localisation signal (NLS) followed by hSpCsnI sequence and another NLS, polyA, inverted terminal repeat sequence and finally another 45 bp homology to pBlueScript KS+3′ to the EcoRV cutting site. This 6006 bp stretch of DNA will be synthetized as 7 individual DNA fragments where each fragment will have a 45 bp overlap to the adjacent DNA fragment to allow DNA assembly. The DNA sequence of these fragments is shown below in the order of assembly.

TABLE-US-00002 Fragment 1A (1340 bp) (SEQ ID NO: 7) GGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATGAGGG CCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTA GAGAGATAATTGTAATTAATTTGACTGTAAACACAAAGATATTAGTACAA AATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAA ATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATT TCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGGTCT TCGAGAAGACCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG TCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGTTTTT AGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTTTAGCGCGTG CGCCAATTCTGCAGACAAATGGCTCTAGAGGTACCCGTTACATAACTTAC GGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGT CAATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTAT TTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAG TACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTGTG CCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTA TTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCAC TCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTT TTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCG CCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGG TGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGG CGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCG GGAGTCGCTGCGACGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCT CGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGC GGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCTGAGCAAGAGGTA AGGGTTTAAGGGATGGTTGGTTGGTGGGGTATTAATGTTTAATTACCTGG AGCACCTGCCTGAAATCACTTTTTTTCAGGTTGGACCGGTGCCACCATGG ACTATAAGGACCACGACGGAGACTACAAGGATCATGATATT Fragment 2 (852 bp) (SEQ ID NO: 8) ATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTA CAAAGACGATGACGATAAGATGGCCCCAAAGAAGAAGCGGAAGGTCGGTA TCCACGGAGTCCCAGCAGCCGACAAGAAGTACAGCATCGGCCTGGACATC GGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCC CAGCAAGAAATTCAAGGTGCTGGGCAACACCGACCGGCACAGCATCAAGA AGAACCTGATCGGAGCCCTGCTGTTCGACAGCGGCGAAACAGCCGAGGCC ACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGAAGAACCG GATCTGCTATCTGCAAGAGATCTTCAGCAACGAGATGGCCAAGGTGGACG ACAGCTTCTTCCACAGACTGGAAGAGTCCTTCCTGGTGGAAGAGGATAAG AAGCACGAGCGGCACCCCATCTTCGGCAACATCGTGGACGAGGTGGCCTA CCACGAGAAGTACCCCACCATCTACCACCTGAGAAAGAAACTGGTGGACA GCACCGACAAGGCCGACCTGCGGCTGATCTATCTGGCCCTGGCCCACATG ATCAAGTTCCGGGCCACCACTTCCTGATCGAGGGCGACCTGAACCCCGAC AACAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCA GCTGTTCGAGGAAAACCCCATCAACGCCAGCGGCGTGGACGCCAAGGCCA TCCTGTCTGCCAGACTGAGCAAGAGCAGACGGCTGGAAAATCTGATCGCC CAGCTGCCCGGCGAGAAGAAGAATGGCCTGTTCGGAAACCTGATTGCCCT GAGC Fragment 3 (920 bp) (SEQ ID NO: 9) GGCGAGAAGAAGAATGGCCTGTTCGGAAACCTGATTGCCCTGAGCCTGGG CCTGACCCCCAACTTCAAGAGCAACTTCGACCTGGCCGAGGATGCCAAAC TGCAGCTGAGCAAGGACACCTACGACGACGACCTGGACAACCTGCTGGCC CAGATCGGCGACCAGTACGCCGACCTGTTTCTGGCCGCCAAGAACCTGTC CGACGCCATCCTGCTGAGCGACATCCTGAGAGTGAACACCGAGATCACCA AGGCCCCCCTGAGCGCCTCTATGATCAAGAGATACGACGAGCACCACCAG GACCTGACCCTGCTGAAAGCTCTCGTGCGGCAGCAGCTGCCTGAGAAGTA CAAAGAGATTTTCTTCGACCAGAGCAAGAACGGCTACGCCGGCTACATTG ACGGCGGAGCCAGCCAGGAAGAGTTCTACAAGTTCATCAAGCCCATCCTG GAAAAGATGGACGGCACCGAGGAACTGCTCGTGAAGCTGAACAGAGAGGA CCTGCTGCGGAAGCAGCGGACCTTCGACAACGGCAGCATCCCCCACCAGA TCCACCTGGGAGAGCTGCACGCCATTCTGCGGCGGCAGGAAGATTTTTAC CCATTCCTGAAGGACAACCGGGAAAAGATCGAGAAGATCCTGACCTTCCG CATCCCCTACTACGTGGGCCCTCTGGCCAGGGGAAACAGCAGATTCGCCT GGATGACCAGAAAGAGCGAGGAAACCATCACCCCCTGGAACTTCGAGGAA GTGGTGGACAAGGGCGCTTCCGCCCAGAGCTTCATCGAGCGGATGACCAA CTTCGATAAGAACCTGCCCAACGAGAAGGTGCTGCCCAAGCACAGCCTGC TGTACGAGTACTTCACCGTGTATAACGAGCTGACCAAAGTGAAATACGTG ACCGAGGGAATGAGAAAGCC Fragment 4 (920 bp) (SEQ ID NO: 10) CGAGCTGACCAAAGTGAAATACGTGACCGAGGGAATGAGAAAGCCCGCCT TCCTGAGCGGCGAGCAGAAAAAGGCCATCGTGGACCTGCTGTTCAAGACC AACCGGAAAGTGACCGTGAAGCAGCTGAAAGAGGACTACTTCAAGAAAAT CGAGTGCTTCGACTCCGTGGAAATCTCCGGCGTGGAAGATCGGTTCAACG CCTCCCTGGGCACATACCACGATCTGCTGAAAATTATCAAGGACAAGGAC TTCCTGGACAATGAGGAAAACGAGGACATTCTGGAAGATATCGTGCTGAC CCTGACACTGTTTGAGGACAGAGAGATGATCGAGGAACGGCTGAAAACCT ATGCCCACCTGTTCGACGACAAAGTGATGAAGCAGCTGAAGCGGCGGAGA TACACCGGCTGGGGCAGGCTGAGCCGGAAGCTGATCAACGGCATCCGGGA CAAGCAGTCCGGCAAGACAATCCTGGATTTCCTGAAGTCCGACGGCTTCG CCAACAGAAACTTCATGCAGCTGATCCACGACGACAGCCTGACCTTTAAA GAGGACATCCAGAAAGCCCAGGTGTCCGGCCAGGGCGATAGCCTGCACGA GCACATTGCCAATCTGGCCGGCAGCCCCGCCATTAAGAAGGGCATCCTGC AGACAGTGAAGGTGGTGGACGAGCTCGTGAAAGTGATGGGCCGGCACAAG CCCGAGAACATCGTGATCGAAATGGCCAGAGAGAACCAGACCACCCAGAA GGGACAGAAGAACAGCCGCGAGAGAATGAAGCGGATCGAAGAGGGCATCA AAGAGCTGGGCAGCCAGATCCTGAAAGAACACCCCGTGGAAAACACCCAG CTGCAGAACGAGAAGCTGTACCTGTACTACCTGCAGAATGGGCGGGATAT GTACGTGGACCAGGAACTGG Fragment 5 (920 bp) (SEQ ID NO: 11) ACTACCTGCAGAATGGGCGGGATATGTACGTGGACCAGGAACTGGACATC AACCGGCTGTCCGACTACGATGTGGACCATATCGTGCCTCAGAGCTTTCT GAAGGACGACTCCATCGACAACAAGGTGCTGACCAGAAGCGACAAGAACC GGGGCAAGAGCGACAACGTGCCCTCCGAAGAGGTCGTGAAGAAGATGAAG AACTACTGGCGGCAGCTGCTGAACGCCAAGCTGATTACCCAGAGAAAGTT CGACAATCTGACCAAGGCCGAGAGAGGCGGCCTGAGCGAACTGGATAAGG CCGGCTTCATCAAGAGACAGCTGGTGGAAACCCGGCAGATCACAAAGCAC GTGGCACAGATCCTGGACTCCCGGATGAACACTAAGTACGACGAGAATGA CAAGCTGATCCGGGAAGTGAAAGTGATCACCCTGAAGTCCAAGCTGGTGT CCGATTTCCGGAAGGATTTCCAGTTTTACAAAGTGCGCGAGATCAACAAC TACCACCACGCCCACGACGCCTACCTGAACGCCGTCGTGGGAACCGCCCT GATCAAAAAGTACCCTAAGCTGGAAAGCGAGTTCGTGTACGGCGACTACA AGGTGTACGACGTGCGGAAGATGATCGCCAAGAGCGAGCAGGAAATCGGC AAGGCTACCGCCAAGTACTTCTTCTACAGCAACATCATGAACTTTTTCAA GACCGAGATTACCCTGGCCAACGGCGAGATCCGGAAGCGGCCTCTGATCG AGACAAACGGCGAAACCGGGGAGATCGTGTGGGATAAGGGCCGGGATTTT GCCACCGTGCGGAAAGTGCTGAGCATGCCCCAAGTGAATATCGTGAAAAA GACCGAGGTGCAGACAGGCGGCTTCAGCAAAGAGTCTATCCTGCCCAAGA GGAACAGCGATAAGCTGATC Fragment 6 (789 bp) (SEQ ID NO: 12) AGCAAAGAGTCTATCCTGCCCAAGAGGAACAGCGATAAGCTGATCGCCAG AAAGAAGGACTGGGACCCTAAGAAGTACGGCGGCTTCGACAGCCCCACCG TGCCTATTCTGTGCTGGTGGTGGCCAAAGTGGAAAAGGGCAAGTCCAAGA AACTGAAGAGTGTGAAAGAGCTGCTGGGGATCACCATCATGGAAAGAAGC AGCTTCGAGAAGAATCCCATCGACTTTCTGGAAGCCAAGGGCTACAAAGA AGTGAAAAAGGACCTGATCATCAAGCTGCCTAAGTACTCCCTGTTCGAGC TGGAAAACGGCCGGAAGAGAATGCTGGCCTCTGCCGGCGAACTGCAGAAG GGAAACGAACTGGCCCTGCCCTCCAAATATGTGAACTTCCTGTACCTGGC CAGCCACTATGAGAAGCTGAAGGGCTCCCCCGAGGATAATGAGCAGAAAC AGCTGTTTGTGGAACAGCACAAGCACTACCTGGACGAGATCATCGAGCAG ATCAGCGAGTTCTCCAAGAGAGTGATCCTGGCCGACGCTAATCTGGACAA AGTGCTGTCCGCCTACAACAAGCACCGGGATAAGCCCATCAGAGAGCAGG CCGAGAATATCATCCACCTGTTTACCCTGACCAATCTGGGAGCCCCTGCC GCCTTCAAGTACTTTGACACCACCATCGACCGGAAGAGGTACACCAGCAC CAAAGAGGTGCTGGACGCCACCCTGATCCACCAGAGCATCACCGGCCTGT ACGAGACACGGATCGACCTGTCTCAGCTGGGAGGCGAC Fragment 7 (535 bp) (SEQ ID NO: 13) GGCCTGTACGAGACACGGATCGACCTGTCTCAGCTGGGAGGCGACAAAAG GCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGTAAGAAT TCCTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCAT CTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACT CCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAG TAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGG AGGATTGGGAAGAGAATAGCAGGCATGCTGGGGAGCGGCCGCAGGAACCC CTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGA GGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCT CAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGGGCGCCTATCGAATTCC TGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCC

[0426] To reconstruct the CRISPR/Cas system described in Cong et al the above DNA fragments in addition to EcoRV linearised pBlueScript KS+vector will be assembled using Gibson Assembly kit (NEB Cat No. E5510S). As an alternative approach, the 6006 bp fragment can be assembled by assembly PCR by mixing molar ratio of the individual DNA fragments together and using the DNA mixture as PCR template. The assembled PCR product can then be cloned directly into pBlueScript vector or a standard cloning vector system such as a TOPO TA cloning kit (Invitrogen).

