Methods of increasing biomass and/or growth rate of a plant under non-stress conditions
09745595 · 2017-08-29
Assignee
Inventors
- Eyal Emmanuel (Rechovot, IL)
- Zur Granevitze (Petach-Tikva, IL)
- Alex Diber (Rishon-LeZion, IL)
- Basia Judith Vinocur (Rechovot, IL)
- Sharon Ayal (Kiryat-Ekron, IL)
- Yoav Herschkovitz (Givataim, IL)
Cpc classification
C12N15/8261
CHEMISTRY; METALLURGY
C12N15/8247
CHEMISTRY; METALLURGY
Y02A40/146
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
Provided are methods of increasing yield, biomass, growth rate, vigor, and/or abiotic stress tolerance of a plant by expressing within the plant an exogenous polynucleotide comprising a nucleic acid sequence at least 80% identical to SEQ ID NO: 908 or 71; or an exogenous polynucleotide encoding a polypeptide at least 80% identical to SEQ ID NO: 176.
Claims
1. A method of increasing leaf area, relative growth rate of leaf area, relative growth rate of root length, root coverage, and/or relative growth rate of root coverage of a plant, comprising: (a) expressing within the plant an exogenous polynucleotide comprising a nucleic acid sequence encoding a polypeptide comprising an amino acid sequence as set forth by SEQ ID NO: 176, wherein said polypeptide is capable of increasing leaf area, relative growth rate of leaf area, relative growth rate of root length, root coverage, and/or relative growth rate of root coverage of a plant under non-stress conditions, and (b) selecting said plant expressing said exogenous polynucleotide for an increased leaf area, an increased relative growth rate of leaf area, an increased relative growth rate of root length, an increased root coverage, and/or an increased relative growth rate of root coverage under non-stress growth conditions as compared to a non-transformed plant which is grown under the same growth conditions, thereby increasing the leaf area, relative growth rate of leaf area, relative growth rate of root length, root coverage, and/or relative growth rate of root coverage of the plant.
2. A method of producing seeds of a crop comprising: (a) selecting a parent plant being transformed with an exogenous polynucleotide encoding a polypeptide comprising an amino acid sequence as set forth by SEQ ID NO: 176 for an increased trait selected from the group consisting of: an increased leaf area, an increased relative growth rate of leaf area, an increased relative growth rate of root length, an increased root coverage, and an increased relative growth rate of root coverage under non-stress growth conditions as compared to a non-transformed plant which is grown under the same growth conditions, (b) growing a seed producing plant from said parent plant resultant of step (a), wherein said seed producing plant which comprises said exogenous polynucleotide has said increased trait and (c) producing seeds from said seed producing plant resultant of step (b), wherein said seeds comprise said exogenous polynucleotide, thereby producing seeds of the crop.
3. The method of claim 1, wherein said exogenous polynucleotide is set forth by SEQ ID NO: 908.
4. The method of claim 1, wherein said exogenous polynucleotide is set forth by SEQ ID NO: 71.
5. The method of claim 2, wherein said exogenous polynucleotide is set forth by SEQ ID NO: 908.
6. The method of claim 2, wherein said exogenous polynucleotide is set forth by SEQ ID NO: 71.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.
(2) In the drawings:
(3)
(4)
(5)
DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
(6) The present invention, in some embodiments thereof, relates to polypeptides, polynucleotides encoding same, nucleic acid constructs comprising same, transgenic plants expressing same and methods of producing and using same for increasing plant yield, oil yield, seed yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance and/or nitrogen use efficiency.
(7) Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.
(8) While reducing the present invention to practice, the present inventors have identified novel polypeptides and polynucleotides which can be used to increase yield, growth rate, biomass, oil content, vigor, abiotic stress tolerance and/or nitrogen use efficiency of a plant.
(9) Thus, as shown in the Examples section which follows, the present inventors have utilized bioinformatics tools and microarray analyses to identify polynucleotides which enhance yield (e.g., seed yield, oil yield, oil content), growth rate, biomass, vigor, abiotic stress tolerance and/or nitrogen use efficiency of a plant. Genes which affect the trait-of-interest [Table 15; Example 5 of the Examples section which follows; SEQ ID NOs:1-105 (polynucleotides) and SEQ ID NOs:106-202 (polypeptides)] were identified based on correlation analyses between expression profiles of various genes in tissues, developmental stages, fertilizer limiting conditions, abiotic stress conditions or normal conditions across several Arabidopsis ecotypes, Sorghum Accessions and Tomato accessions and various parameters of yield, biomass, vigor, growth rate and/or oil content (Examples 1, 2, 3, 4, 10 and 11 of the Examples section which follows; Tables 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 28 and 29). Homologous polypeptides and polynucleotides having the same function (activity) were also identified [Table 16, Example 6 of the Examples section which follows; SEQ ID NOs:203-523 (polynucleotides), and SEQ ID NOs:524-844 (polypeptides)]. The identified genes were cloned in binary vectors (see for example, Tables 17, 18, 19 and 20; Example 7 of the Examples section which follows; SEQ ID NOs:47, 845-925 and 933) and transgenic plants over-expressing the identified genes of the invention were generated (see for example, Example 8 of the Examples section which follows). These plants which are transformed with the identified polynucleotides were found to exhibit increased yield, biomass, growth rate, vigor, seed yield, oil content, oil yield, flowering, harvest index and rosette area (Tables 21-27; Example 9 of the Examples section which follows). These results suggest the use of the novel polynucleotides and polypeptides of the invention for increasing yield (including oil yield, seed yield and oil content), growth rate, biomass, vigor, abiotic stress tolerance and/or nitrogen use efficiency of a plant.
(10) Thus, according to an aspect of some embodiments of the invention, there is provided method of increasing yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance and/or nitrogen use efficiency of a plant. The method is effected by expressing within the plant an exogenous polynucleotide comprising a nucleic acid sequence at least 80% identical to SEQ ID NO: 905, 882, 1-12, 15-105, 203-297, 299-523, 845-881, 883-904, 906-925, or 933, thereby increasing the yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance and/or nitrogen use efficiency of the plant.
(11) As used herein the phrase “plant yield” refers to the amount (as determined by weight or size) or quantity (numbers) of tissues or organs produced per plant or per growing season. Hence increased yield could affect the economic benefit one can obtain from the plant in a certain growing area and/or growing time.
(12) It should be noted that a plant yield can be affected by various parameters including, but not limited to, plant biomass; plant vigor; growth rate; seed yield; seed or grain quantity; seed or grain quality; oil yield; content of oil, starch and/or protein in harvested organs (e.g., seeds or vegetative parts of the plant); number of flowers (florets) per panicle (expressed as a ratio of number of filled seeds over number of primary panicles); harvest index; number of plants grown per area; number and size of harvested organs per plant and per area; number of plants per growing area (density); number of harvested organs in field; total leaf area; carbon assimilation and carbon partitioning (the distribution/allocation of carbon within the plant); resistance to shade; number of harvestable organs (e.g. seeds), seeds per pod, weight per seed; and modified architecture [such as increase stalk diameter, thickness or improvement of physical properties (e.g. elasticity)].
(13) As used herein the phrase “seed yield” refers to the number or weight of the seeds per plant, seeds per pod, or per growing area or to the weight of a single seed, or to the oil extracted per seed. Hence seed yield can be affected by seed dimensions (e.g., length, width, perimeter, area and/or volume), number of (filled) seeds and seed filling rate and by seed oil content. Hence increase seed yield per plant could affect the economic benefit one can obtain from the plant in a certain growing area and/or growing time; and increase seed yield per growing area could be achieved by increasing seed yield per plant, and/or by increasing number of plants grown on the same given area.
(14) The term “seed” (also referred to as “grain” or “kernel”) as used herein refers to a small embryonic plant enclosed in a covering called the seed coat (usually with some stored food), the product of the ripened ovule of gymnosperm and angiosperm plants which occurs after fertilization and some growth within the mother plant.
(15) The phrase “oil content” as used herein refers to the amount of lipids in a given plant organ, either the seeds (seed oil content) or the vegetative portion of the plant (vegetative oil content) and is typically expressed as percentage of dry weight (10% humidity of seeds) or wet weight (for vegetative portion).
(16) It should be noted that oil content is affected by intrinsic oil production of a tissue (e.g., seed, vegetative portion), as well as the mass or size of the oil-producing tissue per plant or per growth period.
(17) In one embodiment, increase in oil content of the plant can be achieved by increasing the size/mass of a plant's tissue(s) which comprise oil per growth period. Thus, increased oil content of a plant can be achieved by increasing the yield, growth rate, biomass and vigor of the plant.
(18) As used herein the phrase “plant biomass” refers to the amount (e.g., measured in grams of air-dry tissue) of a tissue produced from the plant in a growing season, which could also determine or affect the plant yield or the yield per growing area. An increase in plant biomass can be in the whole plant or in parts thereof such as aboveground (harvestable) parts, vegetative biomass, roots and seeds.
(19) As used herein the phrase “growth rate” refers to the increase in plant organ/tissue size per time (can be measured in cm.sup.2 per day).
(20) As used herein the phrase “plant vigor” refers to the amount (measured by weight) of tissue produced by the plant in a given time. Hence increased vigor could determine or affect the plant yield or the yield per growing time or growing area. In addition, early vigor (seed and/or seedling) results in improved field stand.
(21) It should be noted that a plant yield can be determined under stress (e.g., abiotic stress, nitrogen-limiting conditions) and/or non-stress (normal) conditions.
(22) As used herein, the phrase “non-stress conditions” refers to the growth conditions (e.g., water, temperature, light-dark cycles, humidity, salt concentration, fertilizer concentration in soil, nutrient supply such as nitrogen, phosphorous and/or potassium), that do not significantly go beyond the everyday climatic and other abiotic conditions that plants may encounter, and which allow optimal growth, metabolism, reproduction and/or viability of a plant at any stage in its life cycle (e.g., in a crop plant from seed to a mature plant and back to seed again). Persons skilled in the art are aware of normal soil conditions and climatic conditions for a given plant in a given geographic location. It should be noted that while the non-stress conditions may include some mild variations from the optimal conditions (which vary from one type/species of a plant to another), such variations do not cause the plant to cease growing without the capacity to resume growth.
(23) The phrase “abiotic stress” as used herein refers to any adverse effect on metabolism, growth, reproduction and/or viability of a plant. Accordingly, abiotic stress can be induced by suboptimal environmental growth conditions such as, for example, salinity, water deprivation, flooding, freezing, low or high temperature, heavy metal toxicity, anaerobiosis, nutrient deficiency, atmospheric pollution or UV irradiation. The implications of abiotic stress are discussed in the Background section.
(24) The phrase “abiotic stress tolerance” as used herein refers to the ability of a plant to endure an abiotic stress without suffering a substantial alteration in metabolism, growth, productivity and/or viability.
(25) As used herein the phrase “water use efficiency (WUE)” refers to the level of organic matter produced per unit of water consumed by the plant, i.e., the dry weight of a plant in relation to the plant's water use, e.g., the biomass produced per unit transpiration.
(26) As used herein the phrase “fertilizer use efficiency” refers to the metabolic process(es) which lead to an increase in the plant's yield, biomass, vigor, and growth rate per fertilizer unit applied. The metabolic process can be the uptake, spread, absorbent, accumulation, relocation (within the plant) and use of one or more of the minerals and organic moieties absorbed by the plant, such as nitrogen, phosphates and/or potassium.
(27) As used herein the phrase “fertilizer-limiting conditions” refers to growth conditions which include a level (e.g., concentration) of a fertilizer applied which is below the level needed for normal plant metabolism, growth, reproduction and/or viability.
(28) As used herein the phrase “nitrogen use efficiency (NUE)” refers to the metabolic process(es) which lead to an increase in the plant's yield, biomass, vigor, and growth rate per nitrogen unit applied. The metabolic process can be the uptake, spread, absorbent, accumulation, relocation (within the plant) and use of nitrogen absorbed by the plant.
(29) As used herein the phrase “nitrogen-limiting conditions” refers to growth conditions which include a level (e.g., concentration) of nitrogen (e.g., ammonium or nitrate) applied which is below the level needed for normal plant metabolism, growth, reproduction and/or viability.
(30) Improved plant NUE and FUE is translated in the field into either harvesting similar quantities of yield, while implementing less fertilizers, or increased yields gained by implementing the same levels of fertilizers. Thus, improved NUE or FUE has a direct effect on plant yield in the field. Thus, the polynucleotides and polypeptides of some embodiments of the invention positively affect plant yield, seed yield, and plant biomass. In addition, the benefit of improved plant NUE will certainly improve crop quality and biochemical constituents of the seed such as protein yield and oil yield.
(31) As used herein the term “increasing” refers to at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, increase in yield, growth rate, biomass, vigor, oil content, abiotic stress tolerance and/or nitrogen use efficiency of a plant as compared to a native plant [i.e., a plant not modified with the biomolecules (polynucleotide or polypeptides) of the invention, e.g., a non-transformed plant of the same species which is grown under the same growth conditions].
(32) The phrase “expressing within the plant an exogenous polynucleotide” as used herein refers to upregulating the expression level of an exogenous polynucleotide within the plant by introducing the exogenous polynucleotide into a plant cell or plant and expressing by recombinant means, as further described herein below.
(33) As used herein “expressing” refers to expression at the mRNA and optionally polypeptide level.
(34) As used herein, the phrase “exogenous polynucleotide” refers to a heterologous nucleic acid sequence which may not be naturally expressed within the plant or which overexpression in the plant is desired. The exogenous polynucleotide may be introduced into the plant in a stable or transient manner, so as to produce a ribonucleic acid (RNA) molecule and/or a polypeptide molecule. It should be noted that the exogenous polynucleotide may comprise a nucleic acid sequence which is identical or partially homologous to an endogenous nucleic acid sequence of the plant.
(35) The term “endogenous” as used herein refers to any polynucleotide or polypeptide which is present and/or naturally expressed within a plant or a cell thereof.
(36) According to some embodiments of the invention the exogenous polynucleotide comprises a nucleic acid sequence which is at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, e.g., 100% identical to the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 905, 882, 1-12, 15-105, 203-297, 299-523, 845-881, 883-904, 906-925 and 933.
(37) Identity (e.g., percent homology) can be determined using any homology comparison software, including for example, the BlastN software of the National Center of Biotechnology Information (NCBI) such as by using default parameters.
(38) According to some embodiments of the invention the exogenous polynucleotide is at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, e.g., 100% identical to the polynucleotide selected from the group consisting of SEQ ID NOs: 905, 882, 1-12, 15-105, 203-297, 299-523, 845-881, 883-904, 906-925 and 933.
(39) According to some embodiments of the invention the exogenous polynucleotide is set forth by SEQ ID NO: 905, 882, 1-12, 15-105, 203-297, 299-523, 845-881, 883-904, 906-925 or 933.
(40) According to an aspect of some embodiments of the invention, there is provided a method of increasing yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance and/or nitrogen use efficiency of a plant. The method is effected by expressing within the plant an exogenous polynucleotide comprising the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 905, 882, 1-13, 15-105, 203-523, 845-881, 883-904, 906-925 and 933, thereby increasing the yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance and/or nitrogen use efficiency of the plant.
(41) According to some embodiments of the invention the exogenous polynucleotide is selected from the group consisting of SEQ ID NOs: 905, 882, 1-13, 15-105, 203-523, 845-881, 883-904, 906-925 and 933.
(42) As used herein the term “polynucleotide” refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and/or a composite polynucleotide sequences (e.g., a combination of the above).
(43) The term “isolated” refers to at least partially separated from the natural environment e.g., from a plant cell.
(44) As used herein the phrase “complementary polynucleotide sequence” refers to a sequence, which results from reverse transcription of messenger RNA using a reverse transcriptase or any other RNA dependent DNA polymerase. Such a sequence can be subsequently amplified in vivo or in vitro using a DNA dependent DNA polymerase.
(45) As used herein the phrase “genomic polynucleotide sequence” refers to a sequence derived (isolated) from a chromosome and thus it represents a contiguous portion of a chromosome.
(46) As used herein the phrase “composite polynucleotide sequence” refers to a sequence, which is at least partially complementary and at least partially genomic. A composite sequence can include some exonal sequences required to encode the polypeptide of the present invention, as well as some intronic sequences interposing therebetween. The intronic sequences can be of any source, including of other genes, and typically will include conserved splicing signal sequences. Such intronic sequences may further include cis acting expression regulatory elements.
(47) According to some embodiments of the invention, the exogenous polynucleotide of the invention encodes a polypeptide having an amino acid sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more say 100% homologous to the amino acid sequence selected from the group consisting of SEQ ID NOs: 172, 146, 106-117, 120-145, 147-171, 173-202, 524-616, 621-844, 926-931 and 932.
(48) Homology (e.g., percent homology) can be determined using any homology comparison software, including for example, the BlastP or TBLASTN software of the National Center of Biotechnology Information (NCBI) such as by using default parameters, when starting from a polypeptide sequence; or the tBLASTX algorithm (available via the NCBI) such as by using default parameters, which compares the six-frame conceptual translation products of a nucleotide query sequence (both strands) against a protein sequence database.
(49) Homologous sequences include both orthologous and paralogous sequences. The term “paralogous” relates to gene-duplications within the genome of a species leading to paralogous genes. The term “orthologous” relates to homologous genes in different organisms due to ancestral relationship.
(50) One option to identify orthologues in monocot plant species is by performing a reciprocal blast search. This may be done by a first blast involving blasting the sequence-of-interest against any sequence database, such as the publicly available NCBI database which may be found at: Hypertext Transfer Protocol://World Wide Web(dot) ncbi(dot)nlm(dot)nih(dot)gov. If orthologues in rice were sought, the sequence-of-interest would be blasted against, for example, the 28,469 full-length cDNA clones from Oryza sativa Nipponbare available at NCBI. The blast results may be filtered. The full-length sequences of either the filtered results or the non-filtered results are then blasted back (second blast) against the sequences of the organism from which the sequence-of-interest is derived. The results of the first and second blasts are then compared. An orthologue is identified when the sequence resulting in the highest score (best hit) in the first blast identifies in the second blast the query sequence (the original sequence-of-interest) as the best hit. Using the same rational a paralogue (homolog to a gene in the same organism) is found. In case of large sequence families, the ClustalW program may be used [Hypertext Transfer Protocol://World Wide Web(dot)ebi(dot)ac(dot)uk/Tools/clustalw2/index(dot)html], followed by a neighbor-joining tree (Hypertext Transfer Protocol://en(dot)wikipedia(dot)org/wiki/Neighbor-joining) which helps visualizing the clustering.
(51) According to some embodiments of the invention, the exogenous polynucleotide encodes a polypeptide consisting of the amino acid sequence set forth by SEQ ID NO: 172, 146, 106-117, 120-145, 147-171, 173-202, 524-616, 621-844, 926-931 or 932.
(52) According to an aspect of some embodiments of the invention, the method of increasing yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance and/or nitrogen use efficiency of a plant is effected by expressing within the plant an exogenous polynucleotide comprising the nucleic acid sequence encoding a polypeptide selected from the group consisting of SEQ ID NOs: 172, 146, 106-117, 120-145, 147-171, 173-202, 524-844 and 926-932, thereby increasing the yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance and/or nitrogen use efficiency of the plant.
(53) Nucleic acid sequences encoding the polypeptides of the present invention may be optimized for expression. Examples of such sequence modifications include, but are not limited to, an altered G/C content to more closely approach that typically found in the plant species of interest, and the removal of codons atypically found in the plant species commonly referred to as codon optimization.
(54) The phrase “codon optimization” refers to the selection of appropriate DNA nucleotides for use within a structural gene or fragment thereof that approaches codon usage within the plant of interest. Therefore, an optimized gene or nucleic acid sequence refers to a gene in which the nucleotide sequence of a native or naturally occurring gene has been modified in order to utilize statistically-preferred or statistically-favored codons within the plant. The nucleotide sequence typically is examined at the DNA level and the coding region optimized for expression in the plant species determined using any suitable procedure, for example as described in Sardana et al. (1996, Plant Cell Reports 15:677-681). In this method, the standard deviation of codon usage, a measure of codon usage bias, may be calculated by first finding the squared proportional deviation of usage of each codon of the native gene relative to that of highly expressed plant genes, followed by a calculation of the average squared deviation. The formula used is: 1 SDCU=n=1N[(Xn−Yn)/Yn]2/N, where Xn refers to the frequency of usage of codon n in highly expressed plant genes, where Yn to the frequency of usage of codon n in the gene of interest and N refers to the total number of codons in the gene of interest. A Table of codon usage from highly expressed genes of dicotyledonous plants is compiled using the data of Murray et al. (1989, Nuc Acids Res. 17:477-498).
(55) One method of optimizing the nucleic acid sequence in accordance with the preferred codon usage for a particular plant cell type is based on the direct use, without performing any extra statistical calculations, of codon optimization Tables such as those provided on-line at the Codon Usage Database through the NIAS (National Institute of Agrobiological Sciences) DNA bank in Japan (Hypertext Transfer Protocol://World Wide Web(dot)kazusa(dot)or(dot)jp/codon/). The Codon Usage Database contains codon usage tables for a number of different species, with each codon usage Table having been statistically determined based on the data present in Genbank.
(56) By using the above Tables to determine the most preferred or most favored codons for each amino acid in a particular species (for example, rice), a naturally-occurring nucleotide sequence encoding a protein of interest can be codon optimized for that particular plant species. This is effected by replacing codons that may have a low statistical incidence in the particular species genome with corresponding codons, in regard to an amino acid, that are statistically more favored. However, one or more less-favored codons may be selected to delete existing restriction sites, to create new ones at potentially useful junctions (5′ and 3′ ends to add signal peptide or termination cassettes, internal sites that might be used to cut and splice segments together to produce a correct full-length sequence), or to eliminate nucleotide sequences that may negatively effect mRNA stability or expression.
(57) The naturally-occurring encoding nucleotide sequence may already, in advance of any modification, contain a number of codons that correspond to a statistically-favored codon in a particular plant species. Therefore, codon optimization of the native nucleotide sequence may comprise determining which codons, within the native nucleotide sequence, are not statistically-favored with regards to a particular plant, and modifying these codons in accordance with a codon usage table of the particular plant to produce a codon optimized derivative. A modified nucleotide sequence may be fully or partially optimized for plant codon usage provided that the protein encoded by the modified nucleotide sequence is produced at a level higher than the protein encoded by the corresponding naturally occurring or native gene. Construction of synthetic genes by altering the codon usage is described in for example PCT Patent Application 93/07278.
(58) According to some embodiments of the invention, the exogenous polynucleotide is a non-coding RNA.
(59) As used herein the phrase ‘non-coding RNA” refers to an RNA molecule which does not encode an amino acid sequence (a polypeptide). Examples of such non-coding RNA molecules include, but are not limited to, an antisense RNA, a pre-miRNA (precursor of a microRNA), or a precursor of a Piwi-interacting RNA (piRNA).
(60) A non-limiting example of a non-coding RNA polynucleotide is provided in SEQ ID NO:72 (BDL90).
(61) Thus, the invention encompasses nucleic acid sequences described hereinabove; fragments thereof, sequences hybridizable therewith, sequences homologous thereto, sequences encoding similar polypeptides with different codon usage, altered sequences characterized by mutations, such as deletion, insertion or substitution of one or more nucleotides, either naturally occurring or man induced, either randomly or in a targeted fashion.
(62) The invention provides an isolated polynucleotide comprising a nucleic acid sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, e.g., 100% identical to the polynucleotide selected from the group consisting of SEQ ID NOs: 905, 882, 1-12, 15-105, 203-297, 299-523, 845-881, 883-904, 906-925 and 933.
(63) According to some embodiments of the invention the nucleic acid sequence is capable of increasing yield, growth rate, vigor, biomass, oil content, abiotic stress tolerance and/or nitrogen use efficiency of a plant.
(64) According to some embodiments of the invention the isolated polynucleotide comprising the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 905, 882, 1-13, 15-105, 203-523, 845-881, 883-904, 906-925 and 933.
(65) According to some embodiments of the invention the isolated polynucleotide is set forth by SEQ ID NO: 905, 882, 1-13, 15-105, 203-523, 845-881, 883-904, 906-925 or 933.
(66) The invention provides an isolated polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises an amino acid sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more say 100% homologous to the amino acid sequence selected from the group consisting of SEQ ID NOs: 172, 146, 106-117, 120-145, 147-171, 173-202, 524-616, 621-844, 926-931 and 932.
(67) According to some embodiments of the invention the amino acid sequence is capable of increasing yield, growth rate, vigor, biomass, oil content, abiotic stress tolerance and/or nitrogen use efficiency of a plant.
(68) The invention provides an isolated polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises the amino acid sequence selected from the group consisting of SEQ ID NOs: 172, 146, 106-117, 120-145, 147-171, 173-202, 524-844 and 926-932.
(69) The invention provides an isolated polynucleotide comprising a nucleic acid sequence encoding a polypeptide selected from the group consisting of SEQ ID NOs: 172, 146, 106-117, 120-145, 147-171, 173-202, 524-844 and 926-932.
(70) The invention provides an isolated polypeptide comprising an amino acid sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more say 100% homologous to an amino acid sequence selected from the group consisting of SEQ ID NOs: 172, 146, 106-117, 120-145, 147-171, 173-202, 524-616, 621-844, 926-931 and 932.
(71) According to some embodiments of the invention, the polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 172, 146, 106-117, 120-145, 147-171, 173-202, 524-844 and 926-932.
(72) According to some embodiments of the invention, the polypeptide is set forth by SEQ ID NO: 172, 146, 106-117, 120-145, 147-171, 173-202, 524-844, 926-931 or 932.
(73) The invention also encompasses fragments of the above described polypeptides and polypeptides having mutations, such as deletions, insertions or substitutions of one or more amino acids, either naturally occurring or man induced, either randomly or in a targeted fashion.
(74) The term “plant” as used herein encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, shoots, stems, roots (including tubers), and plant cells, tissues and organs. The plant may be in any form including suspension cultures, embryos, meristematic regions, callus tissue, leaves, gametophytes, sporophytes, pollen, and microspores. Plants that are particularly useful in the methods of the invention include all plants which belong to the superfamily Viridiplantae, in particular monocotyledonous and dicotyledonous plants including a fodder or forage legume, ornamental plant, food crop, tree, or shrub selected from the list comprising Acacia spp., Acer spp., Actinidia spp., Aesculus spp., Agathis australis, Albizia amara, Alsophila tricolor, Andropogon spp., Arachis spp, Areca catechu, Astelia fragrans, Astragalus cicer, Baikiaea plurijuga, Betula spp., Brassica spp., Bruguiera gymnorrhiza, Burkea africana, Butea frondosa, Cadaba farinosa, Calliandra spp, Camellia sinensis, Canna indica, Capsicum spp., Cassia spp., Centroema pubescens, Chacoomeles spp., Cinnamomum cassia, Coffea arabica, Colophospermum mopane, Coronillia varia, Cotoneaster serotina, Crataegus spp., Cucumis spp., Cupressus spp., Cyathea dealbata, Cyclonia oblonga, Cryptomeria japonica, Cymbopogon spp., Cynthea dealbata, Cyclonia oblonga, Dalbergia monetaria, Davallia divaricata, Desmodium spp., Dicksonia squarosa, Dibeteropogon amplectens, Dioclea spp, Dolichos spp., Dorycnium rectum, Echinochloa pyramidalis, Ehraffia spp., Eleusine coracana, Eragrestis spp., Erythrina spp., Eucalypfus spp., Euclea schimperi, Eulalia vi/losa, Pagopyrum spp., Feijoa sellowlana, Fragaria spp., Flemingia spp, Freycinetia banksli, Geranium thunbergii, GinAgo biloba, Glycine javanica, Gliricidia spp, Gossypium hirsutum, Grevillea spp., Guibourtia coleosperma, Hedysarum spp., Hemaffhia altissima, Heteropogon contoffus, Hordeum vulgare, Hyparrhenia rufa, Hypericum erectum, Hypeffhelia dissolute, Indigo incamata, Iris spp., Leptarrhena pyrolifolia, Lespediza spp., Lettuca spp., Leucaena leucocephala, Loudetia simplex, Lotonus bainesli, Lotus spp., Macrotyloma axillare, Malus spp., Manihot esculenta, Medicago saliva, Metasequoia glyptostroboides, Musa sapientum, Nicotianum spp., Onobrychis spp., Ornithopus spp., Oryza spp., Peltophorum africanum, Pennisetum spp., Persea gratissima, Petunia spp., Phaseolus spp., Phoenix canariensis, Phormium cookianum, Photinia spp., Picea glauca, Pinus spp., Pisum sativam, Podocarpus totara, Pogonarthria fleckii, Pogonaffhria squarrosa, Populus spp., Prosopis cineraria, Pseudotsuga menziesii, Pterolobium stellatum, Pyrus communis, Quercus spp., Rhaphiolepsis umbellata, Rhopalostylis sapida, Rhus natalensis, Ribes grossularia, Ribes spp., Robinia pseudoacacia, Rosa spp., Rubus spp., Salix spp., Schyzachyrium sanguineum, Sciadopitys vefficillata, Sequoia sempervirens, Sequoiadendron giganteum, Sorghum bicolor, Spinacia spp., Sporobolus fimbriatus, Stiburus alopecuroides, Stylosanthos humilis, Tadehagi spp, Taxodium distichum, Themeda triandra, Trifolium spp., Triticum spp., Tsuga heterophylla, Vaccinium spp., Vicia spp., Vitis vinifera, Watsonia pyramidata, Zantedeschia aethiopica, Zea mays, amaranth, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, canola, carrot, cauliflower, celery, collard greens, flax, kale, lentil, oilseed rape, okra, onion, potato, rice, soybean, straw, sugar beet, sugar cane, sunflower, tomato, squash tea, maize, wheat, barely, rye, oat, peanut, pea, lentil and alfalfa, cotton, rapeseed, canola, pepper, sunflower, tobacco, eggplant, eucalyptus, a tree, an ornamental plant, a perennial grass and a forage crop. Alternatively algae and other non-Viridiplantae can be used for the methods of the present invention.
(75) According to some embodiments of the invention, the plant used by the method of the invention is a crop plant such as rice, maize, wheat, barley, peanut, potato, sesame, olive tree, palm oil, banana, soybean, sunflower, canola, sugarcane, alfalfa, millet, leguminosae (bean, pea), flax, lupinus, rapeseed, tobacco, poplar and cotton.
(76) According to some embodiments of the invention, there is provided a plant cell exogenously expressing the polynucleotide of some embodiments of the invention, the nucleic acid construct of some embodiments of the invention and/or the polypeptide of some embodiments of the invention.
(77) According to some embodiments of the invention, expressing the exogenous polynucleotide of the invention within the plant is effected by transforming one or more cells of the plant with the exogenous polynucleotide, followed by generating a mature plant from the transformed cells and cultivating the mature plant under conditions suitable for expressing the exogenous polynucleotide within the mature plant.
