Herpes simplex virus (HSV) with modified tropism, uses and process of preparation thereof

Abstract

A modified Herpes Simplex Virus (HSV), which has a portion of gD (glycoprotein D) of the glycoproteic envelope deleted and a heterologous single chain antibody inserted in place of such deleted portion; the modified HSV is capable of infecting cells through receptor HER2/ErbB2 but not through receptors HVEM/HveA and nectin1/HveC; uses of the modified HSV and a process of the preparation thereof are also disclosed.

Claims

1. A modified herpes simplex virus (HSV) comprising a modified glycoprotein envelope, wherein said modified glycoprotein envelope comprises an altered HSV glycoprotein D (gD), wherein said gD has a portion deleted and a heterologous peptide ligand inserted thereto; wherein the deleted portion (i) starts at any of amino acid residue positions 1 to 8 and ends at any of amino acid residue positions 38 to 55, or (ii) starts at any of amino acid residue positions 40 to 61 and ends at any of amino acid residue positions 210 to 218; wherein said residue numbers correspond to the residue numbering of SEQ ID NO: 1.

2. The modified HSV according to claim 1, wherein the glycoprotein envelope is so modified that the capability of the modified HSV of interacting with receptors HVEM/HveA and nectin1/HveC is ablated.

3. The modified HSV according to claim 1, wherein the deleted portion of gD (i) starts at amino acid residue position 6 and ends at amino acid residue position 38, or (ii) starts at amino acid residue position 61 and ends at amino acid residue position 218.

4. The modified HSV according to claim 1, wherein said heterologous peptide ligand and gD form a fusion protein.

5. The modified HSV according to claim 1, wherein gD has at least 80% homology with respect to SEQ ID NO: 1.

6. The modified HSV according to claim 1, wherein the heterologous peptide ligand binds to the receptor HER2/ErbB2.

7. The modified HSV according to claim 1, wherein the peptide ligand binds to a receptor selected from the group consisting of: EGFR1, EGFR3, PSMA, CEA, GD2, VEGFR1 and 2.

8. The modified HSV according to claim 1, wherein the peptide ligand is a single chain antibody.

9. The modified HSV according to claim 8, wherein the single chain antibody replaces an Ig-folded portion included in gD.

10. The modified HSV according to claim 8, wherein the single chain antibody comprises: a first domain (VL) and a second domain (VH) and a first linker (L1), which is located between and connects the first and the second domain (VL, VH) and is capable of allowing the first and the second domain (VL, VH) to take an adequate relative position; and wherein the single chain antibody comprises a second linker (L2); the second domain (VH) being located between and connecting the first and the second linker (L1, L2); and, (ii) optionally, the single chain antibody comprises a third linker (L3); the first domain (VL) being located between and connecting the first and the third linker (L1, L3).

11. The modified HSV according to claim 10, wherein (i) the first domain (VL) consists of at least one hundred amino acids; the second domain (VH) consists of at least one hundred and ten amino acids; and the first linker (L1) consists of at least twelve amino acids; or (ii) the first domain (VL) has at least 90% homology with respect to SEQ ID NO: 2; the second domain (VH) has at least 90% homology, with respect SEQ ID NO: 3.

12. The modified HSV according to claim 10, wherein (i) the first linker (L1) has at least 90% homology with respect to SEQ ID NO: 4; and/or (ii) the second linker (L2) has at least 90% homology with respect to SEQ ID NO: 5; and/or (iii) the third linker (L3) consists of at least two and no more than eight amino acids; and/or (iv) the third linker (L3) is selected from the group consisting of: a peptide sequence having at least 90% homology with respect to SEQ ID NO: 6, and a peptide sequence having at least 90% homology with respect to SEQ ID NO: 7.

13. The modified HSV according to claim 1, wherein the heterologous peptide ligand is inserted in gD of the glycoprotein envelope and a portion of gD is deleted so that the obtained modified gD is selected from the group consisting of: a sequence having at least 70% homology, with respect to SEQ ID NO: 10, and a sequence having at least 70% homology, with respect to SEQ ID NO: 9.

14. The modified HSV according to claim 13, wherein the modified gD: (i) comprises a sequence having at least 90% homology with respect to SEQ ID NO: 10, and a sequence having at least 90% homology, with respect to SEQ ID NO: 9; or (ii) the modified gD consists of a sequence having at least 90% homology with respect to SEQ ID NO: 10, and a sequence having at least 90% homology, with respect to SEQ ID NO: 9; and wherein the modified gD is N-glycosylated at consensus sequences Asn-X-Ser and/or Asn-X-Thr.

15. A method of treating a tumor disease comprising administering an effective amount of modified HSV according to claim 1, to a patient.

16. The method according to claim 15, wherein the tumor is selected from the group consisting of: (i) an ovary tumor, a mammary tumor, a prostate tumor, colon tumor, melanoma, neuroblastoma, head and neck carcinoma, stomach tumor, and salivary gland tumor; and/or (ii) a neoangiogenic tissue; and/or (iii) a metastasis of a tumor.

17. A method of visualizing a physiological condition comprising administering a modified HSV according to claim 1, to a patient.

18. A pharmaceutical preparation comprising a modified HSV according to claim 1, and at least a pharmaceutical acceptable excipient.

19. The method of preparing a modified HSV in accordance with claim 1, the process comprising inserting a nucleotide sequence encoding the peptide ligand into the DNA of the HSV, under conditions such that the ligand is expressed in the envelope of the resulting modified HSV.

20. The method according to claim 19, further comprising (i) a deletion step, during which a portion of said DNA of the HSV is deleted; and/or (ii) a determination step, which is before the insertion step, during which said ligand is identified.

21. The method according to claim 20, wherein, during the determination step, ligands are obtained and their ability of binding at least one receptor expressed by the diseased cells is tested.

22. The modified HSV according to claim 14, wherein the modified gD is N-glycosylated at consensus sequences Asn-X-Ser and/or Asn-X-Thr and O-glycosylated at one or more Ser and/or Thr residue.

23. The method according to claim 16, wherein the neoangiogenic tissues are tumor tissues, and wherein the tumor metastasis is a tumor selected from the group consisting of an ovary tumor, mammary tumor, prostate tumor, colon tumor, melanoma and neuroblastoma.

24. The modified HSV according to claim 14, wherein the modified gD consists of a sequence having at least 90% homology with respect to SEQ ID NO: 10, and a sequence having at least 90% homology, with respect to SEQ ID NO: 9.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) Non-limiting embodiments of the present invention will be described by way of example with reference to the accompanying drawings, in which:

(2) FIG. 1A, shows schematic representation of the recombinant HSV-BAC genomes described in this invention. The backbone of gDminus-EGFP-HSV-BAC is shown as example. The backbone of gDminus-EGFP-HSV-BAC is shown. The HSV-BACs derive from pYEbac102 Tanaka, M., H. Kagawa, Y. Yamanashi, T. Sata, and Y. Kawaguchi. 2003. Construction of an excisable bacterial artificial chromosome containing a full-length infectious clone of herpes simplex virus type 1: viruses reconstituted from the clone exhibit wild-type properties in vitro and in vivo. J Virol 77:1382-91. [Tanaka, 2003 #672], that carries pBeloBAC11 sequences inserted between UL3 and UL4. In gDminus-EGFP-HSV-BAC the reporter cassette (α27-EGFP) is inserted in the BAC sequences. gDminus-LacZ-HSV-BAC has the same structure, but carries LacZ in place of EGFP.

(3) FIG. 1B, shows schematic representations of linear maps of wt-gD (a) and the gD chimeric proteins: the map labeled (b) illustrates the gD of recombinant R-LM31, carrying substitution at amino acid residue 34; the map labeled (c) illustrates the gD of recombinant R-LM39, carrying mutations at amino acid residues 34, 215, 222 and 223; the map labeled (d) illustrates the gD of recombinant R-LM113, carrying scHER2L in place of amino acid residues 6-38; and the map labeled (e) illustrates the gD of recombinant R-LM249, carrying LscHER2L in place of amino acid residues 61-218. Bold numbers indicate the length in amino acid residues of each fragment. Plain numbers refer to amino acid residues according to wt-gD coordinates. L, linkers. TM, transmembrane domain of gD. V.sub.H and V.sub.L, heavy- and light-chain variable domains of the anti-HER2/neu antibody 4D5. Δ, deletion. Bars are drawn to scale.

