A BIOMOLECULE BASED DATA STORAGE SYSTEM
20170249345 · 2017-08-31
Inventors
Cpc classification
G16B50/00
PHYSICS
G16B45/00
PHYSICS
G06N3/126
PHYSICS
International classification
Abstract
The present invention describes a biomolecule based storage system for converting, storing the data in DNA coded form and retrieving data using pointer file approach. User input data is converted into 4base DNA sequence, called Nibble, which is further mapped onto the DNA sequence of an organism. The first position of each converted nibble is then obtained and stored in a pointer file. By mapping the positions of pointer file onto the DNA sequence of the organism, the data can be retrieved.
Claims
1) A biomolecule based data storage system, comprising: an E.coli Master DNA file, said file containing physical DNA sequence of E.coli; an ASCII map having 256 characters and 256 combinations of 4-base DNA sequence, said 4-base combination is called a Nibble; creating a dictionary having each said Nibble paired up with its corresponding character; mapping each said Nibble with the DNA sequence of E.coli; obtaining all the positions of each Nibble on said DNA sequence of E.coli; wherein a pointer file is created for each Nibble, each said pointer file stores all the said positions of respective Nibble; reading input data and storing each character of said data in first structured format; taking each said character of input data to search for the corresponding Nibble in said dictionary; storing said searched corresponding Nibbles in second structured format; creating a file of second structured format containing said searched Nibbles; wherein each Nibble from said file of second structured format is taken to search for the corresponding pointer file; wherein the said pointer file containing positions of respective Nibble is opened and first position of each said Nibble is obtained; wherein, said obtained first positions are stored in a third structured format; wherein a pointer file of third structured format is created and stored; wherein using the pointer file, complete data can be retrieved by mapping the positions of the Nibble onto the DNA sequence of E.coli; wherein using the pointer file the position to any of the pages/index could be mapped directly.
2) The biomolecule based data storage system as claimed in claim 1, wherein the biomolecule is naturally occurring or synthetically created Deoxyribonucleic acid (DNA), Ribonucleic acid (RNA), proteins, primary metabolites, secondary metabolites, their complexes and other combinations.
3) The biomolecule based data storage system as claimed in claim 2, wherein said biomolecule is of any prokaryotic or eukaryotic organisms.
4) The biomolecule based data storage system as claimed in claim 1, wherein the said input data is text, photos, videos, audio, etc.
5) The biomolecule based data storage system as claimed in claim 1, wherein the said characters are uppercase and lowercase English alphabets, special characters, numbers, tabs, new lines, carriage return and other characters of scripts such as, but not limited to, Devanagari, Bengali, Spanish, Chinese, Japanese, Italian, French, German, Portuguese, Polish, etc.
6) The biomolecule based data storage system as claimed in claim 1, the said structured format is an array, stack, graph, tree, queue, link list, hash map, list, vector, dictionary, union, set and other format.
7) The biomolecule based data storage system as claimed in claim 1, wherein the said data is converted by using any of the decimal number system, binary, hexadecimal, octal and other numeral base systems.
8) The biomolecule based data storage system as claimed in claim 1, wherein said 256 combinations of 4-base DNA occur in less than 25% of physical DNA of E.coli.
9) The biomolecule based data storage system as claimed in claims 1 and 7, wherein owing to the storage of only the first position of each nibble in the pointer file, the data is stored in less than 25% of physical DNA of E.coli.
10) The biomolecule based data storage system as claimed in claim 1, wherein said data can be directly encrypted to protein sequences.
11) The biomolecule based data storage system as claimed in claim 1, wherein said system uses only computational DNA and eliminates the need of physically synthesized and sequenced DNA.
12) The biomolecule based data storage system as claimed in claim 1, wherein the said system can be also used for a virtual DNA shuffle keyboard which is integrated with the secure access networks for entering the input data and other information and writes DNA bases instead of normal characters according to the mapping.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0019] The present invention may be better understood and its methodology, objects, features and advantages are made apparent to those skilled in the art by referring to the accompanying drawings.
[0020]
[0021]
DETAILED DESCRIPTION OF INVENTION
[0022] The following detailed description is merely exemplary in nature and is not intended to limit the invention or the application and uses of the invention. The detailed description is construed as a description of the currently preferred embodiment of the present invention and does not represent the only form in which the present invention may be practiced. This is to be understood that the same or equivalent functions may be accomplished, in any order unless expressly and necessarily limited to a particular order, by different embodiments that are intended to be encompassed within the scope of the present invention.