B: Reconstructing CRISPR/Cas Vector System (D10A Nickase)

[0427] The D10A nickase version of the CRISPR/Cas system can be conveniently reconstructed by assembling the above fragments where fragment 2 is replaced with fragment 2A which contains the D10A substitution (See sequence below)

TABLE-US-00003 Fragment 2A (852 bp) (SEQ ID NO: 14) ATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTA CAAAGACGATGACGATAAGATGGCCCCAAAGAAGAAGCGGAAGGTCGGTA TCCACGGAGTCCCAGCAGCCGACAAGAAGTACAGCATCGGCCTGgccATC GGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCC CAGCAAGAAATTCAAGGTGCTGGGCAACACCGACCGGCACAGCATCAAGA AGAACCTGATCGGAGCCCTGCTGTTCGACAGCGGCGAAACAGCCGAGGCC ACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGAAGAACCG GATCTGCTATCTGCAAGAGATCTTCAGCAACGAGATGGCCAAGGTGGACG ACAGCTTCTTCCACAGACTGGAAGAGTCCTTCCTGGTGGAAGAGGATAAG AAGCACGAGCGGCACCCCATCTTCGGCAACATCGTGGACGAGGTGGCCTA CCACGAGAAGTACCCCACCATCTACCACCTGAGAAAGAAACTGGTGGACA GCACCGACAAGGCCGACCTGCGGCTGATCTATCTGGCCCTGGCCCACATG ATCAAGTTCCGGGGCCACTTCCTGATCGAGGGCGACCTGAACCCCGACAA CAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGC TGTTCGAGGAAAACCCCATCAACGCCAGCGGCGTGGACGCCAAGGCCATC CTGTCTGCCAGACTGAGCAAGAGCAGACGGCTGGAAAATCTGATCGCCCA GCTGCCCGGCGAGAAGAAGAATGGCCTGTTCGGAAACCTGATTGCCCTGA GC

[0428] The substituted aspartate to alanine is highlighted in bold and underlined.

C: Target (Spacer) Sequence Cloning

[0429] The target spacer sequence can be cloned into the above CRISPR/Cas vector system via the BbsI restriction sites located upstream of the chimeric guided RNA sequence. The spacer sequence can be ordered as oligo pairs and annealed together with overhangs as shown below to allow direct cloning into BbsI linearised CRISPR/Cas vector using standard molecular biology protocols.

[0430] Sequence of an example oligo pair with spacer sequence:

TABLE-US-00004 (SEQ ID NO: 15) 5′ - CACCGNNNNNNNNNNNNNNNNNNN - 3′ (SEQ ID NO: 16) 3′ - CNNNNNNNNNNNNNNNNNNNCAAA - 5′

[0431] The 4 bp overhang sequence underlined is required to be included in the spacer oligos to facilitate cloning into the BbsI restriction site in the CRISPR/Cas vector. Using this approach, any spacer sequence can he conveniently cloned into the CRISPR/Cas vector.

D: Reconstructing CRISPR/Cas System for One-Step Generation of Transgenic Animals

[0432] In order to reconstitute a CRISPR/Cas system for one-step generation of transgenic animal as described in Wang et al. (Wang H., Yang H., Shivalila C. S., Dawlaty M. M., Cheng A. W., Zhang F., Jaenisch R.: One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell, 2013, 153(4):910-918) where direct embryo injection is used, the above detailed CRISPR/Cas vector system needs to be modified to incorporate a T7 polymerase promoter to the Cas) coding sequence. In addition, the gRNA needs to be removed and synthetised separately by annealing oligos or produced synthetically (See below for an example T7-spacer sequence fused to chimeric guided RNA sequence—T7-gRNA). Note, ideally the spacer sequence will be designed in a unique region of a given chromosome to minimise off-target effect and also the respective protospacer genomic sequence needs to have a PAM at the 3′-end.

TABLE-US-00005 Example T7-gRNA Sequence (SEQ ID NO: 17) TTAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGC TAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT GGCACCGAGTCGGTGCTTTTTT

[0433] The underlined 20 bp of N's depicts the spacer sequence for a given target DNA.

[0434] To reconstruct the one-step CRISPR/Cas system, the above detailed DNA fragments (Fragments 2, 3, 4, 5, 6 & 7) can be assembled together where fragment 1A (containing 45 bp homology to pBlueScript KS+vector 5′ to the EcoRV restriction site, human U6 promoter, BbsI restriction sites, chimeric guided RNA sequence and chicken b-actin promoter) is replaced with fragment 1, which only contains 45 bp homology to pBlueScript KS+vector and the DNA sequence for T7 polymerase promoter with 45 bp homology to fragment 2. This will create the nuclease version of the CRISPR/Cas system for one-step generation of transgenic animals. To create the nickase version, fragment 2 can be replaced with fragment 2A as detailed above and then fragments 1, 2A, 3, 4, 5, 6 and 7 can be assembled together either by Gibson assembly or by assembly PCR.

TABLE-US-00006 Fragment 1 (111 bp) (SEQ ID NO: 18) GGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATAATAC GACTCACTATAGGGAGAATGGACTATAAGGACCACGACGGAGACTACAAG GATCATGATATT

E: Preparation of Oligo/DNA Fragments for HDR-Mediated Repair

[0435] DNA oligos ranging from 15 bp and upwards in excess of >125 bp will be synthetised through Sigma Custom Oligo synthesis Service. The oligos can contain any sequence such as a defined mutation, introduced restriction sites or a sequence of interest including recombination recognition sequence such as loxP or derivatives thereof, Frt and derivatives thereof or PiggyBac LTR or any other transposon elements or regulatory elements including enhancers, promoter sequence, reporter gene, selection markets and tags. The oligo design will incorporate DNA homology to the region where Cas9 mediates double-stranded DNA break or DNA nick. The size of the homology will range from a few base pairs (2-5 bp) to upwards and in excess of 80 bp. Larger DNA fragments (>100 bp ranging up to several kilobases) will be prepared either synthetically (GeneArt) or by PCR. The DNA fragment will be synthetised either with or without flanked NLS or only with a single NLS and either with or without a promoter (e,g, T7 polymerase promoter). The DNA can be prepared as a single stranded DNA fragment using either the capture biotinylated target DNA sequence method (Invitrogen: Dynabeads M-270 Streptavidin) or any other standard and established single stranded DNA preparation methodology. The single stranded DNA can be prepared for microinjection by IVT as described above and the mRNA co-injected with Cas9 mRNA and gRNA. The DNA fragment can also be co-injected as a double stranded DNA fragment. The DNA fragment will be flanked by DNA homology to the site where Cas9 mediates double-stranded DNA break or DNA nick. The DNA homology can range from a few base pairs (2-5 bp) and up to or in excess of several kilobases. The DNA fragment can be used to introduce any endogenous or exogenous DNA.

[0436] HDR-mediated repair can also be done in ES cells following CRISPR/Cas-mediated DNA cleavage. The above mentioned donor oligo or DNA fragment can be co-transfected into ES cells along with the CRISPR/Cas expression vector.

F: Production of Cas9 mRNA and gRNA

[0437] Vector containing the T7 polymerase promoter with the coding region of humanised Cas9 will be PCR amplified using oligos Cas9-F and Cas9-R, The T7-Cas9 PCR product can be gel extracted and the DNA purified using Qiagen gel extraction kit. The purified T7-Cas9 DNA will be used for in vitro transcription (IVT) using mMESSAGE mMACHINE T7 Ultra Kit (Life Technologies Cat No. AM1345). The vector containing the T7-gRNA can be PCR amplified using oligos gRNA-F and gRNA-R and once again the PCR products gel purified, IVT of the T7-gRNA will be carried out using MEGAshortscript T7 Kit (Life Technologies Cat No. AMI354) and the gRNA purified using MEGAclear Kit (Life Technologies Cat No. AM1908) and eluted in RNase-free water.

TABLE-US-00007 (SEQ ID NO: 19) Cas9-17: TTAATACGACTCACTATAGG (SEQ ID NO: 20) Cas9-R: GCGAGCTCTAGGAATTCTTAC (SEQ ID NO: 21) gRNA-F: TTAATACGACTCACTATAGG (SEQ ID NO: 22) gRNA-R: AAAAAAGCACCGACTCGGTGCCAC

Example 5B

One Step Generation of Transgenic Animals

A: ES Cell Transfection Procedure

[0438] Mouse embryonic stem cells AB2.1 and derivatives of this line will be used for transfecting the mammalian codon optimised Cas9 and sgRNA from a single expression vector or from separate vectors if desired. AB2.1 ES cells will be cultured on a PSNL76/7/4 MEF feeder layer in M-15: Knockout DMEM (Gibco, no pyruvate, high glucose. 15% FBS, 1×GPS, 1×BME) with standard ES cell culturing techniques. Transfection of CRISPR/Cas expression vector along with the optional addition of a donor oligo or DNA fragment will be done by electroporation using the Amaxa 4D-Nucleofector® Protocol (Lonza). A plasmid expressing PGK-Puro will also be optionally co-transfected to promote transfection efficiency.

[0439] In one method, after transfection ES cells will be plated back onto feeder plates and Puromycin (2 μg/ml) will be added 72 hours post transfection for 7 days after which colonies will be picked and genotyped by PCR. Positive colonies will be further cultured and expanded on feeder layer and selection markers where necessary will be excised using a PiggyBac transposon system. This will be done by electroporation of ES cells with a plasmid containing HyPbase using the Amaxa 4D-Nucleofector® Protocol (Lonza). The ES cell will be plated back onto feeder plates. ES cells will be passaged 2-3 clays post transfection and after a further 2-3 days the ES cells will be plated out at different cells densities (1:10, 1:20, 1:100 and 1:300) and FIAU (2 μg/ml) selection will be added 24 hours after replating. Colonies will be picked and analysed by PCR genotyping after 7-10 days on selection media. Positive clones will be further cultured and expanded on feeder layer and sent for zygote (blastocyst) microinjection.

[0440] In an alternative method, 8 hours prior to transfection ES cells are seeded at a density of 0.5×106 cells using antibiotic free M-15 Knockout DMEM (Gihco, no pyruvate, high glucose, 15% FBS, 1×L-Glutamine, 1×BME) onto 6w feeder plates. Transient transfection is performed using Lipofectamine® LTX Reagent with PLUS™ Reagent (Invitrogen™) by standard protocol. After incubation time transfection reagents are transferred to feeder plates (cultured in antibiotic free media), media (M-15) will not be changed on these plates for at least 24 hours post transfection. 48 hours post transfection ES cells are trypsinized into a single cell suspension and a cell count is carried out and cells are plated out at different cell densities ranging for 100-5000 cells per 10 cm feeder plate. 24 hours after replating Puro selection at 2 μg/ml (Puromycin dihycirochloride from Streptomyces alboniger powder, P8833 Sigma) is applied to the cells for 4 days, after which cells are cultured again in M-15. Colonies are picked 10-13 days post transfection.

Method 5C: Microinjection of Mouse Zygotes—Method 1

Materials and Regents:

[0441] M2 (Sigma M7167) [0442] Embryo Max KSOM (Speciality media MR-020P-F) [0443] Hyaluronidase (Sigma 144272) [0444] Mineral Oil (Sigma, M-8410)

Possible Donor Strains:

[0445] S3F/S3F; KF3/KF3 [0446] S3F/S3F; K4/K4 [0447] S7F/S7F [0448] K5F/K5F

Preparation of Zygotes and Microinjection:

[0449] The protocol is as described in: A. Nagy Et al, Manipulating the Mouse Embryo 3rd Edition. Chapter 7, Protocols 7-1, 7-6, 7-10, 7-11. Cold Spring Harbor Laboratory Press.

[0450] In brief: [0451] 1. Zygotes are harvested from E0.5dpc (day post-coitum) superovulated female mice. [0452] 2. The zygotes are incubated in hyaluronidase to disperse cumulus cells. [0453] 3. Zygotes are collected and transferred to several drops of M2 medium to rinse off the hyaluronidase solution and debris. Zygotes are placed into KSOM Media and incubated at 37° C., 5% CO.sub.2 until required. [0454] 4. Zygote quality is assessed and zygotes with normal morphology are selected for injection, these are placed in KSOM media and incubated at 37° C., 5% CO.sub.2 until required.

Microinjection Set Up:

[0455] Injection procedures are performed on a Nikon Eclipse Ti inverted microscope with Eppendorf micromanipulators and an Eppendorf femtojet injection system. A slide is prepared by adding a large drop ˜200 microlitres of M2 into the centre.

