Sialyltransferase ST3GAL6 as a marker for multiple myeloma
11242566 · 2022-02-08
Assignee
Inventors
Cpc classification
C12Q2600/106
CHEMISTRY; METALLURGY
A61K31/7105
HUMAN NECESSITIES
G01N2400/00
PHYSICS
International classification
A61K31/7105
HUMAN NECESSITIES
Abstract
The present invention relates to the sialyltransferase ST3GAL6 for use as a biomarker for multiple myeloma, and especially as a marker for myelomas with inferior survival rates. The inventors have shown that glycosylation gene expression is dysregulated in Multiple Myeloma and that overexpression of the sialyltransferase ST3GAL6 is associated with inferior survival rates in patients.
Claims
1. A method of treating multiple myeloma in a subject in need thereof, the method comprising administering to the subject a modulator of ST3GAL6 in an amount sufficient to decrease ST3GAL6 expression or activity, wherein the modulator of ST3GAL6 is an interfering RNA specific for ST3GAL6.
2. The method of claim 1, wherein the interfering RNA is encoded by a nucleotide comprising the sequence set forth in SEQ ID No. 3 and/or SEQ ID No. 4.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
DETAILED DESCRIPTION OF THE DRAWINGS
(17) Materials and Methods
(18) Real time quantitative PCR (RT_PCR) in the MM cell lines RPMI8226 and MM1R and in primary MM patient CD138 positive cells was used to examine expression of the ST3GAL6 gene. The prognostic significance of the ST3GAL6 gene was analyzed using Kaplan Meier survival estimates. Membrane protein extracts from MM cell lines were applied directly to lectin microarrays following fluorescent labelling to generate cell surface glycan profiles. Protein expression was assessed by immunohistochemistry (IHC) on primary MM bone marrow sections from MM patients and healthy controls. Lectin based flow cytometry was carried out to assess for the binding of sialic acid lectins to MM cell line RPMI8226.
(19) CD138 Cell Isolation
(20) Bone marrow aspirates were obtained from multiple myeloma patients at Galway University Hospital following informed consent. The mononuclear fraction of the bone marrow aspirate was isolated using Ficoll Paque™ Plus (STEMCELL Technologies) and high speed zero brake centrifugation. PC isolation from mononuclear cell fraction was performed by immunomagnetic bead selection with monoclonal mouse antihuman CD138 antibodies using the AutoMACs automated separation system (Miltenyi-Biotec. Auburn, Calif.). PC purity of more than 95% homogeneity was confirmed by 2-color flow cytometry using CD1381/CD452 and CD381/CD452 criteria (Becton Dickinson, San Jose, Calif.).
(21) Real Time Quantitative Polymerase Chain Reaction (RT_PCR)
(22) The mRNA expression of ST3GAL6 was detected by RT-PCR in indicated MM cell lines and in sorted CD138+ cells from MM patients with the forward primer TTG CCT CTC TGC TGA GGT TT and the reverse primer CCT CCA TTA CCA ACC ACC AC The expression of GAPDH or 18S was detected with their respective primers. RT-PCR amplification was carried out with 100 ng of cDNA in a 10-μl reaction mixture containing 5 ul SYBR green mix (Bio-Rad, Mississauga, ON) and 0.2 ul qPCR primers (SA Bioscences, Frederick, Md.). Data quantification was carried out by the deltadeltaCT method.
(23) Lectin Array
(24) Glycan-binding proteins (Lectins) conjugated to microarrays were used to probe compositions and differential presence of glycan residues on glycoconjugates and cells. The glycan samples were fluorescently tagged prior to hybridization step to co-incubate glycan samples and lectins. After hybridization, slides were washed extensively and scanned in a microarray scanner. The lectin-glycan binding data is analyzed using commercially available software.
