PROTEIN WITH DEXTRAN-SACCHARASE ACTIVITY, AND USES
20170247669 · 2017-08-31
Inventors
- Marlène Vuillemin (Ramonville-Saint-Agne, FR)
- Marion Claverie (Benejacq, FR)
- Claire Moulis (Viellevigne, FR)
- Magali Remaud-Simeon (Ramonville-Saint-Agne, FR)
- Pierre Monsan (Mondonville, FR)
- Etienne Severac (Pibrac, FR)
- Catherine Fontagne-Faucher (L'Isle Jourdain, FR)
Cpc classification
C12P19/18
CHEMISTRY; METALLURGY
A23L29/273
HUMAN NECESSITIES
A61K47/36
HUMAN NECESSITIES
A23V2002/00
HUMAN NECESSITIES
International classification
C12P19/18
CHEMISTRY; METALLURGY
A61K47/36
HUMAN NECESSITIES
Abstract
The invention relates to: a protein having dextran-saccharase activity and the sequence SEQ ID NO: 1 for an no acid sequence; a protein having dextran-saccharase activity and the sequence SEQ ID NO: 2 for an amino acid sequence; a complex containing a substrate and a protein with dextran-saccharase activity a method for synthesizing dextrans; and dextrans. The invention also relates to a method for synthesizing gluco-oligosaccharides and gluco-conjugates and to the resulting products.
Claims
1. A protein with dextransucrase activity that is selected from: (a) a protein having the amino acid sequence as set forth in SEQ ID NO:1, (b) a protein comprising an amino acid sequence that has at least 80% identity to the amino acid sequence set forth at positions 563 to 1282 of SEQ ID NO: 1, a protein comprising an amino acid sequence that has at least 85% identity to the amino acid sequence set forth at positions 563 to 1282 of SEQ ID NO: 1, (d) a protein comprising an amino acid sequence that has at least 90% identity to the amino acid sequence set forth at position 563 to 1282 of SEQ ID NO: 1, (e) a protein comprising an amino acid sequence that has at least 95% identity to the amino acid sequence set forth at positions 563 to 1282 of SEQ ID NO: 1, (f) a protein comprising an amino acid sequence that has at least 98% identity to the amino acid sequence set forth at positions 563 to 1282 of SEQ ID NO: 1, (g) a protein comprising an amino acid sequence that has at least 80%. at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence set forth at positions 563 to 1282 and 1316 to 1433 of SEQ ID NO:1, (h) a protein comprising an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%. or at least 98% identity' to the amino acid sequence set forth at positions 563 to 1282, 1316 to 1433 and 174 to 421 of SEQ ID NO:1, and (i) a protein comprising an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence set forth at positions 563 to 1282, 1316 to 1433 and 42 to 421 of SEQ ID NO:1.
2. A protein with dextransucrase activity that is selected from: (a) a protein having the amino acid sequence as set forth in SEQ ID NO: 2, (b) a protein comprising an amino acid sequence that has at least 80% identity to the amino acid sequence set forth at positions 522 to 1241 of SEQ ID NO:2, (c) a protein comprising an amino acid sequence that has at least 85% identity to the amino acid sequence set forth at positions 522 to 1241 of SEQ ID NO:2, (d) a protein comprising an amino acid sequence that has at least 90% identity to the amino acid sequence set forth at positions 522 to 1241 of SEQ ID NO:2, (e) a protein comprising an amino acid sequence that has at least 95% identity to the amino acid sequence set forth at positions 522 to 1241 of SEQ ID NO:2, (f) a protein comprising an amino acid sequence that has at least 98% identity to the amino acid sequence set forth at positions 522 to 1241 of the SEQ ID NO: 2, (g) a protein comprising an amino acid sequence that has at least 80%. at least 85%, at least 90%, at least 95%. or at least 98% identity to the amino acid sequence set forth at positions 522 to 1241 and 1275 to 1392 of SEQ ID NO:2, (h) a protein comprising an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence set forth at positions 522 to 1241, 1275 to 1392 and 133 to 380 of SEQ ID NO:2, and (i) a protein comprising an amino acid sequence that has at least 80%, at least 85%, at least 90% at least 95% or at least 98% identity to the amino acid sequence set forth at positions 522 to 1241, 1275 to 1392 and 1 to 380 of SEQ ID NO: 2.
3. The protein with dextransucrase activity of claim 2, which comprises the amino acid sequence set forth in SEQ ID NO: 2.
4. A complex, comprising a support; and the protein with dextransucrase activity of claim 1, wherein said protein with dextransucrase activity has been immobilized on said support.