Microinjection:

[0456] Place an appropriate number of zygotes onto the slide. Examine the zygotes and select only those with normal morphology (2 distinct pronuclei are visible). Whilst holding a zygote with a male pronucleus closest to the injection pipette, carefully push the injection pipette through the zona pellucida into the pronucleus, apply injection pressure, the pronucleus should visibly swell, remove the injection pipette quickly. The injected zygote can be placed down while the rest are injected.

[0457] At the end of the injection session all viable injected zygotes should be placed into prepared dishes containing drops of KSOM and incubated until ready to surgicall implant. They are incubated for 2-3 hours before surgically implanting into pseudo pregnant females. Pups will be born 21 days later.

Method 5C: Microinjection of Mouse Zygotes Method 2

Materials And Reagents

[0458] PMSG [0459] hCg [0460] M2 (Sigma M7167) [0461] Embryo Max KSOM (Specialty media MR-020P-F) [0462] Mineral Oil (Sigma, M-8410) [0463] Hyluronidase (Sigma H 4272) [0464] 35 mm Falcon Petri dishes (Fisher 08-757-100A) [0465] Sharp scissors [0466] Sharp watchmakers forceps

Preparation of Oocytes:

[0467] 1. Day 0: Give PMSG (5 I.U.) to the females by I. P. injection. [0468] 2. Day 2: Give hCG (5 I.U.) to the females 48 Hours later by 1. P. injection. Mate the females to stud males. [0469] 3. Day 3: Check plugs, sacrifice plugged female mice by CO2 asphyxiation or cervical dislocation at 0.5dpc at 8.00 am. [0470] 4. Dissect open the abdomen, locate the ovary and fat pad, dissect out the oviduct leaving the ovary and fat, trimming the uterine horn to ˜1 cm, place into a 35 mm Petri dish containing M2 at room temp. [0471] 5. Place one ovary at a time into a dish containing hyaluronidase solution in M2 (˜0.3 mg/ml) at room temp. View through a stereoscope at 20× or 40× magnification. [0472] 6. Use one pair of forceps to grasp the oviduct and hold it on the bottom of the dish. Use the second pair of forceps or a 26 g needle to tear the oviduct close to where the zygotes are located (the ampulla), releasing the clutch of cumulus cells. [0473] 7. The zygotes should be left in the hyaluronidase for a few minutes only, after which time the zygotes may become damaged. If necessary pipette them up and down a few times to help the release of the zygotes from the cumulus cells. [0474] 8. Use a mouth pipette to pick up the zygotes and transfer them to a fresh dish of M2, then transfer through several drops of M2 to rinse off the hyaluronidase, cumulus cells and debris. Sort through the zygotes removing any obviously bad ones (fragmented, misshapen, not fertilized), and place the good ones (two polar bodies should be visible and any with polar bodies) into equilibrated drops of KSOM+ AA at 37° c. and 5% CO.sub.2, keep incubated until needed. Place about 50 eggs per drop.

Pronuclear Microinjection

[0475] 1. Microinjection set up: Injection procedures are performed on a Nikon Eclipse Ti inverted microscope with Eppendorf micromanipulators. Prepare a 60 mm petri dish to place injected zygotes into. Pipette four-six 4.0 μl drops of KSOM+AA, cover with oil and place in a 5% CO.sub.2 incubator to equilibrate. Prepare a cavity slide by making a large (˜200 μl) drop of M2 media onto the center of the well, add a small drop of medium on the left side of the slide, for the holding pipette. [0476] 2. Microinjection: Ensure that the pressurized injector has been switched on and is ready to use. Place an appropriate number of zygotes onto the slide, do not add more zygotes than can be injected within 20-30mins. Place the holding pipette into the drop of M2 on the left of the slide; it will fill using capillary action, once filled to about the shoulder attach to the manipulator. Carefully examine the zygotes, making sure that two pronuclei are visible and morphology is good, discard any that appear abnormal. To test if the injection needle is open, place the tip near to but not touching a zygote in the same focal plane. Apply pressure using the pressurized system, if the zygote moves the needle is open, if it doesn't the needle is closed. In this case apply pressure using the “clear’ feature, if the tip is still not open manually break the tip. Carefully “knock” the tip on the holding pipette and repeat the above test, make sure the tip does not become too large, if this happens replace the needle and start again. Place the tip of the holding pipette next to a zygote and suck it onto the end of the pipette by applying negative pressure. Focus the microscope to locate the pronuclei, the zygote should be positioned in such a way that allows injection into the zygote without hitting the pronuclei, preferably with a gap between the zona pellucida and the oolema. Bring the tip of the injection needle into the same focal plane as the zona pellucida. Bring the injection pipette to the same y-axis position as the zona pellucida, adjust the height of the needle so the tip appears completely sharp, without changing the focus. This ensures the needle will target the zygote exactly. Push the injection pipette through the zona pellucida, through the cytoplasm towards the back of the zygote. The needle will create a “bubble” through the oolenia, this needs to be broken, you will see it snap back at which point remove the needle quickly, you will see the cytoplasm moving to indicate RNA is flowing from the needle. Cytoplasmic granules flowing out of the oocytes after removal of the injection pipette is a clear sign that the zygote will soon lyse. In this case, or if nuclear/cytoplasmic components are sticking to the injection pipette, the oocytes should be discarded after injection. If the zygote appears to be intact and successfully injected, sort this into a good group. Pick a new zygote for injection. The same injection pipette can be used as long as it continues to inject successfully. Switch to a new injection pipette if (a) you cannot see any cytoplasmic distortion (b) zygotes are lysing one after the other; (c) the tip of the pipette becomes visibly “dirty” or nuclear contents stick to the pipette. Once all the zygotes have been injected, remove them and place them into the equilibrated KSOM+AA and place them into the incubator at 37° C. overnight. Only transfer those zygotes that have survived injection, and cultured to the 2 cell stage. Leave any lysed ones, and zygotes that have not developed. [0477] 3. Count the total number injected and record the numbers transferred per recipient

Results

[0478] To demonstrate the efficient of the one-step generation of transgenic mice, we used our T7-Cas9 nuclease vector to generate mRNA via in vitro transcription detailed above. mRNA from the guide RNA was also produced using in vitro transcription described above. Before injecting the mRNA mixture into the cytoplasm, oocytes were prepared from female mice using the protocol detailed above. An mRNA mixture containing 100 ng/ul Cas9 nuclease mRNA and 50 ng/ul guide mRNA was injected by microinjection into the cytoplasm as detailed above. The microinjection is done at the single-cell stage. Zygotes that survived the injection were cultured to 2 cell stage, which were then transferred to recipient mice.

[0479] In total, 107 zygotes were injected from which 49 survived and went to 2 cell stage. These were then transferred to two recipient female mice. This resulted in 19 pups from 2 litters. Litter 1 yielded 3 males and 6 females. Litter 2 yielded 4 males and 6 females. The pups were ear clipped 3 weeks after birth and DNA was extracted. PCR was carried out using oligos flanking the gRNA to detect possible indels (FIG. 14).

[0480] PCR amplifying around the guide RNA and separating out the PCR products on an agarose gel highlighted at least one mouse contained a large indel in the form of a deletion, whereas other mice appeared to have smaller indels judging by the sharpness of the PCR product on the gel. As an initial crude analysis, all the PCR products were sent for sequencing and those marked with an asterix (7 mice in total, FIG. 14) yielded mix sequences around the gRNA further confirming they contain indels. To confirm this, the PCR products from these 7 mice together with the PCR product from another mouse which did not yield a mix sequence (PCR product from lane 19, FIG. 14) were individually cloned into a general cloning vector. From each individual cloning, 28 clones were picked and analysed by sequencing. The sequencing confirmed all 7 mice contain indels and the mice that did not contain any mix sequence contained no indels. The sequencing data is summarised in FIG. 15.

[0481] The sequencing data confirmed all of the mice analysed contained indels. It also suggests that using our zygote injection protocol detailed above and our method for preparing mRNA for Cas9 and guide RNA, Cas9 works efficiently at an early stage and until the point where cells starts to divide beyond the 2 cell stage judging by the fact that in all of the mice analysed, no more than 3 types of indels were identified. Out of the 7 mice containing indels, 3 of them had no detectable WT sequence. The female mouse (KMIKY6.1j) that did not show mix sequence from the initial sequencing analysis indeed did not contain any indels so it validates our initial sequencing analysis of the PCR products.

[0482] The male mouse (KMKY5.1c) that showed no WT sequence was used as a mating partner for the two female mice (KMKY5.1e & KMKY6.1e) that showed no WT sequence too. The resulting pups from the two matings yielded 14 pups in total from the first litter. Following similar sequencing analysis whereby PCR products amplified from the region around the guide RNA were cloned individual and several clones were then analysed for the presence of indels. For each mouse, 24 clones were analysed by sequencing. The sequencing data from all 14 pups confirmed only two indel sequences reflecting the two alleles arising from the parental male and female mouse. This data unequivocally demonstrates that our one-step genome editing protocol works very efficiently at an early stage and not beyond the 2 cell stage thus avoiding complex mosaic indel formation. Using our established protocol, we can carry out define deletions directly in zygotes or carry out define deletion followed by insertion to expedite the process of generating transgenic mice to homozygosity in record time.

Example 6

Single Copy Cas9 Expression in ES Cells

[0483] Reference is made to FIG. 6B. [0484] 1. A landing pad consisting of a PiggyBac transposon element with the following features will be targeted into mouse ES cells (e.g., 129-derived ES cells, such as AB2.1 ES cells; Baylor College of Medicine, Texas, USA) and selected for on G418. The PiggyBac transposon element will contain neomycin resistance gene flanked by loxP and lox2272. It will also have a geneless PGK promoter. In this example, the landing pad will be targeted into the introgenic region of Rosa26 gene located on chromosome 6, but it could be targeted elsewhere. Targeting this landing pad in the Rosa26 gene will provide a universal ES cell line for precisely inserting any desired DNA fragment including DNA fragments containing Cas9. mutant Cas9 or any other gene of interest via RMCE with high efficiency. Targeting Rosa26is beneficial since the targeted construct will be inserted as a single copy (unlike random integration elsewhere) and is unlikely to produce an unwanted phenotypic effect.

[0485] Note. This landing pad can be inserted into any gene in any chromosome or indeed in any eukaryotic or mammalian cell line, e.g., a human, insect, plant, yeast, mouse, rat, rabbit, rodent, pig, dog, cat, fish, chicken or bird cell line, followed by generation of the respective transgenic organism expressing Cas9.

Rosa 26 Locus

[0486] Ubiquitous expression of transgene in mouse embryonic stein cell can be achieved by gene targeting to the ROSA26 locus (also known as: gene trap ROSA 26 or Gt(ROSA)26) by homologous recombination (Ref. (a) and (b) below). The genomic coordinates for mouse C57BL/6J Rosa26 gene based on Ensemble release 73—September 2013 is: Chromosome 6: 113,067,428-13,077,333; reverse strand.

[0487] The Rosa26 locus can also be used to as a recipient location to knock-in a transgene. In our example we have use the Rosa26 locus to knock-in the landing pad vector by targeting through homologous recombination into the intronic region located between exons 2 and 3 of mouse strain 129-derived embryonic stem cells using approx. 3.1 kb homology arms. The homology arms were retrieved by recoinbineering from a BAC Clone generated from mouse strain 129. The sequence of the Rosa26 homology arms used for targeting is given below.