(25) Sialyltransferase Serum Assay
(26) This assay employs the quantitative sandwich enzyme immunoassay technique. Antibody specific for ST3GAL6 has been pre-coated onto a microplate. Standards and samples are pipetted into the wells and any ST3GAL6 present is bound by the immobilized antibody. After removing any unbound substances, a biotin-conjugated antibody specific for ST3GAL6 is added to the wells. After washing, avidin conjugated Horseradish Peroxidase (HRP) is added to the wells. Following a wash to remove any unbound avidin-enzyme reagent, a substrate solution is added to the wells and color develops in proportion to the amount of ST3GAL6 bound in the initial step. The color development is stopped and the intensity of the color is measured.
(27) Immunohistochemistry
(28) To detect ST3GAL6, BM aspirates from 55 MM patients and 3 healthy subjects were rinsed with PBS, fixed with 4% formaldehyde in PBS, dehydrated with ethanol, embedded in paraffin, and sectioned. Tissues were then immunostained with mouse anti-human ST3GAL.
(29) Knockdown of ST3GAL6 in Myeloma Cell Lines;
(30) Green Fluorescent Protein (GFP) Luc.sup.+-MM1s cells have been generated using lentiviral infection and cultured at 37° C. in RPMI 1640 medium containing 10% FBS (Sigma-Aldrich), 2 mM L-glutamine, 100 U/mL of penicillin, 100 μg/mL of streptomycin (Invitrogen) and 100 μg/mL Geneticin. Plasmids were routinely amplified in the Escherichia coli DH5_strain and isolated from cultures by using the Qiagen Plasmid Spin Midiprep Kit (Qiagen, Valencia, Calif.).
(31) Scrambled shRNA control plasmids can be generated using the same methods used to generate lentivirus. Scrambled lentivirus is used to infect MM1s cell to act as a control in these experiments. Stable knockdown of ST3GAL6 can be achieved in these cells using a plasmid generated lentiviral vector which infects the MM is cells.
(32) Interfering RNA Screening
(33) IRNA screening is performed in cultured MM cell lines as a lethality study. Using technology available from the Broad Institute Boston Mass., USA siRNAs targeting individual human silayltransferase genes are preprinted on 384-well plates alongside staggered negative and positive control siRNA. Primary screening experiments are conducted in duplicate on separate occasions for several cultured MM cell lines. For each experiment, plates preloaded with siRNA and frozen were thawed at room temperature and 20_L/well-diluted Lipofectamine 2000 or Dharmafect 3 solution is added to the relevant wells. After 30 minutes, MM cells are added to each well. Cell viability is determined at 96 hours by CellTiter-Glo luminescence assay read on a BMG Polarstar machine using excitation 544-nm/emission 590-nm filters. Surviving knock down cells can be analysed by the following methods.
(34) Cellular Adhesion Assays;
(35) BMSCs are cultured overnight to confluence in 96-well plates (5_103 cells/well) before initiating the adhesion assay. MM1s cells are serum-starved for 3 hours, prelabeled with GFP, added to the BMSCs (1_105 cells/well), and allowed to adhere for 2 hours at 37° C. Nonadherent cells can be aspirated away, the BMSCs washed, and fluorescence intensity measured using a fluorescent-plate reader (Ex/Em_485/520 nm).
(36) Transendothelial Migration and Chemotaxis of MM Cells
(37) HUVECs (5_103 cells/basket) are incubated overnight in the upper chamber of 8-micron pore filters (Costar; Corning) before performing the adhesion assay. MM1s cells are serum-starved for 3 hours and then added to the upper chamber of the basket (2_105 cells/well), and left to migrate for 4 hours at 37° C. toward the lower chamber, which contains 0 or 30 nM of SDF1_. This analysis is performed separately for ST3GAL6 knockdown cells vs scrambled control.