5. A process for synthesizing dextrans; that is selected from: (a) a process that comprises contacting (i) sucrose in a synthesis medium with (ii) the protein with dextransucrase activity of claim 1, thereby to form dextrans, or (b) the process of (a) which further comprises isolating the dextrans.
6. A process for synthesizing dextrans that is selected from: (a) a process that comprises contacting (i) sucrose in a synthesis medium with (ii) the complex of claim 4, thereby to form dextrans, or (b) the process of (a) which further comprises isolatina the dextrans.
7. The process of claim 5, wherein the step of contacting to form dextrans is carried out either at a temperature of between 20° C. and 50° C., or at a temperature of between 25° C. and 45° C.
8. The process of claims 5, wherein the sucrose is present in the synthesis medium at either a concentration of between 50 and 600 g.l.sup.−1, or a concentration of between 50 and 400 g.l.sup.−1.
9. The process of claims 5, wherein the step of contacting to form dextrans takes place either at a pH that is between 4 and 7, or at a pH of approximately 5.75.
10. A dextran, having 100% a-1,6 glycosidic bonds, a polydispersity index I.sub.p of less than 1.5, and a weight-average molar mass M.sub.w that is selected from (i) a weight-average molar mass M.sub.w of between 2×10.sup.3 and 40×10.sup.3 g.mol.sup.−1, (ii) a weight-average molar mass M.sub.w of between 3.Math.10.sup.3 g.mol.sup.−1 and 32×10.sup.3 g.mol.sup.−1, and (iii) a weight-average molar mass M.sub.w of between 7×10.sup.3 and 25×10.sup.3 g.mol.sup.−1.
11. A process for synthesizing glucooligosaccharides that is selected from: (a) a process that comprises contacting (i) the protein with dextransucrase activity of claim 1 and (ii) a synthesis medium that comprises, sucrose and at least one carbohydrate acceptor, thereby to form glucooligosaccharides, and (b) the process of (a) which further comprises isolating the glucooligosaccharides.
12. A process for synthesizing glucoconjugate compound that is selected from: (a) a process comprising contacting (i) the protein with dextransucrase activity of claim 1 and (ii) a synthesis medium that comprises sucrose and at least one hydroxylated molecule, thereby to form glucoconjugate compounds, and (b) the process of (a) which further comprises isolating the glucoconjugate compounds.
13. A pharmaceutical, cosmetic or food-grade composition comprising the dextran of claim 10 as an active agent or as an acceptable excipient.
14. A process for synthesizing glucooligosaccharides that is selected from: (a) a process that comprises contacting (i) the complex of claim 4 and (ii) a synthesis medium that comprises sucrose and at least one carbohydrate acceptor, thereby to form glucooligosaccharides, and (b) the process of (a) which further comprises isolating the glucooligosaccharides.
15. A process for synthesizing glucoconjugate compounds that is selected from: (a) a process that comprises contacting (i) the complex of claim 4 and (ii) a synthesis medium that comprises sucrose and at least one hydroxylated molecule, thereby to form glucoconjugate compounds, and (b) the process of (a) which further comprises isolating the glucoconjugate compounds.
Description
FIGURES
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137] Left-hand graphs: HPSEC-RI profiles of the enzymatic reactions at t=24 h starting from 50 g.l.sup.−1, 100 g.l.sup.−1, 200 g.l.sup.−1, 300 g.l.sup.−1 and 400 g.l.sup.−1 of sucrose (curves going from the bottom to the top, respectively) with fixed temperature: 25° C. (A), 30° C. (B), 35° C. (C), 40° C. (D).
[0138]
[0139] Left-hand graphs: HPSEC-RI profiles of the enzymatic reactions at t=24 h at 25° C., 30° C., 35° C., 40° C. and 45° C. (curves going from the bottom to the top, respectively) with fixed initial sucrose concentration: 50 g.l.sup.−1 (A), 100 g.l.sup.−1 (B), 200 g.l.sup.−1 (C), 300 g.l.sup.−1 (D) and 400 g.l.sup.−1 (E).
[0140]
[0141]
[0142] B: HPSEC-RI profiles of the enzymatic reactions catalyzed by immobilized DsrM ΔPS ΔC-APY at t=24 h starting from 50 g.l -1, 100 g.l -1, 200 g.l.sup.−1, 300 g.l.sup.−1 and 400 g.l.sup.−1 of sucrose (curves going from the bottom to the top, respectively).
[0143]
[0144]
EXAMPLES
[0145] Example 1: Identification of the dsrm gene in the Leuconostoc citreum NRRL B-1299 genome and analysis of the primary structure of the corresponding protein.
[0146] The dsrm gene was identified in the genome of Leuconostoc citreum NRRL B-1299 by nucleotide blast against a database consisting of glucansucrase nucleotide sequences listed in glycoside hydrolase family 70 according to CAZY classification (Carbohydrate Active enZYme database, www.cazy.org/GH70_all.html).