(4) FIG. 2 shows that the recombinant virus R-LM31 is not detargeted from nectin1 receptor. Micrographs of receptor negative J cells (A), and J-HER2 (B), J-hNectin1 (C) and J-mNectin1 (D) expressing human HER2, and human or murine nectin1, respectively, were exposed to R-LM31 at 10 PFU/cell. Infection was monitored as β-galactosidase activity by in situ X-gal staining 16 h following infection. E. Electrophoretic mobility of wt and chimeric gDs expressed in SKOV3 cells infected with R-LM5, R-LM13, R-LM31, R-LM39, R-LM113 and R-LM249 recombinant viruses. Infected cell lysates were separated by SDS-PAGE, transferred to nitrocellulose membranes, and visualized by enhanced chemioluminescence. Numbers to the left represent migration positions of molecular mass markers (in kilodaltons). Arrows indicate the apparent electrophoretic mobility of the wt or chimeric gDs. From bottom to top, wild-type gD (wt-gD) expressed by R-LM5 recombinant virus, gD(Δ61-218)-LscHER2L expressed by R-LM249 recombinant virus, gD(Δ6-38)-scHER2L expressed by R-LM113 recombinant virus. The migration of gD-scHER2L expressed by R-LM13, R-LM31 and R-LM39 is indistinguishable from that of gD(Δ6-38)-scHER2L.

(5) FIG. 3 shows infection of an array of cell lines with R-LM113 and R-LM249 recombinant viruses. Monolayers of the indicated cell lines were infected at 5 PFU/cell, and EGFP reporter gene expression was measured 24 later by means of a fluorometer. Numbers to the left indicate EGFP intensity in arbitrary units.

(6) FIG. 4 shows the growth of R-LM39, R-LM113 and R-LM249 recombinants and of control viruses R-LM5 and R-LM13. (A to G) Replicate cultures of J (A), J-Nectin1 (B), J-HVEM (C), J-HER2 (D), SKOV3 (E), I-143 tk.sup.− (F), or HEp-2 (G) cells were infected with recombinant viruses R-LM5 (.square-solid.), R-LM13 (.circle-solid.), R-LM39 (Δ), R-LM113 (x) or R-LM249 (.box-tangle-solidup.) at 1 PFU/cell. Progeny virus was harvested at 3, 24, and 48 h after infection and titrated in SKOV3 cells.

(7) FIG. 5 shows the block of infection of SKOV3 cells with R-LM39 (A), R-LM113 (B) or R-LM249 (C) by antibodies to HER2 (Herceptin) or nectin1 (R1.302). SKOV3 cells were preincubated with the indicated concentrations of purified IgG from Herceptin (Δ), R1.302 (◯) or the combination of Herceptin plus R1.302 (.circle-solid.) or irrelevant mouse IgGs (x) for 2 h at 4° C. Virus was added to the antibody containing medium and allowed to adsorb to the cells for 90 min at 4° C. Infection was monitored 16 h later as EGFP expression. One hundred percent indicates the EGFP readings in untreated virus-infected cultures.

(8) FIG. 6A shows inhibition of cell-to-cell spread by Herceptin. SKOV3 cells infected with serial dilutions of the indicated viruses were overlaid with medium containing with 1% Seaplaque Agarose±10 μg/ml Herceptin. Individual plaques were photographed at 48 h, and the plaque areas were measured by means of the Photoshop Histogram tool program and expressed as pixels×10.sup.3. For each virus, the areas of 4 or 5 plaques were measured. Histograms represent averages; error bars, standard deviations.

(9) FIG. 6B shows photographs of representative infected plaques referred to with regard to FIG. 6A: in this figure, (a) and (b) illustrate plaques infected with R-LM5, and overlaid with Herceptin− and Herceptin+ medium, respectively, (c) and (d) illustrate plaques infected with R-LM13, and overlaid with Herceptin− (no Herceptin) and Herceptin+ (Herceptin containing) medium, respectively, (e) and (f) illustrate plaques infected with R-LM39, and overlaid with Herceptin− and Herceptin+ medium, respectively, (g) and (h) illustrate plaques infected with R-LM113, and overlaid with Herceptin− and Herceptin+ medium, respectively, (i) and (j) illustrate plaques infected with R-LM249 (Hercepin−), and overlaid with Herceptin− and Herceptin+ medium, respectively, FIGS. 7 to 15 show maps of the following respective plasmids: pLM5, pLM13 (scHER2L between aa 24 and 25 of mature gD), pLM31 (obtained by mutagenesis of pLM13 to introduce the V34S substitution), pS31 (shuttle plasmid obtained by subcloning of the NruI-PmeI fragment from pLM31 into SmaI of pST76KSR), pS39 (shuttle plasmid obtained by mutagenesis of pS31 with primer gD_215G-222N-223I_PvuI), pLM113 (carries the sequence coding gD where aa 6-38 of the mature protein are replaced by scHER2L), pS113 (shuttle plasmid obtained by subcloning of the NruI-PmeI fragment from pLM113 into SmaI of pST76KSR), pLM249 (carries the sequence coding gD where aa 61-218 of the mature protein are replaced by scHER2 flanked by linkers), pS249 (shuttle plasmid obtained by subcloning of the NruI-PmeI fragment from pLM249 into SmaI of pST76KSR), respectively: underlined bold italic numbers indicate coordinates in the final complete plasmid; plain font numbers indicate coordinates in original vector and fragments.

(10) FIG. 16 shows the cytotoxic activity of R-LM113 and R-LM249 recombinants compared to R-LM5 control virus. Histograms represent the total numbers of cells (y axis: cell number×10^4). For each sample of infected cells both the adherent (a) and detached (d) fractions of cells were counted. The hatched parts of the histograms represent the fraction of nonviable cells (Erythrosin B positive), and the corresponding values are indicated in the percentage values over the histograms. NI, non infected control cells.

DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

(11) According to a first aspect of the present invention there is provided a modified herpes simplex virus (HSV) comprising a glycoproteic envelope, which has an heterologous peptide ligand capable of binding in specific conditions a given receptor expressed by diseased cells and substantially not (or little) expressed by non-diseased cells. The glycoproteic envelope being so modified that the capability of the modified HSV of binding in specific conditions receptor nectin1/HveC is reduced (with respect to HSV wild type). Advantageously, the capability of the modified HSV of binding in specific conditions receptor nectin1/HveC is substantially ablated.

(12) According to some preferred embodiments, the capability of the modified HSV of binding in specific conditions receptor HVEM/HveA is reduced, advantageously substantially ablated.

(13) The illustrative embodiments are disclosed using as an exemplary virus a member of the Herpesviridae family, HSV-1.

(14) HSV-1 and HSV-2 are herpes simplex viruses. The subject matter of the present invention extends to any member of the Herpesviridae family and is not limited to the exemplary embodiments disclosed in the examples. Many HSV are known in the art. Such viruses may contain one or more mutated genes. Examples of recombinant viruses containing heterologous gene and methods of making and using such viruses are described in U.S. Pat. No. 5,599,691. Heterologous genes include genes encoding marker proteins (such as red or green fluorescent proteins or variations thereof, luciferase or β-galactosidase), which allow detection of infected cells expressing the protein.

(15) The modified HSV herein provided has the advantage of maintaining a relevant part of the infectivity of the wild type virus.

(16) According to specific embodiments, the peptide ligand is inserted in gD (glycoprotein D) of the glycoproteic envelope of HSV. A portion of gD is deleted. Advantageously, the peptide ligand is inserted in place of the deleted portion, in particular, so that the peptide ligand and gD form a fusion protein.

(17) Usually, (mature) wild type gD has the peptide sequence SEQ ID NO:1.

(18) Wild type gD derives from a precursor, which has peptide sequence SEQ ID NO:34.

(19) The mentioned precursor is codified by the nucleotide sequence SEQ ID NO:35.

(20) According to some embodiments of the present invention, gD, before it is modified, has at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 100% homology, advantageously identity, with respect to SEQ ID NO:1.

(21) According to some embodiments, the portion, which extends between positions corresponding to 40 to 61 SEQ ID NO:46, on the one side, and 210 to 218 SEQ ID NO:47, on the other side, is deleted. Advantageously, the deleted portion extends between positions corresponding to 61, on the one side, and 218, on the other side.