(38) Assessment of Multiple Myeloma Tumour Burden in SCID Mice;
(39) This is carried out according to methods developed by David Scadden's group (13). In vivo confocal microscopy is used to test the homing of MM1s cells to the BM in vivo and to assess the tumour burden of GFP-labelled MM1s cells (1_106) injected into anesthetized SCID mice. In some experiments mice may be pretreated with vehicle or a drug of interest 1 hour before the cell injection. A skin flap is made in the scalps of the mice to expose the underlying skull surface and Evan's blue dye is injected intravenously immediately before imaging to visualize blood vessels. High-resolution images with cellular detail are captured 30 minutes after cell injection through the intact mouse skull at depths of up to 250_m from the surface of the skull using a 30_0.9-numerical aperture water-immersion objective lens (Lomo). Multiple imaging depths were acquired and a maximum intensity z-projection is performed in ImageJ software to merge the images. GFP labelled MM cells and Evan's blue dye are excited with 491-nm and 638-am single-photon lasers and detected via 528/19-nm and 680/25-nm bandpass filters, respectively.
(40) Materials and Methods ST3GAL6 Study:
(41) In-Vitro Studies:
(42) Cell Lines & Reagents:
(43) The RPMI-8226 cell lines were purchased from ATCC (Manassas Va.) cultured in RPMI 1640 (Sigma Chemical, St. Louis, Mo.) containing 10% foetal bovine serum, 2 mmol/L L-glutamine (Life Technologies, Grand Island, N.Y.), 100 units/mL penicillin, and 100 Ag/mL streptomycin (Life Technologies). GFP-Luciferin-Neo MM1s cells were generated using a lentiviral infection method as described [1]. Primary MM cells were obtained from bone marrow samples from patients using CD138+ microbead selection (Miltenyi Biotech, Auburn Calif.) as previously described [2]. Bone marrow stromal cells (BMSC's) were obtained from healthy donor and MM patient fresh bone marrow samples and isolated as described [3]. BMSC's were then cultured in DMEM (Sigma Chemical, St Louis, Mo.) supplemented with 10% heat-inactivated foetal bovine serum, 100 units/MI penicillin, 10 Ag/mL streptomycin (Life Technologies; 0.01%), and 2 mmol/L L-glutamine (1%; Life Technologies). Informed consent was obtained from all patients in accordance with the Declaration of Helsinki. Approval of these studies was obtained by the Dana-Farber Cancer Institute Institutional Review Board. Bortezomib was obtained from Millennium Pharmaceutical (Cambridge, Mass.), and SDF-1 was obtained from R&D Systems (Minneapolis, Minn.).
(44) shRNA Meditated ST3GAL6 Gene Silencing:
(45) To determine the role of ST3GAL6 in MM biology we established ST3GAL6 knockout RPMI-8226 and MM1s-GFP-Luc cell lines using a lentiviral system as previously described [4]. A plasmid based system was used to achieve knockdown of ST3GAL6 in the MM cell lines. Lentiviral ST3GAL6 shRNA and non target scrambled control shRNA was produced in HEK293T packaging cells, concentrated at different MOIs and then individually added into MM-cell suspensions in the presence of 8 mg/mL polybrene and transduced for 24 hours followed by selection in puromycin (2 mg/mL; Invitrogen). The efficiency of ST3GAL6 knockdown was assessed by flow cytometry and RT-PCR using the following primers Forward Primer; TTG CCT CTC TGC TGA GGT TT Reverse Primer, CCT CCA TTA CCA ACC ACC AC [5]. The resultant stable ST3GAL6 knockdown (shST3GAL6) cell line is compared to the scrambled control cell line in all subsequent functional assays. The sense and antisense oligonucleotide sequence for construction of ST3GAL6 shRNA were as follows: clone no 10402; [NM_006100.2-1332s1c1, target sequence CCTTTGCACTACTATGGGAAT (A2), NM_006100.2-1110s1c1 target sequence CCAGCCTTAAACCTGATTTAT (A3)]
(46) Adhesion Assays:
(47) Assays for adhesion of MM cells to normal and MM BMSC's were performed using 96-well plates (5×10.sup.3/well). Normal or MM BMSC's (5,000)/well) were seeded in 96-well plates overnight in supplemented DMEM media to establish a confluent monolayer. MM cells were serum starved overnight, prelabelled with calcein AM and added to the BMSC's and allowed to adhere for 2 hours at 37° C. Nonadherent cells were aspirated off, BMSCs were washed with PBS, and fluorescence intensity was measured using a fluorescent-plate reader (Ex/Em_485/520 nm). Fibronectin adhesion assays were performed using an in vitro adhesion assay coated with fibronectin following the manufacturer recommendations (EMD Biosciences, San Diego, Calif.) as previously described 161. Bovine serum albumin (BSA)-coated wells served as negative controls. In some of the above experiments MM cells were pre-incubated with increasing concentrations of bortezomib (0, 2.5, and 5 nM) prior to assessment of adhesion.