[0023] The embodiment is chosen and described to provide the best illustration of the principles of the invention and its practical application, and to enable one of ordinary skill in the art to utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated.
[0024] Furthermore there is no intention to be bound by any expressed or implied theory presented in the preceding technical field, background, brief summary or the following detailed description. It is further understood that the relational terms such as first, second etc., if any, are used solely to distinguish one from another entity, item or action without necessarily requiring or implying any actual such relationship or order between such entities, items or actions.
[0025] The present invention takes into consideration the 256 possible combinations of the four bases of DNA, namely A, G, C & T as the American Standard Code for Information Interchange (ASCII) table contains 256 possible combinations of character and their corresponding encoding in decimal. Therefore, with a set of four bases, complete extended ASCII set (256 in numbers) has been encoded as the possible combinations with 4 bases is 4̂4=256.
[0026] The methodology of the present system is demonstrated on ASCII table's decimal encoding (i.e., base 10), but is not limited to the decimal number system and can be extended to other number systems like binary, hexadecimal, octal and other numeral base systems.
[0027] The ASCII Map contains the possible DNA sequences constructed using four bases (256 in number) in one row and the corresponding characters (Uppercase & Lowercase English alphabets, special characters, numbers, tabs, new lines, carriage return, etc.). Other characters of scripts such as Devanagari, Bengali, Spanish, Italian, French, German, Portuguese, Polish, etc. can also be mapped with DNA sequence using the methodology of present invention.
[0028] For 256 possible combinations of DNA sequences, 256 files with the same name as the Nibble are created. These files are named as <DNA sequence>.csv, where <DNA sequences>are the 256 possible combinations of the DNA, i.e. AGCT, GACT, AAAT, etc.
[0029] The present invention converts data (user input characters) to a set of 4-base DNA sequences (AAAA, AAGT, AACT, etc.) called Nibble (named after 4 bits in the physical computer memory) with the help of an ASCII Map. The 4-base long Nibble allows repetition of bases, like AAAA, AAGT, AACT, AATT, TTAC, etc.
[0030] The present invention maps the data onto the DNA sequence of any prokaryotic or eukaryotic organism. In the most preferred embodiment, the present invention, described as the pointer approach, maps the data onto the DNA sequence of Escherichia coli (E.coli).
[0031] All the possible 256 Nibble combinations occur in less than first 25% of the physical DNA of E.coli. Therefore, less than 25% of physical DNA of E.coli can be used to convert, store and retrieve data. Further, even if the organism is changed in every case, far lesser DNA sequence is used (than what is available naturally) for data storage.
[0032] All 256 possible Nibble combinations, as created above, are mapped to the DNA sequence of E.coli (E.coli's Master DNA file) and their respective positions on the DNA sequence of E.coli are obtained in the format [start position,end position]. These positions are recorded in a file, called pointer file, named as <Nibble sequence>.csv. For example: AAAT.csv will contain the start, end positions of all the AAAT in the DNA of the E.coli. For instance if the DNA sequence of E.coli is AAATTGCGGTACGTAGAAATCAGTTCAAGTCA, then AAAT.csv will contain 1,4 and 17,21 (in the newline).
[0033]
[0034] The array (array 3) containing the positions of the DNA sequence on E.coli's Master DNA is then written into a new file (pointer file), separated by new lines. The pointer file is then stored and can be used to retrieve the complete data by mapping onto the DNA sequence of E.coli. By reading the DNA sequence and loading the pointer file, it is possible to retrieve the original document.
[0035] Using the pointer file, the position to any of the pages/index could be mapped directly which is not present in the conventional methods. That is, with the pointer approach, we can map the specific location (for example particular page of a document) as well and hence go to that specific location.
[0036] The present invention converts data to a set of 4-base DNA sequences, which can be traced back to the data only with the help of ASCII Map, hence the technique is suitable for storing passwords and other classified and confidential information and documents, which can be read only after converting DNA sequence back to Data.
[0037] The DNA sequence file is itself encoded and can be used to produce a physical DNA which can be readily used or can be stored for longer duration and serve as a data warehousing solution. Another use of it can be in terms of the virtual sequence, which can be stored as encrypted data, suitable for password, data security, classified information, etc.
[0038] The data as converted to DNA sequence and a pointer file, provides solutions for massive and long-term data storage, retrieval, encryption, data security, password, classified information, etc.
[0039] The pointer file provides a more robust solution for prevention of Data Loss. It can be maintained as a backup of all the converted data. In case of a complete wipe out of both Data and DNA sequence, the pointer file can be fed to a pointer head and can be used to retrieve the complete data. The positions can then be mapped from pointer file to the corresponding physical position in the DNA sequence and the respective Nibbles can be read, which can then be converted back to data, using the ASCII Map.
[0040] Using the pointer file approach, the data is stored only in less than 25% of physical DNA of E.coli as the pointer file takes only the first position of the DNA sequence even if the same DNA sequence occurs more than once. Therefore, no matter how big the data is, it will be mapped in less than 25% of DNA sequence of E.coli. The pointer file approach used in the present invention leads to reduction of disc space used for data storage. The technique can be used to convert almost all forms of Data into DNA and pointer, which can be mapped to less than 25% of the physical DNA.
[0041] In the pointer file approach of the present invention the cost of physical DNA synthesis and sequencing is eliminated and only DNA sequence is used for data conversion, storage and retrieval. The other advantage of using the pointer approach is to be able to pinpoint the location of different files and identify them uniquely.
[0042] The data (user input) can be converted to DNA sequences as well as to protein sequences. In other embodiment, the DNA sequences are fed into another program/module of the program which converts/translates the DNA sequence to protein sequence.
[0043] The protein sequences (20 in number) are written in top row and first column and a matrix is created that contains combinations of both the row and column, the matrix comes out to be 20×20 (400 elements). These elements are arranged in a list where first 256 sequences are picked up. In this embodiment, the 256 sequences are selected row wise and all the protein sequences are sorted to be arranged alphabetically.
[0044] The list so obtained is used to construct the protein map. The 256 sequences can also be picked up in a random or pseudo-random manner according to a key which can be used to create a different cipher with different keys, wherein the keys could be based on, but not limited to, some alpha-numeric combinations, time, date, etc.
[0045] The protein map is loaded into a dictionary (containing the 4 bases 256 DNA sequences, i.e. Nibble) in the form of key-value pairs, where keys are the Nibble and values are the proteins. The key-value pairs are made in such a way that if a key is called, it returns the value associated with it. For example: if the pair is AAAT:CA, where AAAT is the key (Nibble) and CA is the value (protein sequence), calling AAAT returns CA.
[0046] First the DNA sequence file is obtained in the same manner as stated above in the first embodiment. The ‘DNA sequence file’ (containing 4 base DNA sequences (Nibble) in a space separated manner) is opened and stored in an array (array 4). The
[0047] Nibble is taken one by one from array 4 and checked for its value in the dictionary, the corresponding value returned is stored in the same order in another array (array 5), which will hold all the protein sequences.
[0048] The array holding the protein sequence is then written onto a file, referred to as the protein file, where the sequences are of length two each, separated by a space.
[0049] The Nibble of respective protein sequence can be retrieved by using the dictionary containing protein sequence and corresponding Nibble and thereafter the original data can be obtained by using dictionary containing Nibble and their corresponding characters. The original data can also be retrieved by using pointer file as stated in the first embodiment of the invention.
[0050] In other embodiment, the data can be directly converted to protein sequences by mapping the data to protein using protein map.
[0051] After the complete document is converted to protein sequence, it is stored and can be used to retrieve the complete data by either converting protein sequence to DNA sequence or to data directly.
[0052] The conversion of data to protein sequence provides more credibility as the virtual sequences generated are also reduced in terms of virtual disk storage.
[0053] The aforementioned methodology can be used for a virtual DNA shuffle keyboard (
[0054] The applications of the present invention include, but not limited to, Massive/Big Data Storage, Password Storage, Cryptography, Secure Data Storage, Secret File storage, Data Archival, Data Warehousing, DNA based on-screen Keyboard, DNA based on-screen shuffle Keyboard, Protein based on-screen Keyboard, Protein based on-screen shuffle Keyboard, Banking Information/Data Storage, Data Compression.
[0055] In addition, to generating unique data storage solution, we have also developed a novel approach of encrypting data to store passwords. For example, the work in the field of cryptography can be extended by designing special algorithms for password storage, in both DNA and protein molecules.
[0056] The invention is defined by the appended claims including any amendments made during the pendency of this application and all equivalents of those claims as issued. Moreover, numerous modifications and variations can be made according to requirements by a technical expert in the sector to the invention as described in the foregoing, without forsaking the scope of the invention as claimed in the following.