(22) Herein, loci (positions) of the peptide sequences modified or non-modified are identified with reference to a aminoacid numbering of aminoacid residues in corresponding positions of a unmodified (mature) wild type gD as identified by SEQ ID NO:1. Corresponding positions may be identified by aligning the unmodified residues (see above). For example, we hereinafter report the numbering of sequences of wild type gD (SEQ ID NO:1) and its precursor (SEQ ID NO:34)

(23) TABLE-US-00001 SEQ ID NO: 1 KYALADASLK MADPNRFRGK DLPVLDQLTD PPGVRRVYHI QAGLPDPFQP PSLPITVYYA  60 VLERACRSVL LNAPSEAPQI VRGASEDVRK QPYNLTIAWF RMGGNCAIPI TVMEYTECSY 120 NKSLGACPIR TQPRWNYYDS FSAVSEDNLG FLMHAPAFET AGTYLRLVKI NDWTEITQFI 180 LEHRAKGSCK YALPLRIPPS ACLSPQAYQQ GVTVDSIGML PRFIPENQRT VAVYSLKIAG 240 WHGPKAPYTS TLLPPELSET PNATQPELAP EDPEDSALLE DPVGTVAPQI PPNWHIPSIQ 300 DAATPYHPPA TPNNMGLIAG AVGGSLLAAL VICGIVYWMR RRTQKAPKRI RLPHIREDDQ 360 PSSHQPLFY 369 SEQ ID NO: 34 MGGAAARLGA VILFVVIVGL HGVRG KYALADASLK MADPNRFRGK DLPVLDQLTD PPGVRRVYHI QAGLPDPFQP PSLPITVYYA  60 VLERACRSVL LNAPSEAPQI VRGASEDVRK QPYNLTIAWF RMGGNCAIPI TVMEYTECSY 120 NKSLGACPIR TQPRWNYYDS FSAVSEDNLG FLMHAPAFET AGTYLRLVKI NDWTEITQFI 180 LEHRAKGSCK YALPLRIPPS ACLSPQAYQQ GVTVDSIGML PRFIPENQRT VAVYSLKIAG 240 WHGPKAPYTS TLLPPELSET PNATQPELAP EDPEDSALLE DPVGTVAPQI PPNWHIPSIQ 300 DAATPYHPPA TPNNMGLIAG AVGGSLLAAL VICGIVYWMR ARTQKAPKRI RLPHIREDDQ 360 PSSHQPLFY 369

(24) According to some embodiments, the deleted portion extends between positions corresponding to 1 to 8 SEQ ID NO:44, on the one side, and 38 to 55 SEQ ID NO:45 on the other side. Advantageously, the deleted portion is located between positions corresponding to 6, on the one side, and 38, on the other side.

(25) The aforementioned peptide ligand is any type of suitable ligand known in the art, for example a cytokine, a growth factor, a derivative of monoclonal antibody or, advantageously, a single chain antibody.

(26) According to some specific embodiments, the peptide ligand is capable of binding in specific conditions the given receptor, which has at least 70%, 80%, 90%, 95% or 100% homology, advantageously identity, with respect to receptor HER2/ErbB2.

(27) HER2/ErbB2 is a receptor which is overexpressed by, e.g., ovary tumor, mammary tumor, stomach tumor and salivary glands tumor cells (Hynes N. E. and H. A. Lane. “ERBB receptors and cancer: the complexity of targeted inhibitors.” Nat Rev Cancer (2005) 5: 341; Holbro, T. & Hynes, N. E. ErbB receptors: directing key signaling networks throughout life. Annu. Rev. Pharmacol. Toxicol. 44, 195-217 (2004); Hynes, N. E. & Stern, D. F. The biology of erbB-2/neu/HER-2 and its role in cancer. Biochim. Biophys. Acta 1198, 165-184 (1994)), and which is expressed at very low levels in non malignant tissues (Yamamoto et al; Nature. 1986 Jan. 16-22; 319(6050):230-4) (Press M. F et al., Oncogene (1990) 5:953).

(28) According to other embodiments, the peptide ligand is capable of binding in specific conditions the given receptor, which has at least 70%, 80%, 90%, 95% or 100% homology, advantageously identity, with respect to a given receptor chosen in the group consisting of: EGFR1 (epidermal growth factor receptor1) [Carpenter, G. (1992). Receptor tyrosine kinase substrates: src homology domains and signal transduction. Faseb J 6(14), 3283-9], EGFR3 [Hynes, N. E., and Lane, H. A. (2005). ERBB receptors and cancer: the complexity of targeted inhibitors. Nat Rev Cancer 5(5), 341-54], PMSA (antigen associated with the prostatic membrane), CEA (carcinoembrional antigen), GD2 (disialoganglioside, expressed in neuroblastoma and in melanoma), VEGF (vascular endothelial growth factor) receptors 1 and 2 expressed in neovasculature [Carmeliet, P. (2005). VEGF as a key mediator of angiogenesis in cancer. Oncology 69 Suppl 3, 4-10].

(29) It is important to stress that, for some of the aforementioned receptors natural ligands are known, e.g EGF, VEGF. In the state of the art, monoclonal antibodies and single chain antibodies, which target receptor expressed by diseased cells, are known. For example, J591, J415 e J533 have been made (see the patent application having publication number US20030007974). Single chain antibodies to EGFR1 (Nakamura, T., Peng, K. W., Vongpunsawad, S., Harvey, M., Mizuguchi, H., Hayakawa, T., Cattaneo, R., and Russell, S. J. (2004). Antibody-targeted cell fusion. Nat Biotechnol 22(3), 331-6), to EGFR3 (Horak, E., Heitner, T., Robinson, M. K., Simmons, H. H., Garrison, J., Russeva, M., Furmanova, P., Lou, J., Zhou, Y., Yuan, Q. A., Weiner, L. M., Adams, G. P., and Marks, J. D. (2005). Isolation of scFvs to in vitro produced extracellular domains of EGFR family members. Cancer Biother Radiopharm 20(6), 603-13), to VEGFR2/KDR (A7 scFv, Boldicke, T., Tesar, M., Griesel, C., Rohde, M., Grone, H. J., Waltenberger, J., Kollet, O., Lapidot, T., Yayon, A., and Weich, H. (2001). Anti-VEGFR-2 scFvs for cell isolation. Single-chain antibodies recognizing the human vascular endothelial growth factor receptor-2 (VEGFR-2/flk-1) on the surface of primary endothelial cells and preselected CD34+ cells from cord blood. Stem Cells 19(1), 24-36) have been described.

(30) Single chain antibodies against CEA have been prepared: inter alia, scFv MFE23 (which was disclosed in: Chowdhury et al, Retargeting Retrovirus, 2004 Mol. Ther. 9:85, Imaging, Mayer A., Clin. Cancer. Res. 6 (5): 1711 (2000), and in the patent application having publication number US20020090709) and scFv T84.66 (which was disclosed in: Hu, Cancer Research (1996) 56:3055; Olafsen T. et al., Protein Eng. Des. Sel. (2004) 17:21; Wong Y. J. et al., Clin. Cancer Res. (2004) 10:5014; Kenanova V. et al., Cancer Res. (2005) 65:622; US20030171551). The monoclonal antibody MAb 3F8 (US20040116379, US20040115688, U.S. Pat. No. 6,716,422, Kushner B. H. et al., (2001) 19:4189, Tur M. K. et al., Int. J. Molec. Med. (2001) 8:579, US20040180386) and the single chain antibody scFv 14.18 against GD2 are also known in the art.

(31) According to some specific embodiments, the ligand has at least 70%, 80%, 85%, 90%, 95%, 100% homology (advantageously identity) with a ligand chosen in the group consisting of: scFv J591, scFv MFE23, MAb 3F8, scFv T84.66 and scFv 14.18.

(32) According to some embodiments, the ligand consists of at least three hundred aminoacids; advantageously at least three hundred and twenty, three hundred and sixty or two hundred and forty.

(33) Advantageously, the ligand comprises a first domain (VL) and a second domain (VH) and a first linker (L1), which connects the first and the second domain (VL, VH) and is capable of allowing the first and the second domain (VL, VH) to take an adequate relative position; the first and the second domain (VL, VH) being designed to bind said given receptor.

(34) The ligand further comprises a second linker (L2) and/or a third linker (L3). The second domain (VH) being located between and connecting the first and the second linker (L1, L2). The first domain (VL) being located between and connecting the first and the third linker (L1, L3).

(35) The first domain (VL) consists of at least one hundred aminoacids, advantageously no more than one hundred and seventeen aminoacids. The second domain (VH) consists of at least one hundred and ten, advantageously no more than one hundred and thirty, aminoacids. The first linker (L1) consists of at least twelve, advantageously no more than thirty, amino acids.

(36) According to some embodiments, the first domain (VL) has at least 80%, 90%, 95%, 98%, 100% homology, advantageously identity, with respect to SEQ ID NO:2.

(37) TABLE-US-00002 SEQ ID NO: 2 SDIQMTQSPS SLSASVGDRV TITCRASQDV NTAVAWYQQK PGKAPKLLIY SASFLYSGVP SRFSGSRSGT DFTLTISSLQ PEDFATYYCQ QHYTTPPTFG QGTKVEI

(38) According to some embodiments, the first domain (VL) has at least 80%, 90%, 95%, 98% or 100% homology, advantageously identity, with respect to SEQ ID NO:3.