(48) Migration Assays:
(49) Migration assays were performed as previously described [6] [7]. Migration ability of MM scrambled control cells vs. shST3GAL6 cells was assessed using a transwell migration assay plate (pore size 0.8_m; Corning Life Sciences, Acton, Mass.) according to the manufacturer's instructions. MM cells were serum starved for 4 hours and following calcein AM labelling were then placed in the upper migration chambers. SDF-1_(30 nM) was added to 500_uL of RPMI 1640 in the lower chambers. After 4 hours at 37° C. cells that migrated to the lower chambers were counted on a fluorescent plate reader (Molecular Devices).
(50) Immunoblotting:
(51) Immunoblotting was performed as previously described [8]. Briefly, whole-cell lysates were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinyldene fluoride (PVDF) membrane (Bio-Rad Laboratories, Hercules, Calif.). The antibodies used for immunoblotting included anti-ST3GAL6 produced in rabbit (Sigma-Aldrich, MO, USA) and anti-Actin (Cell Signaling Technology)
(52) Immunohistochemistry:
(53) To detect ST3GAL6, BM aspirates from 50 MM patients and 10 healthy subjects were rinsed with PBS, fixed with 4% formaldehyde in PBS, dehydrated with ethanol, embedded in paraffin, and sectioned. Tissues were then immunostained with mouse anti-human ST3GAL6 antibody and mouse-antihuman-CD138.
(54) In-Vivo Xenograft Models
(55) Animals:
(56) Approval of these studies was obtained by the Dana-Farber Cancer Institute and Massachusetts General Hospital Institutional Animal Care and Use Committees. Female, 6 to 7 weeks old, severe combined immunodeficient beige (SCID-Bg) mice were obtained from Taconic Laboratories. Anesthesia was performed by intraperitoneal injections of ketamine (Bedford Laboratories, Bedford, Ohio)/xylazine (Lloyd Laboratories, Shenandoah, Iowa) at 80 mg/kg/12 mg/kg body weight prior to in-vivo imaging sessions. Following this mice were killed by inhalation of CO2.
(57) Xenograft Models:
(58) Tumors were established in mice using MM1s-GFP-Luc cells (5_10.sup.6/mouse) which were injected into the tail vein of 12 SCID-Bg mice (n=6/group).
(59) BLI:
(60) To detect tumor burden on a weekly basis following injection mice were injected with 75 mg/kg luciferin (Xenogen, Hopkinton, Mass.) and imaged for bioluminescence 5 minutes after the injection. The home-built bioluminescence system used an electron multiplying CCD (Andor Technology, Belfast, United Kingdom) with an exposure time of 15 seconds, an electron multiplication gain of 500-voltage gain_200, 5-by-5 binning, and background subtraction. Images were analyzed with the use of ImageJ software (National Institutes of Health, Bethesda, Md.).