[0147] The gene was translated into protein sequence using the Transeq software from EMBOSS (www.ebi.ac.uk/Tools/st/emboss_transeq/).
[0148] A sequence encoding a signal peptide was identified by the SignalP server 4.1 software (www.cbs.dtu.dk/services/SignalP/).
[0149] Multiple protein alignments (with the overall alignment software ClustalW2, available online, www.ebi.ac.uk/Tools/msa/clustalw2/) with other characterized glucansucrases made it possible to identify the conserved motifs of the catalytic core of DsrM, and to cut the enzyme up into various protein domains (A, B, C, IV and V).
[0150] The various identity and similarity percentages between protein sequences, indicated in the preliminary sheet for the invention, were calculated with the BlastP tool (protein-protein Blast) from the NCBI, available online (blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastp&PAGE_TYPE=BlastSearch&LINK_L OC=blasthome) and using the default parameters proposed by the site.
[0151] Example 2: Cloning the dsrm gene
[0152] The dsrm gene was amplified by PCR from the genomic DNA of Leuconostoc citreum NRRL B-1299 and using the two primers presented in table 1.
TABLE-US-00001 TABLE 1 Primer Sequence (5′ to 3′) Forward primer CACCATGAAAATAAAAGAAACAATTACCCGAAA (SEQ ID NO: 3) Reverse primer AAGCTTGCAAAGCACGCTTATCAATC (SEQ ID NO: 4)
[0153] The addition of the 4 bases, CACC, in the 5′ position of the forward primer (underlined in table 1) allowed the correct insertion of the PCR fragment into the entry vector pENTR/D/TOPO (Life Technologies), in order to subsequently perform a cloning using the Gateway technology. A positive entry clone (entry vector containing the PCR fragment in the desired sense) was selected and recombined with the destination vector pET-53-DEST (Novagen) using the LR clonase enzyme mix II (Life Technologies). The positive recombinant clones were selected and analyzed by restriction. The absence of mutation in the plasmids was confirmed by sequencing (GATC).
[0154] Example 3: Cloning of the dsrm Δps Δc-apy gene.
[0155] The dsrm Δps Δc-apy gene was amplified by PCR from the plasmid pET-55/DsrM previously constructed in example 2, and using the two primers presented in table 2.
TABLE-US-00002 TABLE 2 Primer Sequence (5′ to 3′) Forward primer CACCCAAACGCCGGTTGGTACAACACAG (SEQ ID NO: 5) Reverse primer TTTTGCCATCGTACCATCGTTATT (SEQ ID NO: 6)
[0156] The addition of the 4 bases, CACC, in the 5′ position of the forward primer (underlined in table 2) allowed the correct insertion of the PCR fragment into the entry vector pENTR/D/TOPO (Life Technologies), in order to subsequently perform a cloning using the Gateway technology. A positive entry clone (entry vector containing the PCR fragment in the desired sense) was selected and recombined with the destination vector pET-53-DEST (Novagen) using the LR clonase enzyme mix II (Life Technologies). The positive recombinant clones were selected and analyzed by restriction. The absence of mutation in the plasmids was confirmed by sequencing (GATC).
[0157] Example 4: Heterologous expression of dsrm and dsrm Δps Δc-apy in Escherichia coli
[0158] For the production of the recombinant enzymes, Escherichia coli BL21 star DE3 cells were transformed with the corresponding (pET-55/dsrm or pET-55/dsrm Δps Δc-apy) plasmid constructed according to examples 2 and 3. 300 μl of the transformation mix were inoculated into 30 ml of LB (Lysogeny Broth) medium, supplemented with 100 μg.ml.sup.−1 of ampicillin, and incubated overnight at 37° C. in order to prepare a preculture. Cultures of 11 in modified ZYM5052 medium (1% glycerol, 0% glucose, 1% lactose, Studier, 2005) were thus inoculated at an initial OD.sub.600 nm of 0.05 using the preculture from the day before, then incubated for 26 hours at 21° C. and 150 rpm. At the end of fermentation, the culture media are centrifuged (15 min, 6500 rpm, 4° C.) and the pellets are concentrated to an OD of 80 in 50 mM of sodium acetate buffer, pH 5.75.
[0159] In order to obtain the recombinant enzyme (produced intracellularly by Escherichia coli), the cells are ruptured with ultrasound according to the following protocol: 5 cycles of 20 seconds at 30% of the maximum power of the probe, under cold conditions, with 4 minutes of rest in ice between each cycle. The sonication supernatant (containing the soluble recombinant enzyme) is then recovered after 30 minutes of centrifugation (10 000 rpm, 10° C.) and stored at 4° C.
