RECOMBINANT PROTEINS COMPRISING BOTULINUM TOXIN AND CELL PENETRATING PEPTIDE AND COSMETIC COMPOSITION COMPRISING THEREOF

Abstract

Disclosed herein is a recombinant protein including botulinum toxin and cell penetrating peptides and cosmetic composition. The cell penetrating peptide according to the present disclosure may be actively used as a topical agent for various disease treatment, aesthetic, or cosmetic purposes, especially for a cosmetic composition, by securing better convenience as well as maximizing the intrinsic in vivo efficacy of the botulinum toxin through the cell penetrating recombinant proteins that combines the botulinum toxin and a cell penetrating peptide by making skin penetration and/or cell penetration for botulinum toxin more efficient.

Claims

1. Recombinant proteins, comprising: Botulinum toxin; and Cell penetrating botulinum toxin recombinant proteins comprising cell penetrating peptides. The cell penetrating peptide is a peptide that is capable of mediating the transport of an active molecule into a cell and is a cell penetrating botulinum toxin recombinant protein, characterized in that it consists of one amino acid sequence type selected from the group consisting of sequence number 1 to sequence number 13.

2. The recombinant proteins of claim 1, wherein the active molecule is a cell penetrating botulinum toxin recombinant protein, characterized in that it consists of one or more selected from the group consisting of growth factors, enzymes, transcription factors, toxins, antigenic peptides, antibodies, antibody fragments, nucleic acids, coding nucleic acid sequences, mRNAs, antisense RNA molecules, microRNAs, siRNAs, carbohydrates, lipids, and glycolipids.

3. The recombinant proteins of claim 1, wherein the botulinum toxin is a cell penetrating botulinum toxin recombinant protein, characterized in that it consists of one type selected from the group consisting of serotypes A, B, C, D, E, F, and G.

4. The recombinant proteins of claim 1, wherein the fusion is a cell penetrating botulinum toxin recombinant protein, characterized in that the cell penetrating peptide is fused to the carboxy terminal, amino terminal, or both of the botulinum toxin light chain.

5. The recombinant proteins of claim 1, wherein the fusion is a cell penetrating botulinum toxin recombinant protein, characterized in that is made by a peptide bond or a covalent bond.

6. The recombinant proteins of claim 1, wherein the cell penetrating botulinum toxin recombinant protein is a cell penetrating botulinum toxin recombinant protein, characterized in that it is fused with a botulinum toxin light chain peptide consisting of the amino acid sequence number 14 or sequence number 15; a translocation region peptide of a heavy chain of botulinum toxin consisting of the amino acid sequence number 16; and a cell penetrating peptide.

7. The recombinant protein of claim 6, wherein the cell penetrating botulinum toxin recombinant protein is a cell penetrating botulinum toxin recombinant protein characterized in that it further comprises a linker in any one or more among the gap between the cell penetrating peptide and the botulinum toxin light chain peptide, that between the botulinum toxin light chain peptide and the translocation region peptide of the botulinum toxin heavy chain, or that between the translocation region peptide of the botulinum toxin heavy chain and cell penetrating peptides.

8. A cosmetic composition comprising the cell penetrating botulinum toxin recombinant protein according to claim 1 as an active ingredient.

9. The recombinant protein of claim 8, wherein the cosmetic composition is a cosmetic composition characterized in that it further comprises a transdermal penetration enhancer.

10. The recombinant protein of claim 9, wherein the transdermal penetration enhancer is a cosmetic composition characterized in that it is glyceryl monostearate or cetyl alcohol.

11. The recombinant protein of claim 8, wherein the transdermal penetration enhancer is a cosmetic composition characterized in that it contains at least 0.5 w/w % for the total weight of the composition.

12. The recombinant protein of claim 8, wherein the cosmetic composition is a cosmetic composition for improving or preventing skin wrinkles.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0037] The accompanying drawings are only to explain the exemplary embodiment of the present disclosure in more detail for those skilled in the related art, and the technical idea of the present disclosure is not limited thereto.

[0038] FIG. 1 is a table comparing CDP 1 to CDP 13, novel CPPs derived from the exemplary embodiment 1 of the present disclosure to the conventional CPPs and predicted SVM scores.

[0039] FIG. 2 shows a diagram illustrating an exemplary protein expression vector according to the present disclosure.

[0040] FIG. 3 shows the results of electrophoresis performed to confirm the expression and purification of the GFP-Cargo Delivery Peptide recombinant protein in the Exemplary Embodiment 3 of the present disclosure.