(39) TABLE-US-00003 SEQ ID NO: 3 SEVQLVESGG GLVQPGGSLR LSCAASGFNI KDTYIHWVRQ APGKGLEWVA
RIYPTNGYTR YADSVKGRFT ISADTSKNTA YLQMNSLRAE DTAVYYCSRW GGDGFYAMDY WGQGTLVTVS

(40) According to some embodiments, the first linker (L1) has at least 50%, 60%, 70%, 80%, 90%, 95%, 98% or 100% homology, advantageously identity, with respect to SEQ ID NO:4.

(41) TABLE-US-00004 SEQ ID NO: 4 KSDMPMADPN RFRGKNLVFH

(42) According to some embodiments, the second linker (L2) has at least 50%, 60%, 70%, 80%, 90%, 95%, 98% or 100% homology, advantageously identity, with respect to SEQ ID NO:5 or SEQ ID NO:8.

(43) TABLE-US-00005 SEQ ID NO: 5 SSGGGSGSGG S SEQ ID NO: 8 SSGGGSGSGG SG

(44) According to some embodiments, the third linker (L3) consists of at least two and, advantageously, no more than eight aminoacids. The third linker (L3) has at least 50%, 60%, 70%, 80%, 90% or 100% homology, advantageously identity, with respect to SEQ ID NO:6 or SEQ ID NO:7.

(45) TABLE-US-00006 SEQ ID NO: 6 EN SEQ ID NO: 7 HSSGGGSG

(46) According to some particular embodiments, the peptide ligand is inserted in gD (glycoprotein D) of the glycoproteic envelope and a portion of gD is deleted so that the obtained modified gD has at least 70%, 80%, 90%, 95%, 98% or 100% homology, advantageously identity, with respect to SEQ ID NO:10 or SEQ ID NO:9.

(47) TABLE-US-00007 SEQ ID NO: 10 KYALADASLK MADPNRFRGK DLPVLDQLTD PPGVRRVYHI QAGLPDPFQP PSLPITVYYA HSSGGGSGSD IQMTQSPSSL SASVGDRVTI TCRASQDVNT AVAWYQQKPG KAPKLLIYSA SFLYSGVPSR FSGSRSGTDF TLTISSLQPE DFATYYCQQH YTTPPTFGQG TKVEIKSDMP MADPNRFRGK NLVFHSEVQL VESGGGLVQP GGSLRLSCAA SGFNIKDTYI HWVRQAPGKG LEWVARIYPT NGYTRYADSV KGRFTISADT SKNTAYLQMN SLRAEDTAVY YCSRWGGDGF YAMDYWGQGT LVTVSSSGGG SGSGGSGMLP RFIPENQRTV AVYSLKIAGW HGPKAPYTST LLPPELSETP NATQPELAPE DPEDSALLED PVGTVAPQIP PNWHIPSIQD AATPYHPPAT PNNMGLIAGA VGGSLLAALV ICGIVYWMRR RTQKAPKRIR LPHIREDDQP SSHQPLFY SEQ ID NO: 9 KYALAENSDI QMTQSPSSLS ASVGDRVTIT CRASQDVNTA VAWYQQKPGK APKLLIYSAS FLYSGVPSRF SGSRSGTDFT LTISSLQPED FATYYCQQHY TTPPTFGQGT KVEIKSDMPM ADPNRFRGKN LVFHSEVQLV ESGGGLVQPG GSLRLSCAAS GFNIKDTYIH WVRQAPGKGL EWVARIYPTN GYTRYADSVK GRFTISADTS KNTAYLQMNS LRAEDTAVYY CSRWGGDGFY AMDYWGQGTL VTVSSSGGGS GSGGSHIQAG LPDPFQPPSL PITVYYAVLE RACRSVLLNA PSEAPQIVRG ASEDVRKQPY NLTIAWFRMG GNCAIPITVM EYTECSYNKS LGACPIRTQP RWNYYDSFSA VSEDNLGFLM HAPAFETAGT YLRLVKINDW TEITQFILEH RAKGSCKYAL PLRIPPSACL SPQAYQQGVT VDSIGMLPRF IPENQRTVAV YSLKIAGWHG PKAPYTSTLL PPELSETPNA TQPELAPEDP EDSALLEDPV GTVAPQIPPN WHIPSIQDAA TPYHPPATPN NMGLIAGAVG GSLLAALVIC GIVYWMRRRT QKAPKRIRLP HIREDDQPSS HQPLFY

(48) The precursors of SEQ ID NO:10 and SEQ ID NO:9 may be expressed by SEQ ID NO:36 and SEQ ID NO:37, respectively.

(49) The herein disclosed peptide sequences, in particular the modified gD, may be post-traslationally changed. Possible changes include, but are not limited to glycosylation, pegylation, albumination, farnysylation, carboxylation, hydroxylation, phosphorylation.

(50) In this regard it should be noted that, wild type gD has N-linked oligosaccharides added at every specific consensus sequence (Asn-X-Ser and/or Asn-X-Thr) (Sodora, D. L., G. H. Cohen, and R. J. Eisenberg. 1989. Influence of asparagine-linked oligosaccharides on antigenicity, processing, and cell surface expression of herpes simplex virus type 1 glycoprotein D. J Virol 63:5184-93) and possible O-linked oligosaccharides added at one or more Ser and/or Thr residue. Advantageously, also the modified gD and/or the ligand include such modifications.

(51) It has been experimentally seen that, surprisingly, the modified HSV according to the present invention, although the sequences aa 7-32, that in wt gD are involved in the interaction with HVEM, were not always deleted, has lost not only the ability to interact with nectin1, but also with HVEM, and is therefore detargeted from both natural receptors HVEM and nectin1.

(52) In this regard, it should be noted that, contrary to efforts described by Zhou and Roizman (WO2004/033639), the used ligand (in this case the scFv) is not inserted at the N-terminus of gD, but is inserted between two portions of gD that contain residues that can not be deleted (namely the N-terminus up to aa residue 60, and the region 218-end). A particular feature of the modified HSV is that these portions are linked together in a single polypeptide chain, and are linked and held together, in particular, by the scFv that, in this case, fulfills simultaneously two functions (i) provides the new ligand for the receptors to be targeted (and hence directs the tropism of the recombinant virus to the receptor of choice), and (ii) provides the scaffolding function that, in wt-gD, is located in the Ig-folded portion included in the polypeptide 61-218.

(53) Further modifications that conceivably improve the ability of the targeted virus to specifically attach to and enter cells that express the receptor targeted by the heterologous ligand include the removal of specific sequences in glycoprotein gB (aminoacid residues 68-77) and gC (aminoacid residues 136-152) that enable the binding to the non specific HSV receptor heparan sulphate. Such sequences, or extensions thereof, may be replaced with the heterologous ligand of choice, in order to concentrate further the recombinant virus on the cells of choice.

(54) A further implementation consists in the introduction in the viral genome of mutations that greatly favour the spread of the virus from an infected cell to a nearby adjacent cells. Mutations that exert such effect are known. Typically they cause the infected cells to form a syncytium (or polykaryocyte) with nearby cells, and are called syncytial (syn) mutations. Examples of such mutations are A40V located in gK and R858H, T813I, R796C located in gB.

(55) In accordance with a further aspect of the present invention, there is provided the above identified modified HSV for use as a medicament, advantageously for treating tumors; in particular, ovary tumor, mammary tumor, prostate tumor, colon tumor, stomach tumor, salivary gland tumor, melanoma, neuroblastoma, head and neck carcinoma, neoangiogenic tissue, in particular neoangiogenic tissues of a tumor, and/or metastasis thereof. Advantageously, the above defined modified HSV is used for treating ovary tumor, mammary tumor, prostate tumor, stomach tumor, salivary gland tumor and metastasis thereof. Advantageously, the above defined modified HSV is provided for use in treating ovary tumor, mammary tumor and metastasis thereof.

(56) In this regard, it is important to point out that the aforementioned modified HSV is particularly useful for treating tumor metastasis. This is due to the fact that once the modified HSV is administered, it diffuses and infects autonomously the metastasis.

(57) The modified HSV may be administered to a subject by any known means. In particular, the modified HSV may be administered directly in the area of a tumor or, alternatively, systemically, for example where metastasis have been detected or the tumor is not directly accessible.

(58) Pharmaceutical preparations containing the modified HSV are substantially devoid of impurities that may cause damages to the subject, in particular human beings or other mammals. Pharmaceutical preparations, advantageously, comprise one or more pharmaceutically acceptable excipients.

(59) The modified HSV may be formulated for every known type of administration: in particular, for oral or parenteral or rectal administration or in forms designed for inhalation or insufflation (both by mouth and by nose). Formulation for parenteral use are advantageous.