TABLE-US-00008 Sequence of Rosa26 5′ homology arm (SEQ ID NO: 23) CACATTTGGTCCTGCTTGAACATTGCCATGGCTCTTAAAGTCTTAATTAA GAATATTAATTGTGTAATTATTGTTTTTCCTCCTTTAGATCATTCCTTGA GGACAGGACAGTGCTTGTTTAAGGCTATATTTCTGCTGTCTGAGCAGCAA CAGGTCTTCGAGATCAACATGATGTTCATAATCCCAAGATGTTGCCATTT ATGTTCTCAGAAGCAAGCAGAGGCATGATGGTCAGTGACAGTAATGTCAC TGTGTTAAATGTTGCTATGCAGTTTGGATTTTTCTAATGTAGTGTAGGTA GAACATATGTGTTCTGTATGAATTAAACTCTTAAGTTACACCTTGTATAA TCCATGCAATGTGTTATGCAATTACCATTTTAAGTATTGTAGCTTTCTTT GTATGTGAGGATAAAGGTGTTTGTCATAAAATGTTTTGAACATTTCCCCA AAGTTCCAAATTATAAAACCACAACGTTAGAACTTATTTATGAACAATGG TTGTAGTTTCATGCTTTTAAAATGCTTAATTATTCAATTAACACCGTTTG TGTTATAATATATATAAAACTGACATGTAGAAGTGTTTGTCCAGAACATT TCTTAAATGTATACTGTCTTTAGAGAGTTTAATATAGCATGTCTTTTGCA ACATACTAACTTTTGTGTTGGTGCGAGCAATATTGTGTAGTCATTTTGAA AGGAGTCATTTCAATGAGTGTCAGATTGTTTTGAATGTTATTGAACATTT TAAATGCAGACTTGTTCGTGTTTTAGAAAGCAAAACTGTCAGAAGCTTTG AACTAGAAATTAAAAAGCTGAAGTATTTCAGAAGGGAAATAAGCTACTTG CTGTATTGTTGAAGGAAAGTGTAATAGCTTAGAAAATTTAAAACCATATA GTTGTCATTGCTGAATATCTGGCAGATGAAAAGAAATACTCAGTGGTTCT TTTGAGCAATATAACAGCTTGTTATATTAAAAATTTTCCCCACAGATATA AACTCTAATCTATAACTCATAAATGTTACAAATGGATGAAGCTTACAAAT GTGGCTTGACTTGTCACTGTGCTTGTTTTAGTTATGTGAAAGTTTGGCAA TAAACCTATGTCCTAAATAGTCAAACTGTGGAATGACTTTTTAATCTATT GGTTTGTCTAGAACAGTTATGTTGCCATTTGCCCTAATGGTGAAAGAAAA AGTGGGGAGTGCCTTGGCACTGTTCATTTGTGGTGTGAACCAAAGAGGGG GGCATGCACTTACACTTCAAACATCCTTTTGAAAGACTGACAAGTTTGGG TCTTCACAGTTGGAATTGGGCATCCCTTTTGTCAGGGAGGGAGGGAGGGA GGGAGGCTGGCTTGTTATGCTGACAAGTGTGATTAAATTCAAACTTTGAG GTAAGTTGGAGGAACTTGTACATTGTTAGGAGTGTGACAATTTGGACTCT TAATGATTTGGTCATACAAAATGAACCTAGACCAACTTCTGGAAGATGTA TATAATAACTCCATGTTACATTGATTTCACCTGACTAATACTTATCCCTT ATCAATTAAATACAGAAGATGCCAGCCATCTGGGCCTTTTAACCCAGAAA TTTAGTTTCAAACTCCTAGGTTAGTGTTCTCACTGAGCTACATCCTGATC TAGTCCTGAAAATAGGACCACCATCACCCCCAAAAAAATCTCAAATAAGA TTTATGCTAGTGTTTCAAAATTTTAGGAATAGGTAAGATTAGAAAGTTTT AAATTTTGAGAAATGGCTTCTCTAGAAAGATGTACATAGTGAACACTGAA TGGCTCCTAAAGAGCCTAGAAAACTGGTACTGAGCACACAGGACTGAGAG GTCTTTCTTGAAAAGCATGTATTGCTTTACGTGGGTCACAGAAGGCAGGC AGGAAGAACTTGGGCTGAAACTGGTGTCTTAAGTGGCTAACATCTTCACA ACTGATGAGCAAGAACTTTATCCTGATGCAAAAACCATCCAAACAAACTA AGTGAAAGGTGGCAATGGATCCCAGGCTGCTCTAGAGGAGGACTTGACTT CTCATCCCATCACCCACACCAGATAGCTCATAGACTGCCAATTAACACCA GCTTCTAGCCTCCACAGGCACCTGCACTGGTACACATAATTTCACACAAA CACAGTAAGAAGCCTTCCACCTGGCATGGTATTGCTTATCTTTAGTTCCC AACACTTGGGAGGCAGAGGCCAGCCAGGGCTATGTGACAAAAACCTTGTC TAGAGGAGAAACTTCATAGCTTATTTCCTATTCACGTAACCAGGTTAGCA AAATTTACCAGCCAGAGATGAAGCTAACAGTGTCCACTATATTTGTAGTG TTTTAAGTCAATTTTTTAAATATACTTAATAGAATTAAAGCTATGGTGAA CCAAGTACAAACCTGGTGTATTAACTTGAGAACTTAGCATAAAAAGTAGT TCATTTGTTCAGTAAATATTAAATGCTTACTGGCAAAGATTATGTCAGGA ACTTGGTAAATGGTGATGAAACAATCATAGTTGTACATCTTGGTTCTGTG ATCACCTTGGTTTGAGGTAAAAGTGGTTCCTTTGATCAAGGATGGAATTT TAAGTTTATATTCAATCAATAATGTATTATTTTGTGATTGCAAAATTGCC TATCTAGGGTATAAAACCTTTAAAAATTTCATAATACCAGTTCATTCTCC AGTTACTAATTCCAAAAAGCCACTGACTATGGTGCCAATGTGGATTCTGT TCTCAAAGGAAGGATTGTCTGTGCCCTTTATTCTAATAGAAACATCACAC TGAAAATCTAAGCTGAAAGAAGCCAGACTTTCCTAAATAAATAACTTTCC ATAAAGCTCAAACAAGGATTACTTTTAGGAGGCACTGTTAAGGAACTGAT AAGTAATGAGGTTACTTATATAATGATAGTCCCACAAGACTATCTGAGGA AAAATCAGTACAACTCGAAAACAGAACAACCAGCTAGGCAGGAATAACAG GGCTCCCAAGTCAGGAGGTCTATCCAACACCCTTTTCTGTTGAGGGCCCC AGACCTACATATTGTATACAAACAGGGAGGTGGGTGATTTTAACTCTCCT GAGGTAC Sequence of Rosa26 3′ homology arm (SEQ ID NO: 24) CTTGGTAAATCTTTGTCCTGAGTAAGCAGTACAGTGTACAGTTTACATTT TCATTTAAAGATACATTAGCTCCCTCTACCCCCTAAGACTGACAGGCACT TTGGGGGTGGGGAGGGCTTTGGAAAATAACGCTTCCATACACTAAAAGAG AAATTTCTTTAATTAGGCTTGTTGGTTCCATACATCTACTGGTGTTTCTA CTACTTAGTAATATTATAATAGTCACACAAGCATCTTTGCTCTGTTTAGG TTGTATATTTATTTTAAGGCAGATGATAAAACTGTAGATCTTAAGGGATG CTTCTGCTTCTGAGATGATACAAAGAATTTAGACCATAAAACAGTAGGTT GCACAAGCAATAGAATATGGCCTAAAGTGTTCTGACACTTAGAAGCCAAG CAGTGTAGGCTTCTTAAGAAATACCATTACAATCACCTTGCTAGAAATCA AGCATTCTGGAGTGGTCAAGCAGTGTAACCTGTACTGTAAGTTACTTTTC TGCTATTTTTCTCCCAAAGCAAGTTCTTTATGCTGATATTTCCAGTGTTA GGAACTACAAATATTAATAAGTTGTCTTCACTCTTTTCTTTACCAAGGAG GGTCTCTTCCTTCATCTTGATCTGAAGGATGAACAAAGGCTTGAGCAGTG CGTTTAGAAGATAAACTGCAGCATGAAGGCCCCCGATGTTCACCCAGACT ACATGGACCTTTCGCCACACATGTCCCATTCCAGATAAGGCCTGGCACAC ACAAAAAACATAAGTCATTAGGCTACCAGTCTGATTCTAAAACAACCTAA AATCTTCCCACTTAAATGCTATGGGTGGTGGGTTGGAAAGTTGACTCAGA AAATCACTTGCTGTTTTTAGAGAGGATCTGGGTTCAGTTTCTGATACATT GTGGCTTACAACTATAACTCCAGTTCTAGGGGGTCCATCCAACATCCTCT TCTGTTGAGGGCACCAAATAAATGTATTGTGTACAAACAGGGAGGTGAGT GATTTAACTCTCGTGTATAGTACCTTGGTAAAACATTTCTTGTCCTGAGT AAGCAGTACAGCTCTGCCTGTCCCTGGTCTACAGACACGGCTCATTTCCC GAAGGCAAGCTGGATAGAGATTCCAATTTCTCTTCTTGGATCCCATCCTA TAAAAGAAGGTCAAGTTTAATCTATTGCAAAAGGTAAATAGGTAGTTTCT TACATGAGACAAGAACAAATCTTAGGTGTGAAGCAGTCATCTTTTACAGG CCAGAGCCTCTATTCTATGCCAATGAAGGAAACTGTTAGTCCAGTGTTAT AGAGTTAGTCCAGTGTATAGTTTTCTATCAGAACACTTTTTTTTTAAACA ACTGCAACTTAGCTTATTGAAGACAAACCACGAGTAGAAATCTGTCCAAG AAGCAAGTGCTTCTCAGCCTACAATGTGGAATAGGACCATGTAATGGTAC AGTGAGTGAAATGAATTATGGCATGTTTTTCTGACTGAGAAGACAGTACA ATAAAAGGTAAACTCATGGTATTTATTTAAAAAGAATCCAATTTCTACCT TTTTCCAAATGGCATATCTGTTACAATAATATCCACAGAAGCAGTTCTCA GTGGGAGGTTGCAGATATCCCACTGAACAGCATCAATGGGCAAACCCCAG GTTGTTTTTCTGTGGAGACAAAGGTAAGATATTTCAATATATTTTCCCAA GCTAATGAGATGGCTCAGCAAATAATGGTACTGGCCATTAAGTCTCATGA CCTGAGCTTGATCCTCAGGGACCATGTGGTACAAGGAGAGACCTAAATCC TTCAGTTGGACTTCAATCTTCTACCCTCATGTCCACACACAAATAAATAC AATAAAAAACATTCTGCAGTCTGAATTTCTAAAGGTTGTTTTTCTAAAAA GAAATGTTAAAGTAACATAGGAAGAAATATGTCCATAACTGAAATACAAG TTTTTTAAATGGTTAAGACTGGTTTTCAAAGGATGTATGGTTAAGAAAAT ACCAGGGAAAATGAGCTTACATGTAAAAAAGTGTCTAAAAGGCCAGAGAA ATGACCCAGCTGGCAAAGGTGTCTGCCCTAAGCCAGACAAAAGGAATTTG ATTCACAGGAAGAAGAGACCCAACTCTCACTAGTTATCCTCTGACTTCCA CACCATGACACAGCTCCATGGCACTCTCAGGCCCCCACACATATACAGAT ATAAACAGAAACCTAATCCACCAGCCTTCAGAAGCAAAGCAATTGGAGGA TTTAAACAGGCCATGGCTACTAATAGAGATAACTGGTAGTTTAAAAGTTA TGGTAATGACTTTCATGCTTCTTTCAACTCATATTGTTCTAAATAATTAA TTTGGTTTTTCAAGGCAGGGTTTCTCTGTGTAGTTCTGGCTGTCCTGGAA CTCACTCTGTAGACCAGGCTGGCCTTGAACTCAGATCCATCTGCCTCTGG AATAAGGGCACGTGCGTGCCTTTTCTACATAACAAAACCTATACTATAAC AAAACCTATACCATACTGTACCGTTTTGGGAAAAGACAAAAAATAATGAA CAAAAAAGGAGAAATAACATTCCAATAAAGTATGGAAATGGTAGTTAAAT TAATTACAAATGTTTTTCAGTAAATTAGATGTGACTTCTCATACTGTTCA TTTGGCTATAATGATACCACAAAGCACTGGGGGTGAATAATAATTCCAAG TCAGTAGGGAGAGAGACTTGAAAAGATGCAATGCAATCATTGAAGTTAAA CTTACCCATCTTTAATCTGGCTCTTAGTCAATAGAGATGAGATGTTATTT GCTGCTCTGTTCACTGCCAGTGGGTTATTGTCCCCAGCAATATGGTAACA GTGAGACCACTCAGTAGCCCCCTATGAGACAGGAGTGTTGGTTAAACATG CCACAAGAGAAAAGGGAAAAGTCACTATGGCCAACTCTCAGTAACATGGC AATCCGTGCCATTCATTTCCTTGCCAGAAATGTCTTCCCTGTTCTTCTGC CTACTGAACTTTCACCCACTAGAAATGTGGCTCCAATGTCATCCACTATG ACATCAATGTCAGCGCTAGAAGCACTTTGCACACCTCTGTTGCTGACTTA G