[0041] FIG. 4 is a diagram illustrating the results of confocal microscope observation regarding the human skin tissue permeability of CDP1, CDP2, and CDP3, GFP-Cargo Delivery Peptide recombinant proteins, in the Exemplary Embodiment 4 of the present disclosure.

[0042] FIG. 5 is a diagram illustrating the results of confocal microscope observation comparing the human skin tissue permeability of CDP2, a GFP-Cargo Delivery Peptide recombinant protein, in the Exemplary Embodiment 4 of the present disclosure, and that of TD1, a conventional CPP.

[0043] FIG. 6 is a diagram illustrating the results of confocal microscope observation comparing the human skin tissue permeability of CDP1, a GFP-Cargo Delivery Peptide recombinant protein, in the Exemplary Embodiment 4 of the present disclosure, and that of HIV-Tat, a conventional CPP.

[0044] FIG. 7 is a diagram illustrating the results of electrophoresis performed on a 10% SDS-PAGE gel to test whether the recombinant protein was appropriately purified in the Exemplary Embodiment 6 of the present disclosure.

[0045] FIG. 8 depicts the result of FITC fluorescence observation in the exemplary embodiment 7 of the present disclosure.

[0046] FIG. 9 is a diagram showing the results of FITC fluorescence observation in the exemplary embodiment 8 of the present disclosure.

[0047] FIGS. 10 and 11 illustrate the absorbance and WST-1 assay results (cellular viability) measured in the exemplary embodiment 9 of the present disclosure.

[0048] FIGS. 12 and 13 illustrate the results of fluorescence measurement measured in the exemplary embodiment 10 of the present disclosure.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0049] Hereinafter, the present disclosure explains a recombinant protein including a botulinum toxin and a CPP according to an exemplary embodiment of the present disclosure and cosmetic composition including them in detail. However, the scope of a right of recombinant proteins including botulinum toxin and CPP and cosmetic composition is not limited by the following description.

[0050] Besides, throughout the specification, when a part “includes” a certain component, it means that other components may be further included rather than excluding other components unless otherwise specified.

[0051] The terminology “botulinum toxin” used herein also includes variants and fusion proteins produced or engineered by bacteria or by recombinant technology and it is used to include all known types of botulinum toxins, regardless of whether it may subsequently be found.

[0052] The present disclosure is regarding a recombinant protein including a botulinum toxin and a CPP.

[0053] The CPP includes novel CPPs.

[0054] The CPP preferably does not have an enzyme or therapeutic biological activity defined by itself, but it works as a carrier that enables intracellular transport through the cell membrane. It can be attached to the N-terminal, C-terminus, or both terminals of a cargo to be delivered into the cell, and it can be attached in the forward or reverse direction at each terminal. The peptide according to the present disclosure will preferably be applied as a monomer, but it is not limited thereto, and it may be used in the form of a dimer or a polymer.

[0055] The peptide of the present disclosure may be a peptide capable of mediating the transport of an active molecule into a cell.

[0056] In this case, the active molecule may be one or more selected from a group that consists of growth factors, enzymes, transcription factors, toxins, antigenic peptides, antibodies, antibody fragments, nucleic acids, coding nucleic acid sequences, mRNAs, antisense RNA molecules, microRNAs, siRNAs, carbohydrates, lipids, and glycolipids, but is not particularly limited thereto.

[0057] The CPP according to the present disclosure may consist of one type of amino acid sequence selected from the group composed of sequence number 1 to sequence number 13.

[0058] When the CPP according to the present disclosure consists of one type of amino acid sequence selected from the group consisting of sequence number 1 to sequence number 13 as described above, it can maximize the in vivo efficacy of botulinum toxin by making the skin penetration or cell penetration of botulinum toxin more efficient through chemical bonding with botulinum toxin as described below and it may be used for various purposes.

[0059] The terminology “cell penetrating botulinum toxin recombinant protein” used herein includes the CPP and botulinum toxin, and may refer to an assembly formed by chemical bonding such as a peptide bond or a covalent bond of them. That is, the cell penetrating botulinum toxin recombinant protein can deliver the botulinum toxin into the cell with high efficiency by giving cell permeability by fusing a specific cell penetrating peptide with botulinum toxin, which is a macromolecule that is difficult to transport into the cell. In this case, the CCP may be fused to the carboxy terminal of the botulinum toxin light chain, the amino terminal of it, or both.

[0060] As described above, the cell penetrating botulinum toxin recombinant protein according to the present disclosure is not particularly limited. For example, it may have a structure or a form of fusing botulinum toxin and the CPP.

[0061] The botulinum toxin light chain may be one type selected from the group consisting of serotypes A, B, C, D, E, F, and G. In the present disclosure, the botulinum toxin light chain may include alternatively botulinum toxin derivatives, which is a compound that has botulinum toxin activity but arbitrarily having one or more modifications on a portion or sequence. For example, they may be a modified form in a way that enhances properties or reduces side effects while maintaining the endopeptidase activity of the light chain by applying methods such as deletion, modification, replacement, or chimeric fusion on the amino acid sequence, in contrast to the seven serotypes of botulinum toxin light chain proteins. Alternatively, it may use a botulinum toxin light chain prepared by recombinant or chemical synthesis or a portion of a botulinum toxin light chain.

[0062] In an exemplary embodiment, the botulinum toxin light chain may consist of the amino acid sequence number 14 or sequence number 15.

[0063] In an exemplary embodiment, the cell penetrating botulinum toxin recombinant protein according to the present disclosure includes a botulinum toxin light chain peptide consisting of the amino acid sequence number 14 or sequence number 15; the translocation region peptide of the botulinum toxin heavy chain consisting of the amino acid sequence number 16; and a structure or a form in which the CPPs are sequentially fused.

[0064] When the cell penetrating botulinum toxin recombinant protein according to the present disclosure has the above-described structure or form, it can be actively used as a topical agent for various disease treatment, aesthetic, or cosmetic purposes by making the skin penetration and/or cell penetration of botulinum toxin more efficient, maximizing the in vivo intrinsic efficacy of the botulinum toxin, and securing better convenience at the same time.

[0065] In an exemplary embodiment, the cell penetrating botulinum toxin recombinant protein according to the present disclosure may additionally include a linker in any one or more among the gap between the CPP and the botulinum toxin light chain peptide, that between the botulinum toxin light chain peptide and the translocation region peptide of the botulinum toxin heavy chain, or that between the translocation region peptide of the botulinum toxin heavy chain and CPPs.

[0066] The linker, although not particularly limited, may consist of various amino acid sequences, and preferably may consist of the amino acid sequence number 17.

[0067] The present disclosure may also include a polynucleotide that encodes the cell penetrating botulinum toxin recombinant protein and a recombinant expression vector including the polynucleotide.

[0068] The terminology “recombinant expression vector” used herein is a vector that is capable of expressing a protein of interest or an RNA of interest in a suitable host cell, and it may refer to a gene construct including essential regulatory elements operably linked to express a gene insert.

[0069] The terminology “operably linked” may also mean that a nucleic acid expression regulator sequence and a nucleic acid sequence encoding a protein of interest or an RNA of interest are functionally linked to perform a general function. For example, the nucleic acid sequence coding a promotor, a protein, or an RNA is operably linked to affect the expression of the encoding nucleic acid sequence. Operably linked with the recombinant expression vector can be prepared using the gene recombination technique well known in the related art, and enzymes generally known in the related art can be used for site-specific DNA cleavage and ligation.

[0070] In an exemplary embodiment, the expression vector includes a plasmid vector, a cosmid vector, a bacteriophage vector, a viral vector, and others, but it is not particularly limited thereto. Appropriate expression vectors can be prepared in various ways according to the purpose, including a signal sequence or a leader sequence for membrane targeting or secretion besides expression regulatory sequences such as promoters, operators, initiation codons, termination codons, polyadenylation signals, and enhancers. The promoter of the expression vector may be constitutive or inducible. Besides, the expression vector may include a selection marker for selecting a host cell containing the vector, and it may include a replication origin when it is a replicable expression vector.

[0071] The recombinant expression vector according to the present disclosure may also contain at least one type of affinity label selected from the group consisting of His, FLAG, HAT, SBP, c-myc, chitin-binding domain, glutathione-S transferase, and maltose binding protein.

[0072] The recombinant expression vector of the present disclosure may also contain at least one regulatory gene type selected from the group consisting of cold shock protein A promoter, T7, Toc, BAD, and pRha.

[0073] When the recombinant expression vector according to the present disclosure contains the described regulatory gene, it may consequently maximize the yield efficiency of the active protein by obtaining a larger amount of soluble protein.

[0074] The present disclosure also relates to a cosmetic composition.

[0075] More specifically, the present disclosure is regarding a cosmetic composition including the above-described cell penetrating botulinum toxin recombinant protein as an active ingredient.

[0076] The cosmetic composition of the present disclosure may be prepared in any formulation conventionally prepared in the related art. For example, it can be formulated as a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, and wax foundation, and others, but it is not limited thereto. More specifically, it may be prepared in the form of a skin, a nutritional toner, a nutritional cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, or a powder.

[0077] The cosmetically effective carrier contained in the cosmetic composition of the present disclosure may be a carrier commonly used in the related art according to the formulation. When the formulation of the present disclosure is paste, cream, or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, or zinc oxide may be used as a carrier ingredient.

[0078] When the formulation of the cosmetic composition of the present disclosure is a solution or an emulsion, a solvent, a solubilizer, or an emulsifier may be used as a carrier ingredient. For example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol, or fatty acid ester of sorbitan may be used.

[0079] When the formulation of the present invention is a suspension, a liquid diluent such as water, ethanol, or propylene glycol, a suspending agent such as an ethoxylated isostearyl alcohol, a polyoxyethylene sorbitol ester, and a polyoxyethylene sorbitan ester, and microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tragacanth can be used.

[0080] When the formulation of the present disclosure is a surfactant containing cleansing, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinetic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide ether sulfates, alkylamidobetaines, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives, ethoxylated glycerol fatty acid esters, and others can be used as a carrier ingredient.

[0081] Ingredients included in the cosmetic composition of the present disclosure may include ingredients commonly used for cosmetic compositions besides active ingredients and carrier ingredients. For example, it may include moisturizers, antioxidants, air freshener, fillers, viscosity-increasing agents, dyes, colorings, surfactants, natural or synthetic oils, preservatives, penetrants, hydrating agents, antifungal agents, emulsifier solvents, softeners, deodorants, waxes, and others. It may include other ingredients commonly used in such products including selectively plant extracts, conditioning agents, pigmentation or whitening agents, sunscreens, humectants, vitamins, derivatives, and others.

[0082] In an exemplary embodiment, the cosmetic composition according to the present disclosure preferably further includes a transdermal penetration enhancer.

[0083] The terminology “transdermal penetration enhancer” used herein may refer to an ingredient that affects skin penetration among emulsifiers. In the present disclosure, it enhances the skin penetration and cell penetration of recombinant proteins. Although it can use one or more selected from the group consisting of lecithin, lauryl pyrrolidone, glyceryl monostearate, glycerol monooleate, glycerol monolaurate, propylene glycol monolaurate, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monostearate, polyoxyethylene sorbitan monolaurate, sorbitan monooleate, sorbitan monostearate, sorbitan monolaurate, and cetyl alcohol, glyceryl monostearate or cetyl alcohol is preferred.

[0084] In an exemplary embodiment, the transdermal penetration enhancer may be contained 0.5 w/w % or more based on the total weight of the composition. When transdermal penetration enhancer is included within the weight range, the cosmetic composition according to the present disclosure may maximize skin penetration.

[0085] The cosmetic composition according to the present disclosure may further include a sugar-alcohol that stabilizes the ingredients contained therein, and the sugar-alcohol may be mannitol, erythritol, xylitol, sorbitol, and others, but is not particularly limited thereto.

[0086] The cosmetic composition of the present disclosure also relates to a cosmetic composition for improving or preventing skin wrinkles.

[0087] The cosmetic composition of the present disclosure, as described above, can improve or prevent skin wrinkles when it is administrated locally because it includes the cell penetrating botulinum toxin recombinant protein as an active ingredient.

[0088] The terminology “local administration” used herein means directly administering a drug on, into, or near an animal body that requires a biological effect of the drug. Local administration excludes systemic routes such as intravenous or oral administration. Topical administration refers to applying a pharmaceutical agent on the skin of a person. That is, the “putting on the skin” type is also included as a form of the local administrations. The composition of the present disclosure is preferably administered by “applying it on” the skin transdermally for the above dermatologically and cosmetically desired effects.

[0089] Hereinafter, the present disclosure will be described in more detail using specific exemplary embodiments. However, these exemplary embodiments are to explain the present disclosure using examples only, and the scope of the present disclosure is not limited to these exemplary embodiments.

[Exemplary Embodiment 1] Preparation of a Novel CPP

[0090] Novel skin penetrating and cell penetrating peptides that can deliver the botulinum toxin light chain transdermally have been developed.

[0091] First, the structure and function of the botulinum toxin heavy and light chains were analyzed, and it was confirmed that it shows the most optimal cell permeability when the length of amino acids is between 11 and 15 due to the positive charge and structure of CCPs. In particular, considering that arginine has the best cell permeability, final 13 peptide types (amino acid sequence 1 to 13) according to the amino acid sequence of the protein by deriving proteins that are expected to have excellent cell permeability by checking the changes in cell permeability when each 11 and 12 arginine amino acid sequences are replaced with other amino acids.

[0092] The predicted cell permeability scores of the novel CPP CDPs 1 to 13 derived from the present disclosure using a database program that predicts cell permeability based on this were compared with those of the conventional CPPs, and it is shown in FIG. 1.

[Exemplary Embodiment 2] Preparation of Recombinant Expression Vector for the Production of GFP-Cargo Delivery Peptide Recombinant Protein

[0093] GFP-CDP1, GFP-CDP2, and GFP-CDP3 recombinant proteins were produced as a test group by binding them with green fluorescent protein (GFP) to evaluate the cell permeability with CDP1, CDP2 and CDP3, CPPs, developed by the company. Trans-activator of transcription (TAT), known as a cell penetrating protein, GFP-TAT, a recombinant protein of GFP, translocation domain 1 (TD1) called a CPP in the domestic patent (10-1882461), and GFP-TD1, a recombinant protein of GFP were prepared and used as a control group. GFP was also used as a negative control group.

[0094] The used GFP was obtained from the pCMV-GFP (#11153) of Addgene, and a CPP was attached behind GFP using a poly chain reaction (PCR) through the prepared primer. The sequence information of each primer is shown in [Table 1].

TABLE-US-00001 TABLE 1 GFP Forward TCGAAGGTAGGCATATGGTGAGCAAGGGCGAGG (SEQ ID primer NO: 17) Reverse GCTTGAATTCGGATCCTCACTTGTACAGCTCGTCCATGCCG primer AG (SEQ ID NO: 18) GFP-CDP1 Forward TCGAAGGTAGGCATATGGTGAGCAAGGGCGAGG (SEQ ID primer NO: 19) Reverse GCTTGAATTCGGATCCTCAGCAACGGGGTTTACGCAGACG primer GGAACGTTTCCCCTTGTACAGCTCGTCCAT (SEQ ID NO: 20) GFP-CDP2 Forward TCGAAGGTAGGCATATGGTGAGCAAGGGCGAGG (SEQ ID primer NO: 21) Reverse GCTTGAATTCGGATCCTCAGCATTTACGCTTACGCAAGCGC primer CAGATGCGGCACTTGTACAGCTCGTCCAT (SEQ ID NO: 22) GFP-CDP3 Forward TCGAAGGTAGGCATATGGTGAGCAAGGGCGAGG (SEQ ID primer NO: 23) Reverse GCTTGAATTCGGATCCTCAGGCAGGAGCGGCGGCGCAAAC primer GACGAATACGCAACCCCTTGTACAGCTCGTCCAT (SEQ ID NO: 24) GFP-TAT Forward TCGAAGGTAGGCATATGGTGAGCAAGGGCGAGG (SEQ ID primer NO: 25) Reverse GCTTGAATTCGGATCCTCATTGTGGTGGACGGCGACGCTGG primer CGACGTTTCTTGCGTCCCTTGTACAGCTCGTCCAT (SEQ ID NO: 26) GFP-TD1 Forward TCGAAGGTAGGCATATGGTGAGCAAGGGCGAGG (SEQ ID primer NO: 27) Reverse GCTTGAATTCGGATCCTCAACACTGATTCAAGAATTTGTTA primer ATGTTAATCATTGCTTTCTTGTACAGCTCGTCCAT (SEQ ID NO: 28)

[0095] The PCR started with a final volume of 500 with 1 μl of pCMV-GFP vector as a template, 0.5 μl of each 100 pmole primer, 0.5 μl of polymerase, 5 μl of 2.5 mM dNTP, and 5× buffer. The reaction condition was denaturing at 95° C. for 5 minutes, and then 25 repetitions of 30 seconds at 95° C., 30 seconds at 56° C., and 30 seconds at 72° C., and final amplification was performed at 72° C. for 5 minutes. After confirming this PCR product with agarose gel electrophoresis, it was prepared by cleaving it into Nde I and BamH I. The expression vector pCold I (TaKaRa #3360) with histidine-tag, lac operator, and cold shock protein A (cspA) promoter was prepared by cleaving Nde I and BamH I from multi cloning sites (MCS), and this was also confirmed by agarose gel electrophoresis. An expression vector was prepared by treating the insert and vector for 150 seconds at RT and ligating for 10 minutes on ice. This was transformed into E. coli top10 cells to prepare a final recombinant protein expression vector. This was done by requesting to Cosmo Genetech.

[Exemplary Embodiment 3] Expression and Purification of GFP-Cargo Delivery Peptide Recombinant Protein

[0096] A genetically modified organism was prepared by transforming a plasmid expressing the recombinant protein by applying the heat shock (42° C., 90 seconds) method to E. coli BL21 (TaKaRa #9126). The transformed strain was first cultured for about 18-22 hours at 37° C. in an LB medium containing 10 μl of ampicillin. As a secondary culture, 1 μl of primary cultured cells and 100 μl of ampicillin were added to 100 μl of LB medium and cultured at 37° C. until the OD 600 value of the cells reached 0.6-0.8.

[0097] The expression of the recombinant protein was induced while adding 0.5 mM IPTG (isopropyl β-d-1-thiogalactopyranoside), and it was cultivated for about 19 hours at 15° C. and 200 rpm. The cells were collected by centrifugation, and the cells were pulverized using a lysis buffer (xTractor buffer) provided by the Capturem™ His-Tagged Purification Maxiprep Kit (TaKaRa #635713) and a homogenizer. Then, it was centrifuged at 10,000 rpm and 4° C. for 20 minutes, and the supernatant was separated.

[0098] The purification process of the recombinant protein was to purify the supernatant using the Capturem™ His-Tagged Purification Maxiprep Kit. Afterward, the protein was put into a cellulose membrane and then it was dialyzed using 1 L phosphate buffer.

[0099] Electrophoresis was performed on a 10% SDSPAGE gel to test whether the recombinant protein was properly purified.

[0100] The results of the electrophoresis are shown in FIG. 3. In FIG. 3, M stands for “BIO RAD standard (#161-0377)”, UI stands for “Uninduced”, I stands for “Induced”, HS stands for “cell harvest & supernatant”, Ly stands for “Lysate”, P stands for “pellet”, FT stands for “Flow Through”, W stands for “Column wash”, and E stands for “Elution”.

[0101] As shown in FIG. 3, it was confirmed that the recombinant protein was well purified according to the above protocol considering that a high concentration of the recombinant protein was observed after elution on the SDS-PAGE gel.

[Exemplary Embodiment 4] Human Skin Tissue Permeability of GFP-Cargo Delivery Peptide Recombinant Protein

[0102] The purified GFP-cell penetrating peptide recombinant protein 20-30 μg was spread on the donated real human skin (HuSKIN™, HansBiomed Corp) at 4° C. for about 24 hours. The tissue was fixed at 4° C. for 24 hours with 4% paraformaldehyde after 24 hours, and it was dehydrated using 4.5% sucrose, 15% sucrose, and 30% sucrose.

[0103] The tissue that had undergone the dehydration process was prepared as cryosection (20 μm) using a Microm freezing microtome by requesting to the Korea Pathology Support. Afterward, GFP fluorescence was observed using a confocal microscopy after placing it on a slide.

[0104] Observation results are shown in FIGS. 4 to 6, respectively.

[0105] As shown in FIGS. 4 to 6, it was confirmed that the recombinant protein according to the present disclosure has a higher cell permeability than TAT and TD1 set as controls and GFP, a negative control.

[Exemplary Embodiment 5] Preparation of Recombinant Expression Vector for Producing Botulinum Toxin-Cargo Delivery Peptide Recombinant Protein

[0106] BTA-CDP1 and BTA-CDP3 recombinant proteins were prepared as test groups by combining CPPs to a portion of the botulinum toxin light and heavy chain to examine the botulinum toxin delivery efficacy of CDP1 and CDP3, which have meaningful effects among the CPPs developed by the company. Trans-activator of transcription (TAT), known as a cell penetrating protein, BTA-TAT, a recombinant protein of botulinum toxin, and BTA-TD1, a recombinant protein of translocation domain 1 (TD1) called a CPP in the domestic patent (Registration No. 10-1882461) and botulinum toxin were prepared respectively and used as control groups.

[0107] First, the A type light chain portion of botulinum toxin was prepared by synthesizing genes. A recombinant expression vector was prepared by attaching a CPP to the synthesized gene's C-terminal through PCR, ligating to pColdI vector by cleaving with NdeI/BamHI, and then transforming to TOP10 cell. This was conducted by requesting it to Cosmo Genetech.

[Exemplary Embodiment 6] Expression and Purification of Botulinum Toxin-Cargo Delivery Peptide Recombination Protein

[0108] A genetically modified organism was prepared by transforming a plasmid expressing the recombinant protein by applying the heat shock (42° C., 90 seconds) method to E. coli BL21 (TaKaRa #9126). The transformed strain was primarily cultured for about 18-22 hours at 37° C. in an LB medium containing 100 of ampicillin. As a secondary culture, 1 ml of primary cultured cells and 1000 of ampicillin were added to 100 ml of LB medium and cultured at 37° C. until the OD 600 value of the cells reached 0.6-0.8.

[0109] The expression of the recombinant protein was induced while adding 0.5 mM IPTG (isopropyl β-d-1-thiogalactopyranoside), and it was cultivated for about 19 hours at 15° C. and 200 rpm. The cells were collected by centrifugation, and the cells were pulverized using a lysis buffer (xTractor buffer) provided by the Capturem™ His-Tagged Purification Maxiprep Kit (TaKaRa #635713) and a homogenizer. Then, it was centrifuged at 10,000 rpm and 4° C. for 20 minutes, and the supernatant was separated.

[0110] The purification process of the recombinant protein was to purify the supernatant using a HisTrap FF (GE Healthcare) column. Afterward, the protein was put into a cellulose membrane and then it was dialyzed using 1 L phosphate buffer.

[0111] Electrophoresis was also performed on a 10% SDS-PAGE gel to test whether the recombinant protein was properly purified.

[0112] The results of the electrophoresis are presented in FIG. 7.

[0113] In FIG. 7, it was confirmed that the recombinant protein was well purified according to the above protocol considering that a high concentration of the recombinant protein was observed after elution on the SDS-PAGE gel.

[Exemplary Embodiment 7] Human Skin Tissue Permeability of Botulinum Toxin-Cargo Delivery Peptide Recombinant Protein

[0114] The process of labeling FITC on the purified botulinum toxin-cargo delivery peptide recombinant protein was conducted using a Fluoro Tag FITC conjugation kit (Sigma-Aldrich). The recombinant protein was dissolved in 0.1M Sodium Carbonate-Bicarbonate Buffer pH 9.0, and FITC isomer was slowly added thereto. Afterward, it was stirred at 37° C. for 1 hour. The recombinant protein to which FITC was attached was purified using a NAP-5 column (GE Healthcare).

[0115] 3 μg of recombinant protein fluorescently labeled with FITC was spread on the donated real human skin (HuSKIN™, HansBiomed Corp) at 4° C. for about 30 minutes. The tissue was fixed at 4° C. for 24 hours with 4% paraformaldehyde after 30 minutes, and it was dehydrated using 4.5% sucrose, 15% sucrose, and 30% sucrose.

[0116] The tissue that had undergone the dehydration process was prepared as cryosection (20 μm) using a Microm freezing microtome by requesting to the Korea Pathology Support. Afterward, FITC fluorescence was observed using a confocal microscopy after placing it on a slide.

[0117] The results of the FITC fluorescence observation are shown in FIG. 8.

[0118] As shown in FIG. 8, it was confirmed that the botulinum toxin-cargo delivery peptide 1 recombinant protein (BTA-CDP1) of the company had the highest cell permeability compared to the control groups (BTA-TAT and BTA-TD1) and the negative control group (PBS).

[Exemplary Embodiment 8] Skin Penetration Test of a Composition Containing a Botulinum Toxin-Cargo Delivery Peptide Recombinant Protein and a Transdermal Penetration Enhancer

[0119] A composition was prepared by mixing 3 μg of the recombinant protein fluorescently labeled with FITC prepared in the Exemplary Embodiment 7 using glycerol stearate (GMS), cetyl alcohol, which are transdermal penetration enhancers, and purified water.

[0120] The composition was spread on the donated real human skin (HuSKIN™, HansBiomed Corp) at 4° C. for about 30 minutes. The tissue was fixed at 4° C. for 24 hours with 4% paraformaldehyde after 30 minutes, and it was dehydrated using 4.5% sucrose, 15% sucrose, and 30% sucrose.