[0160] Example 5: Method of determining the enzymatic activity by the DNS method.
[0161] One glucansucrase enzymatic unit represents the amount of enzyme which releases one μmol of fructose per minute, at 30° C., from 100 g.l.sup.−1 of sucrose in 50 mM of sodium acetate, at pH 5.75.
[0162] The activity is determined by measuring the initial rate of production of the reducing sugars using the dinitrosalicylic acid (DNS) method. During a time course, 100 μl of reaction medium are removed and the reaction is stopped by adding an equivalent volume of DNS. The samples are then heated for 5 min at 95° C., cooled in ice, and diluted 50/50 in water, and the absorbance is read at 540 nm. A standard range from 0 to 2 of fructose makes it possible to establish the link between the absorbance value and concentration of reducing sugars.
[0163] Example 6: Immobilization of the truncated dextransucrase DsrM ΔPS ΔC-APY
[0164] Immobilization was carried out by reacting weights varying between 0.1 g and 0.6 g of different commercial supports with 2.5 ml of sonication supernatant containing the recombinant enzyme DsrM ΔPS ΔC-APY. The pH of this enzymatic solution is controlled and must be between 5.75 and 7.5. The reaction is conducted at 4° C. with gentle agitation (100 rpm). The immobilization is stopped after 16 hours of reaction by filtration and washing with three successive volumes (10 ml) of sodium acetate buffer, pH 5.75, at 50 mM. The immobilized enzyme is stored at 4° C. before use.
[0165] The characteristics of the supports tested are given in
[0166] Hereinafter, such an immobilized enzyme is referred to as “immobilized DsrM ΔPS ΔC-APY”.
[0167] The different immobilization supports were tested for their ability to fix the enzyme DsrM ΔPS ΔC-APY. The screening consisted in placing 250 mg weights of each support in contact with 2.5 ml of sonication supernatant (free initial activity: 16.5 U/ml).
[0168] The fixed activity following reaction and washing on the different supports was measured on aliquots of controlled weight from each enzyme batch produced. The reaction volume was also adapted to the activity of each batch, with larger volumes enabling the measurement of the most active enzymes. The results of the screening are given in table 3 below.
TABLE-US-00003 TABLE 3 Weight of enzyme Production of immobilized in Reaction reducing sugars Activity Support reaction (mg) volume (ml) (μmol/min/reaction) (U/g) Purolite ECR8214 ® 39.5 3 1.03 77.94 Sprinbeads AO110 ® 35.8 3 0.93 77.77 Sepabeads ECQ1A ® 36.7 3 0.43 35.34 Purolite ECR1604 ® 44.4 3 0.46 31.19 Purolite ECR4204 ® 56.5 1 1.71 30.27 Sprinbeads AA130 ® 54.4 1 1.32 24.26 Sprinbeads SN110 ® 43.4 3 0.32 21.88
[0169] The different supports, as a function of the measured activity, may be grouped into two categories: [0170] the 2 supports, Purolite ECR8214® and Sprinbeads AO110®, which have the best activities, of the order of 78 U/g; [0171] 5 supports having average but good activities, of between 22 and 35 U/g;
[0172] Only the support Purolite ECR8214® was then used in order to optimize the immobilization, especially by optimizing immobilization yields, fixed activities, etc.
[0173] The optimization of the immobilization of DsrM ΔPS ΔC-APY on Purolite ECR8214® consisted in varying the weight of support between 100 mg and 600 mg placed in contact with a fixed amount of free enzyme (2.5 ml of sonication supernatant having an initial activity of 45 U/ml).
[0174] The calculation of three different yields makes it possible to characterize the immobilization: [0175] The fixation yield R.sub.fixation, which quantifies the total share of enzyme fixed to the supports
[0178] The results of the immobilization are given in table 4 below.
TABLE-US-00004 TABLE 4 Weight for Immobilized immobilization activity Fixation Immobilization (mg) U/g yield % yield % Efficiency % 105.5 144.3 44 14 31 248.7 147.2 58 33 56 355.6 146.0 80 46 58 456.7 148.2 92 60 66 604.0 132.3 97 71 73
[0179] The best immobilization condition is defined as being the result of a compromise between these different yields and the activity of the immobilized biocatalyst obtained.
[0180] First of all, it is observed that the use of a solution of free DsrM ΔPS ΔC-APY with higher activity (45 U/ml vs 16 U/ml used during the screening of the supports) makes it possible to significantly increase the activity when fixed on the support. Indeed, the measured activities are increased by a factor of 2 (cf. table 4, activities of the order of 140 U/ml).