REFERENCE

[0488] a) Pablo Perez-Pinera, David G. Ousterout, Matthew T. Brown and Charles A. Gersbach (2012) Gene targeting to the ROSA26 locus directed by engineered zinc finger nucleases. Nucleic Acids Research, 2012, Vol. 40, No. 8 3741-3752 [0489] b) Peter Hohenstein, Joan Slight, Derya Deniz Ozdemir, Sally F Burn, Rachel Berry and Nicholas D Hastie (2008) High-efficiency Rosa26 knock-in vector construction for Crc-regulated overexpression and RNAi. PathoGenetics 2008, 1:3 [0490] 2. A recombinase mediated cassette exchange (RMCE)-enabled vector containing a promoterless puromycin-delta-tk with in-frame fusion of T2A at the C-terminus following by either Cas9 or mutant Cas9 nucleotide sequence and a series of unique restriction sites flanked by loxP and lox2272 will allow for the direct targeting of this vector into the landing pad by Cre-mediated RMCE. As is known, ‘T2A allows ribosomal skipping during translation. The insertion of the coding sequence of T2A between two genes results in two products (one gene, one transcript but two proteins expressed, in this case the Cas9 and selection marker). ES clones containing the correctly inserted DNA fragment can be directly selected on puromycin. This approach also advantageously ensures single copy expression of Cas9 as suppose to a random integration or transient expression approach. Insertion of the RMCE enabled vector into the desired locus containing the landing pad can be selected directly as the PGK promoter in the landing pad will drive the transcription of the promoterless Puro-Delta-Tk and Cas9. Since the Puro-delta-Tk is in the same transcriptional unit as Cas9, ES clones selected on puromycin will ensure expression of Cas9. [0491] 3. The above strategy allows for three separate approaches to express the sgRNA designed for disrupting (mutation through indel formation, deletion or deletion followed by insertion) gene of interest. [0492] a. The above ES cell line containing Cas9 can be used for generating transgenic mice with either constitutively expressed Cas9 or modified for inducible Cas9 expression or indeed tissue specific Cas9 expression for example expression of Cas9 at an embryo stage using Nanog-, Pou5fl- or SoxB promoter-specifc Cas9 expression. Such derived mouse line expressing Cas9 can he used for genome editing in a streamline fashion whereby in vitro transcribed sgRNA can be easily injected into embryos obtained from such transgenic mice. This will enhance the efficiency of generating mouse lines with the desired homozygous genotype and thus will dramatically reduce the number of animals required. [0493] b. sgRNA can be transfected directly into the ES cells expressing Cas9 and thus avoids the requirement for cloning into the RMCE enabled vector single or multiple sgRNA. This approach will allow multiple sgRNA to be inserted into the ES cells simultaneously very rapidly. [0494] c. Multiple sgRNA can be cloned directly into the multiple cloning site of the RMCE enabled vector (ie, using a plurality of different restriction endonuclease sites) to allow single copy expression of the guide-RNA. This approach may be useful for limiting off-target effects particularly relevant for those genes with high sequence homology within the genome. [0495] 4. ES cells expressing Cas9 and sgRNA can be selected for directly on medium containing puromycin. Selection on puromycin for 4-6 days will allow for the desired location to be mutated or disrupted and the advantage of manipulating ES cells is that individual clones can be analysed by PCR followed by sequencing for the desired mutation. Only correctly mutated ES cell clones can be processed further whereby inserted DNA element introduced through insertion of the landing pad and the subsequent insertion of the RMCE vector can be completely removed leaving the ES cell devoid of any alteration other than the intended mutation induced by the action of Cas9 and the sgRNA. This can be done through transiently expressing PBase transposon followed by selection on FIAU. Removal of the constitutively expressed Cas9 with only the minimal length of time required to induce mutation in the presence of sgRNA will reduce or eliminate the possibility of Cas9 inducing unwanted mutations. [0496] 5. ES Clones containing the desired mutation can be injected into blastocyst to generate transgenic mice.

TABLE-US-00009 TABLE 1 PAM conservation in repeats and leaders for various CRISPR types (reproduced from Short motif sequences determine the targets of the prokaryotic CRISPR defence system F. J. M. Mojica, C. Diez-Villasdor, J. Garcia-Martinez, C. Almendros Microbiology(2009) ,155, 733-740) Genomes* PAM CRISPR Consensus.sup.† Leaders.sup.‡ Group 1 Mth NGG ATTTCAATCCCATTTTGGTCTGATTTTAAC AGGGCGGATT ATGGCCAATT Lmo WGG ATTTACATTTCAHAATAAGTARYTAAAAC CCACTAACTT CCGCTCTATT Group 2 Eco CWT CGGTTTATCCCCGCTGGCGCGGGGAACWC TCTAAACATA TCTAAAAGTA Pae CTT CGGTTCATCCCCACRCMYGTGGGGAACAC ACTTACCGTA CCTTACCGTA Group 3 Spy GAA ATTTCAATCCACTCACCCATGAAGGGTGAGAC TGCGCCAAAT Xan GAA GTTTCAATCCACGCGCCCGTGAGGTCGCGAC CCCCCCTTAG GCCGCCAGCA Group 4 She GG TTTCTAAGCCGCCTGTGCGGCGGTGAAC AATAGCTTAT TGTAGAATAA Pae GG TTTCTTAGCTGCCTATACGGCAGTGAAC TAGCTCCGAA TAGACCAAAA Ype GG TTTCTAAGCTGCCTGTGCGGCAGTGAAC GTAAGATAAT Group 7 Sso NGG CTTTCAATTCTATAAGAGATTATC TGAGGGTTTA Mse NGG CTTTCAACTCTATAGGAGATTAAC TGATACCTTT TGAAACTTTT TGACACTCTT Group 10 Str NGG GTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAAC CTCGTAGACT CTCGTAGAAA Lis NGG GTTTTAGAGCTATGTTATTTTGAATGCTAMCAAAAC CTCGCAGAAT CTCGTAGAAT *Genomes are abbreviated according, to the denominations of the species or genera carrying the corresponding CRISPR arrays: Mth, M. thermautotyophicus; Lmo. L. monocytogenes; Eco, E. coli; Pae, P. aeruginosa; Spy, S. Pyogenes; Xan, Xanthomonas spp.; She, Shewanella spp.; Ype, Y. pestis; Sso, S. solfataricus; Mse, M. sedula; Str, Streptococcus spp.; Lis, Listeria spp. .sup.†Sequences matching the PAM are underlined. .sup.‡Representative CRISPR array proximal Leader sequences. Nucleotides matching the PAM are underlined.

[0497] SEQ ID NOs for the sequences in Table 1 are set out the table below.

TABLE-US-00010 SEQ SEQ Ge- ID ID nomes* PAM CRISPR Consens.sup.† NO. Leaders.sup.‡ NO. Group Mth NGG ATTTCAATCCCATTTTGGT 25 AGGGCGG 38 1 CTGATTTTAAC ATT 39 ATGGCCA ATT Lmo WGG ATTTTACATTTCAHATAAG 26 CCACTAA 40 TARYTAAAAC CTT 41 CCGCTCT ATT Group Eco CWT CGGTTTATCCCCGCTGGCG 27 TCTAAAC 42 2 CGGGGAACWC ATA 43 TCTAAAA GTA Pae CTT CGGTTCATCCCCACRCMYG 28 ACTTACC 44 TGGGGAACAC GTA 45 CCTTACC GTA Group Spy GAA ATTTCAATCCACTCACCCA 29 TGCGCCA 46 3 TGAAGGGTGAGAC ATT Xan GAA GTTTCAATCCACGCGCCCG 30 CCCCCCT 47 TGAGGRCGCGAC TAG 48 GCCGCCA GCA Group She GG TTTCTAAGCCGCCTGTGCG 31 AATAGCT 49 4 GCGGTGAAC TAT 50 TGTAGAA TAA Pae GG TTTCTTAGCTGCCTATACG 32 TAGCTCC 51 GCAGTGAAC GAA 52 TAGACCA AAA Ype GG TTTCTAAGCTGCCTGTGCG 33 GTAAGAT 53 GCAGTGAAC AAT Group Sso NGG CTTTCAATTCTATAAGAGA 34 TGAGGGT 54 7 TTATC TTA Mse NGG CTTTCAACTCTATAGGAGA 35 TGATACC 55 TTAAC TTT 56 TGAAACT 57 TTT TGACACT CTT Group Str NGG GTTTTAGAGCTATGCTGTT 36 CTCGTAG 58 10 TTGAATGGTCCCAAAAC ACT 59 CTCGTAG AAA Lis NGG GTTTTAGAGCTATGTTATT 37 CTCGCAG 60 TTGAATGCTAMCAAAAC AAT 61 CTCGTAG AAT