(60) For oral administration, the pharmaceutical preparations can be, for example, in the form of tablets or capsules prepared using known methods with excipients acceptable from a pharmaceutical point of view as binding agents (for example pre-gelatised corn starch, polyvinylpyrrolidone or methylcellulose); fillers (for example lactose, microcrystalline cellulose or calcium hydrogen phosphate); additives (for example magnesium stearate, talc, silica); disintegrants (for example potato starch); and/or lubricating agents (for example sodium lauryl sulphate). The tablets can be coated with known methods. Liquid preparations for oral administration may have the form, for example, of syrupy solutions or suspensions, or they can be in the form of a dry product which can be dissolved in water or in another liquid before use. These preparations can be prepared in known ways with pharmaceutically acceptable additives such as suspending agents (for example sorbitol, cellulose derivatives, edible hydrogenated fats); emulsifying agents (for example lecithin or acacia); non aqueous liquids (for example almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and/or preservatives (for example methyl or propylp-hydroxybenzoates, sorbic acid or ascorbic acid). The preparations can also contain, in appropriate cases, buffering salts, colouring, aromatic and/or sweetening agents.

(61) Preparations for oral administration can be formulated in a known way, so as to give a controlled release of the active compound.

(62) The modified HSV can be formulated, in a known way, for parenteral administration by injection or continuous administration. Formulae for injection may be in the form of single doses, for example in ampoules or multidose containers containing preservatives. The preparation may be in the form of a suspension, in aqueous or oily liquids, and it may contain formulation elements such as dispersing and stabilising agents. Alternatively, the active compound may be in powder form to be dissolved immediately before use in a suitable liquid, for example sterilised water.

(63) The modified HSV can be formulated for rectal administration as suppositories or enteroclysis, for example containing excipients for suppositories of a known type such as cocoa butter or other fats.

(64) The modified HSV can also be formulated, in a known way, as preparations with prolonged release. These preparations with prolonged release can be administered by means of an implant (for example subcutaneous, or intramuscular) or by means of an intramuscular injection. So, for example, the modified HSV can be formulated with suitable polymeric or hydrophobic materials (for example an emulsion or an oil) or resins with ionic exchange, or relatively poorly soluble derivatives, such as relatively poorly soluble salts.

(65) For intranasal administration, the modified HSV can be formulated for administration by means of a (known) device, for example in powder form with a suitable carriers.

(66) The dosages of the modified HSV may be defined as the number of plaque forming unit (pfu). Example of dosages include 10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10 o 10.sup.11 pfu.

(67) The subject to be treated may be any mammal, for example a human being. Other examples of animals that may be treated are: farm animals such as cattle, swine, goat, sheep, horse; pets such as cats and dogs; rabbit, mouse, rat.

(68) In some cases it is possible to administer the modified HSV together with further treatments of chemi-, immuno-, radio-therapy and/or other types of treatments.

(69) In particular, the modified HSV may be used in combination with inhibitors of angiogenesis such as, for example: Endostatine (EntreMED), SU5416, SU6668 (Sugen, San Francisco), Talidomide, COL-3 (Collagenex, Newton Pa.), AG3340 (Agouron, LaJolla, Calif.), Marimastat (British Biotech), Neovastat (Aeterna, Quebec), BMS-275291 (Bristol-Myers Squibb).

(70) In accordance with a further aspect of the present invention, there is provided the use of a modified HSV for visualising a physiological condition, advantageously for identifying tumor metastasis. Accordingly, it is herein provided the use of the modified HSV for preparing a composition for visualising a physiological condition. Such a composition may be prepared using known methods so that it can be administered to a subject.

(71) Advantageously, the visualization may be directed to: ovary tumor, mammary tumor, prostate tumor, colon tumor, stomach tumor, salivary gland tumor, melanoma, head and neck carcinoma, neoangiogenic tissue, in particular neoangiogenic tissues of a tumor, and neuroblastoma and/or metastasis thereof; advantageously, ovary tumor, mammary tumor, prostate tumor, stomach tumor, salivary gland tumor and metastasis thereof; in particular, ovary tumor, mammary tumor and metastasis thereof.

(72) The visualization of physiological conditions may be obtained by means of imaging of the expression of the gene thymidine-kinase (TK) using detecting highly sensible techniques such as PET or SPECT (Sharma et al, Molecular imaging of gene expression and protein function in vivo with PET and SPECT, J. Magn. Reson. Imaging., 16(4):336-51, 2002) (Vries et al., Scintgraphic Imaging of HSV Gene Therapy, Curr. Pharm. Des., 8(16):1435-50, 2002) (Vries et al., Positron Emission Tomography: measurement of transgene expression, Methods, 27(3):234, 2002).

(73) Alternatively it is possible to fuse a non-essential protein (for example U.sub.511) and a reporter protein capable of being identified in vivo (for example red or green fluorescent proteins or variations thereof, luciferase or β-galactosidase).

(74) Where the luciferase is used, its presence may be emphasized by means of a suitable luminescent or chromatic substrate. The reporter protein may be fused to a thymidine-kinase (Soling et al., Intercellular localization of Herpes simplex virus of the type 1 thymidine kinase fused to different fluorescent proteins depends on choice of fluorescent tag, FEBS Lett., 527(1-3):153, 2002).

(75) In accordance with a further aspect of the present invention, there is provided a process of preparing a modified HSV as above defined. The process comprises an insertion phase, during which a nucleotide sequence codifying the peptide ligand is inserted in the DNA of HSV so that the so obtained modified HSV expresses on its envelope the peptide ligand.

(76) Advantageously, the DNA of the HSV is so manipulated that the gD codifying sequence of the modified HSV has at least 70%, 80%, 90%, 95% or 100% homology, advantageously identity, with respect to SEQ ID NO:36 or SEQ ID NO:37, in particular SEQ ID NO:37.

(77) Before insertion suitable ligands, advantageously a single chain antibodies, may be identified using known techniques for testing their ability of binding at least one receptor expressed by the diseased cells.

(78) Further characteristics of the present invention will be clarified the following description of some merely illustrative and non-limiting examples.

Example 1—Construction of HSV Expressing Genetically Modified gDs Carrying Deletions Substituted with a Single Chain Antibody Directed to HER2/Neu and Carrying EGFP as Reporter Gene

(79) A) Deletion of gD from HSV-BAC.

(80) To generate a gDminus virus, the “ET-cloning” procedure in bacteria was performed (Muyrers, J. P., Y. Zhang, G. Testa, and A. F. Stewart. 1999. Rapid modification of bacterial artificial chromosomes by ET-recombination. Nucleic Acids Res 27:1555-7). A kanamycin resistance cassette flanked by two FRT sites was PCR amplified from the plasmid pFRT-2, with primers that contained at their 5′ ends 60 nt of sequences flanking gD ORF: gDup_Kan_f (TGT TCG GTC ATA AGC TTC AGC GCG AAC GAC CAA CTA CCC CGA TCA TCA GTT ATC CTT AAG CCA GTG AAT TCG AGC TCG GTA C) (SEQ ID NO:11) and gDdown_Kan_r (ACT TAT CGA CTG TCC ACC TTT CCC CCC TTC CAG ACT CGC TTT ATA TGG AGT TAA GGT CCC GAC CAT GAT TAC GCC AAG CTC C) (SEQ ID NO:12). pFRT-2 was constructed by insertion of the kanamycin resistance derived from pCP15 into the NsiI sites of pCP16 replacing the tetracyclin resistance gene Cherepanov, P. P., and W. Wackernagel. 1995. Gene disruption in Escherichia TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158:9-14. The PCR product was electroporated into DH10B E. coli (Stratagene) harboring the YEbac102 HSV-BAC Tanaka, H. Kagawa, Y. Yamanashi, T. Sata, and Y. Kawaguchi. 2003. Construction of an excisable bacterial artificial chromosome containing a full-length infectious clone of herpes simplex virus type 1: viruses reconstituted from the clone exhibit wild-type properties in vitro and in vivo. J Virol 77:1382-91, and transiently expressing lambda phage Red-β and Red-γ recombinases from pKD46 plasmid Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97:6640-5. Recombinant clones were selected on plates containing two antibiotics, 25 μg/ml kanamycin (the marker contained in the PCR product) and 20 μg/ml chloramphenicol (the marker contained into HSV-BAC sequences), to ensure substitution of the gD coding sequence by the kanamycin resistance cassette. To remove the kanamycin cassette, the positive clones were electroporated with pCP20 (Cherepanov, P., and W. Wackernagel. 1995. Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158:9-14), a plasmid expressing yeast FLP recombinase, which targets FRT sequences. Finally the colonies were assayed for loss of the kanamycin marker and for chloramphenicol resistance. The resulting gDminus HSV-BAC genome, designated 102gD.sup.−FRT, was checked by Southern blot, PCR, sequencing, and for the ability to form plaques only in R6, and not in other cell lines.