[0181] Moreover, weights of Purolite ECR8214® support of between 100 and 450 mg make it possible to obtain a fixed activity around 140 U/g. Without wishing to be bound by any theory, the inventors think that under these conditions, the support is totally saturated with protein. This is moreover confirmed by the fixation and immobilization yields obtained which tend to increase with the weight of support used. Above 600 mg placed in contact with 2.5 ml of sonication supematant, the activity starts to decrease (approximately 132 U/g).
[0182] The best immobilization condition for the Purolite ECR8214® support is therefore placing in contact with an amount of between 450 and 600 mg of support, typically of approximately 500 ml, with 2.5 ml of sonication supernatant. These conditions enable the best activity to be obtained (approximately 140 U/g) while limiting enzyme losses (high yields).
[0183] Hereinafter, “immobilized DsrM ΔPS ΔC-APY” is a dextransucrase DsrM ΔPS ΔC-APY immobilized on Purolite ECR8214® support.
[0184] Example 7: Determination of the production yields of the whole dextransucrase DsrM and of the truncated dextransucrase DsrM ΔPS ΔC-APY
[0185] The production yields are determined by anion exchange chromatography (HPAEC-PAD, High Performance Anion Exchange Chromatography with Pulsed Amperometric Detection), and by size exclusion chromatography (HPSEC, High Performance Size Exclusion Chromatography).
[0186] HPAEC-PAD analysis
[0187] The sugars, glucose, fructose, leucrose and sucrose are separated on a Dionex CarboPac PA-100 column by means of a sodium acetate gradient of from 6 to 500 mM over 36 min, containing 150 mM of sodium hydroxide. Standard ranges of 5, 10, 15 and 20 mg.kg.sup.−1 of these sugars are prepared and enable their quantification.
[0188] The production yields, that is to say the share of glucose derived from the sucrose, that is incorporated into the formation of free glucose, of leucrose and of dextran, are calculated as follows:
[0189] HPSEC analysis
[0190] The sugars are separated as a function of their size on two gel permeation columns placed in series (Shodex OH Pack 805 and 802.5) in an oven, the temperature of which is kept at 70° C. The flow rate of the mobile phase (0.45 M NaNO.sub.3, 1% ethylene glycol) is 0.3 ml.min.sup.−1. The samples are diluted in the same solvent as the eluent at 10 g.l.sup.−1 maximum total sugars.
[0191] Analysis of the reaction products by size exclusion chromatography makes it possible to calculate the share of glucosyl units derived from the sucrose and used in the production of dextran:
[0192] Whole dextransucrase DsrM
[0193] It has been demonstrated here that the enzyme DsrM is a very good polymerase. Indeed, chromatographic analyses (HPAEC-PAD and HPSEC-RI) carried out following dextran synthesis starting from 100 g.l.sup.−1 of sucrose, at 30° C., pH 5.75, show that 81% of the glucosyl units derived from the substrate are used for the production of dextran. Only 4% and 15% of these units are incorporated into the synthesis of free glucose and of leucrose, respectively.
[0194] Truncated dextransucrase DsrM ΔPS ΔC-APY
[0195] It has been demonstrated here that the truncated dextransucrase DsrM ΔPS ΔC-APY is also an excellent polymerase. Indeed, chromatographic analyses (HPAEC-PAD and HPSEC-RI) carried out following dextran synthesis starting from 100 g.l.sup.−1 of sucrose, at 30° C., pH 5.75, show that 85% of the glucosyl units derived from the substrate are used for the production of the polymer. Only 3% and 12% of these units are lost by incorporation into the synthesis of free glucose and of leucrose, respectively.
[0196] Example 8: Method for determining the molar mass of the dextrans by HPSEC analysis
[0197] A standard range produced with commercial dextrans of 503 000, 68 400, 34 100, 11 300 g.mol.sup.−1, and also maltopheptose, sucrose and fructose, made it possible to determine the molar mass of the dextrans synthesized by DsrM, DsrM ΔPS ΔC-APY or immobilized DsrM ΔPS ΔC-APY.
[0198] Example 9: Determination of the optimal working conditions of the whole dextransucrase DsrM and of the truncated dextransucrase DsrM ΔPS ΔC-APY
[0199] Effect of temperature
[0200] The optimal temperature value is determined by measuring the activity of the crude enzymatic extract at various temperatures (between 23 and 50° C.) starting from 100 g.l.sup.−1 of sucrose in 50 mM of sodium acetate buffer, pH 5.75.
[0201] As can be seen in
[0202] Effect of pH
[0203] The effect of pH on the enzymatic activity of the crude extract is measured at 30° C. starting from 100 g.l.sup.−1 of sucrose, in 50 mM of phosphate citrate buffer, for pH values of between 3.5 and 8 (intervals of 0.5).
[0204] As can be seen in
[0205] As can be seen in
[0206] Example 10: Production of dextrans of different molar masses
[0207] Enzymatic reactions with DsrM, DsrM ΔPS ΔC-APY and immobilized DsrM ΔPS ΔC-APY were carried out at 1 U/mL, starting from different initial sucrose concentrations (50, 100, 200, 300 and 400 g.l.sup.−1) and optionally at different temperatures (25, 30, 35, 40 and 45° C.), in sodium acetate buffer, 50 mM, pH 5.75.
[0208] Samples were taken at starting and finishing times (24 h) (the enzymatic reaction was stopped by heating at 95° C. for 5 minutes) and stored at -20° C. before being analyzed by HPAEC-PAD, as explained in example 7, in order to control the production yields, and by size exclusion chromatography (HPSEC), as explained in example 8, in order to determine the molecular weight of the dextrans synthesized.
[0209] As regards the assays on immobilized DsrM ΔPS ΔC-APY, the reaction media are centrifuged in order to eliminate the solid residues of the immobilized enzyme.
[0210] Whole dextransucrase DsrM
[0211] A linear variation in the size of the products as a function of the initial sucrose concentration is observed (temperature fixation).
[0212] It is thus possible to control the-molar mass of the dextran synthesized by the whole form of DsrM, by varying the initial substrate concentration, at fixed temperature. Thus, for example at 25° C., it is possible to obtain a panel of dextrans, the average molar mass of which varies between 32×10.sup.3 and 6.5×10.sup.3 g.mol.sup.−1 over a range of initial substrate concentrations extending from 100 to 500 g.l.sup.−1 (
[0213]
[0214] Truncated dextransucrase DsrM ΔPS ΔC-APY
[0215] As can be seen in
[0216] It is thus possible to very precisely control the molar mass of the dextran synthesized by the truncated dextransucrase DsrM ΔPS ΔC-APY, by varying the initial substrate concentration, at fixed temperature (or vice-versa).
[0217] Thus, by way of example, by fixing the temperature at 25° C., the truncated dextransucrase DsrM ΔPS ΔC-APY produces a dextran of an average molar mass of 25×10.sup.3 g.mol.sup.−1 starting from 50 g.l.sup.−1 of sucrose and a dextran of an average molar mass of 8×10.sup.3 g.mol.sup.−1 starting from 400 g.l.sup.−1 of sucrose.
[0218] Moreover, it is noted that the dextrans synthesized are barely polydisperse, with the exception of the polymers produced starting from high sucrose concentration (400 g.l.sup.−1).
[0219] It is also noted that it is possible to cover a broader spectrum of products, in terms of molecular weights, at low temperatures or starting from low sucrose concentrations.
[0220] Similarly, at an initial sucrose concentration fixed at 50 g.l.sup.−1, it is possible to obtain dextrans, the average molar mass of which is between 25×10.sup.3 g.mol.sup.−1 and 7×10.sup.3 g.mol.sup.−1 over a temperature range extending from 25 to 45 ° C.
[0221] Moreover, the production outcomes hardly vary as a function of the experimental conditions. The HPAEC-PAD analyses carried out show that for all the reactions tested, more than 81% of the glucosyl units derived from the substrate are used for the production of the polymer during the use of the truncated dextransucrase DsrM ΔPS ΔC-APY.
[0222]
[0223] Immobilized dextransucrase DsrM ΔPS ΔC-APY
[0224] As can be seen in
[0225] Moreover, the dispersity of the dextrans obtained is similar between the two enzyme forms (dextransucrase DsrM ΔPS ΔC-APY and immobilized dextransucrase DsrM ΔPS ΔC-APY) (
[0226] Finally, the dextransucrase DsrM ΔPS ΔC-APY immobilized on Purolite ECR8214® support has the particularity of producing dextrans of lower molar masses than those produced by the dextransucrase DsrM ΔPS ΔC-APY under identical conditions. For example, for an initial concentration of 100 g.l.sup.−1 of sucrose, a dextran of a molar mass of 9.4×10.sup.3 g.mol.sup.−1 is obtained with the non-immobilized dextransucrase DsrM ΔPS ΔC-APY whereas a dextran of a molar mass of 4.7×10.sup.3 g.mol.sup.−1 is obtained with the immobilized dextransucrase DsrM ΔPS ΔC-APY (
[0227] Example 11: Analysis of the nature of the bonds of the dextrans produced by the whole dextransucrase DsrM and by the truncated dextransucrase DsrM ΔPS ΔC-APY
[0228] After lyophilization, 20 mg of crude reaction medium (after total consumption of the sucrose) are diluted in 0.5 ml of deuterated water and analyzed by proton NMR with the Bruker Avance spectrometer (500 MHz). The spectra are then processed and interpreted using the TOPSPIN 3.0 software.
[0229] Whole dextransucrase DsrM
[0230] It was demonstrated by the NMR analyses that the product synthesized from DsrM and 100 g.l.sup.−1 of sucrose alone, at 30° C. in 50 mM of sodium acetate, pH 5.75, is a polymer of glucosyl units bonded exclusively (100%) in a-1,6 (
[0231] The product synthesized from DsrM is therefore a perfectly linear dextran, and DsrM is a dextransucrase which is very specific to polymerization by a-1,6-type glycosidic bonds.
[0232] Truncated dextransucrase DsrM ΔPS ΔC-APY
[0233] It was demonstrated by the NMR analyses that, just as for the dextransucrase DsrM, the product synthesized from the truncated form DsrM ΔPS ΔC-APY and 100 g.l.sup.−1 of sucrose alone, at 30° C. and pH 5.75, is a polymer of glucosyl units bonded exclusively (100%) in a-1,6 (
[0234] The product synthesized from the truncated form DsrM ΔPS ΔC-APY is therefore a perfectly linear dextran, and DsrM ΔPS ΔC-APY is a dextransucrase which is very specific to polymerization by a-1,6-type glycosidic bonds.
[0235] Example 12: Production of glucooligosaccharides by acceptor reaction
[0236] Acceptor reactions were carried out using 1 U.ml.sup.−1 of DsrM ΔPS ΔC-APY and immobilized DsrM ΔPS ΔC-APY, starting from initial sucrose concentrations varying from 60 to 333 g.l.sup.−1 and from glucose concentrations (in the role of carbohydrate acceptor) varying from 83 to 333 g.l.sup.−1. The syntheses took place at a temperature of 30° C. and in sodium acetate buffer, 50 mM, pH 5.75. The enzymatic reactions were stopped by heating at 95° C. for 5 minutes after 24 hours.
[0237] The different samples were then analyzed by HPSEC as explained in example 8 in order to determine the average molar mass of the products synthesized.
[0238] The results obtained for DsrM ΔPS ΔC-APY, i.e. the protein with dextransucrase activity having the sequence SEQ ID NO: 2 as amino acid sequence, starting from different sucrose concentrations and glucose acceptor concentrations, are presented in table 5 below:
TABLE-US-00005 TABLE 5 Total Glucooligosaccharides [Glucose]/ dry weight Glucose Sucrose molar mass [Sucrose] ratio.sup.a (g .Math. l.sup.−1) (g .Math. l.sup.−1) (g .Math. l.sup.−1) (g .Math. mol.sup.−1) 1.25 375 167 208 1.9 × 10.sup.3 2.31 375 113 262 2.7 × 10.sup.3 1.25 198 88 110 3.4 × 10.sup.3 0.50 500 333 167 0.8 × 10.sup.3 1.25 375 167 208 1.9 × 10.sup.3 0.19 375 315 60 0.7 × 10.sup.3 1.25 552 245 307 1.1 × 10.sup.3 2.00 500 167 333 1.6 × 10.sup.3 1.25 375 167 208 1.9 × 10.sup.3 0.50 250 167 83 1.6 × 10.sup.3 2.00 250 83 167 1.6 × 10.sup.3 1.25 375 167 208 1.9 × 10.sup.3 .sup.aRatio calculated from concentrations by weight
[0239] The results obtained for immobilized DsrM ΔPS ΔC-APY, i.e. the protein with dextransucrase activity having the sequence SEQ ID NO: 2 as amino acid sequence, immobilized on ECR8214® as described in example 6, starting from different sucrose concentrations and glucose acceptor concentrations, are presented in table 6 below:
TABLE-US-00006 TABLE 6 [Glc]/ Total dry Glucooligosaccharides [Sucrose] weight [Glucose] [Sucrose] molar mass ratio.sup.a (g .Math. l.sup.−1) (g .Math. l.sup.−1) (g .Math. l.sup.−1) (g .Math. mol.sup.−1) 1.25 375 167 208 1.5 × 10.sup.3 2.31 375 113 262 2.0 × 10.sup.3 1.25 198 88 110 2.4 × 10.sup.3 0.50 500 333 167 0.7 × 10.sup.3 1.25 375 167 208 1.6 × 10.sup.3 0.19 375 315 60 0.7 × 10.sup.3 1.25 552 245 307 1.0 × 10.sup.3 2.00 500 167 333 1.4 × 10.sup.3 1.25 375 167 208 1.6 × 10.sup.3 1.25 375 167 208 1.5 × 10.sup.3 0.50 250 167 83 1.5 × 10.sup.3 2.00 250 83 167 2.3 × 10.sup.3 1.25 375 167 208 1.6 × 10.sup.3 .sup.aRatio calculated from concentrations by weight
[0240] Thus, it has been demonstrated here that, with the synthesis conditions used, the use of dextransucrases according to the invention makes it possible at least to synthesize glucooligosaccharides of a medium molar mass ranging from 0.7×10.sup.3 to 3.4×10.sup.3 g.mol.sup.−1.