TABLE-US-00011 TABLE 2 CRISPR-Associated Endonucleases [Gene ID numbers refer to genes in the NCBI Gene Database as at September 2013; all sequence information relating to the gene IDs below is incorporated herein by reference for possible use in the present invention] 1. Plav_0099 CRISPR-associated endonuclease Csn1 family protein [Parvibaculum lavamentivorans DS-1] Other Aliases: Plav_0099 Genomic context: Chromosome Annotation: NC_009719.1 (105795 . . . 108908, complement) ID: 5454634 SEQ ID NO: 62 2. FTN_0757 membrane protein [Francisella novicida U112] Other Aliases: FTN_0757 Genomic context: Chromosome Annotation: NC_008601.1 (810052 . . . 814941) ID: 4548251 SEQ ID NO: 63 3. Cj1523c CRISPR-associated protein [Campylobacter jejuni subsp. jejuni NCTC 11168 = ATCC 700819] Other Aliases: Cj1523c Genomic context: Chromosome Annotation: NC_002163.1 (1456880 . . . 1459834, complement) ID: 905809 SEQ ID NO: 64 4. mcrA restriction endonuclease [Bifidobacterium longum DJO10A] Other Aliases: BLD_1902 Genomic context: Chromosome Annotation: NC_010816.1 (2257993 . . . 2261556) ID: 6362834 SEQ ID NO: 65 5. MGA_0519 Csn1 family CRISPR-associated protein [Mycoplasma gallisepticum str. R(low)] Other Aliases: MGA_0519 Genomic context: Chromosome Annotation: NC_004829.2 (919248 . . . 923060) ID: 1089911 SEQ ID NO: 66 6. Emin_0243 CRISPR-associated endonuclease Csn1 family protein [Elusimicrobium minutum Pei191] Other Aliases: Emin_0243 Genomic context: Chromosome Annotation: NC_010644.1 (261119 . . . 264706) ID: 6263045 SEQ ID NO: 67 7. FTW_1427 CRISPR-associated large protein [Francisella tularensis subsp. tularensis WY96-3418] Other Aliases: FTW_1427 Genomic context: Chromosome Annotation: NC_009257.1 (1332426 . . . 1335803, complement) ID: 4958852 SEQ ID NO: 68 8. SMA_1444 CRISPR-associated protein, Csn1 family [Streptococcus macedonicus ACA-DC 198] Other Aliases: SMA_1444 Annotation: NC_016749.1 (1418337 . . . 1421729, complement) ID: 11601419 SEQ ID NO: 69 9. SSUST3_1318 CRISPR-associated protein, Csn1 family [Streptococcus suis ST3] Other Aliases: SSUST3_1318 Genomic context: Chromosome Annotation: NC_015433.1 (1323872 . . . 1327240, complement) ID: 10491484 SEQ ID NO: 70 10. cas5 CRISPR-associated protein, Csn1 family [Streptococcus gallolyticus UCN34] Other Aliases: GALLO_1439 Genomic context: Chromosome Annotation: NC_013798.1 (1511433 . . . 1514825, complement) ID: 8776949 SEQ ID NO: 71 11. GALLO_1416 CRISPR-associated protein [Streptococcus gallolyticus UCN34] Other Aliases: GALLO_1446 Genomic context: Chromosome Annotation: NC_013798.1 (1518984 . . . 1523110, complement) ID: 8776185 SEQ ID NO: 72 12. csn1 CRISPR-associated endonuclease Csn1 [Bifidobacterium dentium Bd1] Other Aliases: BDP_1254 Genomic context: Chromosome Annotation: NC_013714.1 (1400576 . . . 1403992, complement) ID: 8692053 SEQ ID NO: 73 13. NMO_0348 putative CRISPR-associated protein [Neisseria meningitidis alpha 14] Other Aliases: NMO_0348 Genomic context: Chromosome Annotation: NC_013016.1 (369547 . . . 372795, complement) ID: 8221228 SEQ ID NO: 74 14. csn1 CRISPR-Associated Protein Csn1 [Streptococcus equi subsp. zooepidemicus MGCS10565] Other Aliases: Sez_1330 Genomic context: Chromosome Annotation: NC_011134.1 (1369339 . . . 1373385, complement) ID: 6762114 SEQ ID NO: 75 15. csn1 CRISPR-associated endonuclease Csn1 family protein [Streptococcus gordonii str. Challis substr. CH1] Other Aliases: SGO_1381 Genomic context: Chromosome Annotation: NC_009785.1 (1426750 . . . 1430160, complement) ID: 5599802 SEQ ID NO: 76 16. M28_Spy0748 cytoplasmic protein [Streptococcus pyogenes MGAS6180] Other Aliases: M28_Spy0748 Genomic context: Chromosome Annotation: NC_007296.1 (771231 . . . 775337) ID: 3573516 SEQ ID NO: 77 17. SGGBAA2069_c14690 CRISPR-associated protein [Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069] Other Aliases: SGGBAA2069_c14690 Genomic context: Chromosome Annotation: NC_015215.1 (1520905 . . . 1525017, complement) ID: 10295470 SEQ ID NO: 78 18. SAR116_2544 CRISPR-associated protein, Csn1 family [Candidatus Puniceispirillum marinum IMCC1322] Other Aliases: SAR116_2544 Genomic context: Chromosome Annotation: NC_014010.1 (2748992 . . . 2752099) ID: 8962895 SEQ ID NO: 79 19. TDE0327 CRISPR-associated Cas5e [Treponema denticola ATCC 35405] Other Aliases: TDE0327 Genomic context: Chromosome Annotation: NC_002967.9 (361021 . . . 365208) ID: 2741543 SEQ ID NO: 80 20. csn1 CRISPR-associated protein [Streptococcus pasteurianus ATCC 43144] Other Aliases: SGPB_1342 Genomic context: Chromosome Annotation: NC_015600.1 (1400035_1403427, complement) ID: 10753339 SEQ ID NO: 81 21. cas9 CRISPR-associated protein [Corynebacterium ulcerans BR-AD22] Other Aliases: CULC22_00031 Genomic context: Chromosome Annotation: NC_015683.1 (30419 . . . 33112, complement) ID: 10842578 SEQ ID NO: 82 22. MGAS2096_Spy0843 putative cytoplasmic protein [Streptococcus pyogenes MGAS2096] Other Aliases: MGAS2096_Spy0843 Genomic context: Chromosome Annotation: NC_008023.1 (813084 . . . 817190) ID: 4066021 SEQ ID NO: 83 23. MGAS9429_Spy0885 cytoplasmic protein [Streptococcus pyogenes MGAS9429] Other Aliases: MGAS9429_Spy0885 Genomic context: Chromosome Annotation: NC_008021.1 (852508 . . . 856614) ID: 4061575 SEQ ID NO: 84 24. AZL_009000 CRISPR-associated protein, Csn1 family [Azospirillum sp. B510] Other Aliases: AZL_009000 Genomic context: Chromosome Annotation: NC_013854.1 (1019522 . . . 1023028, complement) ID: 8789261 SEQ ID NO: 85 25. EUBREC_1713 contains RuvC-like nuclease and HNH-nuclease domains [Eubacterium rectale ATCC 33656] Other Aliases: EUBREC_1713 Other Designations: CRISPR-system related protein Genomic context: Chromosome Annotation: NC_012781.1 (1591112 . . . 1594456) ID: 7963668 SEQ ID NO: 86 26. Alide2_0194 CRISPR-associated protein, Csn1 family [Alicycliphilus denitrificans K601] Other Aliases: Alide2_0194 Genomic context: Chromosome Annotation: NC_015422.1 (218107 . . . 221196) ID: 10481210 SEQ ID NO: 87 27. Alide_0205 crispr-associated protein, cns1 family [Alicycliphilus denitrificans BC] Other Aliases: Alide_0205 Genomic context: Chromosome Annotation: NC_014910.1 (228371 . . . 231460) ID: 10102228 SEQ ID NO: 88 28. STER_1477 CRISPR-system-like protein [Streptococcus thermophilus LMD-9] Other Aliases: STER_1477 Genomic context: Chromosome Annotation: NC_008532.1 (1379975 . . . 1384141, complement) ID: 4437923 SEQ ID NO: 89 29. STER_0709 CRISPR-system-like protein [Streptococcus thermophilus LMD-9] Other Aliases: STER_0709 Genomic context: Chromosome Annotation: NC_008532.1 (643235 . . . 646600) ID: 4437391 SEQ ID NO: 90 30. cas9 CRISPR-associated protein [Corynebacterium diphtheriae 241] Other Aliases: CD241_2102 Genomic context: Chromosome Annotation: NC_016782.1 (2245769 . . . 2248399) ID: 11674395 SEQ ID NO: 91 31. cas3 CRISPR-associated endonuclease [Corynebacterium diphtheriae 241] Other Aliases: CD241_0034 Genomic context: Chromosome Annotation: NC_016782.1 (35063 . . . 38317) ID: 11672999 SEQ ID NO: 92 32. Corgl_1738 CRISPR-associated protein; Csn1 family [Coriobacteriurn glomerans PW2] Other Aliases: Corgl_1738 Genomic context: Chromosome Annotation: NC_015389.1 (2036091 . . . 2040245) ID: 10439994 SEQ ID NO: 93 33. Fluta_3147 CRISPR-associated protein, Csn1 family [Fluviicola taffensis DSM 16823] Other Aliases: Fluta_3147 Genomic context: Chromosome Annotation: NC_015321.1 (3610221 . . . 3614597, complement) ID: 10398516 SEQ ID NO: 94 34. Acav_0267 CRISPR-associated protein, Csn1 family [Acidovorax avertae subsp. avenae ATCC 19860] Other Aliases: Acav_0267 Genomic context: Chromosome Annotation: NC_015138.1 (295839 . . . 298976) ID: 10305168 SEQ ID NO: 95 35. NAL212_2952 CRISPR-associated protein, Csn1 family [Nitrosomonas sp. AL212] Other Aliases: NAL212_2952 Genomic context: Chromosome Annotation: NC_015222.1 (2941806 . . . 2944940, complement) ID: 10299493 SEQ ID NO: 96 36. SpiBuddy_2181 CRISPR-associated protein, Csn1 family [Sphaerochaeta globosa str. Buddy] Other Aliases: SpiBuddy_2181 Genomic context: Chromosome Annotation: NC_015152.1 (2367952 . . . 2371491, complement) ID: 10292274 SEQ ID NO: 97 37. Tmz1t_2411 HNH endonuclease [Thauera sp. MZ1T] Other Aliases: Tmz1t_2411 Genomic context: Plasmid pTha01 Annotation: NC_011667.1 (75253 . . . 76200, complement) ID: 7094333 SEQ ID NO: 98 38. Gdia_0342 Csn1 family CRISPR-associated protein [Gluconacetobacter diazotrophicus PAl 5] Other Aliases: Gdia_0342 Genomic context: Chromosome Annotation: NC_011365.1 (382737 . . . 385748) ID: 6973736 SEQ ID NO: 99 39. JJD26997_1875 CRISPR-associated Cas5e family protein [Campylobacter jejuni subsp. doylei 269.97] Other Aliases: JJD26997_1875 Genomic context: Chromosome Annotation: NC_009707.1 (1656109 . . . 1659063, complement) ID: 5389688 SEQ ID NO: 100 40. Asuc_0376 CRISPR-associated endonuclease Csn1 family protein [Actinobacillus succinogenes 130Z] Other Aliases: Asuc_0376 Genomic context: Chromosome Annotation: NC_009655.1 (43192 . . . 435116) ID: 5348478 SEQ ID NO: 101 41. Veis_1230 CRISPR-associated endonuclease Csn1 family protein [Verminephrohactcr eiseniae EF01-2] Other Aliases: Veis_1230 Genomic context: Chromosome Annotation: NC_008786.1 (1365979 . . . 1369185) ID: 4695198 SEQ ID NO: 102 42. MGAS10270_Spy0886 putative cytoplasmic protein [Streptococcus pyogenes MGAS10270] Other Aliases: MGAS10270_Spy0886 Genomic context: Chromosome Annotation: NC_008022.1 (844446 . . . 848552) ID: 4063984 SEQ ID NO: 103 43. gbs0911 hypothetical protein [Streptococcus agalactiae NEM316] Other Aliases: gbs0911 Genomic context: Chromosome Annotation: NC_004368.1 (945801 . . . 949946) ID: 1029893 SEQ ID NO: 104 44. NMA0631 hypothetical protein [Neisseria meningitidis Z2491] Other Aliases: NMA0631 Genomic context: Chromosome Annotation: NC_003116.1 (610868 . . . 614116, complement) ID: 906626 SEQ ID NO: 105 45. Ccan_14650 hypothetical protein [Capnocytophaga canimorsus Cc5] Other Aliases: Ccan_14650 Genomic context: Chromosome Annotation: NC_015846.1 (1579873 . . . 1584165, complement) ID: 10980451 SEQ ID NO: 106 46. lpp0160 hypothetical protein [Legionella pneumophila str. Paris] Other Aliases: lpp0160 Genomic context: Chromosome Annotation: NC_006368.1 (183831 . . . 187949) ID: 3118625 SEQ ID NO: 107 47. Cbei_2080 hypothetical protein [Clostridium beijerinckii NCIMB 8052] Other Aliases: Cbei_2080 Genomic context: Chromosome Annotation: NC_009617.1 (2422056 . . . 2423096) ID: 5296367 SEQ ID NO: 108 48. MMOB0330 hypothetical protein [Mycoplasma mobile 163K] Other Aliases: MMOB0330 Genomic context: Chromosome Annotation: NC_006908.1 (45652 . . . 49362, complement) ID: 2807677 SEQ ID NO: 109 49. MGF_5203 Csn1 family CRISPR-associated protein [Mycoplasma gallisepticum str. F] Other Aliases: MGF_5203 Genomic context: Chromosome Annotation: NC_017503.1 (888602 . . . 892411) ID: 12397088 SEQ ID NO: 110 50. MGAH_0519 Csn1 family CRISPR-associated protein [Mycoplasma gallisepticum str. R(high)] Other Aliases: MGAH_0519 Genomic context: Chromosome Annotation: NC_017502.1 (918476 . . . 922288) ID: 12395725 SEQ ID NO: 111 51. Smon_1063 CRISPR-associated protein, Csn1 family [Streptobacillus moniliformis DSM 12112] Other Aliases: Smon_1063 Genomic context: Chromosome Annotation: NC_013515.1 (1159048 . . . 1162827, complement) ID: 8600791 SEQ ID NO: 112 52. Spy49_0823 hypothetical protein [Streptococcus pyogenes NZ131] Other Aliases: Spy49_0823 Genomic context: Chromosome Annotation: NC_011375.1 (821210 . . . 825316) ID: 6985827 SEQ ID NO: 113 53. C8J_1425 hypothetical protein [Campylobacter jejuni subsp. jejuni 81116] Other Aliases: C8J_1425 Genomic context: Chromosome Annotation: NC_009839.1 (1442672 . . . 1445626, complement) ID: 5618449 SEQ ID NO: 114 54. FTF0584 hypothetical protein [Francisella tularensis subsp. tularensis FSC198] Other Aliases: FTF0584 Genomic context: Chromosome Annotation: NC_008245.1 (601115 . . . 604486) ID: 4200457 SEQ ID NO: 115 55. FTT_0584 hypothetical protein [Francisella tularensis subsp. tularensis SCHU S4] Other Aliases: FTT_0584 Genomic context: Chromosome Annotation: NC_006570.2 (601162 . . . 604533) ID: 3191177 SEQ ID NO: 116 56. csn1 CRISPR-associated protein [Streptococcus dysgalactiae subsp. equisimilis RE378] Other Aliases: GGS_1116 Annotation: NC_018712.1 (1169559 . . . 1173674, complement) ID: 13799322 SEQ ID NO: 117 57. SMUGS5_06270 CRISPR-associated protein csn1 [Streptococcus mutans GS-5] Other Aliases: SMUGS5_06270 Genomic context: Chromosome Annotation: NC_018089.1 (1320641 . . . 1324678, complement) ID: 13299050 SEQ ID NO: 118 58. Y1U_C1412 Csn1 [Streptococcus thermophilus MN-ZLW-002] Other Aliases: Y1U_C1412 Genomic context: Chromosome Annotation: NC_017927.1 (1376653 . . . 1380819, complement) ID: 12977193 SEQ ID NO: 119 59. Y1U_C0633 CRISPR-system-like protein [Streptococcus thermophilus MN-ZLW-002] Other Aliases: Y1U_C0633 Genomic context: Chromosome Annotation: NC_017927.1 (624274 . . . 627639) ID: 12975630 SEQ ID NO: 120 60. SALIVA_0715 CRISPR-associated endonuclease, Csn1 family [Streptococcus salivarius JIM8777] Other Aliases: SALIVA _0715 Annotation: NC_017595.1 (708034 . . . 711417) ID: 12910728 SEQ ID NO: 121 61. csn1 CRISPR-associated protein csn1 [Streptococcus mutans LJ23] Other Aliases: SMULJ23_9701 Annotation: NC_017768.1 (751695 . . . 755732) ID: 12898085 SEQ ID NO: 122 62. RIA_1455 CRISPR-associated protein, SAG0894 [Riemerella anatipestifer RA-GD] Other Aliases: RIA_1455 Genomic context: Chromosome Annotation: NC_017569.1 (1443996 . . . 1448198) ID: 12613647 SEQ ID NO: 123 63. STND_0658 CRISPR-associated endonuclease, Csn1, family [Streptococcus thermophilus ND03] Other Aliases: STND_0658 Genomic context: Chromosome Annotation: NC_017563.1 (633621 . . . 636986) ID: 12590813 SEQ ID NO: 124 64. RA0C_1034 putative BCR [Riemerella anatipestifer ATCC 11845 = DSM 15868] Other Aliases: RA0C_1034 Genomic context: Chromosome Annotation: NC_017045.1 (1023494 . . . 1026931, complement) ID: 11996006 SEQ ID NO: 125 65. Sinf_1255 CRISPR-associated protein, 5AG0894 family [Streptococcus infantarius subsp. infantarius CJ18] Other Aliases: Sinf_1255 Genomic context: Chromosome Annotation: NC_016826.1 (127484 . . . 1280611, complement) ID: 11877786 SEQ ID NO: 126 66. Nitsa_1472 CRISPR-associated protein, csn1 family [Nitratifractor salsuginis DSM 16511] Other Aliases: Nitsa_1472 Genomic context: Chromosome Annotation: NC_014935.1 (1477331 . . . 1480729) ID: 10148263 SEQ ID NO: 127 67. NLA_17660 hypothetical protein [Neisseria actamica 020-06] Other Aliases: NLA_17660 Genomic context: Chromosome Annotation: NC_014752.1 (1890078 . . . 1893326) ID: 10006697 SEQ ID NO: 128 68. SmuNN2025_0694 hypothetical protein [Streptococcus mutans NN2025] Other Aliases: SmuNN2025_0694 Genomic context: Chromosome Annotation: NC_013928.1 (737258 . . . 741295) ID: 8834629 SEQ ID NO: 129 69. SDEG_1231 hypothetical protein [Streptococcus dysgalactiae subsp. equisimilis GGS_124] Other Aliases: SDEG_1231 Chromosome: 1 Annotation: Chromosome 1NC_012891.1 (1176755 . . . 1180870, complement) ID: 8111553 SEQ ID NO: 130 70. NMCC_0397 hypothetical protein [Neisseria meningitidis 053442] Other Aliases: NMCC_0397 Genomic context: Chromosome Annotation: NC_010120.1 (402733 . . . 405981, complement) ID: 5796426 SEQ ID NO: 131 71. SAK_1017 hypothetical protein [Streptococcus agalactiae A909] Other Aliases: SAK_1 Genomic context: Chromosome Annotation: NC_007432.1 (980303 . . . 984415) ID: 3686185 SEQ ID NO: 132 72. M5005_Spy_0769 hypothetical protein [Streptococcus pyogenes MGAS5005] Other Aliases: M5005_Spy_0769 Genomic context: Chromosome Annotation: NC_007297.1 (773340 . . . 777446) ID: 3572134 SEQ ID NO: 133 73. MS53_0582 hypothetical protein [Mycoplasma synoviae 53] Other Aliases: MS53_0582 Genomic context: Chromosome Annotation: NC_007294.1 (684155 . . . 688099) ID: 3564051 SEQ ID NO: 134 74. DIP0036 hypothetical protein [Corynebacterium diphtheriae NCTC 13129] Other Aliases: DIP0036 Genomic context: Chromosome Annotation: NC_002935.2 (34478 . . . 37732) ID: 2650188 SEQ ID NO: 135 75. WS1613 hypothetical protein [Wolinella succinogenes DSM 1740] Other Aliases: WS1613 Genomic context: Chromosome Annotation: NC_005090.1 (1525628 . . . 1529857) ID: 2553552 SEQ ID NO: 136 76. PM1127 hypothetical protein [Pasteurella multocida subsp. multocida str. Pm 70] Other Aliases: PM1127 Genomic context: Chromosome Annotation: NC_002663.1 (1324015 . . . 1327185, complement) ID: 1244474 SEQ ID NO: 137 77. SPs1176 hypothetical protein [Streptococcus pyogenes SSI-1] Other Aliases: SPs1176 Genomic context: Chromosome Annotation: NC_004606.1 (1149610 . . . 1153716, complement) ID: 1065374 SEQ ID NO: 138 78. SMU_1405c hypothetical protein [Streptococcus mutans UA159] Other Aliases: SMU_1405c, SMU.1405c Genomic context: Chromosome Annotation: NC_004350.2 (1330942 . . . 1334979, complement) ID: 1028661 SEQ ID NO: 139 79. lin2744 hypothetical protein [Listeria innocua Clip11262] Other Aliases: lin2744 Genomic context: Chromosome Annotation: NC_003212.1 (2770707 . . . 2774711, complement) ID: 1131597 SEQ ID NO: 140 80. csn1B CRISPR-associated protein [Streptococcus gallolyticus subsp. gallolyticus ATCC 43143] Other Aliases: SGBB_1441 Annotation: NC_07576.1 (1489111 . . . 1493226, complement) ID: 12630646 SEQ ID NO: 141 81. csn1A CRISPR-associated protein [Streptococcus gallolyticus subsp. gallolyticus ATCC 43143] Other Aliases: SGCG_1431 Annotation: NC_017576.1 (1480439 . . . 1483831, complement) ID: 12630636 SEQ ID NO: 142 82. cas9 CRISPR-associated protein [Corynebacterium ulcerans 809] Other Aliases: CULC809_00033 Genomic context: Chromosome Annotation: NC_017317.1 (30370 . . . 33063, complement) ID: 12286148 SEQ ID NO: 143 83. GDI_2123 hypothetical protein [Gluconacetobacter diazotrophicus PAl 5] Other Aliases: GDI_2123 Genomic context: Chromosome Annotation: NC_010125.1 (2177083 . . . 2180235) ID: 5792482 SEQ ID NO: 144 84. Nham_4054 hypothetical protein [Nitrobacter hamburgensis X14] Other Aliases: Nham_4054 Genomic context: Plasmid 1 Annotation: NC_007959.1 (13284 . . . 16784, complement) ID: 4025380 SEQ ID NO: 145 85. str0657 hypothetical protein [Streptococcus thermophilus CNRZ1066] Other Aliases: str0657 Genomic context: Chromosome Annotation: NC_006449.1 (619189 . . . 622575) ID: 3165636 SEQ ID NO: 146 86. stu0657 hypothetical protein [Streptococcus thermophilus LMG 18311] Other Aliases: stu0657 Genomic context: Chromosome Annotation: NC_006448.1 (624007 . . . 627375) ID: 3165000 SEQ ID NO: 147 87. SpyM3_0677 hypothetical protein [Streptococcus pyogenes MGAS315] Other Aliases: SpyM3_0677 Genomic context: Chromosome Annotation: NC_004070.1 (743040 . . . 747146) ID: 1008991 SEQ ID NO: 148 88. HFMG06CAA_5227 Csn1 family CRISPR-associated protein [Mycoplasma gallisepticum CA06_2006.052-5-2P] Other Aliases: HFMG06CAA_5227 Genomic context: Chromosome Annotation: NC_018412.1 (895338 . . . 899147) ID: 13464859 SEQ ID NO: 149 89. HFMG01WIA_5025 Csn1 family CRISPR-associated protein [Mycoplasma gallisepticum WI01_2001.043-13-2P] Other Aliases: HFMG01WIA_5025 Genomic context: Chromosome Annotation: NC_018410.1 (857648 . . . 861457) ID: 13463863 SEQ ID NO: 150 90. HFMG01NYA_5169 Csn1 family CRISPR-associated protein [Mycoplasma gallisepticum NY01_2001.047-5-1P] Other Aliases: HFMG01NYA_5169 Genomic context: Chromosome Annotation: NC_018409.1 (883511 . . . 887185) ID: 13462600 SEQ ID NO: 151 91. HFMG96NC SEQ ID NO: 127 A_5295 Csn1 family CRISPR-associated protein [Mycoplasma gallisepticum NC96_1596-4-2P] Other Aliases: HFMG96NCA_5295 Genomic context: Chromosome Annotation: NC_018408.1 (904664 . . . 908473) ID: 13462279 SEQ ID NO: 152 92. HFMG95NCA_5107 Csn1 family CRISPR-associated protein [Mycoplasma gallisepticum NC95_13295-2-2P] Other Aliases: HFMG95NCA_5107 Genomic context: Chromosome Annotation: NC_018407.1 (871783 . . . 875592) ID: 13461469 SEQ ID NO: 153 93. MGAS10750_Spy0921 hypothetical protein [Streptococcus pyogenes MGAS10750] Other Aliases: MGAS10750_Spy0921 Genomic context: Chromosome Annotation: NC_008024.1 (875719 . . . 879834) ID: 4066656 SEQ ID NO: 154 94. XAC3262 hypothetical protein [Xanthomonas axonopodis pv. citri str. 306] Other Aliases: XAC3262 Genomic context: Chromosome Annotation: NC_003919.1 (3842310 . . . 3842765) ID: 1157333 SEQ ID NO: 155 95. SSUST1_1305 CRISPR-system-like protein [Streptococcus suis ST1] Other Aliases: SSUST1_1305 Genomic context: Chromosome Annotation: NC_017950.1 (1293105 . . . 1297250, complement) ID: 13017849 SEQ. ID NO: 156 96. SSUD9_1467 CRISPR-associated protein, Csn1 family [Streptococcus suis D9] Other Aliases: SSUD9_1467 Genomic context: Chromosome Annotation: NC_017620.1 (1456318 . . . 1459686, complement) ID: 12718289 SEQ ID NO: 157 97. BBta_3952 hypothetical protein [Bradyrhizobium sp. BTAi1] Other Aliases: BBta_3952 Genomic context: Chromosome Annotation: NC_009485.1 (4149455 . . . 