(81) B) Engineering of EGFP (Enhanced Green Fluorescent Protein) or LacZ Reporter Genes into 102gD.sup.−FRT HSV-BAC.

(82) The second step in the engineering of HSV-BAC recombinants was the insertion of the reporter gene EGFP or LacZ, thus generating gDminus-EGFP-HSV-BAC or gDminus-LacZ-HSV-BAC. We chose as site of reporter gene insertion the pBeloBAC sequences themselves, so that, the marker gene can be deleted together with the BAC sequences by Cre recombinase, if required (FIG. 1 A). The coding sequence of EGFP followed by the polyadenylation signal from the bovine growth hormone (BGH) was PCR amplified from pCMS-EGFP (Clontech) with primers EGFP_BamHI_f (CAA CCC GGG ATC CAC CGG TCG CCA CCA TGG TGA GC) (SEQ ID NO:13) and EGFP+pA_BamHI_r (CCC CTT GGG ATC CTG CCC CAC CCC ACC CCC CAG AAT AG) (SEQ ID NO:14), and cloned downstream the HSV a27 promoter. The a27-EGFP cassette was inserted between two 700 bp sequences, PCR amplified from the plasmid pBeloBac11 (GenBank Accession #: U51113). The two aforementioned 700 bp sequences were designated as pBeloBac11-up [primers Sal_pBelo_1209_f: TTG CCA GTC GAC ATT CCG GAT GAG CAT TCA TCA GGC GGG CA (SEQ ID NO:15) and pBelo_1897_Xho_r: GCA AAA ACT CGA GTG TAG ACT TCC GTT GAA CTG ATG GAC (SEQ ID NO:16)] and pBeloBac11-down [primers Mun_pBelo_1898_f: GGA AGT CAA TTG GAA GGT TTT TGC GCT GGA TGT GGC TGC CC (SEQ ID NO:17) and pBelo_2586_Eco_r: CAC ACT GAA TTC GCA ATT TGT CAC AAC ACC TTC TCT AGA AC (SEQ ID NO:18)]. In the resulting construct, the a27-EGFP cassette resulted inserted between nt 1897 and 1898 (original coordinates) of pBeloBac11. The cassette a27-EGFP plus the pBeloBac11 flanking sequences was subcloned in the shuttle vector pST76KSR Adler, H., M. Messerle, M. Wagner, and U. H. Koszinowski. 2000. Cloning and mutagenesis of the murine gammaherpesvirus 68 genome as an infectious bacterial artificial chromosome. J Virol 74:6964-74 for homologous recombination in bacteria. For LacZ insertion, we followed the same strategy, cloning pBeloBac11-up and -down sequences into a plasmid already containing the a27-LacZ cassette. The relevant insert and adjacent regions were sequenced for accuracy in all plasmids.

(83) C) Construction of Shuttle Vectors for Insertion of Chimeric gD into gDminus BACs.

(84) The gD shuttle vector named pS31 (FIG. 10) carries the scHER2L (scFv anti HER2 plus a 9-aa serine glycine Linker) inserted between aa residues 24 and 25 of gD, plus the V34S substitution (FIG. 1 B, b). It was constructed as follows. First, the V34S substitution was introduced by site directed mutagenesis in pLM13 (FIG. 8), a construct carrying scHER2L inserted between aa residues 24 and 25 of gD, generating pLM31 (FIG. 9). Mutagenesis was performed by means of the Stratagene Quickchange II kit (Stratagene) with primers gD_34S_StuI 5′-TCC TCC GGG GAG CCG GCG CGT GTA CCA CAT CCA GGC AGG CCT ACC GG-3′ (SEQ ID NO:19) and its reverse. The primers contained the indicated silent restriction sites, for ease of mutant clones screening. Next, the cassette containing the mutagenized gD+scHER2 plus gD genomic upstream and downstream flanking sequences (about 500 bp each) was transferred to pST76KSR shuttle vector to enable homologous recombination in E. coli.

(85) To construct pS39 (FIG. 11), the D215G, R222N, F223I substitutions were added to gD cloned in pS31 by means of the primer gD_215G-222N-223I_PvuI 5′-AGG GGG TGA CGG TGG GCT CGA TCG GGA TGC TGC CCA ACA TCA TCC CCG AGA ACC-3′ (SEQ ID NO:20) and its reverse (FIG. 1 B, c).

(86) The pS113 shuttle vector (FIG. 13) contains gD, in which aa residues 6-38 were deleted and replaced with scHER2L [scFv anti HER2 followed by a 11 aa serine-glycine linker: SSGGGSGSGGS (SEQ ID NO:5), encoded by the sequence TCGAGTGGCGGTGGCTCTGGTTCCGGTGGATCC (SEQ ID NO:21)](FIG. 1 B, d). To generate this construct, EcoRI and BamHI restriction sites were sequentially introduced in gD ORF in pLM5 (FIG. 7). The EcoRI restriction site was inserted in the aminoacid positions 6-8 of the protein sequence and BamHI restriction site was inserted in the amino acid positions 37-39 of the protein sequence, by means of the mutagenic primers gD_6/8_EcoRI_f 5′-CAA ATA TGC CTT GGC GGA GAA TTC TCT CAA GAT GGC CG-3′ (SEQ ID NO:22) and gD_37/38_BamHI_f 5′-CGG GGG TCC GGC GCG GAT CCC ACA TCC AGG CGG G-3′ (SEQ ID NO:23), respectively. The insertion of the EcoRI site introduces the substitutions D6E and A7N. The scHER2L was amplified from pS2019a Sidhu, S. S., B. Li, Y. Chen, F. A. Fellouse, C. Eigenbrot, and G. Fuh. 2004. Phage-displayed antibody libraries of synthetic heavy chain complementarity determining regions. J Mol Biol 338:299-310 with primers scFv_x6_Eco_f 5′-GCA AAG GAA TTC CGA TAT CCA GAT GAC CCA GTC CCC G-3′ (SEQ ID NO:24) and scFv_SG_x37_BamH 5′-CGG AGG ATC CAC CGG AAC CAG AGC CAC CGC CAC TCG AGG-3′ (SEQ ID NO:25). This construct was designated pLM113 (FIG. 12). The final shuttle plasmid pS113 was constructed by subcloning the engineered gD along with genomic flanking sequences (NruI-PmeI fragment) into pST76KSR (FIG. 13).

(87) The pS249 shuttle vector contains gD, in which aa residues 61-218 were deleted and replaced with LscHER2L [scFv anti HER2 flanked by serine-glycine linkers, upstream 8 aa: HSSGGGSG (SEQ ID NO:7), encoded by the sequence CATAGTAGTGGCGGTGGCTCTGGA (SEQ ID NO:26); downstream 12 aa: SSGGGSGSGGSG (SEQ ID NO:8), encoded by the sequence TCGAGTGGCGGTGGCTCTGGTTCCGGTGGATCCGGT (SEQ ID NO:27)] in place of gD aa residues 61 to 218 (FIG. 1 B, e). Mutagenesis and cloning was performed on pLM5 (FIG. 7), a plasmid containing gD ORF cloned in pcDNA3.1 (−) (Invitrogen), flanked by two 500-bp upstream and downstream genomic flanking sequences Menotti, L., A. Cerretani, and G. Campadelli-Fiume. 2006. A herpes simplex virus recombinant that exhibits a single-chain antibody to HER2/neu enters cells through the mammary tumor receptor, independently of the gD receptors. J Virol 80:5531-9. First, two NdeI sites were inserted in the coding sequence replacing the amino acids 61-62 and 218-219 of mature gD, respectively, by using mutagenic primers gD_61/62_NdeI_f (5′-acg gtt tac tac gcc CAT Atg gag cgc gcc tgc c-3′) (SEQ ID NO:28) and gD_218/219_NdeI_f (5′-GAC GGT GGA CAG CAT CCA TAT GCT GCC CCG CTT C-3′) (SEQ ID NO:29). Next, a 9 aa serine-glycine linker was inserted by annealing and ligating into the NdeI site the two phosphorylated oligos P-SG9Bam7/Nde_f (5′-TAG TAG TGG CGG TGG CTC TGG ATC CGG-3′) (SEQ ID NO:30) and P-SG9Bam7/Nde_r (5′-tAC CGG AtC CAG AGC CAC CGC CAC Tac-3′) (SEQ ID NO:31), containing a silent BamHI site. The scHER2 was amplified from pS2019a Sidhu, S. S., B. Li, Y. Chen, F. A. Fellouse, C. Eigenbrot, and G. Fuh. 2004. Phage-displayed antibody libraries of synthetic heavy chain complementarity determining regions. J Mol Biol 338:299-310 with primers scFv_Bam_f (5′-GGC TTA TGG ATC CGA TAT CCA GAT GAC CCA GTC CCC-3′) (SEQ ID NO:32) and scFv_SG_x37_BamH_r (5′-CGG Agg atc cAC CGG AAC CAG AGC CAC CGC CAC TCG AGG-3′) (SEQ ID NO:33) and inserted into the BamHI site of the serine-glycine linker. The total insert length is of 801 bp, encoding 267 aa residues. The construct was designated pLM249. Finally the cassette containing the engineered gDΔ61-218+LscHER2L plus gD genomic upstream and downstream flanking sequences (the NruI-PmeI fragment from pLM249) was subcloned into SmaI of pST76KSR shuttle vector generating pS249 (FIG. 14) for homologous recombination in E. coli. The relevant insert and adjacent regions were sequenced for accuracy in all plasmids.

(88) D) Generation of Recombinant Genomes by Two-Step Replacement in Bacteria.

(89) The procedure applied to generate recombinant genomes in E. coli was essentially as described, with slight modifications O'Connor, M., M. Peifer, and W. Bender. 1989. Construction of large DNA segments in Escherichia coli. Science 244:1307-12; Messerle, M., I. Crnkovic, W. Hammerschmidt, H. Ziegler, and U. H. Koszinowski. 1997. Cloning and mutagenesis of a herpesvirus genome as an infectious bacterial artificial chromosome. Proc Natl Acad Sci USA 94:14759-63; Borst, E. M., G. Hahn, U. H. Koszinowski, and M. Messerle. 1999. Cloning of the human cytomegalovirus (HCMV) genome as an infectious bacterial artificial chromosome in Escherichia coli: a new approach for construction of HCMV mutants. J Virol 73:8320-9. Briefly, electrocompetent DH10B E. coli (Stratagene) harbouring the relevant gDminus HSV-BAC genomes were electroporated with the shuttle vector in 0.2 cm electroporation cuvettes (Bio-Rad) at 200 o, 25 μF, 2.5 kV, plated on LB agar containing 25 μg/ml Kana (the shuttle vector's marker) and 20 μg/ml Cam (the BAC's marker Tanaka, M., H. Kagawa, Y. Yamanashi, T. Sata, and Y. Kawaguchi. 2003. Construction of an excisable bacterial artificial chromosome containing a full-length infectious clone of herpes simplex virus type 1: viruses reconstituted from the clone exhibit wild-type properties in vitro and in vivo. J Virol 77:1382-91), and incubated at 30° C. o/n to allow the expression of RecA from the shuttle vector. The clones were re-plated onto LB+Kana+Cam at 43° C. to allow the identification of those harbouring the cointegrates (visible as large colonies, as compared to the temperature sensitive “small colony” phenotype determined by non-integrated shuttle vectors). Subsequently, the cointegrates were allowed to resolve by plating the clones onto LB+Cam at 30° C., and clones containing the resolved HSV-BAC were selected on LB+Cam plates supplemented with 10% sucrose. Finally, the clones were checked for loss of Kana resistance, and for the presence of the desired insert by colony PCR.

(90) Recombination between the 102gD.sup.−FRT HSV-BAC and the appropriate shuttle vectors generated gDminus-EGFP-HSV-BAC, or gDminus-LacZ-HSV-BAC DNAs, that contain the a27promoter-EGFP (or a27promoter-LacZ) cassette inserted into the BAC sequences (FIG. 1 A). The viruses were reconstituted by transfection of the BAC DNA in the gD-complementing R6 cells.

(91) The gDminus-HSV-BACs was used as recipient for the generation of recombinants containing the engineered gD. The recombinant genomes were checked by PCR and sequencing. The viruses were reconstituted by transfection of the BAC-DNAs into R6 cells Zhou, G., V. Galvan, G. Campadelli-Fiume, and Roizman. 2000. Glycoprotein D or J delivered in trans blocks apoptosis in SK-N-SH cells induced by a herpes simplex virus 1 mutant lacking intact genes expressing both glycoproteins. J Virol 74:11782-91, followed by a single passage in BHK (baby hamster kidney) cells, and subsequent growth in J-HER2 Menotti, L., A. Cerretani, and G. Campadelli-Fiume. 2006. A herpes simplex virus recombinant that exhibits a single-chain antibody to HER2/neu enters cells through the mammary tumor receptor, independently of the gD receptors. J Virol 80:5531-9 or SKOV3 (ATCC#HTB-77) cells. The virus stocks were grown in J-HER2 or SKOV3 cells and serially passaged for more than 10 passages. The virus titer was determined in SKOV3 cells.

Example 2—Infection Assay with the R-LM31 Recombinant Carrying the V34S Substitution in gD

(92) The 1.sup.st generation recombinants R-LM11 and R-LM11L carried scHER2 inserted between aa residues 24 and 25 of gD Menotti, L., A. Cerretani, and G. Campadelli-Fiume. 2006. A herpes simplex virus recombinant that exhibits a single-chain antibody to HER2/neu enters cells through the mammary tumor receptor, independently of the gD receptors. J Virol 80:5531-9. The insertion altered the N-terminus such that entry through HVEM was hampered. Entry through nectin1 was maintained Menotti, L., A. Cerretani, and G. Campadelli-2006. A herpes simplex virus recombinant that exhibits a single-chain antibody to HER2/neu enters cells through the mammary tumor receptor, independently of the gD receptors. J Virol 80:5531-9. The first attempt to generate a nectin1-detargeted recombinant consisted in the insertion of the V34S mutation in gD-scHER2 (FIG. 1b). When introduced in the IL13-retargeted gD, the V34S substitution strongly decreased entry via nectin1 Zhou, G., and B. Roizman. 2006. Construction and properties of a herpes simplex virus 1 designed to enter cells solely via the IL-13alpha2 receptor. Proc Natl Acad Sci USA 103:5508-13. The recombinant LM31-BAC DNA was generated by homologous recombination in E. coli. The recipient genome was gDminus-LacZ-HSV-BAC. The R-LM31 recombinant virus was obtained by transfection of the LM31-BAC DNA in the gD-complementing R6 cells. R-LM31 tropism was assayed in J cells expressing human or murine nectin1, or human HER2, and monitored as β-galactosidase activity. As shown in FIG. 2 A-D, the R-LM31 recombinant infected J-nectin1 cells (Cocchi, F., L. Menotti, P. Mirandola, M. and G. Campadelli-Fiume. 1998. The ectodomain of a novel member of the immunoglobulin superfamily related to the poliovirus receptor has the attibutes of a bonafide receptor for herpes simplex viruses 1 and 2 in human cells. J Virol 72:9992-10002) (via either the human or murine receptor); hence it was not detargeted from nectin1. The result indicates that the effect of the V34S substitution varies depending on the insert present in gD.

Example 3—Electrophoretic Mobility of Wt and Chimeric gDs Expressed in SKOV3 Cells

(93) SKOV3 cells were infected with R-LM5 (the peptide sequence of gD of R-LM5 is SEQ ID NO:1, whose precursor is expressed by the nucleotide sequence SEQ ID NO:35), R-LM13 (the peptide sequence of gD of R-LM13 is SEQ ID NO:42, whose precursor is expressed by the nucleotide sequence SEQ ID NO:43), R-LM31 (the peptide sequence of gD of R-LM31 is SEQ ID NO:38, whose precursor is expressed by the nucleotide sequence SEQ ID NO:39), R-LM39 (the peptide sequence of gD of R-LM39 is SEQ ID NO:40, whose precursor is expressed by the nucleotide sequence SEQ ID NO:41), R-LM113 (SEQ ID NO:9) and R-LM249 at an m.o.i of 10 pfu/cell. 24 h later infected cell lysates were separated by SDS-PAGE, transferred to nitrocellulose membranes (Amersham), and visualized by Western blotting with MAb BD80 against gD C-terminal portion of the ectodomain, followed by peroxidase-conjugated anti-mouse IgG and enhanced chemioluminescence (FIG. 2 E). In the R-LM31 and R-LM39 recombinants the presence of scHER2L results in a slower migration, as in the R-LM13 prototype virus, as compared to R-LM5 carrying wt-gD. In the R-LM113 recombinant the electrophoretic mobility of chimeric gD is indistinguishable from that of the R-LM13-31-39 recombinants'. In the R-LM249 recombinant, the replacement of 158 aa residues of gD with LscHER2L results in a migration intermediate between wt gD and gD of R-LM113 (where 6-38 aa residues of gD are replaced by scHER2L). R-LM113 produces less gD as R-LM5 or R-LM249, as the corresponding lane needed to be loaded with 10 times as much lysate as compared to R-LM5 or R-LM249 to obtained the signal observed in FIG. 2. This lower production of gD was previously reported for viruses carrying deletion in gD N-terminus Zhou, G., and B. Roizman. 2006. Construction and properties of a herpes simplex virus 1 designed to enter cells solely via the IL-13alpha2 receptor. Proc Natl Acad Sci USA 103:5508-13.

Example 4—Infection of an Array of Cells Lines by R-LM113 and R-LM249

(94) Monolayers of an array of cell lines of rodent, simian or human origin were infected at increasing m.o.i, and EGFP reporter gene expression (Clontech) was measured 24 h later by means of a fluorometer. Digital pictures were taken with a Kodak camera connected to a Zeiss Axioplan fluorescence microscope. R-LM113 and R-LM249 infected J-HER2 cells, but not J cells expressing human nectin1 or murine nectin1 as the sole receptor (FIG. 3). The detargeting from murine nectin1 was confirmed by failure to infect L and NIH-3T3 cells. Human cells were susceptible to R-LM113 and R-LM249, provided that they expressed HER2 at high level (SKOV3). HER2-negative cells, e.g. HEp-2 ATCC #CCL-23, I-143 tk.sup.− (Post, L. E., and Roizman, B. (1981). A generalized technique for deletion of specific genes in large genomes: alpha gene 22 of herpes simplex virus 1 is not essential for growth. Cell 25(1), 227-32.) and RH4 (rhabdomyosarcoma) cells Ricci, C., L. Landuzzi, I. Rossi, C. De Giovanni, G. Nicoletti, A. Astolfi, S. Pupa, S. Menard, K. Scotlandi, P. Nanni, and P. L. Lollini. 2000. Expression of HER/erbB family of receptor tyrosine kinases and induction of differentiation by glial growth factor 2 in human rhabdomyosarcoma cells. Int J Cancer 87:29-36, were infected to a negligible level. Interestingly, R-LM113 and R-LM249 were specific for human HER2, as they failed to infect the TT12.E2 mouse cell line expressing the rat ortholog of HER2 (neu-NT) De Giovanni, C., G. Nicoletti, L. Landuzzi, A. Astolfi, S. Croci, A. Comes, S. Ferrini, R. Meazza, M. Iezzi, E. Di Carlo, P. Musiani, F. Cavallo, P. Nanni, and P. L. Lollini. 2004. Immunoprevention of HER-2/neu transgenic mammary carcinoma through an interleukin 12-engineered allogeneic cell vaccine. Cancer Res 64:4001-9.

Example 5—Virus Replication Assay

(95) J, J-hNectin1, J-HVEM, J-HER2, SKOV3, I-143 tk.sup.− and HEp-2 cells grown in 12-well plates were infected with the viruses indicated in FIG. 4 at a m.o.i. of 1 pfu/cell for 90 min at 37° C. Following virus adsorption, the inoculum was removed and the non penetrated virus was inactivated by means of an acid wash (40 mM citric acid, 10 mM KCl, 135 mM NaCl [pH 3]) Brunetti, C. R., R. L. Burke, B. Hoflack, T. Ludwig, K. S. Dingwell, and D. C. Johnson. 1995. Role of mannose-6-phosphate receptors in herpes simplex virus entry into cells and cell-to-cell transmission. J Virol 69:3517-28. Replicate cultures were frozen at the indicated times (3, 24, 48 h) after infection. The viral progeny (intracellular plus extracellular) was titrated in SKOV3 cells.

(96) The growth of R-LM39, R-LM113 and R-LM249 was compared to recombinant virus R-LM5 (encoding wild type gD) and R-LM13 (encoding chimeric gD-scHER2L without further mutations or deletions). (i) R-LM39 was unable to grow in J-HVEM cells, but replicated in J-HER2 and in J-nectin1 cells, implying that it could use both HER2 and nectin1 as receptors (FIG. 4 B, C, D). Accordingly, it replicated in the human cell lines SKOV3 (that express both nectin1 and HER2), I-143 tk.sup.− and HEp-2 cells (that express nectin1) (FIG. 4 E, F, G). (ii) R-LM113 grew efficiently in J-HER2 cells, better than R-LM249 and R-LM5 (FIG. 4D). In SKOV3 cells R-LM113 and R-LM249 replicated to titers only 1 to 1.5 orders of magnitude lower than those of the control virus R-LM5 (FIG. 4E). (iii) R-LM113 and R-LM249 were detargeted from both nectin1 and HVEM, as assessed by its inability to grow in J-nectin1 and in J-HVEM cells, as well as in the human I-143 tk.sup.− and HEp-2 to titers higher than 10.sup.2-10.sup.3-10.sup.4 pfu/ml (FIG. 4 B, C F, G).

Example 6—Inhibition of Virus Infection by Antibodies

(97) SKOV3 cells grown in 96-well plates were incubated for 2 h on ice with increasing concentrations of antibodies (R1.302 to nectin1, Herceptin to HER2, or mouse immunoglobulins) diluted in DMEM without serum, and then with the viral inoculum at the m.o.i of 2 pfu/cell (as titered in SKOV3 cells) for further 90 min on ice. Following virus adsorption, the unattached virus was removed and cells were washed twice with ice cold RPMI+Glutamax supplemented with 2.5% FBS. Cells were overlaid with medium containing the same concentration of antibodies or IgGs, rapidly shifted at 37° C., and incubated for 16 h. Infection was quantified as EGFP fluorescence intensity by means of a Victor plate reader (Perkin Elmer). The 100% value represents data obtained with cells infected with virus, in the absence of antibodies.

(98) Receptor usage was confirmed in virus blocking experiments with Herceptin, MAb R1.302, or mixture of the two antibodies. The results in FIG. 5 show that R-LM39 was not blocked by Herceptin or R1.302 administered singly, but only by the two antibodies in combination (FIG. 5 A). The results imply that R-LM39 can use alternatively nectin1 or HER2 as receptors, further documenting the lack of detargeting from nectin1. On the contrary R-LM113 and R-LM249 were blocked by Herceptin (FIGS. 5B and C). The combination of Herceptin plus MAb R1.302 exerted the same inhibition as Herceptin alone; MAb R1.302 had no effect. R-LM113 or R-LM249 infection was inhibited by Herceptin alone, while MAb R1.302 alone had no effect. We conclude that R-LM113 and R-LM249 can enter cells only through the HER2 receptor, in accordance with the results shown in FIG. 4.

Example 7—Inhibition of R-LM113 and R-LM249 Plaque Formation by Herceptin

(99) We asked whether R-LM113 and R-LM249 used HER2 not only for virus infection, but also for cell-to cell spread. SKOV3 cells were infected with serial dilutions of the indicated viruses and overlaid with medium containing 1% Seaplaque agarose, with or without the addition of 10 μg/ml Herceptin (MAb to HER2 Genentech). Fluorescent plaques were monitored with a Zeiss fluorescence microscope, and pictures of 5 plaques per sample were taken at 48 h after infection. The areas of the plaques were measured with Photoshop Histogram tool. As shown in FIGS. 6A and 6B, exposure of R-LM113- and R-LM249-infected SKOV3 monolayers to Herceptin reduced plaque size (in FIG. 6B, −Herceptin indicates in the absence of Herceptin; +Herceptin indicates in the presence of Herceptin. Plaque size of R-LM5 and of the other non-detargeted viruses (R-LM13 and R-LM39) was not reduced by Herceptin.

Example 8—Cytotoxic Activity of the Recombinant Viruses

(100) We asked whether R-LM113 and R-LM249 maintained the cytotoxic activity of HSV-1 parental virus. SKOV3 cells were seeded in 12 well plates (4×10.sup.5 cells/well) and infected the following day with R-LM5, R-LM116 or R-LM249 at a m.o.i. of 3 pfu/cell. After three days the infected cells were trypsinized, and the number of viable and nonviable cells was determined by means of the Erythsosin B exclusion assay. Briefly, cells were mixed 1:1 with 0.04% Erythrosin B (Sigma) in PBS, loaded on a hemocytometer and counted. Nonviable cells take up the stain and appear red in color. The number of nonviable cells was reported as a fraction of the total number of cells (red plus colorless). Cells detached from the monolayer and present in the supernatant of the infected samples were collected and counted in the same way. Replicate wells of non infected cells were included as control. As shown FIG. 16, viral infection almost prevents cells from dividing, as the total number of cells is lower as compared to non infected cells. Moreover infection causes cell cytotoxicity, as the percentage of nonviable cells is higher in infected cultures with respect to non infected replicate cultures. The effect of infection of the R-LM113 and R-LM249 recombinants is comparable to that of R-LM5 virus, carrying wild type gD, indicating that the retargeting and detargeting of the virus did not affect the cytotoxic properties of the recombinants.