(61) In-vivo confocal: Using the above SCID-Bg xenograft mice homing of MM cells to distant bone marrow niches was tracked in vivo, by using in vivo confocal microscopy [9]. Briefly, MM cells homing to the BM were imaged in vivo using a Zeiss 710 confocal system (Carl Zeiss Microimaging, Jena, Germany) on an upright examiner stand with a custom stage. A skin flap was made in the scalp of the mice to expose the underlying dorsal skull surface. High-resolution images with cellular detail were be obtained through the intact mouse skull at depths of up to 250 μm from the surface of the skull using a 10×0.45NA Plan-Apo objective (Carl Zeiss Microimaging). Multiple imaging depths were acquired, and a maximum intensity z-projection was performed in Image J to merge the images. GFP was excited with the 488 nm line on an Argon laser. Blood vessels were imaged using Evans Blue (Sigma-Aldrich, St. Louis. Mo.) excited with a 633 nm laser. Emission signals were be collected by the Zeiss internal confocal Quasar detectors.
(62) Results
(63) The sialyltransferase ST3GAL6 (ST3 beta-galactosidase, alpha-2,3-sialyltransferase 6), which plays a critical role in generation of functional selectin ligands such as sLex, was upregulated in MM (fold change=2.67) and smoldering MM (fold change=2.22) but was absent in MGUS (Monoclonal gammopathy of undetermined significance). Patients from GSE24080 (n=S09) were stratified into two groups based on their expression intensities for ST3GAL6. Patients with higher normalized intensity values corresponding to probeset ID 210942_s_at (ST3GAL6) were found to have a lower median survival compared to their lower expressing counterparts. The difference in survival observed was 5.13 months (p<0.001 CI 1.3, 8.9). The association with reduced survival was independently verified in the MRC Myeloma IX microarray dataset (n=260). In this dataset using the median expression of ST3GAL6 as a cutoff there was a statistically significant reduction on overall survival with higher expression of ST3GAL6 (median OS 35.7 vs 48 months, log rank test p=0.04).
(64) RT-PCR analysis validated the over expression of ST3GAL6 in MM cell lines and primary samples compared to healthy controls. We observed a trend for higher fold changes for ST3GAL6 in samples from patients with relapsed/refractory disease compared to those with responsive disease. IHC for ST3GAL6 on primary bone marrow sections from MM patients (n=27), demonstrated specific Golgi staining compared to controls. Consistent with the over expression of ST3GAL6 lectin microarray analysis of membrane protein extracts from MM cell lines RPMI8226 and MM1R showed binding to sialic acid-specific lectins Maackia amurensis agglutinin (MAA), which is specific for α2-3 bound sialic acids, and Sambucus nigra (SNA) which is specific for α2-6 bound sialic acids. This pattern was confirmed using biotinylated lectin based flow cytometry, which demonstrated a shift in allophycocyanin (APC) median fluorescence intensity for these lectins on RPMI8226 cells.
(65) As shown in
(66)
(67)
(68) To directly identify the biological role of ST3GAL6 in myeloma, lentivaral stocks were produced from hairpin-pLKO.1 plasmids and transfected into myeloma cell lines MM1s-green fluorescent protein-luciferase positive (GFP-Luc) and RPMI-8226. The MM1s-GFP-Luc cell line was chosen in order to create a stable shST3GAL6 cell line that was amenable to later in-vivo imaging and Confocal imaging. The RPMI-8226 cell line was chosen as a representative cell line of multiple myeloma which had not been previously manipulated. As
(69) Western blots demonstrating the reduced level of protein detected in the shST3GAL6 stable cell lines in comparison to respective scrambled controls are shown in
(70) The results of the adhesion analysis to primary bone marrow stromal cells are shown in
(71) In-vivo studies in the SCID-bg xenograft mouse model of MM were conducted to assess the effect of shST3GAL6 on myeloma xenograft tumour growth in-vivo compared with scrambled control cells were conducted.
(72) MM cell lines show low levels of FUCA1 transcripts by QPCR. The OPM2 cell line, which contains t(4;14) showed increased ST3GAL1 transcripts relative to NBM. High expression (top quartile) of the sialytranserase gene ST3GAL1 also showed a trend towards inferior OS (median survival 35 mos .v. 45 mos, p=0.07) with significantly reduced PFS (19 .v. 14 mos, p=0.015). Increased expression of ST3GAL1 correlated with the presence of t(4;14) (p=0.009), del13q (p=0.001), +1q (p=0.01) and hypodiploidy (p=0.00001).