4152649, complement) ID: 5151538 SEQ ID NO: 158 98. CIY_03670 CRISPR-associated protein, Csn1 family [Butyrivibrio fibrisolvens 16/4] Other Aliases: CIY_03670 Annotation: NC_021031.1 (309663 . . . 311960, complement) ID: 15213189 SEQ ID NO: 159 99. A11Q_912 CRISPR-associated protein, Csn1 family [Bdellovibrio exovorus JSS] Other Aliases: A11Q_912 Genomic context: Chromosome Annotation: NC_020813.1 (904781 . . . 907864, complement) ID: 14861475 SEQ ID NO: 160 100. MCYN0850 Csn1 family CRISPR-associated protein [Mycoplasma cynos C142] Other Aliases: MCYN_0850 Annotation: NC_019949.1 (951497 . . . 955216, complement) ID: 14356531 SEQ ID NO: 161 101. SaSA20_0769 CRISPR-associated protein [Streptococcus agalactiae SA20-06] Other Aliases: SaSA20_0769 Genomic context: Chromosome Annotation: NC_019048.1 (803597 . . . 807709) ID: 13908026 SEQ ID NO: 162 102. csn1 CRISPR-associated protein, Csn1 family [Streptococcus pyogenes A20] Other Aliases: A20_0810 Genomic context: Chromosome Annotation: NC_018936.1 (772038 . . . 776144) ID: 13864445 SEQ ID NO: 163 103. P700755_000291 CRISPR-associated protein Cas9/Csn1, subtype II [Psychroflexus torquis is ATCC 700755] Other Aliases: P700755_000291 Genomic context: Chromosome Annotation: NC_018721.1 (312899 . . . 317428) ID: 13804571 SEQ ID NO: 164 104. A911_07335 CRISPR-associated protein [Campylobacter jejuni subsp. jejuni PT14] Other Aliases: A911_07335 Genomic context: Chromosome Annotation: NC_018709.2 (1450217 . . . 1453180, complement) ID: 13791138 SEQ ID NO: 165 105. ASU2_02495 CRISPR-associated endonuclease Csn1 family protein [Actinobacillus suis H91-0380] Other Aliases: ASU2_02495 Genomic context: Chromosome Annotation: NC_018690.1 (552318 . . . 555482) ID: 13751600 SEQ ID NO: 166 106. csn1 CRISPR-associated protein [Listeria monocytogenes SLCC2540] Other Aliases: LMOSLCC2540_2635 Annotation: NC_018586.1 (2700744 . . . 2704748, complement) ID: 13647248 SEQ ID NO: 167 107. csn1 CRISPR-associated protein [Listeria monocytogenes SLCC5850] Other Aliases: LMOSLCC5850_2605 Annotation: NC_018592.1 (2646023 . . . 2650027, complement) ID: 13626042 SEQ ID NO: 168 108. csn1 CRISPR-associated protein [Listeria monocytogenes serotype 7 str. SLCC2482] Other Aliases: LMOSLCC2482_2606 Annotation: NC_018591.1 (2665393 . . . 2669397, complement) ID: 13605045 SEQ ID NO: 169 109. csn1 CRISPR-associated protein [Listeria monocytogenes SLCC2755] Other Aliases: LMOSLCC2755_2607 Annotation: NC_018587.1 (2694850 . . . 2698854, complement) ID: 13599053 SEQ ID NO: 170 110. BN148_1523e CRISPR-associated protein [Campylobacter jejuni subsp. jejuni NCTC 11168-BN148] Other Aliases: BN148_1523c Annotation: NC_018521.1. (1456880 . . . 1459834, complement) ID: 13530688 SEQ ID NO: 171 111. Belba_3201 CRISPR-associated protein Cas9/Csn1, subtype II/NMEMI [Belliella baltica DSM 15883] Other Aliases: Belba_3201 Genomic context: Chromosome Annotation: NC_018010.1 (3445311 . . . 3449369, complement) ID: 13056967 SEQ ID NO: 172 112. FN3523_1121 membrane protein [Francisella cf. novicida 3523] Other Aliases: FN3523_1121 Genomic context: Chromosome Annotation: NC_017449.1 (1129528 . . . 1134468, complement) ID: 12924881 SEQ ID NO: 173 113. cas9 CRISPR-associated protein Cas9/Csn1, subtype II/NMEMI [Prevotella intermedia 17] Other Aliases: PIN17_A0201 Chromosome: II Annotation: Chromosome IINC_017861.1 (240722 . . . 244864) ID: 12849954 SEQ ID NO: 174 114. csn1 CRISPR-associated protein, Csn1 family [Streptococcus thermophilus JIM 8232] Other Aliases: STH8232_0853 Annotation: NC_017581.1 (706443 . . . 709808) ID: 12637306 SEQ ID NO: 175 115. LMOG_01918 CRISPR-associated protein [Listeria monocytogenes J0161] Other Aliases: LMOG_01918 Genomic context: Chromosome Annotation: NC_017545.1 (2735374 . . . 2739378, complement) ID: 12557915 SEQ ID NO: 176 116. LMRG_02138 CRISPR-associated protein [Listeria monocytogenes 10403S] Other Aliases: LMRG_02138 Genomic context: Chromosome Annotation: NC_017544.1 (2641981 . . . 2645985, complement) ID: 12554876 SEQ ID NO: 177 117. CJSA_1443 putative CRISPR-associated protein [Campy lobacter jejuni subsp. jejuni IA3902] Other Aliases: CJSA_1443 Genomic context: Chromosome Annotation: NC_017279.1 (1454273 . . . 1457227, complement) ID: 12250720 SEQ ID NO: 178 118. csn1 CRISPR-associated protein Csn1 [Streptococcus pyogenes MGAS1882] Other Aliases: MGAS1882_0792 Genomic context: Chromosome Annotation: NC_017053.1 (775696 . . . 779799) ID: 12014080 SEQ ID NO: 179 119. csn1 CRISPR-associated protein Csn1 [Streptococcus pyogenes MGAS15252] Other Aliases: MGAS15252_0796 Genomic context: Chromosome Annotation: NC_017040.1 (778271 . . . 782374) ID: 11991096 SEQ ID NO: 180 120. cas3 CRISPR-associated endonuclease [Corynebacterium diphtheriae HC02] Other Aliases: CDHC02_0036 Genomic context: Chromosome Annotation: NC_016802.1 (37125 . . . 40379) ID: 11739116 SEQ ID NO: 181 121. cas3 CRISPR-associated endonuclease [Corynebacterium diphtheriac C7 (beta)] Other Aliases: CDC7B_0035 Genomic context: Chromosome Annotation: NC_016801.1 (36309 . . . 39563) ID: 11737358 SEQ ID NO: 182 122. cas3 CRISPR-associated endonuclease [Corynebacterium diphtheriae BH8] Other Aliases: CDBH8_0038 Genomic context: Chromosome Annotation: NC_016800.1 (37261 . . . 40515) ID: 11735325 SEQ ID NO: 183 123. cas3 CRISPR-associated endonuclease [Corynebacterium diphtheriae 31A] Other Aliases: CD31A_0036 Genomic context: Chromosome Annotation: NC_016799.1 (34597 . . . 37851) ID: 11731168 SEQ ID NO: 184 124. cas3 CRISPR-associated endonuclease [Corynebacterium diphtheriae VA01] Other Aliases: CDVA01_0033 Genomic context: Chromosome Annotation: NC_016790.1 (34795 . . . 38049) ID: 11717708 SEQ ID NO: 185 125. cas3 CRISPR-associated endonuclease [Corynebacterium diphtheriae HC01] Other Aliases: CDHC01_0034 anomie context: Chromosome Annotation: NC_016786.1 (35060 . . . 38314) ID: 11708318 SEQ ID NO: 186 126. cas9 CRISPR-associated protein [Corynebacterium diphtheriae HC01] Other Aliases: CDHC01_2103 Genomic context: Chromosome Annotation: NC_016786.1 (2246368 . . . 2248998) ID: 11708126 SEQ ID NO: 187 127. PARA_18570 hypothetical protein [Haemophilus parainfluenzae T3T1] Other Aliases: PARA_18570 Genomic context: Chromosome Annotation: NC_015964.1 (1913335 . . . 1916493) ID: 11115627 SEQ ID NO: 188 128. HDN1F_34120 hypothetical protein [gamma proteobacterium HdN1] Other Aliases: HDN1F_34120 Genomic context: Chromosome Annotation: NC_014366.1 (4143336 . . . 4146413, complement) ID: 9702142 SEQ ID NO: 189 129. SPy_1046 hypothetical protein [Streptococcus pyogenes M1 GAS] Other Aliases: SPy_1046 Genomic context: Chromosome Annotation: NC_002737.1 (854757 . . . 858863) ID: 901176 SEQ ID NO: 190 130. GBS222_0765 Hypothetical protein [Streptococcus agalactiae] Other Aliases: GBS222_0765 Annotation: NC_021195.1 (810875 . . . 814987) ID: 15484689 SEQ ID NO: 191 131. NE061598_03330 hypothetical protein [Francisella tularensis subsp. tularensis NE061598] Other Aliases: NE061598_03330 Genomic context: Chromosome Annotation: NC_017453.1 (601219 . . . 604590) ID: 12437259 SEQ ID NO: 192 132. NMV_1993 hypothetical protein [Neisseria meningitidis 8013] Other Aliases: NMV_1993 Annotation: NC_017501.1 (1917073 . . . 1920321) ID: 12393700 SEQ ID NO: 193 133. csn1 hypothetical protein [Campylobacter jejuni subsp. jejuni M1] Other Aliases: CJM1_1467 Genomic context: Chromosome Annotation: NC_017280.1 (1433667 . . . 1436252, complement) ID: 12249021 SEQ ID NO: 194 134. FTU_0629 hypothetical protein [Francisella tularensis subsp. tularensis TIGB03] Other Aliases: FTU_0629 Genomic context: Chromosome Annotation: NC_016933.1 (677092 . . . 680463) ID: 11890131 SEQ ID NO: 195 135. NMAA_0315 hypothetical protein [Neisseria meningitidis WUE 2594] Other Aliases: NMAA_0315 Annotation: NC_017512.1 (377010 . . . 380258, complement) ID: 12407849 SEQ ID NO: 196 136. WS1445 hypothetical protein [Wolinella succinogenes DSM 1740] Other Aliases: WS1445 Genomic context: Chromosome Annotation: NC_005090.1 (1388202 . . . 1391381, complement) ID: 2554690 SEQ ID NO: 197 137. THITE_2123823 hypothetical protein [Thielavia terrestris NRRL 8126] Other Aliases: THITE_2123823 Chromosome: 6 Annotation: Chromosome 6NC_016462.1 (1725696 . . . 1725928) ID: 11523019 SEQ ID NO: 198 138. XAC29_16635 hypothetical protein [Xanthomonas axonopodis Xac29-1] Other Aliases: XAC29_16635 Genomic context: Chromosome Annotation: NC_020800.1 (3849847 . . . 3850302) ID: 14853997 SEQ ID NO: 199 139. M1GAS476_0830 hypothetical protein [Streptococcus pyogenes M1 476] Other Aliases: M1GAS476_0830 Chromosome: 1 Annotation: NC_020540.1 (792119 . . . 796225) ID: 14819166 SEQ ID NO: 200 140. Piso0_000203 Piso0_000203[Millerozyma farinosa CBS 7064] Other Aliases: GNLVRS01_PISO0A04202g Other Designations: hypothetical protein Chromosome: A Annotation: NC_020226.1 (343553 . . . 343774, complement) ID: 14528449 SEQ ID NO: 201 141. G148_0828 hypothetical protein [Riemerella anatipestifer RA-CH-2] Other Aliases: G148_0828 Genomic context: Chromosome Annotation: NC_020125.1 (865673 . . . 869875) ID: 14447195 SEQ ID NO: 202 142. csn1 hypothetical protein [Streptococcus dysgalactiae subsp. equisimilis AC-2713] Other Aliases: SDSE_1207 Annotation: NC_019042.1 (1134173 . . . 1138288, complement) ID: 13901498 SEQ ID NO: 203 143. A964_0899 hypothetical protein [Streptococcus agalactiae GD201008-001] Other Aliases: A964_0899 Genomic context: Chromosome Annotation: NC_018646.1 (935164 . . . 939276) ID: 13681619 SEQ ID NO: 204 144. FNFX1_0762 hypothetical protein [Francisella cf. novicida Fx1] Other Aliases: FNFX1_0762 Genomic context: Chromosome Annotation: NC_017450.1 (781484 . . . 786373) ID: 12435564 SEQ ID NO: 205 145. FTV_0545 hypothetical protein [Francisella tularensis subsp. tularensis TI0902] Other Aliases: FTV_0545 Genomic context: Chromosome Annotation: NC_016937.1 (601185 . . . 604556) ID: 11880693 SEQ ID NO: 206 146. FTL_1327 hypothetical protein [Francisella tularensis subsp. holarctica LVS] Other Aliases: FTL_1327 Genomic context: Chromosome Annotation: NC_007880.1 (1262508 . . . 1263689, complement) ID: 3952607 SEQ ID NO: 207 147. FTL_1326 hypothetical protein [Francisella tularensis subsp. holaretica LVS] Other Aliases: FTL_1326 Genomic context: Chromosome Annotation: NC_007880.1 (1261927 . . . 1262403, complement) ID: 3952606 SEQ ID NO: 208