[0241] Example 13:
[0242] The commercial dextran of 11 300 g/mol supplied by Sigma (ref D-9260, batch 74H0764) was compared to the dextran synthesized by the process of the invention starting from 300 g/l of sucrose in sodium acetate buffer at pH 5.75 and a temperature of 30° C. in order to obtain a molar mass of 11 300 g/mol. Analysis by size exclusion chromatography on Shodex SB-805 and SB-802.5 columns in series shows that the population of dextrans obtained by virtue of the process of the invention is markedly less polydisperse than the commercial dextran.
REFERENCES
[0243] (1) Mage and Kabat, Immunochemical studies on dextrans; III. The specificities of rabbit antidextrans. Further findings on antidextrans with 1,2- and 1,6-specificities; 1963; Vol. 91, p. 634-640
[0244] (2) De Belder, Dextran; Amersham Biosciences; 2003
[0245] (3) Glucansucrases: Three-dimensional structures, reactions, mechanism, alpha-glucan analysis and their implications in biotechnology and food applications Lemhuis et al., Journal of Biotechnology, January 2013, vol 163, Issue 2, 250-272
[0246] (4) A method for determination of invertase activity, Sumner & Howell, Journal of biological chemistry, 1935, vol 108, Issue 51
[0247] (5) Moulis C, Vaca Medina G, Suwannarangsee S, Monsan P, Remaud-Simeon M, Potocki-Veronese G (2008) One-step synthesis of isomalto-oligosaccharide syrups and dextrans of controlled size using engineered dextransucrase. Biocatal. Biotransformation. Taylor & Francis, pp 141-151
[0248] (6) Kim et al., Dextran molecular size and degree of branching as a function of sucrose concentration, pH, and temperature of reaction of Leuconostoc mesenteroides B-512FMCM dextransucrase; Carbohydrate Research 338 (2003) 1183-1189
[0249] (7) High-level production and purification of a fully active recombinant dextransucrase from Leuconostoc mesenteroides NRRL B-512F, Moulis et al, FEMS Microbiology Letters, August 2006, vol 261, Issue 2, 203-210
[0250] (8) Kothari et al, Structural Characterization of Enzymatically Synthesized Dextran and Oligosaccharides from Leuconostoc mesenteroides NRRL B-1426 Dextransucrase. ISSN 0006-2979, Biochemistry (Moscow), 2013, Vol. 78, No. 10, pp. 1164-1170.
[0251] (9) Amari et al, Characterization of a novel dextransucrase from Weissella confusa isolated from sourdough. Appl Microbiol Biotechnol (2013) 97:5413-5422
[0252] (10) Kralj et al, Glucan synthesis in the genus Lactobacillus: isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains; Microbiology (2004), 150, 3681-3690.
[0253] (11) Striegel et al, An SEC/MALS study of alteman degradation during size-exclusion chromatographic analysis; Anal Bioanal Chem (2009) 394:1887-1893
[0254] (12) Dextran: effect of process parameters on production, purification and molecular weight and recent applications, Vettori et al., Dialogos & Ciencia, ISSN 1678-0493, no 31, September 2012
[0255] (13) GOULAS, A. K. et al. Synthesis of isomaltoligosaccharides and oligodextrans by the combined use of dextransucrase and dextransase. Enzyme Microb. Technol., 35, 2004. 327-338.
[0256] (14) Naessens et al., M. et al. Leuconostoc dextransucrase and dextran: production, properties and applications. J. Chem. Technol. Biotechnol., 80, 2005. 845-860.
[0257] (15) EGGLESTON AND COTE, G. L. Oligosaccharides in food and agriculture. Washington, D.C.: ACS symposium series 849, 2003. p. 1-15.
[0258] (16) Functional Polymers Based on Dextran, Thomas Heinze, Tim Liebert, Brigitte Heublein, Stephanie Hornig, Adv Polym Sci (2006) 205: 199-291, DOI 10.1007/12_100.
[0259] (17) Structure and macromolecular properties of Weissella confusa and Leuconostoc citreum dextrans with a potential application in sourdough, Ndegwa Henry MaMa, 1st June 2012, University of Helsinki, Department of Food and Environmental Sciences, Chemistry and Biochemistry Division.