(73) As shown in
(74) Combining gene expression data showed that reduced expression of FUCA1 with increased expression of either ST3GAL6 or ST3GAL1 or both, identified a subgroup of patents (18%) in MRC Myeloma IX with particularly poor outcome (red and black lines), as shown in
CONCLUSIONS
(75) The sialyltransferase ST3GAL6 is differentially regulated in all stages of MM with potential effects on MM biology and survival. Upregulation of ST3GAL6 may play an important role in MM cell trafficking and in this analysis is associated with inferior survival. Studies are ongoing to address the roles of ST3GAL6 over expression and altered sialylation in MM cell adhesion and trafficking.
(76) The present inventors have shown that this glycogene is overexpressed in multiple myeloma cell lines and in CD138 cells from myeloma patients when compared to their healthy counterparts. We have also demonstrated an association between increased expression of this gene and reduced median survival following analysis of a publically available transcriptomic dataset.
(77) Altered glycosylation gene expression patters may identify patients at high risk of disease progression and early death. Our data implicates sialytransferases and selectin ligands as potential therapeutic targets in Multiple Myeloma. In particular, low expression of the FUCA1 gene is an adverse prognostic factor in MM and when combined with high sislyltransferase gene expression identifies patients at increased risk of early disease progression and death.
REFERENCES
(78) 1. Alsayed, Y., et al., Mechanisms of regulation of CXCR4/SDF-1 (CXCL12)-dependent migration and homing in multiple myeloma. Blood, 2007, 109(7): p. 2708-17. 2. Hideshima, T., et al., Molecular mechanisms mediating antimyeloma activity of proteasome inhibitor PS-341. Blood, 2003, 101(4): p. 1530-4. 3. Roccaro, A. M., et al., Bortezomib mediates antiangiogenesis in multiple myeloma via direct and indirect effects on endothelial cells. Cancer Res, 2006, 66(1): p. 184-91. 4. Dillon, C. P., et al., Rnai as an experimental and therapeutic tool to study and regulate physiological and disease processes. Annu Rev Physiol, 2005, 67: p. 147-73. 5. Wang, Z., et al., Roles for UDP-GlcNAc 2-epimerase/ManNAc 6-kinase outside of sialic acid biosynthesis: modulation of sialytransferase and BiP expression, GM3 and GD3 biosynthesis, proliferation, and apoplosis, and ERK1/2 phosphorylation. J Biol Chem, 2006. 281(37): p. 27016-28. 6. Azab. A. K., et al., CXCR4 inhibitor AMD3100 disrupts the interaction of multiple myeloma cells with the bone marrow microenvironment and enhances their sensitivity to therapy. Blood, 2009. 113(18): p. 4341-51. 7. Leleu, X., et al., The Akt pathway regulater survival and homing in Waldenstrom macroglobulinemia. Blood, 2007. 110(13): p. 4417-26. 8. Roccaro, A. M., et al., MicroRNAs 15a and 16 regulate tumor proliferation in multiple myeloma. Blood, 2009. 113(26): p. 6669-80. 9. Azab, A. K., et al., RhoA and Rac1 GTPfases play major and differential roles in stromal cell-derived factor-1-induced cell adhesion and chemotaxis in multiple myeloma. Blood, 2009. 114(3): p. 619-29. 13 Nature, 2005 Jun. 16;435(7044):969-73. In vivo imaging of specialized bone marrow endothelial microdomains for tumour engraftment.
(79) The words “comprises/comprising” and the words “having/including” when used herein with reference to the present invention are used to specify the presence of stated features, integers, steps or components but does not preclude the presence or addition of one or more other features, integers, steps, components or groups thereof.
(80) It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination.