PROGENITOR CELLS, METHOD FOR PREPARATION THEREOF AND USES THEREOF
20170247660 · 2017-08-31
Assignee
Inventors
Cpc classification
C12N5/0682
CHEMISTRY; METALLURGY
A61P25/14
HUMAN NECESSITIES
A61P29/00
HUMAN NECESSITIES
A61P25/18
HUMAN NECESSITIES
A61P7/00
HUMAN NECESSITIES
A61P9/10
HUMAN NECESSITIES
C12N5/0668
CHEMISTRY; METALLURGY
A61P25/28
HUMAN NECESSITIES
C12N2509/00
CHEMISTRY; METALLURGY
International classification
Abstract
The present application provides progenitor cells and a preparing method thereof. The preparing method comprises obtaining a tissue sample containing myometrium from uterus, treating the tissue sample with collagenase, and culturing the treated tissue sample to obtain the progenitor cells, wherein the progenitor cell is multipotent and immunomodulatory. The present application also provides a method for treating a degenerative disease, an ischemic disease or a disease caused by abnormal immune response comprising administering the progenitor cells to a patient subjecting the disease.
Claims
1. A method for preparing progenitor cells, comprising: obtaining a tissue sample containing myometrium from uterus, treating the tissue sample with an enzyme to remove fibrous tissue, and culturing the treated tissue sample to obtain the progenitor cells, and wherein the progenitor cells are multipotent and immunomodulatory and have negative expression of cell surface marker CD34.
2. The method of claim 1, wherein the uterus is from hysterectomies.
3. The method of claim 1, wherein the tissue sample is a biopsy sample, or an exfoliation sample.
4. The method of claim 1, which further comprises removing endometrium and serosal from the tissue sample prior to treating the tissue sample with collagenase.
5. The method of claim 1, wherein the enzyme is collagenase.
6. The method of claim 1, wherein the treated tissue sample is cultured in a serum-supplemented medium.
7. The method of claim 1, wherein the progenitor cells have positive expression of cell surface marker CD44, CD73, CD90, CD105, or any combination thereof.
8. The method of claim 1, wherein the progenitor cells have negative expression of cell surface marker CD31, CD14, CD45, CD19, HLA-DR, SidePop or any combination thereof.
9. Progenitor cells prepared according to claim 1, which have positive expression of cell surface markers CD44, CD73, CD90 and CD105, and negative expression of cell surface markers CD31, CD34, CD14, CD45, CD19, HLA-DR and SidePop.
8. The progenitor cells of claim 9, which are capable of osteogenesis, adipogenesis, chondrogenesis, and neurogenesis.
10. The progenitor cells of claim 9, which have suppressive effects on CD4 and CD8 T lymphocytes.
11. A method for treating a degenerative disease, an ischemic disease or a disease caused by abnormal immune response comprising administering progenitor cells prepared according to claim 1 to a patient subjecting the disease.
12. The method of claim 11, wherein the degenerative disease comprises Parkinson's disease, Alzheimer's disease, Huntington's disease, cerebral atrophy, cerebellar atrophy, schizophrenia and dementia.
13. The method of claim 11, wherein the ischemic disease comprises stroke, cerebral apoplexy, cerebral hemorrhage, cerebral infarction, head trauma, vascular dementia and myocardial infarction.
14. The method of claim 11, wherein the disease caused by abnormal immune response comprising autoimmune disease or graft rejection of organ transplantation.
15. The method of claim 14, wherein the autoimmune disease comprises system lupus erythematosus, multiple sclerosis, rheumatoid arthritis, type 1 diabetes mellitus, coeliac disease, Sjögren's syndrome, Hashimoto's thyroiditis, Graves' disease, and idiopathic thrombocytopenic purpura.
16. The method of claim 11, wherein the progenitor cells have positive expression of CD44, CD73, CD90 and CD105, and negative expression of CD31, CD34, CD14, CD45, CD19, HLA-DR and SidePop.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0013]
[0014]
[0015]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0016] The present application describes a method for preparing progenitor cells comprising obtaining a tissue sample containing myometrium from uterus. The isolated progenitor cell is multipotent and immunomodulatory.
[0017] As used herein, the term “myometrium” refers to tissue derived from the middle layer of the uterine wall.
[0018] As used herein, the term “uterus” encompasses the cervical canal and uterine cavity.
[0019] The multipotent and immunomodulatory progenitor cells of the present application can be obtained from any tissue sample containing myometrium of any suitable source from any suitable animal. In one embodiment, the suitable animal is an mammal such as a rodent, primate, carnivora, artiodactyla and the like, preferably a primate.
[0020] In one embodiment, the tissue sample can be obtained from non-pathological post-natal uterus.
[0021] In one preferred embodiment, the tissue sample is obtained from the human uterine corpus.
[0022] In one embodiment, the uterus can be from hysterectomies. Hysterectomy is the most common surgical procedure performed on non-pregnant woman. The method of the present application allows for the efficient isolation of uterine myometrium-derived multipotent progenitors (MDMPs) from post-hysterectomy specimens—which is to be discarded—with multilineage differentiation capacity, immunomodulation, and high proliferative potential. In addition, the method of the present application is to prepare the progenitor cells from commonly available surgical to ‘waste’ has high therapeutic applicability, since no further invasive procedure need to be performed and no ethical concerns are raised.
[0023] In the method of present application, the tissue sample containing myometrium is treated with an enzyme to remove fibrous tissue. It is one-step enzyme treatment, and none of further steps such as filtration and gradient selection is needed. In one embodiment, the enzyme includes collagenase. The enzyme-treated tissue sample is then cultured in a serum-supplemented medium to obtain the progenitor cells. In one embodiment, the treated tissue sample is cultured in a complete medium supplemented by a serum and an antibiotic.
[0024] The present application also provides progenitor cells obtained from the above method. The progenitor cells are unique, differing from prior arts in terms of isolation method, differentiation capacity and cell surface marker expression profile.
[0025] The progenitor cells have negative expression of cell surface marker CD34, i.e. CD34(−). In one embodiment, the progenitor cells have positive expression of cell surface marker CD44, CD73, CD90, CD105, or any combination thereof. In one embodiment, the progenitor cells have negative expression of cell surface marker CD31, CD14, CD45, CD19, HLA-DR, Side Population (SidePop) or any combination thereof. In one preferred embodiment, the progenitor cells have positive expression of cell surface markers CD44, CD73, CD90 and CD105, and negative expression of cell surface markers CD31, CD34, CD14, CD45, CD19, HLA-DR and SidePop.
[0026] The progenitor cells of the present application can undergo osteogenesis, adipogenesis, chondrogenesis, and neurogenesis.
[0027] The progenitor cells of the present application possess strong immunomodulatory properties, which have suppressive effects on both CD4 and CD8 T lymphocytes.
[0028] The progenitor cells of the present application represent a new source of human stem cells which can be isolated without ethical concerns and in high volumes for wide clinical applicability. The clinical applications of the progenitor cells include, but is not limited to, degenerative diseases, ischemic diseases, a disease caused by abnormal immune response and the like.
[0029] Therefore, the present application further provides a method for treating a degenerative disease, an ischemic disease or a disease caused by abnormal immune response comprising administering the progenitor cells to a patient subjecting the disease.
[0030] In one embodiment, the degenerative disease includes, but is not limited to, Parkinson's disease, Alzheimer's disease, Huntington's disease, cerebral atrophy, cerebellar atrophy, schizophrenia and dementia.
[0031] In one embodiment, the ischemic disease includes, but is not limited to, stroke, cerebral apoplexy, cerebral hemorrhage, cerebral infarction, head trauma, vascular dementia and myocardial infarction.
[0032] In one embodiment, the disease caused by abnormal immune response includes, but is not limited to, autoimmune disease or graft rejection of organ transplantation. The autoimmune disease includes such as system lupus erythematosus, multiple sclerosis, rheumatoid arthritis, type 1 diabetes mellitus, coeliac disease, Sjögren's syndrome, Hashimoto's thyroiditis, Graves' disease, and idiopathic thrombocytopenic purpura.
[0033] In the method, the patient can be an mammal such as a rodent, primate, carnivora, artiodactyla and the like, preferably a primate. In one embodiment, the patient is a human.
[0034] Examples for preparing the progenitor cells are described hereinafter.
EXAMPLES
[0035] Methods & Materials
[0036] Cell Isolation & Culture
[0037] Uteri from hysterectomies for benign disease were obtained with informed consent approved by the institutional review board. The myometrium was dissected and separated from the endometrium and serosa, then digested with collagenase IV (Sigma-Aldrich) for 30 minutes. The samples and supernatant were then cultured in complete medium consisting of Dulbecco's modified Eagle's medium low glucose (Gibco-Invitrogen, Grand Island, USA) supplemented by 10% fetal bovine serum (FBS; selected lots, HyClone, Logan, Utah, USA), 100 U/ml penicillin, and 100 g/ml streptomycin (Sigma-Aldrich, St. Louis, Mo., USA). Cell cultures were maintained at 37° C. with a water-saturated atmosphere and 5% CO2. Medium was replaced one to two times every week, and when 80% confluent, cells were subcultured at 1:3 ratio.
[0038] Immunophenotyping
[0039] To detect surface antigens, aliquots of cells were washed with PBS containing 2% FBS after detachment with 0.25% trypsin/EDTA. All antibodies were purchased from BD Biosciences (Franklin Lakes, N.J.). Cells were stained with fluorescein isothiocyanate (FITC)- or phycoetrythrin (PE)-conjugated antibodies and compared with appropriate isotype controls. Flow cytometry analysis was performed using a FACSCalibur flow using CellQuest software (BD Biosciences) as we have previously reported (Yen, B. L., Huang, H. I., Chien, C. C., Jui, H. Y., Ko, B. S., Yao, M., Shun, C. T., Yen, M. L., Lee, M. C., and Chen, Y. C. (2005). Isolation of multipotent cells from human term placenta. Stem Cells 23, 3-9; Yen, B. L., Yen, M. L., Hsu, P. J., Liu, K. J., Wang, C. J., Bai, C. H., and Sytwu, H. K. (2013). Multipotent human mesenchymal stromal cells mediate expansion of myeloid-derived suppressor cells via hepatocyte growth factor/c-Met and STATS. Stem Cell Reports 1, 139-151). Sidepopulation cells were determined as previously reported (Ono et al. PNAS 2007) with the use of 50 μm verapamil to block efflux of the Hoechst 33342 dye (Sigma-Aldrich) (Goodell, M. A., Brose, K., Paradis, G., Conner, A. S., and Mulligan, R. C. (1996). Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo. J Exp Med 183, 1797-1806).
[0040] Differentiation Studies and Characterization
[0041] Differentiation into adipogenic, osteoblastic, and chondrogenic lineages was performed and characterized as we and others have previously reported (Liu, K. J., Wang, C. J., Chang, C. J., Hu, H. I., Hsu, P. J., Wu, Y. C., Bai, C. H., Sytwu, H. K., and Yen, B. L. (2011). Surface expression of HLA-G is involved in mediating immunomodulatory effects of placenta-derived multipotent cells (PDMCs) towards natural killer lymphocytes. Cell Transplant 20, 1721-1730; Pittenger, M. F., Mackay, A. M., Beck, S. C., Jaiswal, R. K., Douglas, R., Mosca, J. D., Moorman, M. A., Simonetti, D. W., Craig, S., and Marshak, D. R. (1999). Multilineage potential of adult human mesenchymal stem cells. Science 284, 143-147). Neurogenic differentiation was induced by standard methods; briefly, by culturing cells at low density (1000 cells/cm3), in serum-free medium with the addition of 0.5 μm retinoic acid (Sanchez-Ramos, J. R., Song, S., Kamath, S. G., Zigova, T., Willing, A., Cardozo-Pelaez, F., Stedeford, T., Chopp, M., and Sanberg, P. R. (2001). Expression of neural markers in human umbilical cord blood. Exp Neurol 171, 109-115), or in complete medium with the addition of 10 μm Y-27632 as we previously reported (Wang, C. H., Wu, C. C., Hsu, S. H., Liou, J. Y., Li, Y. W., Wu, K. K., Lai, Y. K., and Yen, B. L. (2013). The role of RhoA kinase inhibition in human placenta-derived multipotent cells on neural phenotype and cell survival. Biomaterials 34, 3223-3230 (“Wang et al.”). All reagents are from Sigma-Aldrich with the exception of TGF-β3 for chondrogenic differentiation, which was obtained from R&D Systems (Minneapolis, Minn.).
[0042] Immunofluorescence Staining
[0043] Immunofluorescence staining for neural characterization was performed as previously reported (Wang et al.). Briefly, cultured cells were fixed with 4% paraformaldehyde (PFA) (Sigma-Aldrich) for 10 minutes at room temperature and permeabilized with 0.1% Triton-X 100 (Sigma-Aldrich) for 10 minutes. Primary antibodies against the human antigens nestin and glial fibrillary acidic protein were purchased from Chemicon (Temecula, Calif.); for α-SMA were purchased from Sigma-Aldrich. Samples were first incubated with the primary antibodies at 4° C. overnight, then rinsed three times with PBS and incubated for 60 minutes at room temperature with FITC-conjugated secondary antibodies at a dilution of 1:100. All samples were stained with 4′,6-Diamidino-2-phenylindole (DAPI, 1:2000; Molecular Probes). Staining was visualized under a fluorescence microscope (Olympus, Tokyo, Japan).
[0044] Cell Proliferation Assessment
[0045] Cells were seeded initially at 1.5×104 cells/cm2 beginning from the 2nd passage (P2). Upon sub-confluent growth at a density of 80%, cells were trypsinized as usual and replated at the initial density. Growth curve were determined as we previously described (Ho et al.).
[0046] Reverse Transcription PCR (RTPCR)
[0047] RNA was isolated and RTPCR was performed as we previously reported (Ho et al.). Primers are as follows: [0048] NeuroD, forward primer CTGATCTGGTCTCCTTCGTACAG, reverse primer GATGCGAATGGCTATCGAAAG; [0049] Sox1: forward primer AAAGTCAAAACGAGGCGAGA, reverse primer AAGTGCTTGGACCTGCCTTA, and [0050] nestin: forward primer AACAGCGACGGAGGTCTCTA, reverse primer TTCTCTTGTCCCGCAGACTT.
Quantification was performed after normalization against the gene product of β-actin (primers: forward TGGCACCACACCTTCTACAATGAGC, reverse GCACAGCTTCTCCTTAATGTCACGC).
[0051] Progenitor/Stem Cell and Human Peripheral Blood Mononuclear Cells (PBMCs)/Lymphocyte Coculture Experiments
[0052] PBMC-related experiments were carried out similar to our previously described methods (Chang, C. J., Yen, M. L., Chen, Y. C., Chien, C. C., Huang, H. I., Bai, C. H., and Yen, B. L. (2006). Placenta-derived multipotent cells exhibit immunosuppressive properties that are enhanced in the presence of interferon-gamma Stem Cells 24, 2466-2477 (“Chang et al.”); Chen, P. M., Liu, K. J., Hsu, P. J., Wei, C. F., Bai, C. H., Ho, L. J., Sytwu, H. K., and Yen, B. L. (2014) Induction of immunomodulatory monocytes by human mesenchymal stem cell (MSC)-derived hepatocyte growth factor (HGF) through ERK1/2. J Leukoc Biol 95, 295-303 (“Chen et al.”)). Briefly, human PBMCs were isolated from the buffy coat of healthy donor blood samples (Taiwan Blood Services Foundation, Taipei Blood Center, Taipei, Taiwan) obtained with informed consent approved according to the procedures of the institutional review board and cultured as previously reported. Isolated PBMCs were first stained with carboxyfluorescein succinimidyl ester (CFSE; Gibco-Invitrogen)—a green fluorescence dye—to track for cell division after stimulation with phytoagglutinin (PHA; Sigma-Aldrich) or anti-CD3/28 beads (a-CD3/28; Dynabeads) which more specifically stimulates T lymphocytes. Progenitor/stem cells (MDMPs or BMMSCs) were plated at 3.5×104 cells per well in 6-well plates, and incubated at 37° C. for 24 hours prior to co-culture with stimulated PBMCs (1×105). After 3 days further of culture, cells were harvested and evaluated by flow cytometric analysis for CFSE staining intensity or various protein (surface marker, cytokine, transcription factor, etc.) expression.
[0053] Mouse In Vivo Experiments
[0054] All animal work was performed in accordance with protocols approved by the institutional Animal Care and Use Committee. Wild-type C57BL/6J mice were purchased from the National Laboratory Animal Center of Taiwan (Taipei, Taiwan). Induction of proinflammatory leukocytes in vivo was performed similarly as previously reported (Shi, G., Vistica, B. P., Nugent, L. F., Tan, C., Wawrousek, E. F., Klinman, D. M., and Gery, I. (2013). Differential involvement of Th1 and Th17 in pathogenic autoimmune processes triggered by different TLR ligands. J Immunol 191, 415-423). Briefly, lipopolysaccharide (LPS; 100 μg, Escherichia coli 00041:B4; Sigma-Aldrich) was injected intraperitoneally into 8- to 12-week-old mice, followed 2 hours later by transfer of either MDMPs or BMMSCs (1×105 cells/mouse). Mice were sacrificed on day 3 with harvesting of leukocytes from the spleen and regional lymph nodes for assessment of Th1 cells and Tregs as previously reported (Chen et al; Chang et al).
[0055] Results
[0056] Characterization of Multipotent Progenitors From the Human Uterine Corpus
[0057] Myometrial-derived multipotent progenitors (MDMPs) were isolated from posthysterectomy specimens of benign diagnosis. These MDMPs are highly roliferative, even as compared to somatic progenitors isolated from adipose tissue, which is currently a popular source for isolation of human therapeutic progenitors (
[0058] MDMPs Possess Multilineage Potential
[0059] The differentiation potential of MDMPs were then assessed. It was found that MDMPs can differentiate into multiple cell lineages, including osteogenic, hondrogenic, adipogenic, and neurogenic lineages (
[0060] MDMPs Possess More Significant In Vitro and In Vivo Immunomodulatory Capacity Than BMMSCs
[0061] Increasing evidence show that inflammation is involved in multiple disease entities previously not thought to involve such processes, and this includes such epidemiologically prominent diseases including neurodegenerative diseases, ischemic diseases and cancer. The uterus has been postulated to have a unique immunological milieu (Moffett-King, A. (2002). Natural killer cells and pregnancy. Nat Rev Immunol 2, 656-663). Thus, whether MDMPs possess immunomodulatory effects was evaluated. To assess whether MDMPs are immunosuppressive, it was performed mixed lymphocyte reactions using stimulated human peripheral blood monoclear cells (PBMCs) and co-cultured either MDMPs or BMMSCs—a known immunomodulatory type of stem/progenitor cells—simultaneously. It was found that coculture of MDMPs not only suppressed the proliferation of PBMCs stimulated with either phytoagglutinin or anti-CD3/28 beads, but can do so more potently than BMMSCs can be significantly suppressed when MDMPs are co-cultured (
[0062] Comparison Between the MDMPs and the Prior Arts
[0063] Referring to Table 1, summary of the comparison are shown.
[0064] Ono et al. (Ono et al, PNAS 2007) disclosed that the MyoSPs were isolated by incubating myometrial tissue in medium with minimal enzyme addition (0.02%) for 4-16 hours with subsequent filtration (2 times) and gradient selection (Ficollpaque), then the tissue was further trypsinized.
[0065] Galvez et al., In Vivo 2009, WO2010/057965 and WO2011/042547A1 disclose that AMPs were isolated by incubating the myometrial tissue in serum-free medium, and selecting only fragments with small vessels for further culturing. The method likely selects endothelial-like cells, and the results showing high CD31(+) percentage of these isolated AMPs (>99.7% for mouse AMPs and >90% for human AMPs) can be explained accordingly.
[0066] In the method of the present application, a one-step of enzymatic treatment is applied for less than 1 hour without filtration or gradient selection, with culturing in serum-supplemented medium. In addition, there is no need to use portions with vessels for further culturing in the present application.
[0067] MyoSPs were characterized by the ability to efflux Hoechst 33342 dye, which show up on flow cytometric analysis as a “side population,” which the present application does not yield (see
[0068] In addition, MyoSPs are unable to differentiate into chondrogenic cells, nor reported to differentiate into neurogenic cells, as MDMPs can Immunomodulatory capacity of MyoSPs are not discussed by Ono et al., but MyoSPs may unlikely to have this capacity since they are CD34(+) and CD31(+), indicating a hematopoietic background and likely immunogenic.
[0069] Only mouse AMPs but not human AMPs were tested for differentiation capacity. The mouse AMPs possessed osteogenesis, adipogenesis and neurogenesis, but no chondrogenesis was reported Immunomodulatory capacity of AMPs are not discussed in the above disclosures, but AMPs could possibly be immunogenic due to being HLA-DR (+) at baseline.
[0070] Obviously, MDMPs possesses distinct characteristics from MyoSPs and AMPs.
TABLE-US-00001 TABLE 1 Isolated cells AMPs MDMPs (Galvez et al, 2009 + Characteristic (our MyoSP cells WO2010/057965 + & Marker profile method) (Ono et al, 2007) WO2011/042547A1) Isolation Method Enzymatic Minimal enzyme treatment Exfolinted fragment treatment (0.02%) for 4-16 hours with “explants” with small only, <1 hour subsequent filtration (2 vessels selected in serum- times) and gradient free medium selection (Ficoll-paque) then further trypsinized CD31* − ~67%+ +>90% both mouse & human AMPs CD34**§ − + +>99% for mouse AMPs, − for human AMPs CD73 + + − CD44 + − + CD105 + + +>50% for human AMPs Side population (Efflux − + Not done of Hoechst 33342 stain) HLA-DR§ − Not reported +~30% for mouse AMPs Osteogenesis + + + for mouse AMPs only Adipogenesis + + + for mouse AMPs only Chondrogenesis + Not possible (stated in Not reported publication) Neurogenesis + Not reported + for mouse AMPs only Immunomodulation + Not reported Not reported
[0071] While the present invention is disclosed by reference to the preferred embodiments and examples detailed above, it is to be understood that these examples are intended in an illustrative rather than in a limiting sense. It is contemplated that modifications and combinations will readily occur to those skilled in the art, which modifications and combinations will be within the spirit of the invention and the scope of the following claims and its equivalent systems and methods.