[0121] The tissue that had undergone the dehydration process was prepared as cryosection (20 μm) using a Microm freezing microtome by requesting to the Korea Pathology Support. Afterward, FITC fluorescence was observed using a confocal microscopy after placing it on a slide.

[0122] The results of FITC fluorescence observation are shown in FIG. 9.

[0123] As shown in FIG. 9, when the botulinum toxin-cargo delivery peptide recombinant protein (BTA-CDP1) was used with a transdermal penetration enhancer, higher cell permeability could be confirmed.

[Exemplary Embodiment 9] Cytotoxicity Test of Botulinum Toxin-Cargo Delivery Peptide Recombinant Protein

[0124] A WST-1 assay, measuring cell viability, was performed to evaluate the toxicity of the recombinant protein BT-CDP to skin cells. Human dermal fibroblasts were first cultured in a 96 well plate until it became at 5×10.sup.3/well, and then it was treated with 5 to 80 μg of recombinant protein and reacted for 24 hours. After the reaction, 10 μl of Cell Proliferation Reagent WST-1 (Sigma-aldrich) was added to each and reacted for an additional 4 hours. Thereafter, absorbance was measured between 420 and 480 nm using an ELISA reader. In this case, a botulinum toxin protein not bound to a CPP was used as a control group, and the results of absorbance measurement are shown in FIGS. 10 and 11.

[0125] As shown in FIGS. 10 and 11, the results of the WST-1 assay confirmed that the recombinant protein (5-80 μg) did not show toxicity, compared to TCPS.

[Exemplary Embodiment 10] SNAP-25 Cleavage Assay of Botulinum Toxin-Cargo Delivery Peptide Recombinant Protein

[0126] A cleavage assay was performed to measure the activity (proteolytic ability) of the botulinum toxin contained in the recombinant protein BTA-CDP. Among soluble N-ethylmaleimide-sensitive factor activating protein receptor (SNARE) proteins that botulinum toxin degrades in the body, SNAPtide® (Cat. #521, List Biological Laboratories, Inc., Campbell, Calif.), made by synthesizing a part of the original sequence of the SNAP-25 protein decomposed by botulinum toxin A type, and attaching a fluorescent substance was used. The proteolytic ability of botulinum toxin can be quantitatively measured by using the fluorescence resonance energy transfer (FRET) effect, which shows little fluorescence until it is decomposed by botulinum toxin and then emits light as the distance between the fluorescent substances on both ends increases when it is hydrolyzed by the toxin. First, samples were prepared in HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) buffer at a concentration of 100 μg/ml by measuring the concentration of the recombinant protein. 10 μM stock solution was prepared by dissolving the purchased SNAPtide® in DMSO. A 96 well clear bottom black plate (Corning®, CLS3603) was prepared for the reaction, the prepared recombinant protein was added to the well at a concentration of 10 μg/ml, and SNAPtide® was added to a well at a concentration of 5 μM. After mixing them, the reaction was initiated. The reaction was conducted at 37° C., and the fluorescence measurement was performed for about 2 hours at a wavelength of excitation 490 nm/emission 523 nm/cutoff 495 nm.

[0127] The recorded results are shown in FIGS. 12 and 13.

[0128] As shown in FIGS. 12 and 13, the results of the SNAP-25 cleavage assay revealed that the botulinum toxin-cargo delivery peptide recombinant protein activated botulinum toxin.

[0129] The results of Exemplary Embodiments 5 to 10 showed that the botulinum toxin-cell penetrating peptide recombinant protein according to the present disclosure made the skin penetration and/or cell penetration efficient to maximize the in vivo intrinsic efficacy of the botulinum toxin and secure convenience. Hence, it can be actively used as a topical agent for various disease treatment, aesthetic or cosmetic purposes, especially for a cosmetic composition.

[0130] The description of the present application is for exemplary embodiments, it is to be understood that the disclosure is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. Thus, it should be understood that the embodiments described above are illustrative and are not limited to the disclosed embodiments. For example, each component described as a single type may be implemented in a distributed manner, and similarly, components described as being distributed may also be implemented in a combined form.

[0131] The scope of the present application is indicated by the claims to be described later rather than the above-stated description. All changes or modified forms derived from the meaning, scope, and equivalent concepts of the claims should be interpreted as being included in the scope of the present application.