(78) According to some embodiments of the invention, the transformation is effected by introducing to the plant cell a nucleic acid construct which includes the exogenous polynucleotide of some embodiments of the invention and at least one promoter for directing transcription of the exogenous polynucleotide in a host cell (a plant cell). Further details of suitable transformation approaches are provided hereinbelow.
(79) According to some embodiments of the invention, there is provided a nucleic acid construct comprising the isolated polynucleotide of the invention, and a promoter for directing transcription of the nucleic acid sequence of the isolated polynucleotide in a host cell.
(80) According to some embodiments of the invention, the isolated polynucleotide is operably linked to the promoter sequence.
(81) A coding nucleic acid sequence is “operably linked” to a regulatory sequence (e.g., promoter) if the regulatory sequence is capable of exerting a regulatory effect on the coding sequence linked thereto.
(82) As used herein, the term “promoter” refers to a region of DNA which lies upstream of the transcriptional initiation site of a gene to which RNA polymerase binds to initiate transcription of RNA. The promoter controls where (e.g., which portion of a plant) and/or when (e.g., at which stage or condition in the lifetime of an organism) the gene is expressed.
(83) Any suitable promoter sequence can be used by the nucleic acid construct of the present invention. Preferably the promoter is a constitutive promoter, a tissue-specific, or an abiotic stress-inducible promoter.
(84) Suitable constitutive promoters include, for example, CaMV 35S promoter (SEQ ID NO:1184; Odell et al., Nature 313:810-812, 1985); Arabidopsis At6669 promoter (SEQ ID NO:1183; see PCT Publication No. WO04081173A2); maize Ubi 1 (Christensen et al., Plant Sol. Biol. 18:675-689, 1992); rice actin (McElroy et al., Plant Cell 2:163-171, 1990); pEMU (Last et al., Theor. Appl. Genet. 81:581-588, 1991); CaMV 19S (Nilsson et al., Physiol. Plant 100:456-462, 1997); GOS2 (de Pater et al, Plant J November; 2(6):837-44, 1992); ubiquitin (Christensen et al, Plant Mol. Biol. 18: 675-689, 1992); Rice cyclophilin (Bucholz et al, Plant Mol. Biol. 25(5):837-43, 1994); Maize H3 histone (Lepetit et al, Mol. Gen. Genet. 231: 276-285, 1992); Actin 2 (An et al, Plant J. 10(1); 107-121, 1996) and Synthetic Super MAS (Ni et al., The Plant Journal 7: 661-76, 1995). Other constitutive promoters include those in U.S. Pat. Nos. 5,659,026, 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; and 5,608,142.
(85) Suitable tissue-specific promoters include, but not limited to, leaf-specific promoters [such as described, for example, by Yamamoto et al., Plant J. 12:255-265, 1997; Kwon et al., Plant Physiol. 105:357-67, 1994; Yamamoto et al., Plant Cell Physiol. 35:773-778, 1994; Gotor et al., Plant J. 3:509-18, 1993; Orozco et al., Plant Mol. Biol. 23:1129-1138, 1993; and Matsuoka et al., Proc. Natl. Acad. Sci. USA 90:9586-9590, 1993], seed-preferred promoters [e.g., from seed specific genes (Simon, et al., Plant Mol. Biol. 5. 191, 1985; Scofield, et al., J. Biol. Chem. 262: 12202, 1987; Baszczynski, et al., Plant Mol. Biol. 14: 633, 1990), Brazil Nut albumin (Pearson' et al., Plant Mol. Biol. 18: 235-245, 1992), legumin (Ellis, et al. Plant Mol. Biol. 10: 203-214, 1988), Glutelin (rice) (Takaiwa, et al., Mol. Gen. Genet. 208: 15-22, 1986; Takaiwa, et al., FEBS Letts. 221: 43-47, 1987), Zein (Matzke et al Plant Mol Biol, 143). 323-32 1990), napA (Stalberg, et al, Planta 199: 515-519, 1996), Wheat SPA (Albani et al, Plant Cell, 9: 171-184, 1997), sunflower oleosin (Cummins, et al., Plant Mol. Biol. 19: 873-876, 1992)], endosperm specific promoters [e.g., wheat LMW and HMW, glutenin-1 (Mol Gen Genet. 216:81-90, 1989; NAR 17:461-2), wheat a, b and g gliadins (EMBO3:1409-15, 1984), Barley ltr1 promoter, barley B1, C, D hordein (Theor Appl Gen 98:1253-62, 1999; Plant J 4:343-55, 1993; Mol Gen Genet. 250:750-60, 1996), Barley DOF (Mena et al, The Plant Journal, 116(1): 53-62, 1998), Biz2 (EP99106056.7), Synthetic promoter (Vicente-Carbajosa et al., Plant J. 13: 629-640, 1998), rice prolamin NRP33, rice-globulin Glb-1 (Wu et al, Plant Cell Physiology 39(8) 885-889, 1998), rice alpha-globulin REB/OHP-1 (Nakase et al. Plant Mol. Biol. 33: 513-S22, 1997), rice ADP-glucose PP (Trans Res 6:157-68, 1997), maize ESR gene family (Plant J 12:235-46, 1997), sorghum gamma—kafirin (PMB 32:1029-35, 1996)], embryo specific promoters [e.g., rice OSH1 (Sato et al, Proc. Natl. Acad. Sci. USA, 93: 8117-8122), KNOX (Postma-Haarsma of al, Plant Mol. Biol. 39:257-71, 1999), rice oleosin (Wu et at, J. Biochem., 123:386, 1998)], and flower-specific promoters [e.g., AtPRP4, chalene synthase (chsA) (Van der Meer, et al., Plant Mol. Biol. 15, 95-109, 1990), LAT52 (Twell et al Mol. Gen. Genet. 217:240-245; 1989), apetala-3].
(86) Suitable abiotic stress-inducible promoters include, but not limited to, salt-inducible promoters such as RD29A (Yamaguchi-Shinozalei et al., Mol. Gen. Genet. 236:331-340, 1993); drought-inducible promoters such as maize rab17 gene promoter (Pla et. al., Plant Mol. Biol. 21:259-266, 1993), maize rab28 gene promoter (Busk et. al., Plant J. 11:1285-1295, 1997) and maize Ivr2 gene promoter (Pelleschi et. al., Plant Mol. Biol. 39:373-380, 1999); heat-inducible promoters such as heat tomato hsp80-promoter from tomato (U.S. Pat. No. 5,187,267).
(87) The nucleic acid construct of some embodiments of the invention can further include an appropriate selectable marker and/or an origin of replication. According to some embodiments of the invention, the nucleic acid construct utilized is a shuttle vector, which can propagate both in E. coli (wherein the construct comprises an appropriate selectable marker and origin of replication) and be compatible with propagation in cells. The construct according to the present invention can be, for example, a plasmid, a bacmid, a phagemid, a cosmid, a phage, a virus or an artificial chromosome.
(88) The nucleic acid construct of some embodiments of the invention can be utilized to stably or transiently transform plant cells. In stable transformation, the exogenous polynucleotide is integrated into the plant genome and as such it represents a stable and inherited trait. In transient transformation, the exogenous polynucleotide is expressed by the cell transformed but it is not integrated into the genome and as such it represents a transient trait.
(89) There are various methods of introducing foreign genes into both monocotyledonous and dicotyledonous plants (Potrykus, I., Annu. Rev. Plant. Physiol., Plant. Mol. Biol. (1991) 42:205-225; Shimamoto et al., Nature (1989) 338:274-276).
(90) The principle methods of causing stable integration of exogenous DNA into plant genomic DNA include two main approaches:
(91) (i) Agrobacterium-mediated gene transfer: Klee et al. (1987) Annu. Rev. Plant Physiol. 38:467-486; Klee and Rogers in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, eds. Schell, J., and Vasil, L. K., Academic Publishers, San Diego, Calif. (1989) p. 2-25; Gatenby, in Plant Biotechnology, eds. Kung, S, and Arntzen, C. J., Butterworth Publishers, Boston, Mass. (1989) p. 93-112.
(92) (ii) Direct DNA uptake: Paszkowski et al., in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes eds. Schell, J., and Vasil, L. K., Academic Publishers, San Diego, Calif. (1989) p. 52-68; including methods for direct uptake of DNA into protoplasts, Toriyama, K. et al. (1988) Bio/Technology 6:1072-1074. DNA uptake induced by brief electric shock of plant cells: Zhang et al. Plant Cell Rep. (1988) 7:379-384. Fromm et al. Nature (1986) 319:791-793. DNA injection into plant cells or tissues by particle bombardment, Klein et al. Bio/Technology (1988) 6:559-563; McCabe et al. Bio/Technology (1988) 6:923-926; Sanford, Physiol. Plant. (1990) 79:206-209; by the use of micropipette systems: Neuhaus et al., Theor. Appl. Genet. (1987) 75:30-36; Neuhaus and Spangenberg, Physiol. Plant. (1990) 79:213-217; glass fibers or silicon carbide whisker transformation of cell cultures, embryos or callus tissue, U.S. Pat. No. 5,464,765 or by the direct incubation of DNA with germinating pollen, DeWet et al. in Experimental Manipulation of Ovule Tissue, eds. Chapman, G. P. and Mantell, S. H. and Daniels, W. Longman, London, (1985) p. 197-209; and Ohta, Proc. Natl. Acad. Sci. USA (1986) 83:715-719.
(93) The Agrobacterium system includes the use of plasmid vectors that contain defined DNA segments that integrate into the plant genomic DNA. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobacterium delivery system. A widely used approach is the leaf disc procedure which can be performed with any tissue explant that provides a good source for initiation of whole plant differentiation. See, e.g., Horsch et al. in Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht (1988) p. 1-9. A supplementary approach employs the Agrobacterium delivery system in combination with vacuum infiltration. The Agrobacterium system is especially viable in the creation of transgenic dicotyledonous plants.
(94) There are various methods of direct DNA transfer into plant cells. In electroporation, the protoplasts are briefly exposed to a strong electric field. In microinjection, the DNA is mechanically injected directly into the cells using very small micropipettes. In microparticle bombardment, the DNA is adsorbed on microprojectiles such as magnesium sulfate crystals or tungsten particles, and the microprojectiles are physically accelerated into cells or plant tissues.
(95) Following stable transformation plant propagation is exercised. The most common method of plant propagation is by seed. Regeneration by seed propagation, however, has the deficiency that due to heterozygosity there is a lack of uniformity in the crop, since seeds are produced by plants according to the genetic variances governed by Mendelian rules. Basically, each seed is genetically different and each will grow with its own specific traits. Therefore, it is preferred that the transformed plant be produced such that the regenerated plant has the identical traits and characteristics of the parent transgenic plant. Therefore, it is preferred that the transformed plant be regenerated by micropropagation which provides a rapid, consistent reproduction of the transformed plants.
(96) Micropropagation is a process of growing new generation plants from a single piece of tissue that has been excised from a selected parent plant or cultivar. This process permits the mass reproduction of plants having the preferred tissue expressing the fusion protein. The new generation plants which are produced are genetically identical to, and have all of the characteristics of, the original plant. Micropropagation allows mass production of quality plant material in a short period of time and offers a rapid multiplication of selected cultivars in the preservation of the characteristics of the original transgenic or transformed plant. The advantages of cloning plants are the speed of plant multiplication and the quality and uniformity of plants produced.
(97) Micropropagation is a multi-stage procedure that requires alteration of culture medium or growth conditions between stages. Thus, the micropropagation process involves four basic stages: Stage one, initial tissue culturing; stage two, tissue culture multiplication; stage three, differentiation and plant formation; and stage four, greenhouse culturing and hardening. During stage one, initial tissue culturing, the tissue culture is established and certified contaminant-free. During stage two, the initial tissue culture is multiplied until a sufficient number of tissue samples are produced to meet production goals. During stage three, the tissue samples grown in stage two are divided and grown into individual plantlets. At stage four, the transformed plantlets are transferred to a greenhouse for hardening where the plants' tolerance to light is gradually increased so that it can be grown in the natural environment.
(98) According to some embodiments of the invention, the transgenic plants are generated by transient transformation of leaf cells, meristematic cells or the whole plant.
(99) Transient transformation can be effected by any of the direct DNA transfer methods described above or by viral infection using modified plant viruses.
(100) Viruses that have been shown to be useful for the transformation of plant hosts include CaMV, Tobacco mosaic virus (TMV), brome mosaic virus (BMV) and Bean Common Mosaic Virus (BV or BCMV). Transformation of plants using plant viruses is described in U.S. Pat. No. 4,855,237 (bean golden mosaic virus; BGV), EP-A 67,553 (TMV), Japanese Published Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV); and Gluzman, Y. et al., Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189 (1988). Pseudovirus particles for use in expressing foreign DNA in many hosts, including plants are described in WO 87/06261.
(101) According to some embodiments of the invention, the virus used for transient transformations is avirulent and thus is incapable of causing severe symptoms such as reduced growth rate, mosaic, ring spots, leaf roll, yellowing, streaking, pox formation, tumor formation and pitting. A suitable avirulent virus may be a naturally occurring avirulent virus or an artificially attenuated virus. Virus attenuation may be effected by using methods well known in the art including, but not limited to, sub-lethal heating, chemical treatment or by directed mutagenesis techniques such as described, for example, by Kurihara and Watanabe (Molecular Plant Pathology 4:259-269, 2003), Gal-on et al. (1992), Atreya et al. (1992) and Huet et al. (1994).
(102) Suitable virus strains can be obtained from available sources such as, for example, the American Type culture Collection (ATCC) or by isolation from infected plants. Isolation of viruses from infected plant tissues can be effected by techniques well known in the art such as described, for example by Foster and Tatlor, Eds. “Plant Virology Protocols: From Virus Isolation to Transgenic Resistance (Methods in Molecular Biology (Humana Pr), Vol 81)”, Humana Press, 1998. Briefly, tissues of an infected plant believed to contain a high concentration of a suitable virus, preferably young leaves and flower petals, are ground in a buffer solution (e.g., phosphate buffer solution) to produce a virus infected sap which can be used in subsequent inoculations.
(103) Construction of plant RNA viruses for the introduction and expression of non-viral exogenous polynucleotide sequences in plants is demonstrated by the above references as well as by Dawson, W. O. et al., Virology (1989) 172:285-292; Takamatsu et al. EMBO J. (1987) 6:307-311; French et al. Science (1986) 231:1294-1297; Takamatsu et al. FEBS Letters (1990) 269:73-76; and U.S. Pat. No. 5,316,931.
(104) When the virus is a DNA virus, suitable modifications can be made to the virus itself. Alternatively, the virus can first be cloned into a bacterial plasmid for ease of constructing the desired viral vector with the foreign DNA. The virus can then be excised from the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA, which is then replicated by the bacteria. Transcription and translation of this DNA will produce the coat protein which will encapsidate the viral DNA. If the virus is an RNA virus, the virus is generally cloned as a cDNA and inserted into a plasmid. The plasmid is then used to make all of the constructions. The RNA virus is then produced by transcribing the viral sequence of the plasmid and translation of the viral genes to produce the coat protein(s) which encapsidate the viral RNA.
(105) In one embodiment, a plant viral polynucleotide is provided in which the native coat protein coding sequence has been deleted from a viral polynucleotide, a non-native plant viral coat protein coding sequence and a non-native promoter, preferably the subgenomic promoter of the non-native coat protein coding sequence, capable of expression in the plant host, packaging of the recombinant plant viral polynucleotide, and ensuring a systemic infection of the host by the recombinant plant viral polynucleotide, has been inserted. Alternatively, the coat protein gene may be inactivated by insertion of the non-native polynucleotide sequence within it, such that a protein is produced. The recombinant plant viral polynucleotide may contain one or more additional non-native subgenomic promoters. Each non-native subgenomic promoter is capable of transcribing or expressing adjacent genes or polynucleotide sequences in the plant host and incapable of recombination with each other and with native subgenomic promoters. Non-native (foreign) polynucleotide sequences may be inserted adjacent the native plant viral subgenomic promoter or the native and a non-native plant viral subgenomic promoters if more than one polynucleotide sequence is included. The non-native polynucleotide sequences are transcribed or expressed in the host plant under control of the subgenomic promoter to produce the desired products.
(106) In a second embodiment, a recombinant plant viral polynucleotide is provided as in the first embodiment except that the native coat protein coding sequence is placed adjacent one of the non-native coat protein subgenomic promoters instead of a non-native coat protein coding sequence.
(107) In a third embodiment, a recombinant plant viral polynucleotide is provided in which the native coat protein gene is adjacent its subgenomic promoter and one or more non-native subgenomic promoters have been inserted into the viral polynucleotide. The inserted non-native subgenomic promoters are capable of transcribing or expressing adjacent genes in a plant host and are incapable of recombination with each other and with native subgenomic promoters. Non-native polynucleotide sequences may be inserted adjacent the non-native subgenomic plant viral promoters such that the sequences are transcribed or expressed in the host plant under control of the subgenomic promoters to produce the desired product.
(108) In a fourth embodiment, a recombinant plant viral polynucleotide is provided as in the third embodiment except that the native coat protein coding sequence is replaced by a non-native coat protein coding sequence.
(109) The viral vectors are encapsidated by the coat proteins encoded by the recombinant plant viral polynucleotide to produce a recombinant plant virus. The recombinant plant viral polynucleotide or recombinant plant virus is used to infect appropriate host plants. The recombinant plant viral polynucleotide is capable of replication in the host, systemic spread in the host, and transcription or expression of foreign gene(s) (exogenous polynucleotide) in the host to produce the desired protein.
(110) Techniques for inoculation of viruses to plants may be found in Foster and Taylor, eds. “Plant Virology Protocols: From Virus Isolation to Transgenic Resistance (Methods in Molecular Biology (Humana Pr), Vol 81)”, Humana Press, 1998; Maramorosh and Koprowski, eds. “Methods in Virology” 7 vols, Academic Press, New York 1967-1984; Hill, S. A. “Methods in Plant Virology”, Blackwell, Oxford, 1984; Walkey, D. G. A. “Applied Plant Virology”, Wiley, New York, 1985; and Kado and Agrawa, eds. “Principles and Techniques in Plant Virology”, Van Nostrand-Reinhold, New York.
(111) In addition to the above, the polynucleotide of the present invention can also be introduced into a chloroplast genome thereby enabling chloroplast expression.
(112) A technique for introducing exogenous polynucleotide sequences to the genome of the chloroplasts is known. This technique involves the following procedures. First, plant cells are chemically treated so as to reduce the number of chloroplasts per cell to about one. Then, the exogenous polynucleotide is introduced via particle bombardment into the cells with the aim of introducing at least one exogenous polynucleotide molecule into the chloroplasts. The exogenous polynucleotides selected such that it is integratable into the chloroplast's genome via homologous recombination which is readily effected by enzymes inherent to the chloroplast. To this end, the exogenous polynucleotide includes, in addition to a gene of interest, at least one polynucleotide stretch which is derived from the chloroplast's genome. In addition, the exogenous polynucleotide includes a selectable marker, which serves by sequential selection procedures to ascertain that all or substantially all of the copies of the chloroplast genomes following such selection will include the exogenous polynucleotide. Further details relating to this technique are found in U.S. Pat. Nos. 4,945,050; and 5,693,507 which are incorporated herein by reference. A polypeptide can thus be produced by the protein expression system of the chloroplast and become integrated into the chloroplast's inner membrane.
(113) Since processes which increase yield, growth rate, biomass, vigor, oil content, abiotic stress tolerance and/or nitrogen use efficiency of a plant can involve multiple genes acting additively or in synergy (see, for example, in Quesda et al., Plant Physiol. 130:951-063, 2002), the present invention also envisages expressing a plurality of exogenous polynucleotides in a single host plant to thereby achieve superior effect on the yield, growth rate, biomass, vigor, oil content, abiotic stress tolerance and/or nitrogen use efficiency of the plant.
(114) Expressing a plurality of exogenous polynucleotides in a single host plant can be effected by co-introducing multiple nucleic acid constructs, each including a different exogenous polynucleotide, into a single plant cell. The transformed cell can than be regenerated into a mature plant using the methods described hereinabove.
(115) Alternatively, expressing a plurality of exogenous polynucleotides in a single host plant can be effected by co-introducing into a single plant-cell a single nucleic-acid construct including a plurality of different exogenous polynucleotides. Such a construct can be designed with a single promoter sequence which can transcribe a polycistronic messenger RNA including all the different exogenous polynucleotide sequences. To enable co-translation of the different polypeptides encoded by the polycistronic messenger RNA, the polynucleotide sequences can be inter-linked via an internal ribosome entry site (IRES) sequence which facilitates translation of polynucleotide sequences positioned downstream of the IRES sequence. In this case, a transcribed polycistronic RNA molecule encoding the different polypeptides described above will be translated from both the capped 5′ end and the two internal IRES sequences of the polycistronic RNA molecule to thereby produce in the cell all different polypeptides. Alternatively, the construct can include several promoter sequences each linked to a different exogenous polynucleotide sequence.
(116) The plant cell transformed with the construct including a plurality of different exogenous polynucleotides, can be regenerated into a mature plant, using the methods described hereinabove.
(117) Alternatively, expressing a plurality of exogenous polynucleotides in a single host plant can be effected by introducing different nucleic acid constructs, including different exogenous polynucleotides, into a plurality of plants. The regenerated transformed plants can then be cross-bred and resultant progeny selected for superior yield, growth rate, biomass, vigor, oil content, abiotic stress tolerance and/or nitrogen use efficiency traits, using conventional plant breeding techniques.
(118) According to some embodiments of the invention, the method further comprising growing the plant expressing the exogenous polynucleotide under the abiotic stress.
(119) Non-limiting examples of abiotic stress conditions include, salinity, drought, water deprivation, excess of water (e.g., flood, waterlogging), etiolation, low temperature, high temperature, heavy metal toxicity, anaerobiosis, nutrient deficiency, nutrient excess, atmospheric pollution and UV irradiation.
(120) Thus, the invention encompasses plants exogenously expressing the polynucleotide(s), the nucleic acid constructs and/or polypeptide(s) of the invention. Once expressed within the plant cell or the entire plant, the level of the polypeptide encoded by the exogenous polynucleotide can be determined by methods well known in the art such as, activity assays, Western blots using antibodies capable of specifically binding the polypeptide, Enzyme-Linked Immuno Sorbent Assay (ELISA), radio-immuno-assays (RIA), immunohistochemistry, immunocytochemistry, immunofluorescence and the like.
(121) Methods of determining the level in the plant of the RNA transcribed from the exogenous polynucleotide are well known in the art and include, for example, Northern blot analysis, reverse transcription polymerase chain reaction (RT-PCR) analysis (including quantitative, semi-quantitative or real-time RT-PCR) and RNA-in situ hybridization.
(122) In addition, the endogenous homolog of the exogenous polynucleotide or polypeptide of the invention, or a fragment of the endogenous homolog (e.g. introns or untranslated regions) in the plant can be used as a marker for marker assisted selection (MAS), in which a marker is used for indirect selection of a genetic determinant or determinants of a trait of interest (e.g., biomass, growth rate, oil content, yield, abiotic stress tolerance). These genes (DNA or RNA sequence) may contain or be linked to polymorphic sites or genetic markers on the genome such as restriction fragment length polymorphism (RFLP), microsatellites and single nucleotide polymorphism (SNP), DNA fingerprinting (DFP), amplified fragment length polymorphism (AFLP), expression level polymorphism, polymorphism of the encoded polypeptide and any other polymorphism at the DNA or RNA sequence.
(123) Examples of marker assisted selections include, but are not limited to, selection for a morphological trait (e.g., a gene that affects form, coloration, male sterility or resistance such as the presence or absence of awn, leaf sheath coloration, height, grain color, aroma of rice); selection for a biochemical trait (e.g., a gene that encodes a protein that can be extracted and observed; for example, isozymes and storage proteins); selection for a biological trait (e.g., pathogen races or insect biotypes based on host pathogen or host parasite interaction can be used as a marker since the genetic constitution of an organism can affect its susceptibility to pathogens or parasites).
(124) The polynucleotides and polypeptides described hereinabove can be used in a wide range of economical plants, in a safe and cost effective manner.
(125) Plant lines exogenously expressing the polynucleotide or the polypeptide of the invention are screened to identify those that show the greatest increase of the desired plant trait.
(126) The effect of the transgene (the exogenous polynucleotide encoding the polypeptide) on abiotic stress tolerance can be determined using known methods such as detailed below and in the Examples section which follows.
(127) Abiotic Stress Tolerance—
(128) Transformed (i.e., expressing the transgene) and non-transformed (wild type) plants are exposed to an abiotic stress condition, such as water deprivation, suboptimal temperature (low temperature, high temperature), nutrient deficiency, nutrient excess, a salt stress condition, osmotic stress, heavy metal toxicity, anaerobiosis, atmospheric pollution and UV irradiation.
(129) Salinity Tolerance Assay—
(130) Transgenic plants with tolerance to high salt concentrations are expected to exhibit better germination, seedling vigor or growth in high salt. Salt stress can be effected in many ways such as, for example, by irrigating the plants with a hyperosmotic solution, by cultivating the plants hydroponically in a hyperosmotic growth solution (e.g., Hoagland solution), or by culturing the plants in a hyperosmotic growth medium [e.g., 50% Murashige-Skoog medium (MS medium)]. Since different plants vary considerably in their tolerance to salinity, the salt concentration in the irrigation water, growth solution, or growth medium can be adjusted according to the specific characteristics of the specific plant cultivar or variety, so as to inflict a mild or moderate effect on the physiology and/or morphology of the plants (for guidelines as to appropriate concentration see, Bernstein and Kafkafi, Root Growth Under Salinity Stress In: Plant Roots, The Hidden Half 3rd ed. Waisel Y, Eshel A and Kafkafi U. (editors) Marcel Dekker Inc., New York, 2002, and reference therein).
(131) For example, a salinity tolerance test can be performed by irrigating plants at different developmental stages with increasing concentrations of sodium chloride (for example 50 mM, 100 mM, 200 mM, 400 mM NaCl) applied from the bottom and from above to ensure even dispersal of salt. Following exposure to the stress condition the plants are frequently monitored until substantial physiological and/or morphological effects appear in wild type plants. Thus, the external phenotypic appearance, degree of wilting and overall success to reach maturity and yield progeny are compared between control and transgenic plants.
(132) Quantitative parameters of tolerance measured include, but are not limited to, the average wet and dry weight, growth rate, leaf size, leaf coverage (overall leaf area), the weight of the seeds yielded, the average seed size and the number of seeds produced per plant. Transformed plants not exhibiting substantial physiological and/or morphological effects, or exhibiting higher biomass than wild-type plants, are identified as abiotic stress tolerant plants.
(133) Osmotic Tolerance Test—
(134) Osmotic stress assays (including sodium chloride and mannitol assays) are conducted to determine if an osmotic stress phenotype was sodium chloride-specific or if it was a general osmotic stress related phenotype. Plants which are tolerant to osmotic stress may have more tolerance to drought and/or freezing. For salt and osmotic stress germination experiments, the medium is supplemented for example with 50 mM, 100 mM, 200 mM NaCl or 100 mM, 200 mM NaCl, 400 mM mannitol.
(135) Drought Tolerance Assay/Osmoticum Assay—
(136) Tolerance to drought is performed to identify the genes conferring better plant survival after acute water deprivation. To analyze whether the transgenic plants are more tolerant to drought, an osmotic stress produced by the non-ionic osmolyte sorbitol in the medium can be performed. Control and transgenic plants are germinated and grown in plant-agar plates for 4 days, after which they are transferred to plates containing 500 mM sorbitol. The treatment causes growth retardation, then both control and transgenic plants are compared, by measuring plant weight (wet and dry), yield, and by growth rates measured as time to flowering.
(137) Conversely, soil-based drought screens are performed with plants overexpressing the polynucleotides detailed above. Seeds from control Arabidopsis plants, or other transgenic plants overexpressing the polypeptide of the invention are germinated and transferred to pots. Drought stress is obtained after irrigation is ceased accompanied by placing the pots on absorbent paper to enhance the soil-drying rate. Transgenic and control plants are compared to each other when the majority of the control plants develop severe wilting. Plants are re-watered after obtaining a significant fraction of the control plants displaying a severe wilting. Plants are ranked comparing to controls for each of two criteria: tolerance to the drought conditions and recovery (survival) following re-watering.
(138) Cold Stress Tolerance—
(139) To analyze cold stress, mature (25 day old) plants are transferred to 4° C. chambers for 1 or 2 weeks, with constitutive light. Later on plants are moved back to greenhouse. Two weeks later damages from chilling period, resulting in growth retardation and other phenotypes, are compared between both control and transgenic plants, by measuring plant weight (wet and dry), and by comparing growth rates measured as time to flowering, plant size, yield, and the like.
(140) Heat Stress Tolerance—
(141) Heat stress tolerance is achieved by exposing the plants to temperatures above 34° C. for a certain period. Plant tolerance is examined after transferring the plants back to 22° C. for recovery and evaluation after 5 days relative to internal controls (non-transgenic plants) or plants not exposed to neither cold or heat stress.
(142) Water Use Efficiency—
(143) can be determined as the biomass produced per unit transpiration. To analyze WUE, leaf relative water content can be measured in control and transgenic plants. Fresh weight (FW) is immediately recorded; then leaves are soaked for 8 hours in distilled water at room temperature in the dark, and the turgid weight (TW) is recorded. Total dry weight (DW) is recorded after drying the leaves at 60° C. to a constant weight. Relative water content (RWC) is calculated according to the following Formula I:
RWC=[(FW−DW)/(TW−DW)]×100 Formula I
(144) Fertilizer Use Efficiency—
(145) To analyze whether the transgenic plants are more responsive to fertilizers, plants are grown in agar plates or pots with a limited amount of fertilizer, as described, for example, in Yanagisawa et al (Proc Natl Acad Sci USA. 2004; 101:7833-8). The plants are analyzed for their overall size, time to flowering, yield, protein content of shoot and/or grain. The parameters checked are the overall size of the mature plant, its wet and dry weight, the weight of the seeds yielded, the average seed size and the number of seeds produced per plant. Other parameters that may be tested are: the chlorophyll content of leaves (as nitrogen plant status and the degree of leaf verdure is highly correlated), amino acid and the total protein content of the seeds or other plant parts such as leaves or shoots, oil content, etc. Similarly, instead of providing nitrogen at limiting amounts, phosphate or potassium can be added at increasing concentrations. Again, the same parameters measured are the same as listed above. In this way, nitrogen use efficiency (NUE), phosphate use efficiency (PUE) and potassium use efficiency (KUE) are assessed, checking the ability of the transgenic plants to thrive under nutrient restraining conditions.
(146) Nitrogen Use Efficiency—
(147) To analyze whether the transgenic Arabidopsis plants are more responsive to nitrogen, plant are grown in 0.75-1.5 mM (nitrogen deficient conditions) or 6-10 mM (optimal nitrogen concentration). Plants are allowed to grow for additional 20 days or until seed production. The plants are then analyzed for their overall size, time to flowering, yield, protein content of shoot and/or grain/seed production. The parameters checked can be the overall size of the plant, wet and dry weight, the weight of the seeds yielded, the average seed size and the number of seeds produced per plant. Other parameters that may be tested are: the chlorophyll content of leaves (as nitrogen plant status and the degree of leaf greenness is highly correlated), amino acid and the total protein content of the seeds or other plant parts such as leaves or shoots and oil content. Transformed plants not exhibiting substantial physiological and/or morphological effects, or exhibiting higher measured parameters levels than wild-type plants, are identified as nitrogen use efficient plants.
(148) Nitrogen Use Efficiency Assay Using Plantlets—
(149) The assay is done according to Yanagisawa-S. et al. with minor modifications (“Metabolic engineering with Dof1 transcription factor in plants: Improved nitrogen assimilation and growth under low-nitrogen conditions” Proc. Natl. Acad. Sci. USA 101, 7833-7838). Briefly, transgenic plants which are grown for 7-10 days in 0.5×MS [Murashige-Skoog] supplemented with a selection agent are transferred to two nitrogen-limiting conditions: MS media in which the combined nitrogen concentration (NH.sub.4NO.sub.3 and KNO.sub.3) was 0.2 mM or 0.05 mM. Plants are allowed to grow for additional 30-40 days and then photographed, individually removed from the Agar (the shoot without the roots) and immediately weighed (fresh weight) for later statistical analysis. Constructs for which only T1 seeds are available are sown on selective media and at least 25 seedlings (each one representing an independent transformation event) are carefully transferred to the nitrogen-limiting media. For constructs for which T2 seeds are available, different transformation events are analyzed. Usually, 25 randomly selected plants from each event are transferred to the nitrogen-limiting media allowed to grow for 3-4 additional weeks and individually weighed at the end of that period. Transgenic plants are compared to control plants grown in parallel under the same conditions. Mock-transgenic plants expressing the uidA reporter gene (GUS) under the same promoter are used as control.
(150) Nitrogen Determination—
(151) The procedure for N (nitrogen) concentration determination in the structural parts of the plants involves the potassium persulfate digestion method to convert organic N to NO.sub.3.sup.− (Purcell and King 1996 Argon. J. 88:111-113, the modified Cd.sup.− mediated reduction of NO.sub.3.sup.− to NO.sub.2.sup.− (Vodovotz 1996 Biotechniques 20:390-394) and the measurement of nitrite by the Griess assay (Vodovotz 1996, supra). The absorbance values are measured at 550 nm against a standard curve of NaNO.sub.2. The procedure is described in details in Samonte et al. 2006 Agron. J. 98:168-176.
(152) Germination Tests—
(153) Germination tests compare the percentage of seeds from transgenic plants that could complete the germination process to the percentage of seeds from control plants that are treated in the same manner. Normal conditions are considered for example, incubations at 22° C. under 22-hour light 2-hour dark daily cycles. Evaluation of germination and seedling vigor is conducted between 4 and 14 days after planting. The basal media is 50% MS medium (Murashige and Skoog, 1962 Plant Physiology 15, 473-497).
(154) Germination is checked also at unfavorable conditions such as cold (incubating at temperatures lower than 10° C. instead of 22° C.) or using seed inhibition solutions that contain high concentrations of an osmolyte such as sorbitol (at concentrations of 50 mM, 100 mM, 200 mM, 300 mM, 500 mM, and up to 1000 mM) or applying increasing concentrations of salt (of 50 mM, 100 mM, 200 mM, 300 mM, 500 mM NaCl).
(155) The effect of the transgene on plant's vigor, growth rate, biomass, yield and/or oil content can be determined using known methods.
(156) Plant Vigor—
(157) The plant vigor can be calculated by the increase in growth parameters such as leaf area, fiber length, rosette diameter, plant fresh weight and the like per time.
(158) Growth Rate—
(159) The growth rate can be measured using digital analysis of growing plants. For example, images of plants growing in greenhouse on plot basis can be captured every 3 days and the rosette area can be calculated by digital analysis. Rosette area growth is calculated using the difference of rosette area between days of sampling divided by the difference in days between samples.
(160) Evaluation of growth rate can be done by measuring plant biomass produced, rosette area, leaf size or root length per time (can be measured in cm.sup.2 per day of leaf area).
(161) Relative growth rate area can be calculated using Formula II.
Relative growth area rate=Regression coefficient of area along time course. Formula II:
Thus, the relative growth area rate is in units of 1/day and length growth rate is in units of 1/day.
(162) Seed Yield—
(163) Evaluation of the seed yield per plant can be done by measuring the amount (weight or size) or quantity (i.e., number) of dry seeds produced and harvested from 8-16 plants and divided by the number of plants.
(164) For example, the total seeds from 8-16 plants can be collected, weighted using e.g., an analytical balance and the total weight can be divided by the number of plants. Seed yield per growing area can be calculated in the same manner while taking into account the growing area given to a single plant. Increase seed yield per growing area could be achieved by increasing seed yield per plant, and/or by increasing number of plants capable of growing in a given area.
(165) In addition, seed yield can be determined via the weight of 1000 seeds. The weight of 1000 seeds can be determined as follows: seeds are scattered on a glass tray and a picture is taken. Each sample is weighted and then using the digital analysis, the number of seeds in each sample is calculated.
(166) The 1000 seeds weight can be calculated using formula III:
1000 Seed Weight=number of seed in sample/sample weight×1000 Formula III:
(167) The Harvest Index can be calculated using Formula IV
Harvest Index=Average seed yield per plant/Average dry weight Formula IV:
(168) Grain Protein Concentration—
(169) Grain protein content (g grain protein m.sup.−2) is estimated as the product of the mass of grain N (g grain N m.sup.−2) multiplied by the N/protein conversion ratio of k-5.13 (Mosse 1990, supra). The grain protein concentration is estimated as the ratio of grain protein content per unit mass of the grain (g grain protein kg.sup.−1 grain).
(170) Fiber Length—
(171) Fiber length can be measured using fibrograph. The fibrograph system was used to compute length in terms of “Upper Half Mean” length. The upper half mean (UHM) is the average length of longer half of the fiber distribution. The fibrograph measures length in span lengths at a given percentage point (Hypertext Transfer Protocol://World Wide Web(dot)cottoninc(dot)com/ClassificationofCotton/?Pg=4#Length).
(172) According to some embodiments of the invention, increased yield of corn may be manifested as one or more of the following: increase in the number of plants per growing area, increase in the number of ears per plant, increase in the number of rows per ear, number of kernels per ear row, kernel weight, thousand kernel weight (1000-weight), ear length/diameter, increase oil content per kernel and increase starch content per kernel.
(173) As mentioned, the increase of plant yield can be determined by various parameters. For example, increased yield of rice may be manifested by an increase in one or more of the following: number of plants per growing area, number of panicles per plant, number of spikelets per panicle, number of flowers per panicle, increase in the seed filling rate, increase in thousand kernel weight (1000-weight), increase oil content per seed, increase starch content per seed, among others. An increase in yield may also result in modified architecture, or may occur because of modified architecture.
(174) Similarly, increased yield of soybean may be manifested by an increase in one or more of the following: number of plants per growing area, number of pods per plant, number of seeds per pod, increase in the seed filling rate, increase in thousand seed weight (1000-weight), reduce pod shattering, increase oil content per seed, increase protein content per seed, among others. An increase in yield may also result in modified architecture, or may occur because of modified architecture.
(175) Increased yield of canola may be manifested by an increase in one or more of the following: number of plants per growing area, number of pods per plant, number of seeds per pod, increase in the seed filling rate, increase in thousand seed weight (1000-weight), reduce pod shattering, increase oil content per seed, among others. An increase in yield may also result in modified architecture, or may occur because of modified architecture.
(176) Increased yield of cotton may be manifested by an increase in one or more of the following: number of plants per growing area, number of bolls per plant, number of seeds per boll, increase in the seed filling rate, increase in thousand seed weight (1000-weight), increase oil content per seed, improve fiber length, fiber strength, among others. An increase in yield may also result in modified architecture, or may occur because of modified architecture.
(177) Oil Content—
(178) The oil content of a plant can be determined by extraction of the oil from the seed or the vegetative portion of the plant. Briefly, lipids (oil) can be removed from the plant (e.g., seed) by grinding the plant tissue in the presence of specific solvents (e.g., hexane or petroleum ether) and extracting the oil in a continuous extractor. Indirect oil content analysis can be carried out using various known methods such as Nuclear Magnetic Resonance (NMR) Spectroscopy, which measures the resonance energy absorbed by hydrogen atoms in the liquid state of the sample [See for example, Conway T F. and Earle F R., 1963, Journal of the American Oil Chemists'Society; Springer Berlin/Heidelberg, ISSN: 0003-021× (Print) 1558-9331 (Online)]; the Near Infrared (NI) Spectroscopy, which utilizes the absorption of near infrared energy (1100-2500 nm) by the sample; and a method described in WO/2001/023884, which is based on extracting oil a solvent, evaporating the solvent in a gas stream which forms oil particles, and directing a light into the gas stream and oil particles which forms a detectable reflected light.
(179) Thus, the present invention is of high agricultural value for promoting the yield of commercially desired crops (e.g., biomass of vegetative organ such as poplar wood, or reproductive organ such as number of seeds or seed biomass).
(180) Any of the transgenic plants described hereinabove or parts thereof may be processed to produce a feed, meal, protein or oil preparation, such as for ruminant animals.
(181) The transgenic plants described hereinabove, which exhibit an increased oil content can be used to produce plant oil (by extracting the oil from the plant).
(182) The plant oil (including the seed oil and/or the vegetative portion oil) produced according to the method of the invention may be combined with a variety of other ingredients. The specific ingredients included in a product are determined according to the intended use. Exemplary products include animal feed, raw material for chemical modification, biodegradable plastic, blended food product, edible oil, biofuel, cooking oil, lubricant, biodiesel, snack food, cosmetics, and fermentation process raw material. Exemplary products to be incorporated to the plant oil include animal feeds, human food products such as extruded snack foods, breads, as a food binding agent, aquaculture feeds, fermentable mixtures, food supplements, sport drinks, nutritional food bars, multi-vitamin supplements, diet drinks, and cereal foods.
(183) According to some embodiments of the invention, the oil comprises a seed oil.
(184) According to some embodiments of the invention, the oil comprises a vegetative portion oil.
(185) According to some embodiments of the invention, the plant cell forms a part of a plant.
(186) As used herein the term “about” refers to ±10%.
(187) The terms “comprises”, “comprising”, “includes”, “including”, “having” and their conjugates mean “including but not limited to”.
(188) The term “consisting of means “including and limited to”.
(189) The term “consisting essentially of” means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
(190) As used herein, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a compound” or “at least one compound” may include a plurality of compounds, including mixtures thereof.
(191) Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
(192) Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
(193) As used herein the term “method” refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
(194) It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
(195) Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
(196) Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.
EXAMPLES
(197) Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.
(198) Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, “Molecular Cloning: A laboratory Manual” Sambrook et al., (1989); “Current Protocols in Molecular Biology” Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., “Current Protocols in Molecular Biology”, John Wiley and Sons, Baltimore, Md. (1989); Perbal, “A Practical Guide to Molecular Cloning”, John Wiley & Sons, New York (1988); Watson et al., “Recombinant DNA”, Scientific American Books, New York; Birren et al. (eds) “Genome Analysis: A Laboratory Manual Series”, Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; “Cell Biology: A Laboratory Handbook”, Volumes I-III Cellis, J. E., ed. (1994); “Current Protocols in Immunology” Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), “Basic and Clinical Immunology” (8th Edition), Appleton & Lange, Norwalk, Conn. (1994); Mishell and Shiigi (eds), “Selected Methods in Cellular Immunology”, W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; “Oligonucleotide Synthesis” Gait, M. J., ed. (1984); “Nucleic Acid Hybridization” Hames, B. D., and Higgins S. J., eds. (1985); “Transcription and Translation” Hames, B. D., and Higgins S. J., Eds. (1984); “Animal Cell Culture” Freshney, R. I., ed. (1986); “Immobilized Cells and Enzymes” IRL Press, (1986); “A Practical Guide to Molecular Cloning” Perbal, B., (1984) and “Methods in Enzymology” Vol. 1-317, Academic Press; “PCR Protocols: A Guide To Methods And Applications”, Academic Press, San Diego, Calif. (1990); Marshak et al., “Strategies for Protein Purification and Characterization—A Laboratory Course Manual” CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.
Example 1
Gene Identification and Gene Role Prediction Using Bioinformatics Tools
(199) The present inventors have identified polynucleotides which can increase plant yield, seed yield, oil yield, oil content, biomass, growth rate, abiotic stress tolerance, nitrogen use efficiency and/or vigor of a plant, as follows.
(200) The nucleotide sequence datasets used here were from publicly available databases or from sequences obtained using the Solexa technology (e.g. Barley and Sorghum). Sequence data from 100 different plant species was introduced into a single, comprehensive database. Other information on gene expression, protein annotation, enzymes and pathways were also incorporated. Major databases used include:
(201) Genomes
(202) Arabidopsis genome [TAIR genome version 6 (Hypertext Transfer Protocol://World Wide Web(dot)arabidopsis(dot)org/)];
(203) Rice genome [IRGSP build 4.0 (Hypertext Transfer Protocol://rgp(dot)dna(dot)affrc(dot)go(dot)jp/IRGSP/)];
(204) Poplar [Populus trichocarpa release 1.1 from JGI (assembly release v1.0) (Hypertext Transfer Protocol://World Wide Web(dot)genome(dot)jgi-psf(dot)org/)];
(205) Brachypodium [JGI 4× assembly, Hypertext Transfer Protocol://World Wide Web(dot)brachpodium(dot)org)];
(206) Soybean [DOE-JGI SCP, version Glyma( ) (Hypertext Transfer Protocol://World Wide Web(dot)phytozome(dot)net/)];
(207) Grape [French-Italian Public Consortium for Grapevine Genome Characterization grapevine genome (Hypertext Transfer Protocol://World Wide Web(dot)genoscope(dot)cns(dot)fr/)];
(208) Castobean [TIGR/J Craig Venter Institute 4× assembly [(Hypertext Transfer Protocol://msc(dot)jcvi(dot)org/r communis];
(209) Sorghum [DOE-JGI SCP, version Sbi1 [Hypertext Transfer Protocol://World Wide Web(dot)phytozome(dot)net/)];
(210) Partially assembled genome of Maize [Hypertext Transfer Protocol://maizesequence(dot)org/];
(211) Expressed EST and mRNA Sequences were Extracted from the Following Databases:
(212) GenBank versions 154, 157, 160, 161, 164, 165, 166 and 168 (Hypertext Transfer Protocol://World Wide Web(dot)ncbi(dot)nlm(dot)nih(dot)gov/dbEST/);
(213) RefSeq (Hypertext Transfer Protocol://World Wide Web(dot)ncbi(dot)nlm(dot)nih(dot)gov/RefSeq/);
(214) TAIR (Hypertext Transfer Protocol://World Wide Web(dot)arabidopsis(dot)org/);
(215) Protein and Pathway Databases
(216) Uniprot [Hypertext Transfer Protocol://World Wide Web(dot)uniprot(dot) org/].
(217) AraCyc [Hypertext Transfer Protocol://World Wide Web(dot)arabidopsis(dot)org/biocyc/index(dot)jsp].
(218) ENZYME [Hypertext Transfer Protocol://expasy(dot)org/enzyme/].
(219) Microarray Datasets were Downloaded from:
(220) GEO (Hypertext Transfer Protocol://World Wide Web.ncbi.nlm.nih.gov/geo/) TAIR (Hypertext Transfer Protocol://World Wide Web.arabidopsis.org/).
(221) Proprietary microarray data (See WO2008/122980 and Example 3 below).
(222) QTL and SNPs Information
(223) Gramene [Hypertext Transfer Protocol://World Wide Web(dot)gramene(dot) org/qtl/].
(224) Panzea [Hypertext Transfer Protocol://World Wide Web(dot)panzea(dot) org/index(dot)html].
(225) Database Assembly—
(226) was performed to build a wide, rich, reliable annotated and easy to analyze database comprised of publicly available genomic mRNA, ESTs DNA sequences, data from various crops as well as gene expression, protein annotation and pathway data QTLs, and other relevant information.
(227) Database assembly is comprised of a toolbox of gene refining, structuring, annotation and analysis tools enabling to construct a tailored database for each gene discovery project. Gene refining and structuring tools enable to reliably detect splice variants and antisense transcripts, generating understanding of various potential phenotypic outcomes of a single gene. The capabilities of the “LEADS” platform of Compugen LTD for analyzing human genome have been confirmed and accepted by the scientific community [see e.g., “Widespread Antisense Transcription”, Yelin, et al. (2003) Nature Biotechnology 21, 379-85; “Splicing of Alu Sequences”, Lev-Maor, et al. (2003) Science 300 (5623), 1288-91; “Computational analysis of alternative splicing using EST tissue information”, Xie H et al. Genomics 2002], and have been proven most efficient in plant genomics as well.
(228) EST Clustering and Gene Assembly—
(229) For gene clustering and assembly of organisms with available genome sequence data (arabidopsis, rice, castorbean, grape, brachypodium, poplar, soybean, sorghum) the genomic LEADS version (GANG) was employed. This tool allows most accurate clustering of ESTs and mRNA sequences on genome, and predicts gene structure as well as alternative splicing events and anti-sense transcription.
(230) For organisms with no available full genome sequence data, “expressed LEADS” clustering software was applied.
(231) Gene Annotation—
(232) Predicted genes and proteins were annotated as follows:
(233) Blast search [Hypertext Transfer Protocol://blast(dot)ncbi(dot)nlm(dot)nih(dot)gov/Blast(dot)cgi] against all plant UniProt [Hypertext Transfer Protocol://World Wide Web(dot)uniprot(dot)org/] sequences was performed. Open reading frames of each putative transcript were analyzed and longest ORF with higher number of homologues was selected as predicted protein of the transcript. The predicted proteins were analyzed by InterPro [Hypertext Transfer Protocol://World Wide Web(dot)ebi(dot)ac(dot)uk/interpro/].
(234) Blast against proteins from AraCyc and ENZYME databases was used to map the predicted transcripts to AraCyc pathways.
(235) Predicted proteins from different species were compared using blast algorithm [Hypertext Transfer Protocol://World Wide Web(dot)ncbi(dot)nlm(dot)nih(dot)gov/Blast(dot)cgi] to validate the accuracy of the predicted protein sequence, and for efficient detection of orthologs.
(236) Gene Expression Profiling—
(237) Several data sources were exploited for gene expression profiling which combined microarray data and digital expression profile (see below). According to gene expression profile, a correlation analysis was performed to identify genes which are co-regulated under different developmental stages and environmental conditions and which are associated with different phenotypes.
(238) Publicly available microarray datasets were downloaded from TAIR and NCBI GEO sites, renormalized, and integrated into the database. Expression profiling is one of the most important resource data for identifying genes important for yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficieny.
(239) A digital expression profile summary was compiled for each cluster according to all keywords included in the sequence records comprising the cluster. Digital expression, also known as electronic Northern Blot, is a tool that displays virtual expression profile based on the EST sequences forming the gene cluster. The tool provides the expression profile of a cluster in terms of plant anatomy (e.g., the tissue/organ in which the gene is expressed), developmental stage (the developmental stages at which a gene can be found) and profile of treatment (provides the physiological conditions under which a gene is expressed such as drought, cold, pathogen infection, etc). Given a random distribution of ESTs in the different clusters, the digital expression provides a probability value that describes the probability of a cluster having a total of N ESTs to contain X ESTs from a certain collection of libraries. For the probability calculations, the following is taken into consideration: a) the number of ESTs in the cluster, b) the number of ESTs of the implicated and related libraries, c) the overall number of ESTs available representing the species. Thereby clusters with low probability values are highly enriched with ESTs from the group of libraries of interest indicating a specialized expression.
(240) Recently, the accuracy of this system was demonstrated by Portnoy et al., 2009 (Analysis Of The Melon Fruit Transcriptome Based On 454 Pyrosequencing) in: Plant & Animal Genomes XVII Conference, San Diego, Calif. Transcriptomic analysis, based on relative EST abundance in data was performed by 454 pyrosequencing of cDNA representing mRNA of the melon fruit. Fourteen double strand cDNA samples obtained from two genotypes, two fruit tissues (flesh and rind) and four developmental stages were sequenced. GS FLX pyrosequencing (Roche/454 Life Sciences) of non-normalized and purified cDNA samples yielded 1,150,657 expressed sequence tags that assembled into 67,477 unigenes (32,357 singletons and 35,120 contigs). Analysis of the data obtained against the Cucurbit Genomics Database [Hypertext Transfer Protocol://World Wide Web(dot)icugi(dot)org/] confirmed the accuracy of the sequencing and assembly. Expression patterns of selected genes fitted well their qRT-PCR data.
Example 2
Production of Arabidopsis Transcriptom and High Throughput Correlation Analysis of Yield, Biomass and/or Vigor Related Parameters Using 44K Arabidopsis Full Genome Oligonucleotide Micro-Array
(241) To produce a high throughput correlation analysis, the present inventors utilized an Arabidopsis thaliana oligonucleotide micro-array, produced by Agilent Technologies [Hypertext Transfer Protocol://World Wide Web(dot)chem.(dot)agilent(dot)com/Scripts/PDS(dot)asp?1Page=50879]. The array oligonucleotide represents about 40,000 A. thaliana genes and transcripts designed based on data from the TIGR ATH1 v.5 database and Arabidopsis MPSS (University of Delaware) databases. To define correlations between the levels of RNA expression and yield, biomass components or vigor related parameters, various plant characteristics of 15 different Arabidopsis ecotypes were analyzed. Among them, nine ecotypes encompassing the observed variance were selected for RNA expression analysis. The correlation between the RNA levels and the characterized parameters was analyzed using Pearson correlation test [Hypertext Transfer Protocol://World Wide Web(dot)davidmlane(dot) com/hyperstat/A34739(dot)html].
Experimental Procedures
(242) RNA Extraction—
(243) Five tissues at different developmental stages including root, leaf, flower at anthesis, seed at 5 days after flowering (DAF) and seed at 12 DAF, representing different plant characteristics, were sampled and RNA was extracted using TRIzol Reagent from Invitrogen [Hypertext Transfer Protocol://World Wide Web(dot) invitrogen(dot)com/content(dot)cfm?pageid=469]. For convenience, each micro-array expression information tissue type has received a Set ID as summarized in Table 1 below.
(244) TABLE-US-00001 TABLE 1 Tissues used for Arabidopsis transcriptom expression sets Expression Set Set ID Root A Leaf B Flower C Seed 5 DAF D Seed 12 DAF E Table 1: Provided are the identification (ID) letters of each of the Arabidopsis expression sets (A-E). DAF = days after flowering.
(245) Approximately 30-50 mg of tissue was taken from samples. The weighed tissues were ground using pestle and mortar in liquid nitrogen and resuspended in 500 μl of TRIzol Reagent. To the homogenized lysate, 100 μl of chloroform was added followed by precipitation using isopropanol and two washes with 75% ethanol. The RNA was eluted in 30 μl of RNase-free water. RNA samples were cleaned up using Qiagen's RNeasy minikit clean-up protocol as per the manufacturer's protocol.
(246) Yield Components and Vigor Related Parameters Assessment—
(247) eight out of the nine Arabidopsis ecotypes were used in each of 5 repetitive blocks (named A, B, C, D and E), each containing 20 plants per plot. The plants were grown in a greenhouse at controlled conditions in 22° C., and the N:P:K fertilizer (20:20:20; weight ratios) [nitrogen (N), phosphorus (P) and potassium (K)] was added. During this time data was collected, documented and analyzed. Additional data was collected through the seedling stage of plants grown in a tissue culture in vertical grown transparent agar plates. Most of chosen parameters were analyzed by digital imaging.
(248) Digital Imaging in Tissue Culture—
(249) A laboratory image acquisition system was used for capturing images of plantlets sawn in square agar plates. The image acquisition system consists of a digital reflex camera (Canon EOS 300D) attached to a 55 mm focal length lens (Canon EF-S series), mounted on a reproduction device (Kaiser RS), which included 4 light units (4×150 Watts light bulb) and located in a darkroom.
(250) Digital Imaging in Greenhouse—
(251) The image capturing process was repeated every 3-4 days starting at day 7 till day 30. The same camera attached to a 24 mm focal length lens (Canon EF series), placed in a custom made iron mount, was used for capturing images of larger plants sawn in white tubs in an environmental controlled greenhouse. The white tubs were square shape with measurements of 36×26.2 cm and 7.5 cm deep. During the capture process, the tubs were placed beneath the iron mount, while avoiding direct sun light and casting of shadows. This process was repeated every 3-4 days for up to 30 days.
(252) An image analysis system was used, which consists of a personal desktop computer (Intel P4 3.0 GHz processor) and a public domain program—ImageJ 1.37, Java based image processing program, which was developed at the U.S National Institutes of Health and is freely available on the internet at Hypertext Transfer Protocol://rsbweb(dot)nih(dot) gov/. Images were captured in resolution of 6 Mega Pixels (3072×2048 pixels) and stored in a low compression JPEG (Joint Photographic Experts Group standard) format. Next, analyzed data was saved to text files and processed using the JMP statistical analysis software (SAS institute).
(253) Leaf Analysis—
(254) Using the digital analysis leaves data was calculated, including leaf number, area, perimeter, length and width. On day 30, 3-4 representative plants were chosen from each plot of blocks A, B and C. The plants were dissected, each leaf was separated and was introduced between two glass trays, a photo of each plant was taken and the various parameters (such as leaf total area, laminar length etc.) were calculated from the images. The blade circularity was calculated as laminar width divided by laminar length.
(255) Root Analysis—
(256) During 17 days, the different ecotypes were grown in transparent agar plates. The plates were photographed every 3 days starting at day 7 in the photography room and the roots development was documented (see examples in
Relative growth rate of root coverage=Regression coefficient of root coverage along time course. Formula V:
(257) Vegetative Growth Rate Analysis—
(258) was calculated according to Formula VI. The analysis was ended with the appearance of overlapping plants.
Relative vegetative growth rate area=Regression coefficient of vegetative area along time course. Formula VI
(259) For comparison between ecotypes the calculated rate was normalized using plant developmental stage as represented by the number of true leaves. In cases where plants with 8 leaves had been sampled twice (for example at day 10 and day 13), only the largest sample was chosen and added to the Anova comparison.
(260) Seeds in Siliques Analysis—
(261) On day 70, 15-17 siliques were collected from each plot in blocks D and E. The chosen siliques were light brown color but still intact. The siliques were opened in the photography room and the seeds were scatter on a glass tray, a high resolution digital picture was taken for each plot. Using the images the number of seeds per silique was determined.
(262) Seeds Average Weight—
(263) At the end of the experiment all seeds from plots of blocks A-C were collected. An average weight of 0.02 grams was measured from each sample, the seeds were scattered on a glass tray and a picture was taken. Using the digital analysis, the number of seeds in each sample was calculated.
(264) Oil Percentage in Seeds—
(265) At the end of the experiment all seeds from plots of blocks A-C were collected. Columbia seeds from 3 plots were mixed grounded and then mounted onto the extraction chamber. 210 ml of n-Hexane (Cat No. 080951 Biolab Ltd.) were used as the solvent. The extraction was performed for 30 hours at medium heat 50° C. Once the extraction has ended the n-Hexane was evaporated using the evaporator at 35° C. and vacuum conditions. The process was repeated twice. The information gained from the Soxhlet extractor (Soxhlet, F. Die gewichtsanalytische Bestimmung des Milchfettes, Polytechnisches J. (Dingler's) 1879, 232, 461) was used to create a calibration curve for the Low Resonance NMR. The content of oil of all seed samples was determined using the Low Resonance NMR (MARAN Ultra—Oxford Instrument) and its MultiQuant sowftware package.
(266) Silique Length Analysis—
(267) On day 50 from sowing, 30 siliques from different plants in each plot were sampled in block A. The chosen siliques were green-yellow in color and were collected from the bottom parts of a grown plant's stem. A digital photograph was taken to determine silique's length.
(268) Dry Weight and Seed Yield—
(269) On day 80 from sowing, the plants from blocks A-C were harvested and left to dry at 30° C. in a drying chamber. The biomass and seed weight of each plot was separated, measured and divided by the number of plants. Dry weight=total weight of the vegetative portion above ground (excluding roots) after drying at 30° C. in a drying chamber; Seed yield per plant=total seed weight per plant (gr).
(270) Oil Yield—
(271) The oil yield was calculated using Formula VII.
Seed Oil yield=Seed yield per plant(gr)*Oil % in seed Formula VII:
(272) Harvest Index—
(273) The harvest index was calculated using Formula IV as described above [Harvest Index=Average seed yield per plant/Average dry weight].
Experimental Results
(274) Nine different Arabidopsis ecotypes were grown and characterized for 18 parameters (named as vectors). Data parameters are summarized in Table 2, below.
(275) TABLE-US-00002 TABLE 2 Arabidopsis correlated parameters (vectors) Correlated parameter with Correlation ID Root length day 13 (cm) 1 Root length day 7 (cm) 2 Relative root growth (cm/day) day 13 3 Fresh weight per plant (gr) at bolting stage 4 Dry matter per plant (gr) 5 Vegetative growth rate (cm.sup.2/day) till 8 true leaves 6 Blade circularity 7 Lamina width (cm) 8 Lamina length (cm) 9 Total leaf area per plant (cm) 10 1000 Seed weight (gr) 11 Oil % per seed 12 Seeds per silique 13 Silique length (cm) 14 Seed yield per plant (gr) 15 Oil yield per plant (mg) 16 Harvest Index 17 Leaf width/length 18 Table 2. Provided are the Arabidopsis correlated parameters (correlation ID Nos. 1-18). Abbreviations: Cm = centimeter(s); gr = gram(s); mg = milligram(s).
(276) The characterized values are summarized in Tables 3 and 4 below.
(277) TABLE-US-00003 TABLE 3 Measured parameters in Arabidopsis ecotypes Dry Total Seed yield Oil yield Oil % 1000 Seed matter leaf area Seeds Silique per plant per plant per weight per plant Harvest per plant per length Ecotype (gr) (mg) seed (gr) (gr) Index (cm) silique (cm) An-1 0.34 118.63 34.42 0.0203 0.64 0.53 46.86 45.44 1.06 Col-0 0.44 138.73 31.19 0.0230 1.27 0.35 109.89 53.47 1.26 Ct-1 0.59 224.06 38.05 0.0252 1.05 0.56 58.36 58.47 1.31 Cvi 0.42 116.26 27.76 0.0344 1.28 0.33 56.80 35.27 1.47 (N8580) Gr-6 0.61 218.27 35.49 0.0202 1.69 0.37 114.66 48.56 1.24 Kondara 0.43 142.11 32.91 0.0263 1.34 0.32 110.82 37.00 1.09 Ler-1 0.36 114.15 31.56 0.0205 0.81 0.45 88.49 39.38 1.18 Mt-0 0.62 190.06 30.79 0.0226 1.21 0.51 121.79 40.53 1.18 Shakdara 0.55 187.62 34.02 0.0235 1.35 0.41 93.04 25.53 1.00 Table 3. Provided are the values of each of the parameters measured in Arabidopsis ecotypes: Seed yield per plant (gram); oil yield per plant (mg); oil % per seed; 1000 seed weight (gr); dry matter per plant (gr); harvest index; total leaf area per plant (cm); seeds per silique; Silique length (cm).
(278) TABLE-US-00004 TABLE 4 Additional measured parameters in Arabidopsis ecotypes Relat. Root Root Fresh root length length weight Lam. Lam. Leaf Blade Ecotype Veg. GR growth day 7 day 13 per plant Leng. width width/length circularity An-1 0.313 0.631 0.937 4.419 1.510 2.767 1.385 0.353 0.509 Col-0 0.378 0.664 1.759 8.530 3.607 3.544 1.697 0.288 0.481 Ct-1 0.484 1.176 0.701 5.621 1.935 3.274 1.460 0.316 0.450 Cvi 0.474 1.089 0.728 4.834 2.082 3.785 1.374 0.258 0.370 (N8580) Gr-6 0.425 0.907 0.991 5.957 3.556 3.690 1.828 0.356 0.501 Kondara 0.645 0.774 1.163 6.372 4.338 4.597 1.650 0.273 0.376 Ler-1 0.430 0.606 1.284 5.649 3.467 3.877 1.510 0.305 0.394 Mt-0 0.384 0.701 1.414 7.060 3.479 3.717 1.817 0.335 0.491 Shakdara 0.471 0.782 1.251 7.041 3.710 4.149 1.668 0.307 0.409 Table 4. Provided are the values of each of the parameters measured in Arabidopsis ecotypes: Veg. GR = vegetative growth rate (cm/day) until 8 true leaves; Relat. Root growth = relative root growth (cm/day); Root length day 7 (cm); Root length day 13 (cm); fresh weight per plant (gr) at bolting stage; Lam. Leng. = Lamima length (cm); Lam. Width = Lamina width (cm); Leaf width/length; Blade circularity.
(279) Tables 5-7, below, provide the selected genes, the characterized parameters (which are used as x axis for correlation) and the correlated tissue transcriptom along with the correlation value (R, calculated using Pearson correlation). When the correlation coefficient (R) between the levels of a gene's expression in a certain tissue and a phenotypic performance across ecotypes is high in absolute value (between 0.5-1), there is an association between the gene (specifically the expression level of this gene) and the phenotypic character. A positive correlation indicates that the expression of the gene in a certain tissue or developmental stage and the correlation vector (phenotype performance) are positively associated (both, expression and phenotypic performance increase or decrease simultaneously) while a negative correlation indicates a negative association (while the one is increasing the other is decreasing and vice versa).
(280) TABLE-US-00005 TABLE 5 Correlation between the expression level of selected genes in specific tissues or developmental stages and the phenotypic performance across Arabidopsis ecotypes Gene Exp. Corr. Exp. Corr. Exp. Name Corr. Vec. Set R Vec. Set R Vec. Set R BDL117 1 C −0.907 1 A −0.809 13 D 0.961 BDL118 13 A 0.817 6 A 0.805 5 D −0.821 BDL118 17 D 0.958 17 D 0.834 8 D −0.833 BDL118 8 D −0.845 10 D −0.912 10 D −0.975 BDL118 4 D −0.904 BDL126 5 B 0.942 BDL138 16 C 0.841 15 C 0.813 16 B 0.878 BDL138 15 B 0.896 13 A 0.94 BDL140 14 C 0.841 3 C 0.821 11 C 0.855 BDL140 14 B 0.836 11 B 0.855 7 E −0.812 BDL140 6 E 0.889 13 D 0.826 14 D 0.862 BDL147 16 B 0.948 15 B 0.898 BDL149 14 B 0.83 3 B 0.891 14 A 0.951 BDL152 16 D 0.969 3 D 0.855 15 D 0.987 BDL153 14 C 0.836 11 C 0.823 14 A −0.862 BDL153 11 A 0.88 8 D −0.81 BDL154 11 C 0.874 BDL155 16 B 0.829 16 A 0.86 BDL156 3 C 0.923 14 B 0.901 BDL157 3 B 0.854 2 B −0.825 5 D −0.803 BDL157 17 D 0.923 9 D −0.809 8 D −0.834 BDL157 10 D −0.915 4 D −0.89 BDL158 8 B 0.953 10 B 0.945 4 B 0.899 BDL158 11 A −0.833 BDL160 7 C 0.82 18 C 0.972 8 A 0.918 BDL160 8 A 0.839 8 A 0.834 10 A 0.93 BDL160 10 A 0.93 4 A 0.862 1 E 0.864 BDL160 1 E 0.841 2 E 0.861 2 E 0.839 BDL160 8 D 0.867 8 D 0.811 10 D 0.824 BDL162 5 B 0.89 BDL163 16 B 0.925 15 B 0.884 18 E 0.828 BDL165 8 B 0.952 10 B 0.902 4 B 0.821 BDL165 8 E 0.807 15 E 0.816 11 D 0.846 BDL167 16 B 0.899 15 B 0.946 17 D 0.859 BDL167 2 D −0.806 BDL168 16 C 0.97 15 C 0.929 8 B 0.931 BDL168 10 B 0.88 13 A −0.835 5 D −0.911 BDL168 8 D −0.946 10 D −0.849 BDL169 14 B −0.82 11 B −0.848 12 A 0.901 BDL171 14 C −0.842 2 B −0.844 5 A 0.803 BDL171 1 A −0.851 2 A −0.821 5 D −0.827 BDL171 17 D 0.958 17 D 0.853 17 D 0.825 BDL171 9 D −0.82 8 D −0.87 16 D 0.857 BDL171 10 D −0.901 10 D −0.948 4 D −0.808 BDL171 4 D −0.932 15 D 0.838 BDL173 7 B 0.892 9 B −0.874 18 B 0.816 BDL173 17 D 0.948 8 D −0.888 10 D −0.974 BDL173 4 D −0.871 BDL174 17 C 0.901 5 D −0.917 8 D −0.879 BDL174 10 D −0.85 BDL176 5 D −0.907 8 D −0.913 13 D 0.93 BDL177 17 C 0.919 17 B 0.91 17 D 0.82 BDL181 16 C 0.893 15 C 0.838 8 B 0.816 BDL181 12 A 0.931 16 A 0.823 18 E 0.819 BDL181 16 D 0.865 15 D 0.856 BDL182 12 A 0.913 12 D 0.825 BDL183 16 B 0.915 15 B 0.898 BDL186 12 B 0.944 11 B 0.833 8 D −0.807 BDL187 16 B 0.908 15 B 0.835 5 D −0.803 BDL187 8 D −0.892 BDL188 14 B 0.904 12 D 0.964 3 D 0.857 BDL188 2 D −0.886 BDL189 16 B 0.951 15 B 0.907 6 E −0.854 BDL189 8 D −0.821 1 D −0.938 BDL190 16 B 0.857 15 B 0.91 7 E −0.865 BDL192 7 B 0.907 9 B −0.806 17 D 0.91 BDL192 10 D −0.907 4 D −0.94 2 D −0.82 BDL193 8 C 0.846 12 B 0.904 11 B 0.876 BDL193 11 A 0.885 11 E 0.923 5 D −0.801 BDL193 8 D −0.802 8 D −0.844 10 D −0.806 BDL194 12 B 0.933 18 D 0.877 BDL196 16 D 0.917 15 D 0.937 BDL197 13 A 0.91 8 D 0.837 BDL200 2 C 0.818 16 B 0.864 15 B 0.832 BDL200 14 A 0.917 1 E 0.815 3 D 0.851 BDL201 9 C 0.846 5 D 0.916 17 D −0.906 BDL201 8 D 0.954 10 D 0.947 4 D 0.865 BDL203 10 B 0.926 4 B 0.893 14 A −0.828 BDL219 1 A 0.879 2 A 0.821 9 E −0.801 BDL220 8 B 0.822 10 B 0.844 4 B 0.839 BDL221 12 C 0.897 16 C 0.917 15 C 0.814 BDL221 3 B 0.936 9 D −0.936 6 D −0.897 BDL221 4 D −0.808 BDL222 1 B 0.829 2 B 0.887 1 A 0.875 BDL222 2 A 0.849 2 D 0.925 BDL223 14 C 0.93 14 B 0.835 3 B 0.851 BDL223 14 A 0.831 BDL224 5 E −0.826 9 E −0.872 BDL225 7 C 0.833 15 B −0.806 13 A −0.836 BDL227 2 A −0.931 BDL229 10 B 0.858 2 D 0.832 BDL231 16 B 0.911 15 B 0.869 11 D 0.88 BDL233 14 C −0.885 BDL235 11 E 0.808 12 D 0.818 2 D −0.887 BDL240 1 D −0.808 BDL241 13 A −0.88 BDL242 11 B 0.889 BDL243 11 B 0.929 BDL245 3 A −0.863 11 A −0.832 16 D −0.806 BDL247 16 B 0.816 BDL248 13 A −0.829 BDL249 8 C −0.84 16 E −0.808 15 E −0.892 BDL250 9 A −0.805 2 E −0.85 17 D 0.815 BDL250 10 D −0.809 4 D −0.804 1 D −0.9 BDL251 18 C 0.802 7 D −0.861 BDL47 8 B 0.845 BDL49 7 E 0.805 9 E −0.883 6 E −0.809 BDL62 18 A 0.862 6 E −0.869 13 D 0.829 BDL75 11 C 0.816 5 B 0.945 8 B 0.823 BDL79 7 B 0.876 18 B 0.841 12 D 0.884 BDL79 2 D −0.938 BDL81 8 C 0.897 12 B 0.803 1 D −0.81 BDL81 2 D −0.86 BDL83 3 C −0.861 2 C 0.905 BDL85 8 D 0.82 Table 5. Provided are the correlations between the expression level of selected genes in specific tissues or developmental stages (expression sets) and the phenotypic performance (correlation vector) across Arabidopsis ecotypes. The phenotypic characters [correlation (Corr.) vector (Vec.)] include yield (seed yield, oil yield, oil content), biomass, growth rate and/or vigor components as described in Tables 2, 3 and 4. Exp. Set = expression set according to Table 1 hereinabove.
(281) Table 6 hereinbelow provides data about the homologous of selected genes, the characterized parameters (which are used as x axis for correlation) and the correlated tissue transcriptom along with the correlation value (R, calculated using Pearson correlation).
(282) TABLE-US-00006 TABLE 6 Correlation between the expression level of homologous of the selected genes in specific tissues or developmental stages and the phenotypic performance across Arabidopsis ecotypes Gene Name Exp. Set Corr. Vec. R BDL155 H1 leaf relative root growth 0.814 BDL155 H1 seed5daf Silique length −0.855 BDL171 H0 leaf Leaf width/length 0.835 BDL171 H0 seed5daf Dry matter per plant −0.82 BDL171 H0 seed5daf Lamina width −0.813 BDL183 H0 seed12daf Blade circularity −0.878 BDL231 H0 flower seed weight 0.825 BDL231 H0 leaf Silique length 0.816 BDL231 H0 leaf relative root growth 0.854 BDL231 H0 root seed weight 0.92 BDL248 H0 seed5daf relative root growth 0.851 BDL70 H0 seed12daf Lamina length −0.816 BDL70 H0 seed5daf seed yield per plant −0.82 Table 6. Provided are the correlations between the expression levels of homologues of selected Arabidopsis genes in various tissues or developmental stages (Expression sets) and the phenotypic performance in various yield (seed yield, oil yield, oil content), biomass, growth rate and/or vigor components [Correlation (Corr.) vector (Vec.)] Corr. Vec. = correlation vector specified in Tables 2, 3 and 4; Exp. Set = expression set specified in Table 1.
Example 3
Production of Arabidopsis Transcriptom and High Throughput Correlation Analysis of Normal and Nitrogen Limiting Conditions Using 44K Arabidopsis Oligonucleotide Micro-Array
(283) In order to produce a high throughput correlation analysis, the present inventors utilized a Arabidopsis oligonucleotide micro-array, produced by Agilent Technologies [Hypertext Transfer Protocol://World Wide Web(dot)chem(dot)agilent(dot)com/Scripts/PDS(dot)asp?1Page=50879]. The array oligonucleotide represents about 44,000 Arabidopsis genes and transcripts. To define correlations between the levels of RNA expression with NUE, yield components or vigor related parameters various plant characteristics of 14 different Arabidopsis ecotypes were analyzed. Among them, ten ecotypes encompassing the observed variance were selected for RNA expression analysis. The correlation between the RNA levels and the characterized parameters was analyzed using Pearson correlation test [Hypertext Transfer Protocol://World Wide Web(dot)davidmlane(dot)com/hyperstat/A34739(dot)html].
Experimental Procedures
(284) RNA Extraction—
(285) Two tissues of plants [leaves and stems] growing at two different nitrogen fertilization levels (1.5 mM Nitrogen or 6 mM Nitrogen) were sampled and RNA was extracted using TRIzol Reagent from Invitrogen [Hypertext Transfer Protocol://World Wide Web(dot)invitrogen(dot)com/content(dot)cfm?pageid=469]. For convenience, each micro-array expression information tissue type has received a Set ID as summarized in Table 7 below.
(286) TABLE-US-00007 TABLE 7 Tissues used for Arabidopsis transcriptom expression sets Expression Set Set ID Leaves at 1.5 mM Nitrogen fertilization A Leaves at 6 mM Nitrogen fertilization B Stems at 1.5 mM Nitrogen fertilization C Stem at 6 mM Nitrogen fertilization D Table 7: Provided are the identification (ID) letters of each of the Arabidopsis expression sets.
(287) Approximately 30-50 mg of tissue was taken from samples. The weighed tissues were ground using pestle and mortar in liquid nitrogen and resuspended in 500 μl of TRIzol Reagent. To the homogenized lysate, 100 μl of chloroform was added followed by precipitation using isopropanol and two washes with 75% ethanol. The RNA was eluted in 30 μl of RNase-free water. RNA samples were cleaned up using Qiagen's RNeasy minikit clean-up protocol as per the manufacturer's protocol (QIAGEN Inc, CA USA).
(288) Assessment of Arabidopsis Yield Components and Vigor Related Parameters Under Different Nitrogen Fertilization Levels—
(289) 10 Arabidopsis accessions in 2 repetitive plots each containing 8 plants per plot were grown at greenhouse. The growing protocol used was as follows: surface sterilized seeds were sown in Eppendorf tubes containing 0.5× Murashige-Skoog basal salt medium and grown at 23° C. under 12-hour light and 12-hour dark daily cycles for 10 days. Then, seedlings of similar size were carefully transferred to pots filled with a mix of perlite and peat in a 1:1 ratio. Constant nitrogen limiting conditions were achieved by irrigating the plants with a solution containing 1.5 mM inorganic nitrogen in the form of KNO.sub.3, supplemented with 2 mM CaCl.sub.2, 1.25 mM KH.sub.2PO.sub.4, 1.50 mM MgSO.sub.4, 5 mM KCl, 0.01 mM H.sub.3BO.sub.3 and microelements, while normal irrigation conditions (Normal Nitrogen conditions) was achieved by applying a solution of 6 mM inorganic nitrogen also in the form of KNO.sub.3, supplemented with 2 mM CaCl.sub.2, 1.25 mM KH.sub.2PO.sub.4, 1.50 mM MgSO.sub.4, 0.01 mM H.sub.3BO.sub.3 and microelements. To follow plant growth, trays were photographed the day nitrogen limiting conditions were initiated and subsequently every 3 days for about 15 additional days. Rosette plant area was then determined from the digital pictures. ImageJ software was used for quantifying the plant size from the digital pictures [Hypertext Transfer Protocol://rsb(dot)info(dot)nih(dot)gov/ij/] utilizing proprietary scripts designed to analyze the size of rosette area from individual plants as a function of time. The image analysis system included a personal desktop computer (Intel P4 3.0 GHz processor) and a public domain program—ImageJ 1.37 (Java based image processing program, which was developed at the U.S. National Institutes of Health and freely available on the internet [Hypertext Transfer Protocol://rsbweb(dot)nih(dot)gov/]. Next, analyzed data was saved to text files and processed using the JMP statistical analysis software (SAS institute).
(290) Data parameters collected are summarized in Table 8, hereinbelow.
(291) TABLE-US-00008 TABLE 8 Arabidopsis correlated parameters (vectors) Correlated parameter with Correlation Id N 1.5 mM; Rosette Area at day 8 [cm.sup.2] 1 N 1.5 mM; Rosette Area at day 10 [cm.sup.2] 2 N 1.5 mM; Plot Coverage at day 8 [%] 3 N 1.5 mM; Plot Coverage at day 10 [%] 4 N 1.5 mM; Leaf Number at day 10 5 N 1.5 mM; Leaf Blade Area at day 10 [cm.sup.2] 6 N 1.5 mM; RGR of Rosette Area at day 3 [cm.sup.2/day] 7 N 1.5 mM; t50 Flowering [day] 8 N 1.5 mM; Dry Weight [gr/plant] 9 N 1.5 mM; Seed Yield [gr/plant] 10 N 1.5 mM; Harvest Index 11 N 1.5 mM; 1000 Seeds weight [gr] 12 N 1.5 mM; seed yield/rosette area at day 10 [gr/cm.sup.2] 13 N 1.5 mM; seed yield/leaf blade [gr/cm.sup.2] 14 N 1.5 mM; % Seed yield reduction compared to N 6 mM 15 N 1.5 mM; % Biomass reduction compared to N 6 mM 16 N 1.5 mM; N level/DW [SPAD unit/gr] 17 N 1.5 mM; DW/N level [gr/SPAD unit] 18 N 1.5 mM; seed yield/N level [gr/SPAD unit] 19 N 6 mM; Rosette Area at day 8 [cm.sup.2] 20 N 6 mM; Rosette Area at day 10 [cm.sup.2] 21 N 6 mM; Plot Coverage at day 8 [%] 22 N 6 mM; Plot Coverage at day 10 [%] 23 N 6 mM; Leaf Number at day 10 24 N 6 mM; Leaf Blade Area at day 10 25 N 6 mM; RGR of Rosette Area at day 3 [cm.sup.2/gr] 26 N 6 mM; t50 Flowering [day] 27 N 6 mM; Dry Weight [gr/plant] 28 N 6 mM; Seed Yield [gr/plant] 29 N 6 mM; Harvest Index 30 N 6 mM; 1000 Seeds weight [gr] 31 N 6 mM; seed yield/rosette area day at day 10 [gr/cm.sup.2] 32 N 6 mM; seed yield/leaf blade [gr/cm.sup.2] 33 N 6 mM; N level/FW 34 N 6 mM; DW/N level [gr/SPAD unit] 35 N 6 mM; N level/DW (SPAD unit/gr plant) 36 N 6 mM; Seed yield/N unit [gr/SPAD unit] 37 Table 8. Provided are the Arabidopsis correlated parameters (vectors). “N” = Nitrogen at the noted concentrations; “gr.” = grams; “SPAD” = chlorophyll levels; “t50” = time where 50% of plants flowered; “gr/SPAD unit” = plant biomass expressed in grams per unit of nitrogen in plant measured by SPAD. “DW” = Plant Dry Weight; “FW” = Plant Fresh weight; “N level/DW” = plant Nitrogen level measured in SPAD unit per plant biomass [gr]; “DW/N level” = plant biomass per plant [gr]/SPAD unit; Rosette Area (measured using digital analysis); Plot Coverage at the indicated day [%] (calculated by the dividing the total plant area with the total plot area); Leaf Blade Area at the indicated day [cm.sup.2] (measured using digital analysis); RGR (relative growth rate) of Rosette Area at the indicated day [cm.sup.2/day] (calculated using Formula II); t50 Flowering [day] (the day in which 50% of plant flower); seed yield/rosette area at day 10 [gr/cm.sup.2] (calculated); seed yield/leaf blade [gr/cm.sup.2] (calculated); seed yield/N level [gr/SPAD unit] (calculated).
(292) Assessment of NUE, Yield Components and Vigor-Related Parameters—
(293) Ten Arabidopsis ecotypes were grown in trays, each containing 8 plants per plot, in a greenhouse with controlled temperature conditions for about 12 weeks. Plants were irrigated with different nitrogen concentration as described above depending on the treatment applied. During this time, data was collected documented and analyzed. Most of chosen parameters were analyzed by digital imaging.
(294) Digital Imaging—Greenhouse Assay
(295) An image acquisition system, which consists of a digital reflex camera (Canon EOS 400D) attached with a 55 mm focal length lens (Canon EF-S series) placed in a custom made Aluminum mount, was used for capturing images of plants planted in containers within an environmental controlled greenhouse. The image capturing process is repeated every 2-3 days starting at day 9-12 till day 16-19 (respectively) from transplanting.
(296) An image processing system was used, which consists of a personal desktop computer (Intel P4 3.0 GHz processor) and a public domain program—ImageJ 1.37, Java based image processing software, which was developed at the U.S. National Institutes of Health and is freely available on the internet at Hypertext Transfer Protocol://rsbweb(dot)nih(dot)gov/. Images were captured in resolution of 10 Mega Pixels (3888×2592 pixels) and stored in a low compression JPEG (Joint Photographic Experts Group standard) format. Next, image processing output data was saved to text files and analyzed using the JMP statistical analysis software (SAS institute).
(297) Leaf Analysis—
(298) Using the digital analysis leaves data was calculated, including leaf number, leaf blade area, plot coverage, Rosette diameter and Rosette area.
(299) Relative Growth Rate Area:
(300) The relative growth rate of the rosette and the leaves was calculated according to Formula II as described above.
(301) Seed Yield and 1000 Seeds Weight—
(302) At the end of the experiment all seeds from all plots were collected and weighed in order to measure seed yield per plant in terms of total seed weight per plant (gr). For the calculation of 1000 seed weight, an average weight of 0.02 grams was measured from each sample, the seeds were scattered on a glass tray and a picture was taken. Using the digital analysis, the number of seeds in each sample was calculated.
(303) Dry Weight and Seed Yield—
(304) At the end of the experiment, plant were harvested and left to dry at 30° C. in a drying chamber. The biomass was separated from the seeds, weighed and divided by the number of plants. Dry weight=total weight of the vegetative portion above ground (excluding roots) after drying at 30° C. in a drying chamber.
(305) Harvest Index—
(306) The harvest index was calculated using Formula IV as described above [Harvest Index=Average seed yield per plant/Average dry weight].
(307) T.sub.50 Days to Flowering—
(308) Each of the repeats was monitored for flowering date. Days of flowering was calculated from sowing date till 50% of the plots flowered.
(309) Plant Nitrogen Level—
(310) The chlorophyll content of leaves is a good indicator of the nitrogen plant status since the degree of leaf greenness is highly correlated to this parameter. Chlorophyll content was determined using a Minolta SPAD 502 chlorophyll meter and measurement was performed at time of flowering. SPAD meter readings were done on young fully developed leaf. Three measurements per leaf were taken per plot. Based on this measurement, parameters such as the ratio between seed yield per nitrogen unit [seed yield/N level=seed yield per plant [gr]/SPAD unit], plant DW per nitrogen unit [DW/N level=plant biomass per plant [g]/SPAD unit], and nitrogen level per gram of biomass [N level/DW=SPAD unit/plant biomass per plant (gr)] were calculated.
(311) Percent of Seed Yield Reduction—
(312) measures the amount of seeds obtained in plants when grown under nitrogen-limiting conditions compared to seed yield produced at normal nitrogen levels expressed in %.
Experimental Results
(313) 10 different Arabidopsis accessions (ecotypes) were grown and characterized for 37 parameters as described above. The average for each of the measured parameters was calculated using the JMP software and values are summarized in Table 9 below. Subsequent correlation analysis between the various transcriptom sets (Table 7) was conducted. Following are the results integrated to the database.
(314) TABLE-US-00009 TABLE 9 Correlation between the expression level of selected genes in tissues under limiting or normal nitrogen fertilization and the phenotypic performance across Arabidopsis ecotypes Gene Corr. Exp. Corr. Exp. Corr. Name Exp. Set Vec. R Set Vec. R Set Vec. R BDL117 D 31 −0.748 A 12 −0.784 BDL118 C 11 −0.914 C 10 −0.723 C 14 −0.75 BDL118 C 8 0.74 BDL118 D 31 −0.766 B 30 −0.752 D 30 −0.794 BDL118 D 29 −0.715 B 27 0.791 A 11 −0.747 BDL126 A 1 −0.719 BDL126 D 25 0.801 A 6 −0.715 A 2 −0.711 BDL138 B 28 −0.797 B 27 −0.786 C 9 −0.754 BDL140 D 28 −0.761 BDL147 D 30 −0.703 C 11 −0.7 BDL149 C 9 −0.744 A 1 0.703 BDL152 A 14 −0.705 BDL117 D 31 −0.748 A 12 −0.784 BDL118 C 11 −0.914 C 10 −0.723 C 14 −0.75 BDL118 C 8 0.74 BDL154 B 26 0.896 B 32 0.76 B 33 0.861 BDL155 C 9 −0.719 BDL155_H0 B 28 0.768 D 28 0.757 D 29 0.751 BDL155_H0 C 7 0.743 BDL156 D 24 0.725 D 21 0.734 BDL157 B 29 0.714 BDL158 B 30 −0.722 B 27 0.708 BDL160 A 12 −0.807 C 9 −0.771 C 5 −0.797 BDL160 C 2 −0.816 BDL162 B 31 −0.792 BDL165 C 11 −0.755 C 8 0.748 BDL167 C 10 −0.898 C 14 −0.894 C 13 −0.874 BDL167 C 15 0.737 BDL167 D 30 −0.75 C 11 −0.709 C 7 −0.821 BDL168 A 9 0.703 A 11 −0.786 BDL168 B 30 −0.73 D 21 0.721 B 27 0.738 BDL169 A 11 −0.804 A 10 −0.746 A 14 −0.714 BDL169 A 13 −0.708 A 8 0.707 BDL171 B 33 0.865 A 9 −0.735 BDL171 D 25 0.879 B 26 0.891 D 21 0.765 BDL171 D 20 0.711 B 29 0.735 B 32 0.741 BDL171_H0 C 15 0.719 C 8 0.78 BDL173 B 26 0.723 B 33 0.72 A 15 0.751 BDL174 C 16 0.7 C 9 −0.73 BDL176 D 25 0.713 D 24 −0.713 D 26 0.765 BDL176 D 21 0.702 D 20 −0.719 D 32 0.806 BDL176 D 33 0.759 A 7 0.746 BDL177 B 27 −0.713 A 11 0.792 BDL181 C 10 −0.75 C 14 −0.795 C 13 −0.805 BDL181 C 15 0.72 A 8 0.794 BDL181 D 31 −0.704 B 27 0.723 C 11 −0.725 BDL182 A 6 0.728 A 2 0.717 A 1 0.763 BDL183 A 12 −0.764 BDL183_H0 A 2 −0.725 BDL186 A 10 −0.754 A 13 −0.713 A 15 0.805 BDL186 A 8 0.865 BDL117 D 31 −0.748 A 12 −0.784 BDL118 C 11 −0.914 C 10 −0.723 C 14 −0.75 BDL118 C 8 0.74 BDL186 B 31 −0.714 B 27 0.722 A 11 −0.816 BDL187 A 2 0.711 A 1 0.801 A 10 −0.775 BDL187 A 14 −0.843 A 13 −0.89 A 15 0.721 BDL189 A 13 −0.859 A 15 0.748 A 8 0.759 BDL189 B 30 −0.702 B 27 0.832 A 11 −0.71 BDL189 C 7 −0.714 A 10 −0.825 A 14 −0.82 BDL192 B 24 −0.788 B 21 −0.863 B 20 −0.857 BDL192 B 29 −0.701 B 32 0.769 BDL192 D 28 −0.764 B 30 −0.785 B 25 −0.802 BDL193 A 6 −0.754 A 2 −0.781 A 1 −0.875 BDL193 A 14 −0.732 BDL193 D 30 −0.721 D 29 −0.819 C 11 −0.7 BDL194 B 25 0.786 B 21 0.707 BDL196 D 25 −0.715 D 21 −0.71 D 20 −0.715 BDL197 A 6 −0.701 A 5 −0.843 A 2 −0.89 BDL197 A 1 −0.827 BDL201 A 10 −0.768 A 14 −0.84 A 13 −0.872 BDL201 A 15 0.746 BDL201 B 29 −0.815 A 2 0.747 A 1 0.784 BDL220 C 11 −0.81 BDL220 D 30 −0.707 B 29 −0.785 C 9 0.752 BDL221 A 2 0.768 C 2 0.763 A 1 0.817 BDL221 B 31 −0.81 D 25 −0.743 D 24 −0.896 BDL221 C 1 0.74 BDL221 D 21 −0.826 D 20 −0.776 A 5 0.825 BDL222 D 27 −0.716 A 11 0.77 A 14 0.731 BDL223 C 11 −0.757 C 15 0.786 C 8 0.821 BDL223_H0 C 11 −0.736 BDL223_H1 C 8 0.784 BDL223_H1 D 24 0.823 A 12 0.815 C 15 0.793 BDL229 C 11 −0.798 C 10 −0.723 C 14 −0.771 BDL229 C 13 −0.769 A 8 0.753 C 8 0.828 BDL229 D 30 −0.787 B 27 0.793 D 27 0.873 BDL231 A 11 −0.798 C 6 −0.704 A 10 −0.826 BDL231 A 14 −0.836 A 13 −0.843 A 15 0.823 BDL231 A 8 0.768 BDL231.sub.— A 11 −0.779 A 10 −0.799 A 14 −0.841 BDL117 D 31 −0.748 A 12 −0.784 BDL118 C 11 −0.914 C 10 −0.723 C 14 −0.75 BDL118 C 8 0.74 H0 BDL231_H0 A 13 −0.835 A 15 0.706 A 8 0.721 BDL233 C 8 0.835 BDL233 D 28 0.755 C 11 −0.768 C 15 0.725 BDL235 C 11 −0.87 C 10 −0.749 A 14 −0.741 BDL235 C 14 −0.726 A 13 −0.702 C 8 0.802 BDL240 A 8 0.742 BDL240 D 24 0.794 B 27 0.737 A 11 −0.787 BDL241 B 27 0.752 BDL242 A 5 −0.719 A 15 −0.722 BDL245 D 31 −0.875 BDL247 D 31 0.851 BDL249 A 8 −0.707 BDL249 C 12 0.707 A 11 0.82 A 10 0.727 BDL250 A 10 0.717 A 14 0.797 A 13 0.81 BDL252 C 9 −0.707 C 7 −0.714 BDL49 B 30 0.866 B 26 0.85 B 29 0.933 BDL49 B 33 0.762 BDL58 B 26 0.763 D 26 0.755 B 29 0.897 BDL58 C 14 0.816 C 13 0.855 C 15 −0.784 BDL58 C 8 −0.843 BDL58 D 32 0.758 D 33 0.778 C 10 0.8 BDL62 C 11 −0.858 C 10 −0.739 C 14 −0.77 BDL62 C 13 −0.747 C 8 0.819 BDL63 C 16 −0.704 BDL64 B 31 −0.793 C 5 −0.739 BDL70_H0 C 8 0.757 BDL75 C 11 −0.716 C 8 0.713 BDL75 D 31 −0.776 D 28 0.75 D 30 −0.832 BDL79 B 31 −0.77 BDL85 C 10 0.824 C 14 0.754 C 13 0.721 BDL85 C 15 −0.705 Table 9. Provided are the correlations (R) between the expression levels of selected genes in tissues (leaves or stems) under limiting (1.5 mM Nitrogen) or normal (6 mM Nitrogen) conditions (Expression sets) and the phenotypic performance in various yield (seed yield, oil yield, oil content), biomass, growth rate and/or vigor components [Correlation (Corr.) vector (Vec.)] under limiting or normal Nitrogen conditions. Corr. Vec. = correlation vector according to Table 8 hereinabove; Exp. Set = expression set according to Table 7 hereinabove.
Example 4
Production of Sorghum Transcriptom and High Throughput Correlation Analysis with ABST Related Parameters Using 44K Sorghum Oligonucleotide Micro-Arrays
(315) In order to produce a high throughput correlation analysis, the present inventors utilized a Sorghum oligonucleotide micro-array, produced by Agilent Technologies [Hypertext Transfer Protocol://World Wide Web(dot)chem.(dot)agilent(dot) com/Scripts/PDS(dot)asp?1 Page=50879]. The array oligonucleotide represents about 44,000 Sorghum genes and transcripts. In order to define correlations between the levels of RNA expression with ABST and yield components or vigor related parameters, various plant characteristics of 17 different sorghum varieties were analyzed. Among them, 10 varieties encompassing the observed variance were selected for RNA expression analysis. The correlation between the RNA levels and the characterized parameters was analyzed using Pearson correlation test [Hypertext Transfer Protocol://World Wide Web(dot)davidmlane(dot)com/hyperstat/A34739(dot)html].
(316) Correlation of Sorghum Varieties Across Ecotype Grown Under Severe Drought Conditions
Experimental Procedures
(317) 17 Sorghum varieties were grown in 3 repetitive plots, in field. Briefly, the growing protocol was as follows: sorghum seeds were sown in soil and grown under normal condition until around 35 days from sowing, around V8 (Last leaf visible, but still rolled up, ear beginning to swell). At this point, irrigation was stopped, and severe drought stress was developed. In order to define correlations between the levels of RNA expression with drought, yield components or vigor related parameters, the 17 different sorghum varieties were analyzed. Among them, 10 varieties encompassing the observed variance were selected for RNA expression analysis. The correlation between the RNA levels and the characterized parameters was analyzed using Pearson correlation test [Hypertext Transfer Protocol://World Wide Web(dot)davidmlane(dot) com/hyperstat/A34739(dot)html].
(318) RNA Extraction—
(319) All 10 selected Sorghum varieties were sample per each treatment. Plant tissues [Flag leaf and Flower meristem] growing under severe drought stress and plants grown under Normal conditions were sampled and RNA was extracted using TRIzol Reagent from Invitrogen [Hypertext Transfer Protocol://World Wide Web(dot)invitrogen(dot)com/content(dot)cfm?pageid=469]. For convenience, each micro-array expression information tissue type has received a Set ID as summarized in Table 10 below.
(320) TABLE-US-00010 TABLE 10 Sorghum transcriptom expression sets Expression Set Set ID Drought Stress: Flag leaf U Normal conditions: Flag leaf X Normal conditions: Flower meristem Y Table 10: Provided are the sorghum transcriptom expression set U, X and Y. Flag leaf = the leaf below the flower; Flower meristem = Apical meristem following panicle initiation.
(321) The collected data parameters were as follows:
(322) Grain Per Plant (Gr.)—
(323) At the end of the experiment (Inflorescence were dry) all spikes from plots within blocks A-C were collected. 5 Inflorescence were separately threshed and grains were weighted, all additional Inflorescence were threshed together and weighted as well. The average weight per Inflorescence was calculated by dividing the total grain weight by number of total Inflorescence per plot, or in case of 5 inflorescence, by weight by the total grain number by 5.
(324) Plant Height—
(325) Plants were characterized for height during growing period at 6 time points. In each measure, plants were measured for their height using a measuring tape. Height was measured from ground level to top of the longest leaf.
(326) Inflorescence Weight (Gr.)—
(327) At the end of the experiment (when Inflorescence were dry) five Inflorescence from plots within blocks A-C were collected. The Inflorescence were weighted (gr.).
(328) SPAD—
(329) Chlorophyll content was determined using a Minolta SPAD 502 chlorophyll meter and measurement was performed at time of flowering. SPAD meter readings were done on young fully developed leaf. Three measurements per leaf were taken per plot.
(330) Vegetative Dry Weight and Inflorescence—
(331) At the end of the experiment (when Inflorescence were dry) all Inflorescence and vegetative material from plots within blocks A-C were collected. The biomass and Inflorescence weight of each plot was separated, measured and divided by the number of Inflorescence.
(332) Dry weight=total weight of the vegetative portion above ground (excluding roots) after drying at 70° C. in oven for 48 hours;
(333) Harvest Index (for Sorghum)—
(334) The harvest index is calculated using Formula VIII.
Harvest Index=Average grain dry weight per Inflorescence/(Average vegetative dry weight per Inflorescence+Average Inflorescence dry weight) Formula VIII:
Experimental Results
(335) 16 different sorghum varieties were grown and characterized for 7 parameters: “Seed/plant normal”=total seed weight per plant under normal conditions; “DW-5 Inflorescence Normal”—dry weight of five complete inflorescences (seeds and rachis) under normal conditions; “DW all Normal”=dry weight of per plot under normal conditions; “Weight of seeds (5 heads) gr Normal”=dry weight of seeds from five inflorescences under normal conditions; “Plant Height 4 Drought”=plant height in the 4.sup.th time point under drought conditions; “Plant Height 4 Normal”=plant height in the 4.sup.th time point under normal conditions; “Plant Height 6 Normal”=plant height in the 6.sup.th time point under normal conditions. The average for each of the measured parameter was calculated using the JMP software and values are summarized in Table 11 below. Subsequent correlation analysis between the various transcriptom sets (Table 10) and the average parameters, was conducted (Tables 12). Results were then integrated to the database.
(336) TABLE-US-00011 TABLE 11 Measured parameters in Sorghum accessions Weight of DW-5 seeds (5 Plant Plant Plant Seed Seed/Plant Inflorescence DW all heads) gr Height 4 Height 4 Height 6 ID Normal Normal Normal Normal Drought Normal Normal 20 0.031 0.039 5.408 0.237 38.000 37.313 37.313 21 0.026 0.062 3.091 0.225 30.833 22 0.019 0.033 21.341 0.142 110.833 47.750 47.750 24 0.038 0.030 5.329 0.352 42.833 40.083 40.083 25 0.027 0.074 20.600 0.161 49.583 45.938 45.938 26 0.046 0.049 21.685 0.332 49.750 41.438 41.438 27 0.048 0.046 11.205 0.317 46.875 44.875 44.875 28 0.031 0.033 9.045 0.222 41.917 42.125 42.125 29 0.040 0.048 10.293 0.283 46.125 41.000 41.000 30 0.038 0.038 9.139 0.300 50.167 42.500 42.063 31 0.032 0.023 9.549 0.227 43.583 41.875 41.875 32 0.033 0.039 10.424 0.277 50.833 43.375 43.375 33 0.033 0.049 10.150 0.353 42.417 39.813 39.813 34 0.052 0.050 8.783 0.351 45.500 40.625 40.625 35 0.036 0.038 10.259 0.270 50.375 44.375 44.375 36 0.038 0.042 12.005 0.299 48.833 43.250 43.250 37 0.042 0.063 15.681 0.263 49.833 41.000 41.000 Table 11: Provided are the values of each of the parameters (as described above) measured in Sorghum accessions (Seed ID) under normal and drought conditions. Growth conditions are specified in the experimental procedure section.
(337) TABLE-US-00012 TABLE 12 Correlation between the expression level of homologues of selected genes in various tissues and the phenotypic performance under normal or abiotic stress conditions across Sorghum accessions Gene Name Exp. Set Corr. Vec. R BDL102_H47 flower DW all Normal −0.721 BDL102_H47 flower FW-Inflorescence/Plant 0.717 Normal BDL102_H47 flower Plant Height 4 Normal −0.722 BDL102_H47 flower Plant Height 6 Normal −0.718 BDL83_H57 flag leaf DW-5 Inflorescence −0.712 Normal BDL83_H57 flag leaf Seed/Plant Normal −0.708 BDL83_H57 flower Plant Height 4 Normal 0.858 BDL83_H57 flower Plant Height 6 Normal 0.853 BDL83_H58 flag leaf Plant Height 4 Drought 0.763 BDL83_H58 flower Seed/Plant Low-N 0.759 BDL83_H58 flower Weight of seeds (5 heads) −0.707 gr Normal BDL83_H58 Flower meristem Leaf_No 2 Normal 0.802 BDL88_H13 Flag leaf Leaf_No 3 Drought −0.893 BDL88_H13 Flag leaf Leaf_TP 1 Drought −0.929 BDL88_H13 Flag leaf Plant Height 2 Drought −0.796 BDL88_H13 Flag leaf Plant Height 3 Drought −0.837 BDL88_H13 Flag leaf Seed/Plant_Normal 0.73 Table 12. Provided are the correlations (R) between the expression levels of homologues of selected genes in tissues (Flag leaf or Flower meristem; Expression sets) and the phenotypic performance in various yield, biomass, growth rate and/or vigor components [Correlation (Corr.) vector (Vec.)] under abiotic stress conditions (drought) or normal conditions across Sorghum accessions.
(338) Sorghum Vigor Related Parameters Under 100 mM NaCl and Low Temperature (8-10° C.)—
(339) Ten Sorghum varieties were grown in 3 repetitive plots, each containing 17 plants, at a net house under semi-hydroponics conditions. Briefly, the growing protocol was as follows: Sorghum seeds were sown in trays filled with a mix of vermiculite and peat in a 1:1 ratio. Following germination, the trays were transferred to the high salinity solution (100 mM NaCl in addition to the Full Hogland solution), low temperature (8-10° C. in the presence of Full Hogland solution) or at Normal growth solution [Full Hogland solution at 20-24° C.].
(340) Full Hogland solution consists of: KNO.sub.3—0.808 grams/liter, MgSO.sub.4—0.12 grams/liter, KH2 PO.sub.4—0.172 grams/liter and 0.01% (volume/volume) of ‘Super coratin’ micro elements (Iron-EDDHA [ethylenediamine-N,N′-bis(2-hydroxyphenylacetic acid)]—40.5 grams/liter; Mn—20.2 grams/liter; Zn 10.1 grams/liter; Co 1.5 grams/liter; and Mo 1.1 grams/liter), solution's pH should be 6.5-6.8].
(341) RNA Extraction—
(342) All 10 selected Sorghum varieties were sampled per each treatment. Two tissues [leaves and roots] growing at 100 mM NaCl, low temperature (8-10° C.) or under Normal conditions (full Hogland at a temperature between 20-24° C.) were sampled and RNA was extracted using TRIzol Reagent from Invitrogen [Hypertext Transfer Protocol://World Wide Web(dot)invitrogen(dot)com/content(dot)cfm?pageid=469].
Experimental Results
(343) 10 different Sorghum varieties were grown and characterized for the following parameters: “Leaf number Normal”=leaf number per plant under normal conditions (average of five plants); “Plant Height Normal”=plant height under normal conditions (average of five plants); “Root DW 100 mM NaCl”—root dry weight per plant under salinity conditions (average of five plants); The average for each of the measured parameter was calculated using the JMP software and values are summarized in Table 13 below. Subsequent correlation analysis between the various transcriptom sets and the average parameters was conducted (Table 14). Results were then integrated to the database.
(344) TABLE-US-00013 TABLE 13 Measured parameters in Sorghum accessions Plant Leaf DW Seed Height T1 Plant Height Plant Height number Leaf number Root/Plant ID NaCl T1 + 8 NaCl T1 + 15 NaCl T1 NaCl T1 + 8 Normal NaCl 20 7.900 14.200 21.800 3.000 4.167 0.05 22 9.500 16.267 23.167 3.133 4.500 0.10447479 26 10.933 20.367 30.367 3.400 4.800 0.12370635 27 7.933 13.333 22.833 3.067 4.600 0.06880519 28 9.700 15.900 23.700 3.333 4.533 0.07568254 29 8.533 16.533 23.300 3.067 4.967 0.07517045 30 8.900 15.467 22.467 3.067 4.600 0.13539542 31 10.367 18.933 26.833 3.267 4.933 0.09546434 34 7.000 13.680 20.280 3.000 4.500 0.16491667 37 7.833 15.767 23.567 3.067 4.567 0.13888278 Table 13: Provided are the measured parameters of the Sorghum Accessions under normal conditions or high salt conditions at the indicated time points. T1 (first day of measurements); T1 + 8 (8 days following the first day); T1 + 15 (15 days following the first day). The exact conditions are detailed above in the experiment description section.
(345) TABLE-US-00014 TABLE 14 Correlation between the expression level of homologues of selected genes in roots and the phenotypic performance under normal or abiotic stress conditions across Sorghum accessions Gene Name Exp. Set Corr. Vec. R BDL83_H58 root DW Root/Plant NaCl 0.897 BDL83_H58 root Leaf number T1 NaCl −0.75 BDL83_H58 root Plant Height T1 NaCl −0.82 BDL83_H58 root Plant Height T1 + 8 NaCl −0.9 BDL83_H58 root Plant Height T1 + 15 NaCl −0.77 BDL83_H58 root Leaf number T1 Normal 0.779 Table 14. Provided are the correlations (R) between the expression levels of homologues of selected genes in roots [Expression (Exp.) sets] and the phenotypic performance [yield, biomass, growth rate and/or vigor components (Correlation vector)] at the indicated time points under abiotic stress conditions (salinity) or normal conditions across Sorghum accessions. Corr. Vec. = correlation vector as described hereinabove (Table 13). T1 (first day of measurements); T1 + 8 (8 days following the first day); T1 + 15 (15 days following the first day).
Example 5
Identification of Genes which Increase Yield, Biomass, Growth Rate, Vigor, Oil Content, Abiotic Stress Tolerance of Plants and Nitrogen Use Efficieny
(346) Based on the above described bioinformatics and experimental tools, the present inventors have identified 105 genes (89 distinct gene families) which have a major impact on yield, seed yield, oil yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance, and/or nitrogen use efficiency when expression thereof is increased in plants. The identified genes, their curated polynucleotide and polypeptide sequences, as well as their updated sequences according to Genbank database are summarized in Table 15, hereinbelow.
(347) TABLE-US-00015 TABLE 15 Identified polynucleotides which affect plant yield, seed yield, oil yield, oil content, biomass, growth rate, vigor, abiotic stress tolerance and/or nitrogen use efficiency of a plant Serial Gene Polynucleotide Polypeptide No Name Cluster Name Organism SEQ ID NO: SEQ ID NO: 1 BDL47 arabidopsis|gb165|AT4 arabidopsis 1 106 G38660 2 BDL47 arabidopsis|gb165|AT4 arabidopsis 1 194 G38660 3 BDL48 arabidopsis|gb165|AT2 arabidopsis 2 107 G25270 4 BDL62 arabidopsis|gb165|AT1 arabidopsis 3 108 G64390 5 BDL75 arabidopsis|gb165|AT3 arabidopsis 4 109 G55420 6 BDL79 arabidopsis|gb165|AT3 arabidopsis 5 110 G20010 7 BDL81 arabidopsis|gb165|AT1 arabidopsis 6 111 G13030 8 BDL83 arabidopsis|gb165|AT1 arabidopsis 7 112 G43670 9 BDL117 arabidopsis|gb165|AT4 arabidopsis 8 113 G33240 10 BDL118 arabidopsis|gb165|AT2 arabidopsis 9 114 G22125 11 BDL126 arabidopsis|gb165|AT3 arabidopsis 10 115 G59100 12 BDL138 arabidopsis|gb165|AT3 arabidopsis 11 116 G12180 13 BDL140 arabidopsis|gb165|AT5 arabidopsis 12 117 G02640 14 BDL147 arabidopsis|gb165|AT2 arabidopsis 13 118 G47930 15 BDL149 arabidopsis|gb165|AT5 arabidopsis 14 119 G15750 16 BDL152 arabidopsis|gb165|AT1 arabidopsis 15 120 G70420 17 BDL153 arabidopsis|gb165|AT5 arabidopsis 16 121 G47690 18 BDL154 arabidopsis|gb165|AT1 arabidopsis 17 122 G62940 19 BDL155 arabidopsis|gb165|AT4 arabidopsis 18 123 G11630 20 BDL156 arabidopsis|gb165|AT1 arabidopsis 19 124 G01570 21 BDL157 arabidopsis|gb165|AT1 arabidopsis 20 125 G14560 22 BDL158 arabidopsis|gb165|AT1 arabidopsis 21 126 G22030 23 BDL160 arabidopsis|gb165|AT1 arabidopsis 22 127 G28960 24 BDL162 arabidopsis|gb165|AT1 arabidopsis 23 128 G49360 25 BDL163 arabidopsis|gb165|AT1 arabidopsis 24 129 G51430 26 BDL165 arabidopsis|gb165|AT1 arabidopsis 25 130 G65010 27 BDL167 arabidopsis|gb165|AT1 arabidopsis 26 131 G79630 28 BDL168 arabidopsis|gb165|AT2 arabidopsis 27 132 G01910 29 BDL169 arabidopsis|gb165|AT2 arabidopsis 28 133 G19120 30 BDL171 arabidopsis|gb165|AT2 arabidopsis 29 134 G32320 31 BDL173 arabidopsis|gb165|AT2 arabidopsis 30 135 G36720 32 BDL174 arabidopsis|gb165|AT2 arabidopsis 31 136 G39580 33 BDL176 arabidopsis|gb165|AT3 arabidopsis 32 137 G10160 34 BDL177 arabidopsis|gb165|AT3 arabidopsis 33 138 G18610 35 BDL181 arabidopsis|gb165|AT4 arabidopsis 34 139 G12640 36 BDL182 arabidopsis|gb165|AT4 arabidopsis 35 140 G14605 37 BDL183 arabidopsis|gb165|AT4 arabidopsis 36 141 G15620 38 BDL186 arabidopsis|gb165|AT4 arabidopsis 37 142 G32560 39 BDL187 arabidopsis|gb165|AT4 arabidopsis 38 143 G35130 40 BDL188 arabidopsis|gb165|AT4 arabidopsis 39 144 G35560 41 BDL189 arabidopsis|gb165|AT5 arabidopsis 40 145 G05560 42 BDL190 arabidopsis|gb165|AT5 arabidopsis 41 146 G06690 43 BDL192 arabidopsis|gb165|AT5 arabidopsis 42 147 G09880 44 BDL193 arabidopsis|gb165|AT5 arabidopsis 43 148 G12950 45 BDL194 arabidopsis|gb165|AT5 arabidopsis 44 149 G16540 46 BDL196 arabidopsis|gb165|AT5 arabidopsis 45 150 G38180 47 BDL197 arabidopsis|gb165|AT5 arabidopsis 46 151 G39240 48 BDL200 arabidopsis|gb165|AT5 arabidopsis 47 152 G51470 49 BDL201 arabidopsis|gb165|AT5 arabidopsis 48 153 G58250 50 BDL203 arabidopsis|gb165|AT5 arabidopsis 49 154 G66440 51 BDL219 arabidopsis|gb165|AT1 arabidopsis 50 155 G36095 52 BDL220 arabidopsis|gb165|AT1 arabidopsis 51 156 G61170 53 BDL221 arabidopsis|gb165|AT1 arabidopsis 52 157 G75860 54 BDL222 arabidopsis|gb165|AT1 arabidopsis 53 158 G77885 55 BDL223 arabidopsis|gb165|AT2 arabidopsis 54 159 G37975 56 BDL229 arabidopsis|gb165|AT5 arabidopsis 55 160 G53830 57 BDL230 arabidopsis|gb154|ATH arabidopsis 56 161 PEARA 58 BDL231 arabidopsis|gb165|AT1 arabidopsis 57 162 G16350 59 BDL235 arabidopsis|gb165|AT2 arabidopsis 58 163 G38970 60 BDL242 arabidopsis|gb165|AT3 arabidopsis 59 164 G22740 61 BDL243 arabidopsis|gb165|AT3 arabidopsis 60 165 G31430 62 BDL245 arabidopsis|gb165|AT4 arabidopsis 61 166 G12690 63 BDL247 arabidopsis|gb165|AT4 arabidopsis 62 167 G29510 64 BDL248 arabidopsis|gb165|AT4 arabidopsis 63 168 G37360 65 BDL250 arabidopsis|gb165|AT4 arabidopsis 64 169 G37400 66 BDL49 arabidopsis|gb165|AT3 arabidopsis 65 170 G06180 67 BDL58 arabidopsis|gb165|AT1 arabidopsis 66 171 G22160 68 BDL63 arabidopsis|gb165|AT2 arabidopsis 67 172 G40550 69 BDL64 arabidopsis|gb165|AT5 arabidopsis 68 173 G38020 70 BDL70 cotton|gb164|AF150730 cotton 69 174 71 BDL85 arabidopsis|gb165|AT1 arabidopsis 70 175 G05340 72 BDL88 rice|gb157.2|AA754446 rice 71 176 73 BDL90 rice|gb154|AK102950 rice 72 74 BDL94 rice|gb157.2|BE228242 rice 73 177 75 BDL102 maize|gb164|AI600933 maize 74 178 76 BDL224 arabidopsis|gb165|AT4 arabidopsis 75 179 G29780 77 BDL225 arabidopsis|gb165|AT5 arabidopsis 76 180 G39670 78 BDL226 arabidopsis|gb165|AT5 arabidopsis 77 181 G65470 79 BDL227 arabidopsis|gb165|AT3 arabidopsis 78 182 G56410 80 BDL228 castorbean|gb160|EE25 castorbean 79 183 6201 81 BDL232 arabidopsis|gb165|AT1 arabidopsis 80 184 G56100 82 BDL233 arabidopsis|gb165|AT1 arabidopsis 81 185 G66360 83 BDL234 arabidopsis|gb165|AT2 arabidopsis 82 186 G05400 84 BDL237 arabidopsis|gb165|AT2 arabidopsis 83 187 G45510 85 BDL238 arabidopsis|gb165|AT3 arabidopsis 84 188 G04540 86 BDL240 arabidopsis|gb165|AT3 arabidopsis 85 189 G18480 87 BDL241 arabidopsis|gb165|AT3 arabidopsis 86 190 G20020 88 BDL249 arabidopsis|gb165|AT4 arabidopsis 87 191 G37370 89 BDL251 arabidopsis|gb165|AT5 arabidopsis 88 192 G08250 90 BDL252 arabidopsis|gb165|AT5 arabidopsis 89 193 G18650 91 BDL79 arabidopsis|gb165|AT3 arabidopsis 90 110 G20010 92 BDL126 arabidopsis|gb165|AT3 arabidopsis 91 115 G59100 93 BDL153 arabidopsis|gb165|AT5 arabidopsis 92 195 G47690 94 BDL156 arabidopsis|gb165|AT1 arabidopsis 93 124 G01570 95 BDL167 arabidopsis|gb165|AT1 arabidopsis 94 196 G79630 96 BDL169 arabidopsis|gb165|AT2 arabidopsis 95 197 G19120 97 BDL171 arabidopsis|gb165|AT2 arabidopsis 96 134 G32320 98 BDL174 arabidopsis|gb165|AT2 arabidopsis 97 198 G39580 99 BDL187 arabidopsis|gb165|AT4 arabidopsis 98 143 G35130 100 BDL189 arabidopsis|gb165|AT5 arabidopsis 99 199 G05560 101 BDL197 arabidopsis|gb165|AT5 arabidopsis 100 200 G39240 102 BDL200 arabidopsis|gb165|AT5 arabidopsis 101 152 G51470 103 BDL231 arabidopsis|gb165|AT1 arabidopsis 102 162 G16350 104 BDL248 arabidopsis|gb165|AT4 arabidopsis 103 168 G37360 105 BDL70 cotton|gb164|AF150730 cotton 104 201 106 BDL238 arabidopsis|gb165|AT3 arabidopsis 105 202 G04540 Table 15: Provided are the identified genes, their annotation, organism and polynucleotide and polypeptide sequence identifiers.
Example 6
Identification of Homologous Sequences that Increase Seed Yield, Oil Yield, Growth Rate, Oil Content, Biomass, Vigor, ABST Resistance and/or Nue of a Plant
(348) The concepts of orthology and paralogy have recently been applied to functional characterizations and classifications on the scale of whole-genome comparisons. Orthologs and paralogs constitute two major types of homologs: The first evolved from a common ancestor by specialization, and the latter are related by duplication events. It is assumed that paralogs arising from ancient duplication events are likely to have diverged in function while true orthologs are more likely to retain identical function over evolutionary time.
(349) To identify putative orthologs of the genes affecting plant yield, oil yield, oil content, seed yield, growth rate, vigor, biomass, abiotic stress tolerance and/or nitrogen use efficiency, all sequences were aligned using the BLAST (Basic Local Alignment Search Tool). Sequences sufficiently similar were tentatively grouped. These putative orthologs were further organized under a Phylogram—a branching diagram (tree) assumed to be a representation of the evolutionary relationships among the biological taxa. Putative ortholog groups were analyzed as to their agreement with the phylogram and in cases of disagreements these ortholog groups were broken accordingly.
(350) Expression data was analyzed and the EST libraries were classified using a fixed vocabulary of custom terms such as developmental stages (e.g., genes showing similar expression profile through development with up regulation at specific stage, such as at the seed filling stage) and/or plant organ (e.g., genes showing similar expression profile across their organs with up regulation at specific organs such as seed). The annotations from all the ESTs clustered to a gene were analyzed statistically by comparing their frequency in the cluster versus their abundance in the database, allowing the construction of a numeric and graphic expression profile of that gene, which is termed “digital expression”. The rationale of using these two complementary methods with methods of phenotypic association studies of QTLs, SNPs and phenotype expression correlation is based on the assumption that true orthologs are likely to retain identical function over evolutionary time. These methods provide different sets of indications on function similarities between two homologous genes, similarities in the sequence level—identical amino acids in the protein domains and similarity in expression profiles.
(351) Methods for searching and identifying homologues of yield and improved agronomic traits such as ABS tolerance and NUE related polypeptides or polynucleotides are well within the realm of the skilled artisan. The search and identification of homologous genes involves the screening of sequence information available, for example, in public databases such as the DNA Database of Japan (DDBJ), Genbank, and the European Molecular Biology Laboratory Nucleic Acid Sequence Database (EMBL) or versions thereof or the MIPS database. A number of different search algorithms have been developed, including but not limited to the suite of programs referred to as BLAST programs. There are five implementations of BLAST, three designed for nucleotide sequence queries (BLASTN, BLASTX, and TBLASTX) and two designed for protein sequence queries (BLASTP and TBLASTN) (Coulson, Trends in Biotechnology: 76-80, 1994; Birren et al., Genome Analysis, I: 543, 1997). Such methods involve alignment and comparison of sequences. The BLAST algorithm calculates percent sequence identity and performs a statistical analysis of the similarity between the two sequences. The software for performing BLAST analysis is publicly available through the National Centre for Biotechnology Information. Other such software or algorithms are GAP, BESTFIT, FASTA and TFASTA. GAP uses the algorithm of Needleman and Wunsch (J. Mol. Biol. 48: 443-453, 1970) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps.
(352) The homologous genes may belong to the same gene family. The analysis of a gene family may be carried out using sequence similarity analysis. To perform this analysis one may use standard programs for multiple alignments e.g. Clustal W. A neighbour-joining tree of the proteins homologous to the genes in this invention may be used to provide an overview of structural and ancestral relationships. Sequence identity may be calculated using an alignment program as described above. It is expected that other plants will carry a similar functional gene (ortholog) or a family of similar genes and those genes will provide the same preferred phenotype as the genes presented here. Advantageously, these family members may be useful in the methods of the invention. Example of other plants are included here but not limited to, barley (Hordeum vulgare), Arabidopsis (Arabidopsis thaliana), maize (Zea mays), cotton (Gossypium), Oilseed rape (Brassica napus), Rice (Oryza sativa), Sugar cane (Saccharum officinarum), Sorghum (Sorghum bicolor), Soybean (Glycine max), Sunflower (Helianthus annuus), Tomato (Lycopersicon esculentum), Wheat (Triticum aestivum).
(353) The above-mentioned analyses for sequence homology can be carried out on a full-length sequence, but may also be based on a comparison of certain regions such as conserved domains. The identification of such domains, would also be well within the realm of the person skilled in the art and would involve, for example, a computer readable format of the nucleic acids of the present invention, the use of alignment software programs and the use of publicly available information on protein domains, conserved motifs and boxes. This information is available in the PRODOM (Hypertext Transfer Protocol://World Wide Web(dot)biochem(dot)ucl(dot)ac(dot) uk/bsm/dbbrowser/protocol/prodomqry(dot)html), PIR (Hypertext Transfer Protocol://pir(dot)Georgetown(dot)edu/) or Pfam (Hypertext Transfer Protocol://World Wide Web(dot)sanger(dot)ac(dot)uk/Software/Pfam/) database. Sequence analysis programs designed for motif searching may be used for identification of fragments, regions and conserved domains as mentioned above. Preferred computer programs include, but are not limited to, MEME, SIGNALSCAN, and GENESCAN.
(354) A person skilled in the art may use the homologous sequences provided herein to find similar sequences in other species and other organisms. Homologues of a protein encompass, peptides, oligopeptides, polypeptides, proteins and enzymes having amino acid substitutions, deletions and/or insertions relative to the unmodified protein in question and having similar biological and functional activity as the unmodified protein from which they are derived. To produce such homologues, amino acids of the protein may be replaced by other amino acids having similar properties (conservative changes, such as similar hydrophobicity, hydrophilicity, antigenicity, propensity to form or break a-helical structures or 3-sheet structures). Conservative substitution tables are well known in the art (see for example Creighton (1984) Proteins. W.H. Freeman and Company). Homologues of a nucleic acid encompass nucleic acids having nucleotide substitutions, deletions and/or insertions relative to the unmodified nucleic acid in question and having similar biological and functional activity as the unmodified nucleic acid from which they are derived.
(355) Polynucleotides and polypeptides with significant homology to the identified genes described in Table 15 above have been identified from the databases using BLAST software using the Blastp and tBlastn algorithms. The query nucleotide sequences were SEQ ID NOs: 1-106 and the identified homologues are provided in Table 16, below. These genes are expected to increase plant yield, seed yield, oil yield, oil content, growth rate, biomass, vigor, ABST and/or NUE of a plant.
(356) TABLE-US-00016 TABLE 16 Homologous polynucleotides and polypeptides Polynuc. Polypep. Homol. to SEQ ID SEQ ID SEQ ID % Global NO: Gene Name Organism/Cluster name NO: NO: identity Algor. 203 BDL47_H0 radish|gb164|EW717854 524 194 85.15 tblastn 204 BDL48_H0 radish|gb164|EW735131 525 107 82.7 blastp 205 BDL62_H0 canola|gb161|CD835773 526 108 94.5 blastp 206 BDL62_H1 radish|gb164|EV543949 527 108 94.36 tblastn 207 BDL75_H0 canola|gb161|EE485008 528 109 84.1 blastp 208 BDL83_H0 apple|gb171|CN494551 529 112 86.8 blastp 209 BDL83_H1 aquilegia|gb157.3|DR916286 530 112 85.9 blastp 210 BDL83_H2 artemisia|gb164|EY037407 531 112 86.2 blastp 211 BDL83_H3 b_juncea|gb164|EVGN00808312601672 532 112 91.7 blastp 212 BDL83_H4 b_oleracea|gb161|AM387331 533 112 94.7 blastp 213 BDL83_H5 b_rapa|gb162|AY161288 534 112 94.4 blastp 214 BDL83_H6 banana|gb167|AF130251 535 112 85 blastp 215 BDL83_H7 barley|gb157.3|BE420760 536 112 83.4 blastp 216 BDL83_H8 barley|gb157.3|BG365169 537 112 82.1 blastp 217 BDL83_H9 bean|gb167|CA896765 538 112 87.1 blastp 218 BDL83_H10 bean|gb167|CB539815 539 112 87.4 blastp 219 BDL83_H11 beet|gb162|BE590341 540 112 85.9 blastp 220 BDL83_H12 brachypodium|gb169|BE213261 541 112 85.4 blastp 221 BDL83_H13 brachypodium|gb169|BE419504 542 112 82.7 blastp 222 BDL83_H14 canola|gb161|BNU20179 543 112 94.13 tblastn 223 BDL83_H15 canola|gb161|CD818253 544 112 94.4 blastp 224 BDL83_H16 cassava|gb164|DV445162 545 112 88 blastp 225 BDL83_H17 castorbean|gb160|EE256791 546 112 87.4 blastp 226 BDL83_H18 centaurea|gb166|EH734375 547 112 87.7 blastp 227 BDL83_H19 cichorium|gb171|EH680019 548 112 88 blastp 228 BDL83_H20 citrus|gb166|CV885954 549 112 89.15 tblastn 229 BDL83_H21 coffea|gb157.2|DV685589 550 112 87.1 tblastn 230 BDL83_H22 cotton|gb164|AI725778 551 112 86.8 blastp 231 BDL83_H23 cotton|gb164|CA993334 552 112 88.3 blastp 232 BDL83_H24 cowpea|gb166|FF537383 553 112 87.7 blastp 233 BDL83_H25 cynara|gb167|GE584395 554 112 84.16 tblastn 234 BDL83_H26 dandelion|gb161|DY806919 555 112 87.1 blastp 235 BDL83_H27 eucalyptus|gb166|CB967649 556 112 88 blastp 236 BDL83_H28 fescue|gb161|DT696580 557 112 82.8 blastp 237 BDL83_H29 ginger|gb164|DY345757 558 112 86.5 blastp 238 BDL83_H30 grape|gb160|CD008185 559 112 86.8 blastp 239 BDL83_H31 iceplant|gb164|CA833792 560 112 87.1 blastp 240 BDL83_H32 ipomoea|gb157.2|CJ755528 561 112 86.8 blastp 241 BDL83_H33 lettuce|gb157.2|AF162206 562 112 87.7 blastp 242 BDL83_H34 leymus|gb166|EG375854 563 112 84 blastp 243 BDL83_H35 lovegrass|gb167|DN481848 564 112 82.8 blastp 244 BDL83_H36 maize|gb170|BG355384 565 112 83 blastp 245 BDL83_H37 maize|gb170|LLAI603703 566 112 83.5 blastp 246 BDL83_H38 medicago|gb157.2|AL386990 567 112 80.5 blastp 247 BDL83_H39 medicago|gb157.2|AW695293 568 112 84.8 blastp 248 BDL83_H40 papaya|gb165|EX248440 569 112 84.5 blastp 249 BDL83_H41 peanut|gb171|EE126296 570 112 86.8 blastp 250 BDL83_H42 peanut|gb171|ES752783 571 112 85.9 blastp 251 BDL83_H43 pepper|gb171|CO907209 572 112 86.8 blastp 252 BDL83_H44 pepper|gb171|GD064098 573 112 87.4 blastp 253 BDL83_H45 physcomitrella|gb157|BJ157670 574 112 82.4 blastp 254 BDL83_H46 physcomitrella|gb157|BJ171093 575 112 83.63 tblastn 255 BDL83_H47 pine|gb157.2|AW010114 576 112 82.7 blastp 256 BDL83_H48 pine|gb157.2|CO169305 577 112 86.2 blastp 257 BDL83_H49 poplar|gb170|BI068614 578 112 88 blastp 258 BDL83_H50 poplar|gb170|BU878945 579 112 86.05 tblastn 259 BDL83_H51 potato|gb157.2|BF053889 580 112 86.2 blastp 260 BDL83_H52 prunus|gb167|DW341878 581 112 88.9 blastp 261 BDL83_H53 radish|gb164|EV537348 582 112 95 blastp 262 BDL83_H54 radish|gb164|EV565372 583 112 94.7 blastp 263 BDL83_H55 rice|gb170|OS01G64660 584 112 84.5 blastp 264 BDL83_H56 rice|gb170|OS05G36270 585 112 83.3 blastp 265 BDL83_H57 sorghum|gb161.crp|AW566083 586 112 84.8 blastp 266 BDL83_H58 sorghum|gb161.crp|AW671091 587 112 83.6 blastp 267 BDL83_H59 soybean|gb168|AL388391 588 112 81.3 blastp 268 BDL83_H60 soybean|gb168|BE941320 589 112 86.5 blastp 269 BDL83_H61 soybean|gb168|BF636881 590 112 87.1 blastp 270 BDL83_H62 soybean|gb168|CD394856 591 112 86.2 blastp 271 BDL83_H63 spikemoss|gb165|FE443631 592 112 83.9 blastp 272 BDL83_H64 spruce|gb162|CO227794 593 112 87.4 blastp 273 BDL83_H65 spruce|gb162|CO238226 594 112 83.3 blastp 274 BDL83_H66 spurge|gb161|DV121804 595 112 87.4 blastp 275 BDL83_H67 strawberry|gb164|DY671211 596 112 87.4 blastp 276 BDL83_H68 sugarcane|gb157.3|BQ533620 597 112 85.4 blastp 277 BDL83_H69 sunflower|gb162|BU672090 598 112 84.2 blastp 278 BDL83_H70 sunflower|gb162|CD847711 599 112 87.7 blastp 279 BDL83_H71 switchgrass|gb167|DN143181 600 112 84.8 blastp 280 BDL83_H72 switchgrass|gb167|DN148413 601 112 82.4 tblastn 281 BDL83_H73 tomato|gb164|AI486777 602 112 88.3 blastp 282 BDL83_H74 tomato|gb164|BG123415 603 112 85.9 blastp 283 BDL83_H75 triphysaria|gb164|EY166297 604 112 85.9 blastp 284 BDL83_H76 triphysaria|gb164|EY169717 605 112 87.4 blastp 285 BDL83_H77 wheat|gb164|BE213261 606 112 82.8 blastp 286 BDL83_H78 wheat|gb164|BE418868 607 112 82.8 blastp 287 BDL83_H79 wheat|gb164|BE500460 608 112 82.8 blastp 288 BDL118_H0 castorbean|gb160|MDL29877M000477 609 114 81.4 blastp 289 BDL118_H1 poplar|gb170|AI164922 610 114 81.3 blastp 290 BDL118_H2 poplar|gb170|BI138300 611 114 82 blastp 291 BDL118_H3 soybean|gb168|BE658051 612 114 80.1 blastp 292 BDL118_H4 soybean|gb168|CB540069 613 114 80 blastp 293 BDL138_H0 canola|gb161|CD817345 614 116 92.5 blastp 294 BDL138_H1 radish|gb164|EV536083 615 116 91.8 blastp 295 BDL138_H2 radish|gb164|EW725583 616 116 91.1 blastp 296 BDL147_H0 thellungiella|gb167|BY818222 617 118 81.6 blastp 297 BDL149_H0 b_rapa|gb162|DY009670 618 119 87.9 blastp 298 BDL149_H1 canola|gb161|CD818601 619 119 88.5 blastp 299 BDL149_H2 cowpea|gb166|FF400239 620 119 82.4 blastp 300 BDL154_H0 b_rapa|gb162|EX046206 621 122 90.77 tblastn 301 BDL154_H1 canola|gb161|CD841052 622 122 92.25 tblastn 302 BDL155_H0 arabidopsis|gb165|AT1G24240 623 123 92.9 blastp 303 BDL155_H1 arabidopsis|gb165|AT5G11750 624 123 91.7 blastp 304 BDL155_H2 canola|gb161|EE462449 625 123 81.3 blastp 305 BDL155_H3 radish|gb164|EV545009 626 123 80.34 tblastn 306 BDL155_H4 radish|gb164|EV569478 627 123 80.4 blastp 307 BDL158_H0 radish|gb164|EW715818 628 126 88.46 tblastn 308 BDL160_H0 canola|gb161|EE418738 629 127 83.9 blastp 309 BDL160_H1 radish|gb164|EV545765 630 127 85.1 blastp 310 BDL167_H0 radish|gb164|EV535056 631 196 82.7 tblastn 311 BDL168_H0 radish|gb164|EV525399 632 132 90.5 blastp 312 BDL171_H0 arabidopsis|gb165|AT2G31580 633 134 84 blastp 313 BDL182_H0 canola|gb161|CX188804 634 140 87.5 blastp 314 BDL183_H0 arabidopsis|gb165|AT4G15630 635 141 81.6 blastp 315 BDL183_H1 b_rapa|gb162|EE526726 636 141 83.7 blastp 316 BDL183_H2 canola|gb161|CD811977 637 141 80 blastp 317 BDL183_H3 canola|gb161|CN735162 638 141 83.7 blastp 318 BDL183_H4 canola|gb161|CN828640 639 141 83.7 blastp 319 BDL183_H5 radish|gb164|EW722612 640 141 83.2 blastp 320 BDL183_H6 radish|gb164|EX753993 641 141 81.6 blastp 321 BDL183_H7 thellungiella|gb167|BY824379 642 141 80 blastp 322 BDL190_H0 b_oleracea|gb161|AM395197 643 146 84.49 tblastn 323 BDL190_H1 canola|gb161|EE407003 644 146 87.2 blastp 324 BDL190_H2 radish|gb164|EV547395 645 146 86.6 blastp 325 BDL190_H3 thellungiella|gb167|BY827749 646 146 89.8 blastp 326 BDL192_H0 canola|gb161|CD827541 647 147 80.37 tblastn 327 BDL201_H0 b_juncea|gb164|EVGN00584109703185 648 153 81.8 blastp 328 BDL201_H1 b_oleracea|gb161|DY014784 649 153 80.4 blastp 329 BDL201_H2 b_oleracea|gb161|DY015288 650 153 82.2 blastp 330 BDL201_H3 b_rapa|gb162|BQ791239 651 153 83.2 blastp 331 BDL201_H4 canola|gb161|BQ704590 652 153 81.7 blastp 332 BDL201_H5 canola|gb161|CD822183 653 153 80.8 blastp 333 BDL201_H6 canola|gb161|CD838597 654 153 81.8 blastp 334 BDL201_H7 radish|gb164|EV527287 655 153 81.6 blastp 335 BDL201_H8 radish|gb164|EV534907 656 153 81.8 blastp 336 BDL201_H9 radish|gb164|EV543313 657 153 81.3 blastp 337 BDL201_H10 radish|gb164|EV565783 658 153 81.9 blastp 338 BDL201_H11 thellungiella|gb167|BY814893 659 153 83.89 tblastn 339 BDL223_H0 arabidopsis|gb165|AT3G54080 660 159 82.05 tblastn 340 BDL223_H1 arabidopsis|gb165|AT3G54085 661 159 82.1 blastp 341 BDL223_H2 b_juncea|gb164|EVGN01441114591370 662 159 96.15 tblastn 342 BDL223_H3 b_juncea|gb164|EVGN05602102561055 663 159 85 blastp 343 BDL223_H4 b_oleracea|gb161|EE534959 664 159 96.2 blastp 344 BDL223_H5 b_oleracea|gb161|ES947677 665 159 94.9 blastp 345 BDL223_H6 b_rapa|gb162|EE527700 666 159 96.2 blastp 346 BDL223_H7 canola|gb161|CD812251 667 159 96.2 blastp 347 BDL223_H8 canola|gb161|CN734091 668 159 96.15 tblastn 348 BDL223_H9 canola|gb161|DY007214 669 159 96.15 tblastn 349 BDL223_H10 canola|gb161|EG019597 670 159 97.4 blastp 350 BDL223_H11 canola|gb161|ES992154 671 159 97.4 blastp 351 BDL223_H12 canola|gb161|EV087632 672 159 97.4 blastp 352 BDL223_H13 radish|gb164|EV524950 673 159 96.15 tblastn 353 BDL223_H14 radish|gb164|EY899056 674 159 96.2 blastp 354 BDL229_H0 b_rapa|gb162|EX066757 675 160 83.5 blastp 355 BDL229_H1 radish|gb164|EW725388 676 160 82.59 tblastn 356 BDL231_H0 arabidopsis|gb165|AT1G79470 677 162 84.5 blastp 357 BDL231_H1 canola|gb161|CD826885 678 162 84.7 blastp 358 BDL231_H2 canola|gb161|CD827559 679 162 95.42 tblastn 359 BDL242_H0 radish|gb164|EV539529 680 164 85.9 blastp 360 BDL247_H0 b_oleracea|gb161|DY026136 681 167 90.82 tblastn 361 BDL247_H1 b_rapa|gb162|AY185359 682 167 91.1 blastp 362 BDL247_H2 canola|gb161|CD838112 683 167 89.1 blastp 363 BDL247_H3 canola|gb161|EE455228 684 167 91.1 blastp 364 BDL247_H4 maize|gb170|LLEU940833 685 167 92.8 blastp 365 BDL247_H5 radish|gb164|EV566311 686 167 92.6 blastp 366 BDL247_H6 thellungiella|gb167|DN773706 687 167 93.08 tblastn 367 BDL248_H0 arabidopsis|gb165|AT4G37340 688 168 80.6 blastp 368 BDL70_H0 arabidopsis|gb165|AT4G25960 689 201 80.6 blastp 369 BDL70_H1 poplar|gb170|CN192983 690 201 82.8 blastp 370 BDL70_H2 soybean|gb168|BE822547 691 201 81.9 blastp 371 BDL70_H3 soybean|gb168|CD415929 692 201 81.8 blastp 372 BDL85_H0 b_oleracea|gb161|AM385973 693 175 83.3 blastp 373 BDL85_H1 b_rapa|gb162|CV544456 694 175 83.3 blastp 374 BDL85_H2 b_rapa|gb162|EE523194 695 175 84.7 blastp 375 BDL85_H3 canola|gb161|CD813661 696 175 83.3 blastp 376 BDL85_H4 canola|gb161|CD822271 697 175 84.7 blastp 377 BDL85_H5 canola|gb161|CX280350 698 175 83.3 blastp 378 BDL85_H6 radish|gb164|EV527759 699 175 82.2 blastp 379 BDL85_H7 thellungiella|gb167|DN779034 700 175 83.6 blastp 380 BDL88_H0 barley|gb157.3|BI950587 701 176 82.3 blastp 381 BDL88_H1 barley|gb157.3|BI955547 702 176 88.6 blastp 382 BDL88_H2 brachypodium|gb169|BE425841 703 176 82.7 blastp 383 BDL88_H3 brachypodium|gb169|BM817094 704 176 90 blastp 384 BDL88_H4 fescue|gb161|CK802755 705 176 88.7 blastp 385 BDL88_H5 leymus|gb166|EG378145 706 176 83.2 blastp 386 BDL88_H6 maize|gb170|AI622555 707 176 89.9 blastp 387 BDL88_H7 maize|gb170|AI712236 708 176 89.2 blastp 388 BDL88_H8 maize|gb170|AI855432 709 176 80.7 blastp 389 BDL88_H9 pseudoroegneria|gb167|FF342352 710 176 88 blastp 390 BDL88_H10 pseudoroegneria|gb167|FF342444 711 176 82.3 blastp 391 BDL88_H11 rice|gb170|OS08G43320 712 176 84.5 blastp 392 BDL88_H12 sorghum|gb161.crp|AW562977 713 176 81.4 blastp 393 BDL88_H13 sorghum|gb161.crp|BE129901 714 176 91.1 blastp 394 BDL88_H14 sugarcane|gb157.3|SCFMEMPRO 715 176 91.4 blastp 395 BDL88_H15 switchgrass|gb167|DN144780 716 176 91.7 blastp 396 BDL88_H16 switchgrass|gb167|FE629824 717 176 92 blastp 397 BDL88_H17 wheat|gb164|BE406463 718 176 88 blastp 398 BDL88_H18 wheat|gb164|BE425841 719 176 82 blastp 399 BDL88_H19 wheat|gb164|BF474328 720 176 81.2 blastp 400 BDL88_H20 wheat|gb164|BQ484144 721 176 87.7 blastp 401 BDL88_H21 wheat|gb164|CA599299 722 176 88 blastp 402 BDL94_H0 rice|gb170|OS01G09220 723 177 96.7 blastp 403 BDL102_H0 avocado|gb164|CK767108 724 178 80.69 tblastn 404 BDL102_H1 banana|gb167|FL650176 725 178 82.8 blastp 405 BDL102_H2 banana|gb167|FL657720 726 178 80.4 blastp 406 BDL102_H3 banana|gb167|FL658383 727 178 83.4 blastp 407 BDL102_H4 barley|gb157.3|BE215743 728 178 84.83 tblastn 408 BDL102_H5 barley|gb157.3|BE411917 729 178 85.2 blastp 409 BDL102_H6 barley|gb157.3|BF627967 730 178 82.76 tblastn 410 BDL102_H7 brachypodium|gb169|BE398478 731 178 83.7 blastp 411 BDL102_H8 brachypodium|gb169|BE399017 732 178 87.6 blastp 412 BDL102_H9 brachypodium|gb169|BE423566 733 178 85.5 blastp 413 BDL102_H10 cenchrus|gb166|EB655509 734 178 89 blastp 414 BDL102_H11 cichorium|gb171|DT211967 735 178 80.1 blastp 415 BDL102_H12 cichorium|gb171|EH700664 736 178 80 blastp 416 BDL102_H13 citrus|gb166|BE208879 737 178 80 blastp 417 BDL102_H14 clover|gb162|BB906663 738 178 80 blastp 418 BDL102_H15 cowpea|gb166|FC462243 739 178 80.7 blastp 419 BDL102_H16 dandelion|gb161|DY813750 740 178 80.7 blastp 420 BDL102_H17 fescue|gb161|DT685902 741 178 85.6 blastp 421 BDL102_H18 ginger|gb164|DY369602 742 178 80.7 blastp 422 BDL102_H19 ipomoea|gb157.2|BJ557023 743 178 80 tblastn 423 BDL102_H20 ipomoea|gb157.2|BU690707 744 178 80 tblastn 424 BDL102_H21 lettuce|gb157.2|DW044786 745 178 80 blastp 425 BDL102_H22 lettuce|gb157.2|DW050757 746 178 80 tblastn 426 BDL102_H23 lettuce|gb157.2|DW108809 747 178 81.38 tblastn 427 BDL102_H24 lettuce|gb157.2|DW108810 748 178 80 tblastn 428 BDL102_H25 liquorice|gb171|FS238664 749 178 80.7 blastp 429 BDL102_H26 liquorice|gb171|FS241892 750 178 80 tblastn 430 BDL102_H27 liriodendron|gb166|CK766596 751 178 83.4 blastp 431 BDL102_H28 lotus|gb157.2|AW720301 752 178 82.1 blastp 432 BDL102_H29 lotus|gb157.2|CN825142 753 178 81.5 blastp 433 BDL102_H30 lovegrass|gb167|EH188388 754 178 88.97 tblastn 434 BDL102_H31 maize|gb170|AI391795 755 178 95.2 blastp 435 BDL102_H32 maize|gb170|LLBE510254 756 178 95.2 blastp 436 BDL102_H33 melon|gb165|DV632852 757 178 80 tblastn 437 BDL102_H34 millet|gb161|CD725312 758 178 85.7 blastp 438 BDL102_H35 nuphar|gb166|CV003178 759 178 81.4 blastp 439 BDL102_H36 oat|gb164|CN815719 760 178 91.03 tblastn 440 BDL102_H37 oil_palm|gb166|EL681098 761 178 86.21 tblastn 441 BDL102_H38 oil_palm|gb166|EL682630 762 178 84.1 blastp 442 BDL102_H39 oil_palm|gb166|EL684119 763 178 82.1 blastp 443 BDL102_H40 onion|gb162|CF446214 764 178 80.4 blastp 444 BDL102_H41 papaya|gb165|EX258155 765 178 80.7 blastp 445 BDL102_H42 pineapple|gb157.2|DT336701 766 178 84.8 blastp 446 BDL102_H43 pineapple|gb157.2|DT338401 767 178 84.8 blastp 447 BDL102_H44 poppy|gb166|FE964559 768 178 80 tblastn 448 BDL102_H45 rice|gb170|OS03G31090 769 178 93.8 blastp 449 BDL102_H46 rye|gb164|BE637001 770 178 85.2 blastp 450 BDL102_H47 sorghum|gb161.crp|AI673920 771 178 96.6 blastp 451 BDL102_H48 sorghum|gb161.crp|AW747023 772 178 83.3 blastp 452 BDL102_H49 soybean|gb168|AA661036 773 178 80 blastp 453 BDL102_H50 soybean|gb168|AW720301 774 178 80 tblastn 454 BDL102_H51 sugarcane|gb157.3|CA076952 775 178 96.6 blastp 455 BDL102_H52 sugarcane|gb157.3|CA087422 776 178 96.6 blastp 456 BDL102_H53 sugarcane|gb157.3|CA103720 777 178 97.2 blastp 457 BDL102_H54 sugarcane|gb157.3|CA113942 778 178 84.25 tblastn 458 BDL102_H55 sugarcane|gb157.3|CA114406 779 178 97.2 blastp 459 BDL102_H56 sugarcane|gb157.3|CA116867 780 178 87.6 blastp 460 BDL102_H57 sugarcane|gb157.3|CA119956 781 178 90.34 tblastn 461 BDL102_H58 sugarcane|gb157.3|CA128680 782 178 86.9 blastp 462 BDL102_H59 sugarcane|gb157.3|CA139681 783 178 84.3 blastp 463 BDL102_H60 sugarcane|gb157.3|CA151882 784 178 93.1 tblastn 464 BDL102_H61 sugarcane|gb157.3|CA153401 785 178 96.6 blastp 465 BDL102_H62 sugarcane|gb157.3|CA193794 786 178 97.2 blastp 466 BDL102_H63 sugarcane|gb157.3|CA215946 787 178 80 blastp 467 BDL102_H64 sugarcane|gb157.3|CA235573 788 178 80.3 blastp 468 BDL102_H65 sugarcane|gb157.3|CA241742 789 178 82.76 tblastn 469 BDL102_H66 sugarcane|gb157.3|CA289186 790 178 95.2 blastp 470 BDL102_H67 sugarcane|gb157.3|CF571967 791 178 93.79 tblastn 471 BDL102_H68 sugarcane|gb157.3|CF574520 792 178 97.2 blastp 472 BDL102_H69 sunflower|gb162|CD848588 793 178 80 blastp 473 BDL102_H70 sunflower|gb162|CD850971 794 178 80.7 blastp 474 BDL102_H71 switchgrass|gb167|DN142384 795 178 95.9 blastp 475 BDL102_H72 switchgrass|gb167|FE598349 796 178 96.6 blastp 476 BDL102_H73 switchgrass|gb167|FE608943 797 178 96.6 blastp 477 BDL102_H74 switchgrass|gb167|FE642870 798 178 96.6 blastp 478 BDL102_H75 switchgrass|gb167|FL710664 799 178 95.2 blastp 479 BDL102_H76 tea|gb171|FE861343 800 178 80.14 tblastn 480 BDL102_H77 walnuts|gb166|CV195103 801 178 80.7 blastp 481 BDL102_H78 walnuts|gb166|CV196374 802 178 80.7 blastp 482 BDL102_H79 wheat|gb164|BE398202 803 178 85.2 blastp 483 BDL102_H80 wheat|gb164|BE406254 804 178 85.2 blastp 484 BDL102_H81 wheat|gb164|BE414893 805 178 85.2 blastp 485 BDL102_H82 wheat|gb164|CA485952 806 178 96.6 blastp 486 BDL102_H83 wheat|gb164|CA486424 807 178 93.8 blastp 487 BDL226_H0 canola|gb161|CD835072 808 181 89.5 blastp 488 BDL226_H1 radish|gb164|EV568139 809 181 91.7 blastp 489 BDL233_H0 radish|gb164|EV549343 810 185 84.5 blastp 490 BDL237_H0 arabidopsis|gb165|AT2G44890 811 187 86.3 blastp 491 BDL238_H0 arabidopsis|gb165|AT1G32763 812 202 81.5 blastp 492 BDL240_H0 castorbean|gb160|MDL30174M008707 813 189 82.4 blastp 493 BDL240_H1 cotton|gb164|BG446934 814 189 81.4 blastp 494 BDL240_H2 soybean|gb168|AW329693 815 189 80.7 blastp 495 BDL240_H3 soybean|gb168|BE329627 816 189 80.1 blastp 496 BDL241_H0 canola|gb161|CN825973 817 190 85.3 blastp 497 BDL249_H0 radish|gb164|EW735252 818 191 86.7 blastp 498 BDL251_H0 arabidopsis|gb165|AT5G23190 819 192 80.07 tblastn 499 BDL252_H0 apple|gb171|CN489978 820 193 80.9 blastp 500 BDL252_H1 apple|gb171|CN883406 821 193 80.9 blastp 501 BDL252_H2 b_rapa|gb162|EX036871 822 193 91 blastp 502 BDL252_H3 cacao|gb167|CU476642 823 193 84.3 blastp 503 BDL252_H4 canola|gb161|CN732395 824 193 90.6 blastp 504 BDL252_H5 canola|gb161|ES900668 825 193 86.2 blastp 505 BDL252_H6 castorbean|gb160|MDL29726M003996 826 193 81.4 blastp 506 BDL252_H7 citrus|gb166|CB417408 827 193 82.8 blastp 507 BDL252_H8 cotton|gb164|AI725830 828 193 82.8 blastp 508 BDL252_H9 cotton|gb164|CO094656 829 193 82.5 blastp 509 BDL252_H10 cowpea|gb166|FC458375 830 193 80.5 blastp 510 BDL252_H11 grape|gb160|CB920145 831 193 80.5 blastp 511 BDL252_H12 ipomoea|gb157.2|AU223826 832 193 80.2 blastp 512 BDL252_H13 lettuce|gb157.2|DW116753 833 193 80.22 tblastn 513 BDL252_H14 medicago|gb157.2|AL371996 834 193 80.9 blastp 514 BDL252_H15 peach|gb157.2|BU039377 835 193 82.4 blastp 515 BDL252_H16 poplar|gb170|BU816161 836 193 80.7 blastp 516 BDL252_H17 prunus|gb167|BU039377 837 193 82.4 blastp 517 BDL252_H18 radish|gb164|EV535608 838 193 92.1 blastp 518 BDL252_H19 radish|gb164|EW723334 839 193 91.8 blastp 519 BDL252_H20 soybean|gb168|BF636462 840 193 80.1 blastp 520 BDL252_H21 soybean|gb168|BU546186 841 193 82.4 blastp 521 BDL252_H22 soybean|gb168|CD390334 842 193 82.4 blastp 522 BDL252_H23 strawberry|gb164|CX661379 843 193 82 blastp 523 BDL252_H24 thellungiella|gb167|BY812142 844 193 92.1 blastp Table 16: Provided are polynucleotides and polypeptides which are homologous to the identified polynucleotides or polypeptides of Table 15. Homol. = homologue; Algor. = Algorithm;
Example 7
Gene Cloning and Generation of Binary Vectors for Plant Expression
(357) To validate their role in improving oil content, plant yield, seed yield, biomass, growth rate, ABST, NUE and/or vigor, selected genes were over-expressed in plants, as follows.
(358) Cloning Strategy
(359) Genes listed in Examples 5 and 6 hereinabove were cloned into binary vectors for the generation of transgenic plants. For cloning, the full-length open reading frame (ORF) was first identified. In case of ORF-EST clusters and in some cases already published mRNA sequences were analyzed to identify the entire open reading frame by comparing the results of several translation algorithms to known proteins from other plant species. To clone the full-length cDNAs, reverse transcription (RT) followed by polymerase chain reaction (PCR; RT-PCR) was performed on total RNA extracted from leaves, flowers, siliques or other plant tissues, growing under normal conditions. Total RNA was extracted as described in Example 2 above. Production of cDNA and PCR amplification was performed using standard protocols described elsewhere (Sambrook J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning. A Laboratory Manual., 2nd Ed. Cold Spring Harbor Laboratory Press, New York.) which are well known to those skilled in the art. PCR products were purified using PCR purification kit (Qiagen). In case where the entire coding sequence was not found, RACE kit from Ambion, Clontech or Invitrogen (RACE=R apid A ccess to cDNA E nds) was used to access the full cDNA transcript of the gene from the RNA samples described above. The RACE procedure was performed for the genes BDL197 (SEQ ID NO:46), BDL156 (SEQ ID NO:19), BDL169 (SEQ ID NO:28), BDL189 (SEQ ID NO:40), BDL200 (SEQ ID NO:47), BDL79 (SEQ ID NO:5), BDL231 (SEQ ID NO:57), BDL238 (SEQ ID NO:84) and BDL248 (SEQ ID NO:103) using the primers sequences listed in Table 17, below. RACE products were cloned into high copy vector followed by sequencing or directly sequenced. RACE products were sequenced as described hereinbelow for the genes specified in Table 17.
(360) The information from the RACE procedure was used for cloning of the full length ORF of the corresponding genes.
(361) TABLE-US-00017 TABLE 17 RACE primers used for sequencing of the identified genes of the invention Table 17. Provided are the PCR primers used for RACE sequencing. High copy plasmid used for Gene Name Primers used for amplification cloning of RACE products BDL197_5′Race BDL197_NGSP1_R2 (SEQ ID NO: 934) TopoTA (CGCCTGAAGCTTCTCCGAGAAC) BDL156_5′Race BDL156_NGSP1_R (SEQ ID NO: 937) (ACGGTGTTTCCAGAATTTCGCAG) BDL156_3′Race BDL156_NGSP2_F (SEQ ID NO: 938) TopoTA (CTGAATGTGACTGGGATATGTCGG) BDL169_5′Race BDL169_NGSP1_R (SEQ ID NO: 939) (TGCACTGGAGCGTGTAGGGACAG) BDL169_3′Race BDL169_NGSP1_F (SEQ ID NO: 940) (GGCAGAAACTGTTTTATGGAAATGG) BDL189_5′Race BDL189_NGSP1_R (SEQ ID NO: 941) TopoTA (TTCTGTCCCTCGACCAAGGTTG) BDL189_3′Race BDL189_GSP2_F (SEQ ID NO: 942) (CAGTCAATCTTCTTAGCATCGCTGAG) BDL200_5′Race BDL200_NGSP_Rb (SEQ ID NO: 943) TopoTA (CCAATGCCAATACGATGGTCGG) BDL200_3′Race BDL200_NGSP2_F (SEQ ID NO: 944) (GAGCTTTGGAGATAAGATTGGTGCAG) BDL79_5′Race BDL79_GSP1_R (SEQ ID NO: 945) TopoTA (GTATCACTCGAGGCACCATTGGG) BDL231_3′Race BDL231 NGSP R (SEQ ID NO: 946) TopoTA (ATGTGGGATTCCGAGACAGTGTCC) BDL238_5′Race BDL238 NGSP R (SEQ ID NO: 947) (TTTACCGTCCCCAAACGTTGCCG) BDL238_3′Race BDL238 NGSP F (SEQ ID NO: 948) (CTCATCCGGACGATGTCTTACTTCTTCTCC) BDL248_5′Race BDL248 NGSP R (SEQ ID NO: 949) (GAGGTGACCGATCACTGGTAACGC) BDL215_5′Race BDL215_NGSP1_R (SEQ ID NO: 950) (TGGCTTTGAAAACGTAACATGCC) BDL215_3′Race BDL215_NGSP2_F (SEQ ID NO: 951) TopoTA (TATTGGGATTTTCGGATCGATGG) Fwd = forward primer; Rev = reverse primer;
(362) In case genomic DNA was cloned, as in the case of BDL90 and BDL94 the genes were amplified by direct PCR on genomic DNA extracted from leaf tissue using the DNAeasy kit (Qiagen Cat. No. 69104).
(363) Usually, 2 sets of primers were synthesized for the amplification of each gene from a cDNA or a genomic sequence; an external set of primers and an internal set (nested PCR primers). When needed (e.g., when the first PCR reaction did not result in a satisfactory product for sequencing), an additional primer (or two) of the nested PCR primers were used. Table 18 below provides primers used for cloning of selected genes.
(364) TABLE-US-00018 TABLE 18 The PCR primers used for cloning the genes of the invention Table 18. Provided are the PCR primers used for cloning the genes of some embodiments of the invention. Restriction Gene Enzymes used for Name cloning Primers used for amplification BDL102 SalI, XbaI BDL102_NF_SalI(SEQ ID NO: 952) AATGTCGACTACCTGCCTTTCTCTCGTCC BDL102_EF_SalI(SEQ ID NO: 953) AAAGTCGACACTCTACCTGCCTTTCTCTCG BDL102_NR_XbaI(SEQ ID NO: 954) ATTCTAGACTATGTAGCCATCTCAACAATCAAAC BDL102_ER_XbaI(SEQ ID NO: 955) ATTCTAGAGGTTTTGATAAATAGGTACTCAGG BDL117 BDL117_EF_SmaI(SEQ ID NO: 956) CCCCGGGTCTCGGAGGTATCTTATTCCAG BDL117_ER_SmaI(SEQ ID NO: 957) CCCCGGGATGCCACACTTAAGGCCAAG BDL118 SmaI, SmaI BDL118_NF_SmaI(SEQ ID NO: 958) TCCCGGGTCTGGGTCTACTTTTGATTTGAG BDL118_NR_SmaI(SEQ ID NO: 959) TCCCGGGTGAAGCAGAAGTTTCGATTTAAG BDL138 SalI, XbaI BDL138_NF_SalI(SEQ ID NO: 960) AAAGTCGACCGAATCGTAATTGTTGAAGAGAG BDL138_EF_SalI(SEQ ID NO: 961) ATTGTCGACTTTAAGGAGAAGAGTCGCAGTC BDL138_NR_XbaI(SEQ ID NO: 962) ATTCTAGATTAGAGAGTGGTTGATAACGCAGAG BDL138_ER_XbaI(SEQ ID NO: 963) ACTCTAGACTACCTGTCACAATTTTCTAAAACAC BDL140 XbaI, SacI BDL140_NF_XbaI(SEQ ID NO: 964) TATCTAGATTGAGAATGAACTCAGTGTGTATC BDL140_EF_XbaI(SEQ ID NO: 965) AATCTAGAAACTAAACATTGAGAATGAACTCAG BDL140_NR_SacI(SEQ ID NO: 966) TGAGCTCTTAAGTCATTTAGTTTGGATCAACAAC BDL140_ER_SacI(SEQ ID NO: 967) CGAGCTCAGACCATGCATTTAAGGATCAC BDL147 SalI, XbaI BDL147_NF_SalI(SEQ ID NO: 968) TTAGTCGACCACAGTAACCATGTCCGTCTC BDL147_NR_XbaI(SEQ ID NO: 969) TATCTAGAGTGCTGCTTACTCGCTGTTTC BDL149 SalI, XbaI BDL149_NF_SalI(SEQ ID NO: 970) AAAGTCGACCTCAAACCCAAGAACCTCATC BDL149_NR_XbaI(SEQ ID NO: 971) ATTCTAGATGCAATAGTAGTAGCAGTGAACC BDL152 XbaI, SacI BDL152_NF_XbaI(SEQ ID NO: 972) TATCTAGATTCAGACAAAAACAGAGAGAAACT BDL152_NR_SacI(SEQ ID NO: 973) TGAGCTCCTAAGATCGGTTTAATCAATAGGG BDL153 SalI, SmaI BDL153_NF_SalI(SEQ ID NO: 974) AAAGTCGACAACAGCTTCGGTTTAAGAGTTC BDL153_NR_SmaI(SEQ ID NO: 975) TCCCGGGTCTACATTACGGCATACGGC BDL154 SalI, SacI BDL154_NF_SalI(SEQ ID NO: 976) TTAGTCGACTTAAAAATGGAGAGTCAAAAGC BDL154_NR_SacI(SEQ ID NO: 977) TGAGCTCCTACTACTTCTTGTTGATGCTGAGG BDL155 SalI, XbaI BDL155_NF_SalI(SEQ ID NO: 978) AATGTCGACTCCTCTTGCGGAGAGATGC BDL155_NR_XbaI(SEQ ID NO: 979) ATTCTAGATCTCCTTTTGAGAGAGTGCAAC BDL156 SalI, XbaI BDL156_NF_SalI(SEQ ID NO: 980) AATGTCGACTCGTCGTCTTCCTCATTTCG BDL156_ER_XbaI(SEQ ID NO: 981) ATTCTAGACTAATACGATTGGTAACAAGAAAACG BDL157 SalI, XbaI BDL157_NF_SalI(SEQ ID NO: 982) ATTGTCGACTTTCAATAAGAAATCTGCGTCC BDL157_EF_SalI(SEQ ID NO: 983) AAAGTCGACGAATCTGCTTTTAAGCTTCTCG BDL157_NR_XbaI(SEQ ID NO: 984) ATTCTAGACTAAAGAGAGTGAAGGAACAAAGACC BDL157_ER_XbaI(SEQ ID NO: 985) ATTCTAGACTATTTTCTTCTGTCTTCTGTGTCTTC BDL158 BDL158_EF_XbaI(SEQ ID NO: 986) AATCTAGACCTCACTTCTCTCTCTCTCTCTTC BDL158_ER_SmaI(SEQ ID NO: 987) CCCCGGGAGCCTAAAGCCTAACCCAAC BDL160 SalI, XbaI BDL160_NF_SalI(SEQ ID NO: 988) AAAGTCGACTGATCTACACAGAATCCATTTCC BDL160_NR_XbaI(SEQ ID NO: 989) AATCTAGATCATTCAGCCATTCACATTTTAGG BDL162 SalI, XbaI BDL162_NF_SalI(SEQ ID NO: 990) TTAGTCGACCCTAATAATGGCTTGCAGAGC BDL162_NR_XbaI(SEQ ID NO: 991) TATCTAGAAAATCTTGAGACTAAATCAAGCTG BDL167 SalI, XbaI BDL167_NF_SalI(SEQ ID NO: 992) AAAGTCGACGCAAGAAAGGGACTAACCAAG BDL167_NR_XbaI(SEQ ID NO: 993) ACTCTAGACTATGTCGGCATTAACTTAGAATCAC BDL168 XbaI, SmaI BDL168_NF_XbaI(SEQ ID NO: 994) AATCTAGACTTGCTTCAAGATTCGAGTGAG BDL168_EF_XbaI(SEQ ID NO: 995) AATCTAGAATTAACCACCATTTCTGTGAAG BDL168_NR_SmaI(SEQ ID NO: 996) TCCCGGGCTACCTTCCTTCTTCTTCACTTCC BDL168_ER_SmaI(SEQ ID NO: 997) TCCCGGGTCCTAAAAGTCAGTCACCTTCTG BDL169 SalI, XbaI BDL169_NF_SalI(SEQ ID NO: 998) AAAGTCGACGAAGGTGAAGTGATGGATTCTG BDL169_EF_SalI(SEQ ID NO: 999) AATGTCGACTGTTACCGATAAGAAGGTGAAG BDL169_NR_XbaI(SEQ ID NO: 1000) ATTCTAGACTAACAGCTTCAACGTAATTTGGTG BDL169_ER_XbaI(SEQ ID NO: 1001) ATTCTAGATCAACGTCATTTTGTGCATATC BDL173 XbaI, SmaI BDL173_EF_XbaI(SEQ ID NO: 1002) ATTCTAGATTTTCCCGAATCTATTCATCAC BDL173_ER_SmaI(SEQ ID NO: 1003) CCCCGGGAACGCTTCACCCTTTAATCC BDL174 SalI, SacI BDL174_NF_SalI(SEQ ID NO: 1004) AAAGTCGACCCGAGGAAGATGACGACAC BDL174_NR_SacI(SEQ ID NO: 1005) TGAGCTCCTAGTTTCAAGCAAGAGTGATTCC BDL176 SmaI, SmaI BDL176_NF_SmaI(SEQ ID NO: 1006) TCCCGGGTATTGAGCAGCCGTGAAATC BDL176_NR_SmaI(SEQ ID NO: 1007) TCCCGGGTGGACCAAAGAATCAAATAGTAAC BDL177 SalI, SacI BDL177_NF_SalI(SEQ ID NO: 1008) AATGTCGACTCAGGATCTATGGGCAAGTC BDL177_EF_SalI(SEQ ID NO: 1009) AAAGTCGACGCTTGTGATCAGGATCTATGG BDL177_NR_SacI(SEQ ID NO: 1010) TGAGCTCCTAAACAGCTTTCTTCTACTCTTCATC BDL177_ER_SacI(SEQ ID NO: 1011) CGAGCTCACAGAAAACAAAAGAAACTAGGC BDL181 SalI, SacI BDL181_NF_SalI(SEQ ID NO: 1012) AAAGTCGACGCGATAGATCTGACGAATGC BDL181_NR_SacI(SEQ ID NO: 1013) TGAGCTCCTAGATTTCATACTCAGGAAGCCAC BDL182 SalI, SacI BDL182_NF_SalI(SEQ ID NO: 1014) AACGTCGACTCTACCATCGACAACGAGAAAC BDL182_NR_SacI_new(SEQ ID NO: 1015) TGAGCTCCTACATTCACAACAAACCACCACTAC BDL183 SalI, XbaI BDL183_NF_SalI(SEQ ID NO: 1016) AATGTCGACTTATTTTGATCTTCCTCACTTCTG BDL183_EF_SalI(SEQ ID NO: 1017) AAAGTCGACGATCAATCTTTGTTATCTCTCACTC BDL183_NR_XbaI(SEQ ID NO: 1018) ATTCTAGACTAATCACACAAAACGACAAGAACAG BDL183_ER_XbaI(SEQ ID NO: 1019) ACTCTAGAACGATGTGATAAAACATTAGAAGC BDL186 SalI, XbaI BDL186_NF_SalI(SEQ ID NO: 1020) AAAGTCGACCGAAGTGAAAGTCGTGATGG BDL186_EF_SalI(SEQ ID NO: 1021) AAAGTCGACACGCAAACGTGATCCTAAAC BDL186_NR_XbaI(SEQ ID NO: 1022) ATTCTAGACTCAAGGGGACGAGATATCAG BDL186_ER_XbaI(SEQ ID NO: 1023) ACTCTAGAAGGTAGAGAGCATCAAGGAAGC BDL187 SalI, SmaI BDL187_NF_SalI(SEQ ID NO: 1024) ATAGTCGACATTCTTTCAGTTTTCCGGTG BDL187_EF_SalI(SEQ ID NO: 1025) AAAGTCGACGCTTGAATTCTTTCAGTTTTCC BDL187_NR_SmaI(SEQ ID NO: 1026) TCCCGGGCTATTTTCACCAGTAATTTCCACAC BDL187_ER_SmaI(SEQ ID NO: 1027) TCCCGGGTTACTTTAGCCACAATCTGTGTTTTC BDL188 XbaI, SmaI BDL188_NF_XbaI(SEQ ID NO: 1028) AATCTAGAATTTTCATTTGTTCGCTTCG BDL188_NR_SmaI(SEQ ID NO: 1029) TCCCGGGCTAACAGTAGGTAATTTTGACATCCAG BDL189 BDL189_NF_SmaI(SEQ ID NO: 1030) ACCCGGGCATTGCCTGTTGGCTTCG BDL189_NR_SmaI(SEQ ID NO: 1031) ACCCGGGTTACAATACAATTGTTTAATTCGAGG BDL190 SalI, XbaI BDL190_NF_SalI(SEQ ID NO: 1032) TTAGTCGACAAAATAATGGCAGCTTTGGC BDL190_EF_SalI(SEQ ID NO: 1033) TTAGTCGACTCTCGTCACATATCTTCATCGAC BDL190_NR_XbaI(SEQ ID NO: 1034) TATCTAGACTACTAGACAAATTTGTTGATCAATTC BDL190_ER_XbaI(SEQ ID NO: 1035) TATCTAGACTAAAGAGAGAACTAGACAAATTTGTTG BDL192 SalI, XbaI BDL192_NF_SalI(SEQ ID NO: 1036) ATTGTCGACTTTACGAAATACGCCGAATC BDL192_EF_SalI(SEQ ID NO: 1037) AATGTCGACTTCGAAACCCTAACAAAAGC BDL192_NR_XbaI(SEQ ID NO: 1038) ACTCTAGAATCTGCATAGCAGTTAGAACAAG BDL192_ER_XbaI(SEQ ID NO: 1039) ATTCTAGAGAAAGGTCCTCATTCATAATCC BDL193 XbaI, SacI BDL193_EF_XbaI(SEQ ID NO: 1040) AATCTAGACTTCATATTCAAATCTCCTCTCC BDL193_ER_SacI (SEQ ID NO: 1041) CGAGCTCATCACAAACAAACCTAAGAGGC BDL194 EcoRV, EcoRV BDL194_NF_EcoRV(SEQ ID NO: 1042) AAGATATCAGCCATTGTTCTTCATCATCTC BDL194_NR_EcoRV(SEQ ID NO: 1043) ACGATATCCTAACAGGGTTTTCAGTGCTGTG BDL196 SalI, XbaI BDL196_NF_salI(SEQ ID NO: 1044) TTAGTCGACAAGACATGAAGTTCATGACACTAATG BDL196_EF_SalI(SEQ ID NO: 1045) TTAGTCGACAACTGAAACAAAAGAAGAGTCATC BDL196_NR_XbaI(SEQ ID NO: 1046) TATCTAGATTATGAGCTTTAACAACTAGTATAAGGAAC BDL196_ER_XbaI(SEQ ID NO: 1047) TATCTAGACACCACAATTTTAAGCTTCAAC BDL197 SalI, XbaI BDL197_NF_SalI(SEQ ID NO: 1048) AAAGTCGACTGTTCTTGTTCTTCACGATGAG BDL197_EF_SalI(SEQ ID NO: 1049) AAAGTCGACTCTAAATCCTATGTTCTTGTTCTTC BDL197_NR_XbaI(SEQ ID NO: 1050) AATTCTAGAGGTTCAAAATACGTAACACATTG BDL197_ER_XbaI(SEQ ID NO: 1051) AACTCTAGAACCATATTAGGTTCAAAATACGTAAC BDL201 SalI, XbaI BDL201_NF_SalI(SEQ ID NO: 1052) AAAGTCGACCGATCAACAGACTCTAATCAGC BDL201_NR_XbaI(SEQ ID NO: 1053) ATTCTAGATTAGTTCTATACTGCAGATTCTTGGG BDL203 SalI, XbaI BDL203_NF_SalI(SEQ ID NO: 1054) AATGTCGACTTCTCTCTGTTCTTGCACTCG BDL203_EF_SalI(SEQ ID NO: 1055) AAAGTCGACCTTCTTCTTCTTTTCTCAATCTTTC BDL203_NR_XbaI(SEQ ID NO: 1056) ATTCTAGATCTGTATCATTAAAACTGAGGAAG BDL203_ER_XbaI(SEQ ID NO: 1057) ATTCTAGAGTGGCGAGACAACATTTCTAC BDL220 SalI, XbaI BDL220_NF_SalI(SEQ ID NO: 1058) AAAGTCGACCTCTCTCTCTCTAATGGGTAATTG BDL220_EF_SalI(SEQ ID NO: 1059) AATGTCGACTCACCACACAACACAACCAAG BDL220_NR_XbaI(SEQ ID NO: 1060) ACTCTAGAAATCCAACGTCAAATGAGAAG BDL220_NF_SalI(SEQ ID NO: 1061) AAAGTCGACCTCTCTCTCTCTAATGGGTAATTG BDL221 SalI, XbaI BDL221_NF_SalI(SEQ ID NO: 1062) AATGTCGACTTGGATCAGAGAAAATATGTCG BDL221_EF_SalI(SEQ ID NO: 1063) ATAGTCGACCTTGAATCTGAAGCTAATCTTGG BDL221_NR_XbaI(SEQ ID NO: 1064) ATTCTAGATTAGCATTAGAACGGGACAGTATAAG BDL221_ER_XbaI(SEQ ID NO: 1065) ACTCTAGATCAAAGAATCGAGCATTAGAACGG BDL222 SalI, XbaI BDL222_NF_SalI(SEQ ID NO: 1066) AAAGTCGACCTAAACCGGTAAAAGATGTCG BDL222_EF_SalI(SEQ ID NO: 1067) AACGTCGACACTTTTGTTTTGCCTTTCCTC BDL222_NR_XbaI(SEQ ID NO: 1068) ATTCTAGATCTTCTTCATCACTCAATCGC BDL222_ER_XbaI(SEQ ID NO: 1069) ATTCTAGACTGTGGTATTTAGGGAATACATCC BDL223 SalI, XbaI BDL223_NF_SalI(SEQ ID NO: 1070) AAAGTCGACCACAGAGAAATCATGGGGTTC BDL223_EF_SalI(SEQ ID NO: 1071) AACGTCGACAGATATCGTTGGCTTCGTCTC BDL223_NR_XbaI(SEQ ID NO: 1072) ATTCTAGATTAGGTTTGATCATTTTAACCAGAG BDL223_ER_XbaI(SEQ ID NO: 1073) ATTCTAGACTATGCAGAAATGTTTGGATTGAG BDL224 XbaI, SmaI BDL224_NF_XbaI(SEQ ID NO: 1074) AATCTAGACCACAAAATTCGTCAAAGCTC BDL224_EF_XbaI(SEQ ID NO: 1075) ATTCTAGATTTTCAAACCACAAAATTCGTC BDL224_NR_SmaI(SEQ ID NO: 1076) CCCCGGGATCCAACCAATCCCTAAAATG BDL224_ER_SmaI(SEQ ID NO: 1077) CCCCGGGATCAGCCACTTCTACTCTCAATTC BDL225 SalI, XbaI BDL225_NF_SalI(SEQ ID NO: 1078) AATGTCGACTCCTTGTGATTCATTATTTTGC BDL225_EF_SalI(SEQ ID NO: 1079) AAAGTCGACCAACATCTCCTCCAAAACATTC BDL225_NR_XbaI(SEQ ID NO: 1080) ACTCTAGATTAGCAAGAAGAAAAGAAGTGCAG BDL225_ER_XbaI(SEQ ID NO: 1081) ATTCTAGATTAGTAGTTTATACAAGGTGCGGAGAC BDL226 EcoRV, EcoRV BDL226_NF_EcoRV(SEQ ID NO: 1082) AAGATATCGAAACTGGATCTGGGTTTATCC BDL226_NR_EcoRV(SEQ ID NO: 1083) ATGATATCCTAAACTAATCAAACATGGCACATAC BDL227 BDL227_NF_SalI(SEQ ID NO: 1084) AAAGTCGACAGAGTTAAGTCAATCACCAAACC BDL227_NR_SmaI(SEQ ID NO: 1085) TCCCGGGTTACCATCAAGTTTTCTTGCTGAAG BDL228 SalI, XbaI BDL228_NF_SalI(SEQ ID NO: 1086) AAAGTCGACCCAACACTATATCATGGCTACTATC BDL228_NR_XbaI(SEQ ID NO: 1087) ATTCTAGACTAACCTCACTTGATGCTCTTGC BDL229 SalI XbaI BDL229_NR_XbaI(SEQ ID NO: 1088) TATCTAGAGCTAAACAAAATCCGGAGATAG BDL229_ER_XbaI(SEQ ID NO: 1089) TATCTAGACAGTCACTCCATAACTATGATCAAAC BDL229_F_SalI(SEQ ID NO: 1090) TTAGTCGACCTCATTAATGGAAGTTTCAACATC BDL229_F_SalI(SEQ ID NO: 1091) TTAGTCGACCTCATTAATGGAAGTTTCAACATC BDL230 SmaI, SmaI BDL230_NF_SmaI(SEQ ID NO: 1092) TCCCGGGTAAGTTTGTGAGATGGAATTAGTG BDL230_NR_SmaI(SEQ ID NO: 1093) TCCCGGGCTAATTGGTTGGTTACAAGATGC BDL231 SalI, XbaI BDL231_NF_SalI(SEQ ID NO: 1094) AATGTCGACTGGACTGAAGATGTCAGGATTC BDL231_EF_SalI(SEQ ID NO: 1095) ATAGTCGACATTTCTCTCTATTGGCATCGAC BDL231_NR_XbaI(SEQ ID NO: 1096) AATTCTAGACTAAACTGGGGAAAGCTAAAACG BDL231_ER_XbaI(SEQ ID NO: 1097) AATTCTAGATCATAACATAAGAAAGTAAACTGGGG BDL232 XbaI, SacI BDL232_NF_XbaI(SEQ ID NO: 1098) AATCTAGACACACCCCTCAAAGAAATATAAC BDL232_EF_XbaI(SEQ ID NO: 1099) AATCTAGAAAGAAATTCACACCCCTCAAAG BDL232_NR_SacI(SEQ ID NO: 1100) TGAGCTCCTAAAGGTGGAGTAATTAGAAGCG BDL232_ER_SacI(SEQ ID NO: 1101) TGAGCTCTGGTGAAGTGTTAAGTAATTGTCG BDL233 SalI, SacI BDL233_NF_SalI(SEQ ID NO: 1102) AAAGTCGACGAAAGAGAGAAAATGGAGAATATG BDL233_EF_SalI(SEQ ID NO: 1103) AAAGTCGACCGATCTAAAGAAAGAGAGAAAATG BDL233_NR_SacI(SEQ ID NO: 1104) TGAGCTCCTAAGAGTCGATCTAGAAAGCAACATC BDL233_ER_SacI(SEQ ID NO: 1105) TGAGCTCGAATTAGTCCTTGTGGTTCTACTC BDL234 SalI, SmaI BDL234_NF_SalI(SEQ ID NO: 1106) AATGTCGACTGATAAGAATGCTCCTGACTGG BDL234_EF_SalI(SEQ ID NO: 1107) AATGTCGACTCTTTCTCTGTATCTCGACGTTC BDL234_NR_SmaI(SEQ ID NO: 1108) TCCCGGGCTAAAATCCAAGTGCCCAAGAAC BDL234_ER_SmaI(SEQ ID NO: 1109) TCCCGGGCTAGCAAAACATAAATCCAAGTGC BDL235 SalI, SmaI BDL235_NF_SalI(SEQ ID NO: 1110) AATGTCGACTCTTACTCAATCCGAAGAATGG BDL235_NR_SmaI(SEQ ID NO: 1111) CCCCGGGACTTCGATTCACATTTCTCCTC BDL237 SalI, XbaI BDL237_NF_SalI(SEQ ID NO: 1112) AAAGTCGACCGAAGTAAGAAAAGAAAATGGAG BDL237_EF_SalI(SEQ ID NO: 1113) AAAGTCGACCTTCGAAGTAAGAAAAGAAAATG BDL237_NR_XbaI(SEQ ID NO: 1114) AATCTAGATCATACTCAAGTGCTTGTCCTCGG BDL237_ER_XbaI(SEQ ID NO: 1115) ATTCTAGAGTTATTGGTGTCTTGTTCCACC BDL238 SalI, XbaI BDL238_NF_SalI(SEQ ID NO: 1116) AAAGTCGACCAACGAGCAAGAGAAAATGG BDL238_EF_SalI(SEQ ID NO: 1117) AAAGTCGACGATACAACGAGCAAGAGAAAATG BDL238_NR_XbaI(SEQ ID NO: 1118) AATTCTAGATGGTTCTAGCTATCACTAGGTGC BDL238_ER_XbaI(SEQ ID NO: 1119) AATTCTAGAGGCAATACAACAAGAGAAAACTC BDL240 SalI, XbaI BDL240_NF_SalI(SEQ ID NO: 1120) AAAGTCGACCGAGTACAATGGAGGTTTCG BDL240_NR_XbaI(SEQ ID NO: 1121) ATTCTAGATCAAGCTTAAAGACCGTGAGGAAG BDL241 XbaI, SmaI BDL241_NF_XbaI(SEQ ID NO: 1122) AATCTAGAACAGTCGTCGTCGTCAAGC BDL241_NR_SmaI(SEQ ID NO: 1123) TCCCGGGCTAAAGGTAAGGATGAATTGTCAGAG BDL242 SalI, XbaI BDL242_NF_SalI(SEQ ID NO: 1124) AATGTCGACTCAAATCAATATGGGATCTTTC BDL242_NR_XbaI(SEQ ID NO: 1125) ATTCTAGATTATTGACAAGTCTATTGCCCG BDL245 SalI, SmaI BDL245_NF_SalI(SEQ ID NO: 1126) AATGTCGACTTCGTTAAATTATGTCTTTGAGG BDL245_EF_SalI(SEQ ID NO: 1127) AAAGTCGACTGACTCAGAGATCAACAAAACC BDL245_NR_SmaI(SEQ ID NO: 1128) ACCCGGGTTAGACTTACTCCAATTTCCAAGC BDL245_ER_SmaI(SEQ ID NO: 1129) TCCCGGGTCAAGAGTCGGTCACACGC BDL247 SmaI, SacI BDL247_NF_SmaI(SEQ ID NO: 1130) TCCCGGGTCCTTCTTGTGTGAGACCGAG BDL247_NR_SacI(SEQ ID NO: 1131) TGAGCTCCTAAGAACTTTAACGCATTTTGTAGTG BDL248 SalI, XbaI BDL248_NF_SalI(SEQ ID NO: 1132) AAAGTCGACAACGTGATCAATATGGAAGCTC BDL248_EF_SalI(SEQ ID NO: 1133) AAAGTCGACACTCACCAAAATCCAACGTG BDL248_NR_XbaI(SEQ ID NO: 1134) AATTCTAGACTAAACTCAAGAGGAGTCGGGTAAG BDL248_ER_XbaI(SEQ ID NO: 1135) AATTCTAGATTAATTCGTTACCGTTGCTAAG BDL249 SalI, XbaI BDL249_NF_SalI(SEQ ID NO: 1136) AAAGTCGACACCAAAATAGATCTAAAACATGG BDL249_EF_SalI(SEQ ID NO: 1137) AATGTCGACTTCACTCACCAAAATAGATCTAAAAC BDL249_NR_XbaI(SEQ ID NO: 1138) AATCTAGATCAACGTCAAACGGACTCGTTG BDL249_ER_XbaI(SEQ ID NO: 1139) AATCTAGATCACCAAAAGTCTAAACGTCAAACG BDL250 SalI, XbaI BDL250_NF_SalI(SEQ ID NO: 1140) TTAGTCGACCAAAGATGTTTTACTATGTGATTGTC BDL250_EF_SalI(SEQ ID NO: 1141) TTAGTCGACAGGAAGAGAAAGGTCAAAGATG BDL250_NR_XbaI(SEQ ID NO: 1142) TATCTAGATCAAAATCTCACATCTCCATGCATAG BDL250_ER_XbaI(SEQ ID NO: 1143) TATCTAGATCATGTTCGCATTACACAAATATCC BDL252 XbaI, SmaI BDL252_NF_XbaI(SEQ ID NO: 1144) ATTCTAGATTCTCTGTCTCTTTGGCTTTTC BDL252_EF_XbaI(SEQ ID NO: 1145) ATTCTAGATAAAACTCTCAGCTTCCCATTC BDL252_NR_SmaI(SEQ ID NO: 1146) TCCCGGGCTATTGTCATTGAGGAAGAACAGG BDL252_ER_SmaI(SEQ ID NO: 1147) TCCCGGGCTAAAAGTTCTTGCTTGCTTTCTG BDL48 SalI, XbaI BDL48_NF_SalI(SEQ ID NO: 1148) AAAGTCGACAGATTGCGTCACTGTAGTAGTAGTAG BDL48_EF_SalI(SEQ ID NO: 1149) AAAGTCGACCTGCAACTCTTTCTCACTTTCAC BDL48_NR_XbaI(SEQ ID NO: 1150) AGTCTAGAAAACATTTTGCTTAAGATCTACAGAG BDL48_ER_XbaI(SEQ ID NO: 1151) ACTCTAGAAGACATGAAAGCACAAATCAAG BDL49 SmaI, SacI BDL49_NF_SmaI(SEQ ID NO: 1152) ACCCGGGCTAACATGCTCCATCTCCTTC BDL49_NR_SacI(SEQ ID NO: 1153) TGAGCTCTCAACCTGATCAGCGATGGTCG BDL58 SalI, XbaI BDL58_NF_SalI(SEQ ID NO: 1154) AAAGTCGACCACACAAGACTAACGATGTTGC BDL58_NR_XbaI(SEQ ID NO: 1155) ATTCTAGATTAAAAAGAGACCTACACGGCG BDL62 SalI, SacI BDL62_NF_SalI(SEQ ID NO: 1156) AATGTCGACTCTCTGGTCTCCCTATATCAGC BDL62_NR_SacI(SEQ ID NO: 1157) TGAGCTCCTATTTGATGTTGTTGTTGTTGTCTG BDL63 SalI, XbaI BDL63_NF_SalI(SEQ ID NO: 1158) ATAGTCGACGTTTTGAGATATGGGAGGACC BDL63_EF_SalI(SEQ ID NO: 1159) AAAGTCGACCTCTAGATTCTTGGCGATTCTC BDL63_NR_XbaI(SEQ ID NO: 1160) ATTCTAGATTAGTGGTTTTACTTGAGCCTCTCC BDL63_ER_SacI(SEQ ID NO: 1161) TGAGCTCCTATTGTTCGTTACGGTGGTTTTAC BDL64 BDL64_NF_SalI(SEQ ID NO: 1162) AATGTCGACGGACTTTAAACATGGGTGTTC BDL64_NR_XbaI(SEQ ID NO: 1163) ATTCTAGACTACTCATAGGTTTGTTACTTCCTTG BDL75 SalI, XbaI BDL75_NF_SalI(SEQ ID NO: 1164) AAAGTCGACAAGAAGAAAGAAACAGAGAATCG BDL75_NR_XbaI(SEQ ID NO: 1165) ATTCTAGACTAATTGTTCAAAGTTCAGTGAGCC BDL79 XbaI, SmaI BDL79_NF_XbaI(SEQ ID NO: 1166) ATTCTAGAGGAGATTTTGTAATGGATTCTGC BDL79_EF_XbaI(SEQ ID NO: 1167) ATTCTAGAGAAGGAGATTTTGTAATGGATTC BDL79_NR_Sma(SEQ ID NO: 1168) TCCCGGGTTACGCTTAGACCATACAACGAGTAG BDL79_ER_Sma(SEQ ID NO: 1169) TCCCGGGGTTATTTACTTATGGCCTGTTTC BDL81 SalI, SacI BDL81_EF_SalI(SEQ ID NO: 1170) AAAGTCGACCAGGGGTTTAAGGATTTTCTC BDL81_ER_SacI(SEQ ID NO: 1171) CGAGCTCAAATGGCTTTCTCTACCCTTTG BDL83 SalI, XbaI BDL83_NF_SalI(SEQ ID NO: 1172) AATGTCGACTGGTAGGCTGAGAGAAAGAAAG BDL83_NR_XbaI(SEQ ID NO: 1173) AGTCTAGATTAGAGAATAAAAGAAGAATGAGAAGC BDL85 XbaI, SalI BDL85_NF_SalI(SEQ ID NO: 1174) AATGTCGACTTAATCGTTAGAAGATGAGCCAG BDL85_NR_XbaI(SEQ ID NO: 1175) ATTCTAGATCAGGCTTAGAAGCAAATGTCCAG BDL88 SalI, XbaI BDL88_NF_SalI(SEQ ID NO: 1176) AATGTCGACGAGGAGATGGCGAGCAAC BDL88_NR_XbaI(SEQ ID NO: 1177) TATCTAGATTATTAGGTATTGCACTTCCACTTC BDL90 BDL90_EF_SalI(SEQ ID NO: 1178) AAAGTCGACCACCAGAAACAAAGAGAGAGTG BDL90_ER_XbaI(SEQ ID NO: 1179) ATTCTAGATATCATGCAACCACAAACAATAG BDL94 XbaI, SmaI BDL94_EF_XbaLnew(SEQ ID NO: 1180) AATCTAGAAAGTCCAAGTGACCAACCATC BDL94_ER_SmaLnew(SEQ ID NO: 1181) TCCCGGGGGGATACAAGATTATGCAGGC Fwd = forward primer; Rev = reverse primer; Nested = nested primer for PCR (internal primer); External = external primer for PCR.
(365) To facilitate cloning of the cDNAs/genomic sequences, a 8-12 bp extension was added to the 5′ of each primer. The primer extension includes an endonuclease restriction site. The restriction sites were selected using two parameters: (a). The site did not exist in the cDNA sequence; and (b). The restriction sites in the forward and reverse primers were designed such that the digested cDNA is inserted in the sense formation into the binary vector utilized for transformation.
(366) Each digested PCR product was inserted into a high copy vector pBlue-script KS plasmid vector [pBlue-script KS plasmid vector, Hypertext Transfer Protocol://World Wide Web(dot)stratagene(dot)com/manuals/212205(dot)pdf] or into plasmids originating from this vector. In cases where the pGXN high copy vector (originated from pBlue-script KS) was used, the PCR product was inserted upstream to the NOS terminator (SEQ ID NO:1182) originated from pBI 101.3 binary vector (GenBank Accession No. U12640, nucleotides 4356 to 4693) and downstream to the 35S promoter (Table 20 below). The digested products and the linearized plasmid vector were ligated using T4 DNA ligase enzyme (Roche, Switzerland).
(367) Sequencing of the amplified PCR products was performed, using ABI 377 sequencer (Amersham Biosciences Inc). In all cases, after confirmation of the sequence of the cloned genes, the cloned cDNA accompanied or not with the NOS terminator was introduced into the pGI binary vector [pBXYN or pQXYN containing the 35S CaMV promoter] according to Table 19 hereinabove, via digestion with appropriate restriction endonucleases. In any case the insert was followed by single copy of the NOS terminator (SEQ ID NO:1182×).
(368) High copy plasmids containing the cloned genes were digested with the restriction endonucleases (New England BioLabs Inc) according to the sites designed in the primers (Table 18, above) and cloned into binary vectors according to Table 19, below.
(369) Binary Vectors Used for Cloning:
(370) The plasmid pPI was constructed by inserting a synthetic poly-(A) signal sequence, originating from pGL3 basic plasmid vector (Promega, Acc No U47295; by 4658-4811) into the HindIII restriction site of the binary vector pBI101.3 (Clontech, Acc. No. U12640). pGI (pBXYN) (
(371) The modified pGI vector (pQXYN) is a modified version of the pGI vector in which the cassette is inverted between the left and right borders so the gene and its corresponding promoter are close to the right border and the NPTII gene is close to the left border.
(372) TABLE-US-00019 TABLE 19 Restriction enzyme sites used to clone the identified genes into binary vector Restriction Restriction enzymes used enzymes used Restriction for cloning for cloning enzymes used into binary into binary for digesting Gene Binary vector- vector- the binary name vector FORWARD REVERSE vector BDL62 pQXYN SalI SacI SalI, SacI BDL75 pQXYN SalI EcoRI SalI, EcoRI BDL79 pQXYN XbaI SmaI XbaI, Ecl136II BDL81 pQXYN SalI SacI SalI, SacI BDL83 pQXYN SalI EcoRI SalI, EcoRI BDL117 pQXYN SmaI SmaI SmaI, Ecl136II BDL118 pQXYN SmaI SmaI SmaI, Ecl136II BDL138 pQXYN SalI EcoRI SalI, EcoRI BDL140 pQXYN XbaI SacI XbaI, SacI BDL147 pQXYN SalI EcoRI SalI, EcoRI BDL149 pQXYN SalI EcoRI SalI, EcoRI BDL152 pQXYN XbaI SacI XbaI, SacI BDL153 pQXYN SalI SmaI SalI, Ecl136II BDL154 pQXYN SalI SacI SalI, SacI BDL155 pQXYN SalI EcoRI SalI, EcoRI BDL156 pQXYN SalI SacI SacI, SalI BDL157 pQXYN SalI SacI SalI, SacI BDL158 pQXYN XbaI SmaI XbaI, Ecl136II BDL160 pQXYN SalI EcoRI SalI, EcoRI BDL162 pQXYN SalI EcoRI SalI, EcoRI BDL167 pQXYN SalI EcoRI SalI, EcoRI BDL168 pQXYN XbaI SmaI XbaI, Ecl136II BDL169 pQXYN SalI EcoRI SalI, EcoRI BDL171 pQXYN XbaI SacI XbaI, SacI BDL173 pQXYN XbaI SmaI XbaI, Ecl136II BDL174 pQXYN SalI SacI SalI, SacI BDL176 pQXYN SmaI SmaI SmaI, Ecl136II BDL177 pQXYN SalI SacI SalI, SacI BDL181 pQXYN SalI SacI SalI, SacI BDL182 pQXYN SalI SacI SalI, SacI BDL183 pQXYN SalI EcoRI SalI, EcoRI BDL186 pQXYN SalI SacI SalI, SacI BDL187 pQXYN SalI SmaI SalI, Ecl136II BDL188 pQXYN XbaI SmaI XbaI, Ecl136II BDL189 pQXYN SmaI BamHI SmaI, Ecl136II BDL190 pQXYN SalI EcoRI SalI, EcoRI BDL192 pQXYN SalI EcoRI SalI, EcoRI BDL193 pQXYN XbaI SacI XbaI, SacI BDL194 pQXYN EcoRV EcoRV SmaI, Ecl136II BDL196 pQXYN SalI EcoRI SalI, EcoRI BDL197 pQXYN SalI EcoRI SalI, EcoRI BDL201 pQXYN SalI EcoRI SalI, EcoRI BDL203 pQXYN SalI EcoRI SalI, EcoRI BDL220 pQXYN SalI EcoRI SalI, EcoRI BDL221 pQXYN SalI EcoRI SalI, EcoRI BDL222 pQXYN SalI EcoRI SalI, EcoRI BDL223 pQXYN SalI EcoRI SalI, EcoRI BDL229 pQXYN SalI EcoRI SalI, EcoRI BDL230 pQXYN SmaI SmaI SmaI, Ecl136II BDL231 pQXYN SalI EcoRI SalI, EcoRI BDL235 pQXYN SalI SmaI SalI, Ecl136II BDL242 pQXYN SalI EcoRI SalI, EcoRI BDL245 pQXYN SalI SmaI SalI, Ecl136II BDL247 pQXYN SmaI SacI SmaI, SacI BDL248 pQXYN SalI EcoRI SalI, EcoRI BDL250 pQXYN SalI EcoRI SalI, EcoRI BDL49 pQXYN EcoRV SacI SmaI, SacI BDL58 pQXYN SalI EcoRI SalI, EcoRI BDL63 pQXYN SalI SacI SalI, SacI BDL64 pQXYN SalI XbaI SalI, Ecl136II BDL85 pQXYN SalI EcoRI SalI, EcoRI BDL88 pQXYN SalI EcoRI SalI, EcoRI BDL90 pQXYN XbaI SalI SalI, Ecl136II BDL94 pQXYN XbaI SmaI xbaI, Ecl136II BDL102 pQXYN SalI EcoRI SalI, EcoRI BDL224 pQXYN XbaI EcoRI XbaI, EcoRI BDL225 pQXYN SalI EcoRI SalI, EcoRI BDL226 pQXYN EcoRV EcoRV SmaI, Ecl136II BDL227 pQXYN SalI SmaI SalI, Ecl136II BDL228 pQXYN SalI EcoRI SalI, EcoRI BDL232 pQXYN XbaI EcoRI XbaI, EcoRI BDL233 pQXYN SalI EcoRI SalI, EcoRI BDL234 pQXYN SalI SmaI SalI, Ecl136II BDL237 pQXYN SalI SacI SalI, SacI BDL238 pQXYN SalI EcoRI SalI, EcoRI BDL240 pQXYN SalI SacI SalI, SacI BDL241 pQXYN XbaI SmaI XbaI, Ecl136II BDL249 pQXYN SalI EcoRI SalI, EcoRI BDL252 pQXYN XbaI SmaI XbaI, Ecl136II BDL47 pQXYN XbaI SmaI XbaI, Ecl136II BDL48 pQXYN SalI EcoRI SalI, EcoRI Table 19.
(373) TABLE-US-00020 TABLE 20 Genes cloned from cDNA libraries or genomic DNA in a High copy number plasmid Gene Amplified from Polynucleotide Polypeptide Name High copy plasmid Organism Origin SEQ ID NO: SEQ ID NO: BDL62 pGXN Arabidopsis thaliana RNA 847 108 (pKG + Nos + 35S) ND BDL75 pGXN Arabidopsis thaliana RNA 848 109 (pKG + Nos + 35S) ND BDL79 pKS(Pks_J) Arabidopsis thaliana RNA 849 110 ND BDL81 pGXN Arabidopsis thaliana RNA 850 111 (pKG + Nos + 35S) ND BDL83 pGXN Arabidopsis thaliana RNA 851 112 (pKG + Nos + 35S) ND BDL117 Topo B Arabidopsis thaliana RNA 852 926 ND BDL118 Topo B Arabidopsis thaliana RNA 853 114 ND BDL138 pGXN Arabidopsis thaliana RNA 854 116 (pKG + Nos + 35S) ND BDL140 pGXN Arabidopsis thaliana RNA 855 117 (pKG + Nos + 35S) ND BDL147 pGXN Arabidopsis thaliana RNA 856 118 (pKG + Nos + 35S) ND BDL149 pGXN Arabidopsis thaliana RNA 857 119 (pKG + Nos + 35S) ND BDL152 pGXN Arabidopsis thaliana RNA 858 120 (pKG + Nos + 35S) ND BDL153 pKS(Pks_J) Arabidopsis thaliana RNA 859 121 ND BDL154 pGXN Arabidopsis thaliana RNA 860 122 (pKG + Nos + 35S) ND BDL155 pGXN Arabidopsis thaliana RNA 861 123 (pKG + Nos + 35S) ND BDL156 pGXN Arabidopsis thaliana RNA 862 124 (pKG + Nos + 35S) ND BDL157 pGXN Arabidopsis thaliana RNA 863 125 (pKG + Nos + 35S) ND BDL158 pKS(Pks_J) Arabidopsis thaliana RNA 864 126 ND BDL160 pGXN Arabidopsis thaliana RNA 865 127 (pKG + Nos + 35S) ND BDL162 pGXN Arabidopsis thaliana RNA 866 128 (pKG + Nos + 35S) ND BDL167 pGXN Arabidopsis thaliana RNA 867 196 (pKG + Nos + 35S) ND BDL168 pKS(Pks_J) Arabidopsis thaliana RNA 868 132 ND BDL169 pGXN Arabidopsis thaliana RNA 869 133 (pKG + Nos + 35S) ND BDL171 pGXN Arabidopsis thaliana RNA 870 927 (pKG + Nos + 35S) ND BDL173 pKS(Pks_J) Arabidopsis thaliana RNA 871 135 ND BDL174 pGXN Arabidopsis thaliana RNA 872 136 (pKG + Nos + 35S) ND BDL176 pKS(Pks_J) Arabidopsis thaliana RNA 873 137 ND BDL177 pGXN Arabidopsis thaliana RNA 874 138 (pKG + Nos + 35S) ND BDL181 pGXN Arabidopsis thaliana RNA 875 139 (pKG + Nos + 35S) ND BDL182 pGXN Arabidopsis thaliana RNA 876 140 (pKG + Nos + 35S) ND BDL183 pGXN Arabidopsis thaliana RNA 877 141 (pKG + Nos + 35S) ND BDL186 pGXN Arabidopsis thaliana RNA 878 928 (pKG + Nos + 35S) ND BDL187 pKS(Pks_J) Arabidopsis thaliana RNA 879 929 ND BDL188 pKS(Pks_J) Arabidopsis thaliana RNA 880 144 ND BDL189 Topo B Arabidopsis thaliana RNA 881 145 ND BDL190 pGXN Arabidopsis thaliana RNA 882 146 (pKG + Nos + 35S) ND BDL192 pGXN Arabidopsis thaliana RNA 883 147 (pKG + Nos + 35S) ND BDL193 pGXN Arabidopsis thaliana RNA 884 148 (pKG + Nos + 35S) ND BDL194 pKS(Pks_J) Arabidopsis thaliana RNA 885 149 ND BDL196 pGXN Arabidopsis thaliana RNA 886 150 (pKG + Nos + 35S) ND BDL197 pGXN Arabidopsis thaliana RNA 887 151 (pKG + Nos + 35S) ND BDL201 pGXN Arabidopsis thaliana RNA 888 153 (pKG + Nos + 35S) ND BDL203 pGXN Arabidopsis thaliana RNA 889 154 (pKG + Nos + 35S) ND BDL220 pGXN Arabidopsis thaliana RNA 890 156 (pKG + Nos + 35S) ND BDL221 pGXN Arabidopsis thaliana RNA 891 157 (pKG + Nos + 35S) ND BDL222 pGXN Arabidopsis thaliana RNA 892 158 (pKG + Nos + 35S) ND BDL223 pGXN Arabidopsis thaliana RNA 893 159 (pKG + Nos + 35S) ND BDL229 pGXN Arabidopsis thaliana RNA 894 160 (pKG + Nos + 35S) ND BDL230 pKS(Pks_J) Arabidopsis thaliana RNA 895 161 ND BDL231 pGXN Arabidopsis thaliana RNA 896 162 (pKG + Nos + 35S) ND BDL235 pKS(Pks_J) Arabidopsis thaliana RNA 897 163 ND BDL242 pGXN Arabidopsis thaliana RNA 898 164 (pKG + Nos + 35S) ND BDL245 pKS(Pks_J) Arabidopsis thaliana RNA 899 166 ND BDL247 pKS(Pks_J) Arabidopsis thaliana RNA 900 167 ND BDL248 pGXN Arabidopsis thaliana RNA 901 168 (pKG + Nos + 35S) ND BDL250 pGXN Arabidopsis thaliana RNA 902 169 (pKG + Nos + 35S) ND BDL49 pKS(Pks_J) Arabidopsis thaliana RNA 903 170 ND BDL58 pGXN Arabidopsis thaliana RNA 904 171 (pKG + Nos + 35S) ND BDL63 pGXN Arabidopsis thaliana RNA 905 172 (pKG + Nos + 35S) ND BDL64 Topo B Arabidopsis thaliana RNA 906 173 ND BDL85 pGXN Arabidopsis thaliana RNA 907 175 (pKG + Nos + 35S) ND BDL88 pGXN RICE Oryza sativa RNA 908 176 (pKG + Nos + 35S) L. Japonica ND BDL90 Topo B RICE Oryza sativa gDNA 909 Non Coding L. Japonica ND polynucleotide BDL94 pGXN Rice Japonica ND gDNA 910 930 (pKG + Nos + 35S) leaves BDL102 pGXN MAIZE Zea mays L. RNA 911 178 (pKG + Nos + 35S) ND BDL224 pGXN Arabidopsis thaliana RNA 912 179 (pKG + Nos + 35S) ND BDL225 pGXN Arabidopsis thaliana RNA 913 180 (pKG + Nos + 35S) ND BDL226 pKS(Pks_J) Arabidopsis thaliana RNA 914 181 ND BDL227 Topo B Arabidopsis thaliana RNA 915 182 ND BDL228 pGXN CASTOR BEAN RNA 916 931 (pKG + Nos + 35S) Ricinus communis L. ND BDL232 pGXN Arabidopsis thaliana RNA 917 184 (pKG + Nos + 35S) ND BDL233 pGXN Arabidopsis thaliana RNA 918 932 (pKG + Nos + 35S) ND BDL234 pKS(Pks_J) Arabidopsis thaliana RNA 919 186 ND BDL237 pGXN Arabidopsis thaliana RNA 920 187 (pKG + Nos + 35S) ND BDL238 pGXN Arabidopsis thaliana RNA 921 188 (pKG + Nos + 35S) ND BDL240 pGXN Arabidopsis thaliana RNA 922 189 (pKG + Nos + 35S) ND BDL241 pKS(Pks_J) Arabidopsis thaliana RNA 923 190 ND BDL249 pGXN Arabidopsis thaliana RNA 924 191 (pKG + Nos + 35S) ND BDL252 pKS(Pks_J) Arabidopsis thaliana RNA 925 193 ND BDL47 High copy plasmid Synthetic DNA 845 106 pMA BDL48 pGXN Arabidopsis thaliana RNA 846 107 (pKG + Nos + 35S) ND BDL200 High copy plasmid Synthetic DNA 47 152 Table 20: Cloned and synthetic genes are provided along with the sequence identifiers of their polynucleotides and polypeptides. Also provided are the source organism, tissue and the cloning vectors. ND = not a determined ecotype.
(374) Selected DNA sequences were synthesized by a commercial supplier GeneArt, GmbH [Hypertext Transfer Protocol://World Wide Web(dot)geneart(dot)com/)]. Synthetic DNA is designed in silico. Suitable restriction enzymes sites were added to the cloned sequences at the 5′ end and at the 3′ end to enabled later cloning into the pBXYN/pQXYN binary downstream of the CaMV 35S promoter (SEQ ID NO:1184). For example BDL47 (SEQ ID NO:1 was synthesized and the XbaI and SmaI restriction enzymes were added to the synthetic sequence in order to facilitate cloning.
(375) For 7 genes, namely BDL117, BDL171, BDL186, BDL187, BDL94, BDL228 and BDL233, the protein translation of the amplified cDNA sequence did not match the initial bioinformatics prediction of the protein sequences. The polypeptide sequences encoded by the cloned sequence were predicted and are provided in SEQ ID NO: 926-932.
Example 8
Producing Transgenic Arabidopsis Plants Expressing the Identified Polynucleotides of the Invention
(376) Materials and Experimental Methods
(377) Plant Transformation—
(378) The Arabidopsis thaliana var Columbia (T.sub.0 plants) were transformed according to the Floral Dip procedure [Clough S J, Bent A F. (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16(6): 735-43; and Desfeux C, Clough S J, Bent A F. (2000) Female reproductive tissues are the primary targets of Agrobacterium-mediated transformation by the Arabidopsis floral-dip method. Plant Physiol. 123(3): 895-904] with minor modifications. Briefly, Arabidopsis thaliana Columbia (Col0) T.sub.0 plants were sown in 250 ml pots filled with wet peat-based growth mix. The pots were covered with aluminum foil and a plastic dome, kept at 4° C. for 3-4 days, then uncovered and incubated in a growth chamber at 18-24° C. under 16/8 hours light/dark cycles. The T.sub.0 plants were ready for transformation six days before anthesis.
(379) Single colonies of Agrobacterium carrying the binary vectors harboring the seed oil genes were cultured in LB medium supplemented with kanamycin (50 mg/L) and gentamycin (50 mg/L). The cultures were incubated at 28° C. for 48 hours under vigorous shaking and centrifuged at 4000 rpm for 5 minutes. The pellets comprising Agrobacterium cells were resuspended in a transformation medium which contained half-strength (2.15 g/L) Murashige-Skoog (Duchefa); 0.044 μM benzylamino purine (Sigma); 112 μL B5 Gambourg vitamins (Sigma); 5% sucrose; and 0.2 ml/L Silwet L-77 (OSI Specialists, CT) in double-distilled water, at pH of 5.7.
(380) Transformation of T.sub.0 plants was performed by inverting each plant into an Agrobacterium suspension such that the above ground plant tissue was submerged for 3-5 seconds. Each inoculated T.sub.0 plant was immediately placed in a plastic tray, then covered with clear plastic dome to maintain humidity and was kept in the dark at room temperature for 18 hours to facilitate infection and transformation. Transformed (transgenic) plants were then uncovered and transferred to a greenhouse for recovery and maturation. The transgenic T.sub.0 plants were grown in the greenhouse for 3-5 weeks until siliques were brown and dry, then seeds were harvested from plants and kept at room temperature until sowing.
(381) For generating T.sub.1 and T.sub.2 transgenic plants harboring the genes, seeds collected from transgenic T.sub.0 plants were surface-sterilized by soaking in 70% ethanol for 1 minute, followed by soaking in 5% sodium hypochlorite and 0.05% triton for 5 minutes. The surface-sterilized seeds were thoroughly washed in sterile distilled water then placed on culture plates containing half-strength Murashig-Skoog (Duchefa); 2% sucrose; 0.8% plant agar; 50 mM kanamycin; and 200 mM carbenicylin (Duchefa). The culture plates were incubated at 4° C. for 48 hours then transferred to a growth room at 25° C. for an additional week of incubation. Vital T.sub.1 Arabidopsis plants were transferred to a fresh culture plates for another week of incubation. Following incubation the T.sub.1 plants were removed from culture plates and planted in growth mix contained in 250 ml pots. The transgenic plants were allowed to grow in a greenhouse to maturity. Seeds harvested from T.sub.1 plants were cultured and grown to maturity as T.sub.2 plants under the same conditions as used for culturing and growing the T.sub.1 plants.
Example 9
Improved Transgenic Plant Performance
(382) To analyze the effect of expression of the isolated polynucleotides in plants, plants were grown in pots with an adequate amount of nutrients and water. The plants were analyzed for their overall size, growth rate, time to inflorescence emergence (bolting) and flowering, seed yield, weight of 1,000 seeds, dry matter and harvest index [(HI) seed yield/dry matter]. Transgenic plants performance was compared to control plants grown in parallel under the same conditions. Mock-transgenic plants with an empty vector or expressing the uidA reporter gene (GUS-Intron) under the same promoter were used as control.
(383) Parameters were measured as described in Examples 2, 3 and 4 above.
(384) Statistical Analyses—
(385) Plant growth rate, plant area, time to bolt, time to flower, weight of 1,000 seeds, seed yield, oil yield, dry matter, and harvest index area data were analyzed using t-test. To identify outperforming genes and constructs, results from mix of transformation events or independent events were analyzed. For gene versus control analysis t-test was applied, using significance of p<0.1. The JMP statistics software package was used (Version 5.2.1, SAS Institute Inc., Cary, N.C., USA).
Experimental Results
(386) Plants expressing the polynucleotides of the invention were assayed for a number of commercially desired traits. Results are presented in Tables 21 and 22.
(387) Analysis of Plants in Tissue Culture Assay—
(388) Tables 21 and 22, hereinbelow, depict analyses of seed yield in plants overexpressing the polynucleotides of the invention under the regulation of the constitutive 35S (SEQ ID NO:1184) or At6669 (SEQ ID NO:1183) promoters. In cases where a certain event appears more than once, the event was tested in several independent experiments.
(389) TABLE-US-00021 TABLE 21 Results obtained in a tissue culture assay Leaf Leaf Leaf Roots Roots Roots Roots Area Area Area Length Length Length Coverage Gene Ev. Par. TP1 TP2 TP3 TP1 TP2 TP3 TP1 BDL102 10471.1 P 0.24 0.01 0.02 0.13 0.05 BDL102 10471.1 Av 1.15 1.59 1.39 1.23 2.34 BDL102 10471.3 P 0.6 0.03 0.01 0.09 0.01 BDL102 10471.3 Av 1.1 1.43 1.37 1.24 1.72 BDL102 10472.1 P 0.04 0.15 0.03 BDL102 10472.1 Av 1.27 1.1 1.54 BDL102 10474.2 P <0.01 <0.01 <0.01 0.23 0.13 BDL102 10474.2 Av 2.02 1.61 1.51 1.1 1.13 BDL102 10474.6 P 0.13 0.29 BDL102 10474.6 Av 1.21 1.14 BDL118 10481.2 P <0.01 0.01 0.01 0.46 BDL118 10481.2 Av 2.02 1.91 2 1.1 BDL118 10481.5 P 0.2 0.01 BDL118 10481.5 Av 1.15 1.29 BDL118 10484.3 P <0.01 <0.01 <0.01 BDL118 10484.3 Av 1.51 1.41 1.58 BDL140 10421.3 P 0.03 0.01 0.05 0.39 BDL140 10421.3 Av 1.61 1.72 1.68 1.18 BDL140 10423.1 P 0.21 0.09 0.28 0.01 0.11 0.19 BDL140 10423.1 Av 1.24 1.31 1.21 1.38 1.21 1.28 BDL140 10424.4 P <0.01 <0.01 0.01 BDL140 10424.4 Av 1.43 1.48 1.62 BDL152 10431.4 P 0.15 0.12 0.12 BDL152 10431.4 Av 1.17 1.18 1.18 BDL152 10432.5 P 0.37 0.01 0.07 0.14 0.35 BDL152 10432.5 Av 1.16 1.28 1.22 1.13 1.25 BDL152 10434.1 P 0.43 BDL152 10434.1 Av 1.12 BDL152 10434.4 P 0.08 0.04 0.01 <0.01 0.08 BDL152 10434.4 Av 1.18 1.52 1.48 1.31 2.33 BDL153 10142.2 P <0.01 <0.01 0.03 BDL153 10142.2 Av 1.83 1.43 1.99 BDL153 10144.1 P <0.01 0.02 0.07 0.31 0.15 0.7 BDL153 10144.1 Av 1.3 1.31 1.38 1.13 1.12 1.1 BDL153 10144.4 P 0.03 BDL153 10144.4 Av 1.28 BDL154 10703.1 P 0.09 0.14 0.05 0.09 BDL154 10703.1 Av 1.36 1.14 1.2 1.77 BDL154 10703.11 P 0.01 0.17 0.3 0.5 BDL154 10703.11 Av 1.37 1.21 1.16 1.18 BDL154 10703.6 P 0.42 BDL154 10703.6 Av 1.23 BDL154 10703.1 P <0.01 <0.01 <0.01 0.11 0.02 BDL154 10703.1 Av 1.34 1.5 1.61 1.14 1.18 BDL154 10703.5 P 0.46 0.36 0.02 0.02 0.21 BDL154 10703.5 Av 1.1 1.16 1.47 1.39 1.52 BDL154 10703.6 P 0.24 0.06 0.07 0.15 BDL154 10703.6 Av 1.19 1.33 1.24 1.59 BDL155 9994.3 P 0.22 BDL155 9994.3 Av 1.15 BDL156 10853.6 P 0.08 BDL156 10853.6 Av 1.12 BDL156 10852.6 P 0.15 BDL156 10852.6 Av 1.15 BDL156 10853.6 P 0.07 0.01 0.24 BDL156 10853.6 Av 1.34 1.71 1.22 BDL156 10854.4 P 0.11 0.11 <0.01 0.01 BDL156 10854.4 Av 1.13 1.26 1.66 1.24 BDL156 10855.3 P 0.01 0.1 BDL156 10855.3 Av 1.35 1.2 BDL158 9973.3 P 0.01 0.03 0.17 0.09 BDL158 9973.3 Av 1.21 1.27 1.1 1.21 BDL158 9971.3 P 0.42 0.32 0.27 BDL158 9971.3 Av 1.13 1.13 1.11 BDL158 9973.1 P 0.08 0.24 0.17 0.02 BDL158 9973.1 Av 1.27 1.16 1.13 1.37 BDL158 9973.3 P <0.01 0.02 0.06 0.01 BDL158 9973.3 Av 1.66 1.39 1.17 2.06 BDL158 9974.2 P <0.01 <0.01 0.09 BDL158 9974.2 Av 1.68 1.58 1.23 BDL158 9974.3 P <0.01 <0.01 0.13 BDL158 9974.3 Av 1.76 1.62 1.58 BDL158 9971.3 P 0.07 0.15 0.02 BDL158 9971.3 Av 1.22 1.2 1.15 BDL158 9973.1 P 0.01 0.41 0.03 <0.01 <0.01 0.08 0.02 BDL158 9973.1 Av 1.28 1.11 1.35 1.49 1.35 1.26 1.8 BDL158 9973.3 P <0.01 <0.01 <0.01 0.02 BDL158 9973.3 Av 1.36 1.52 1.39 1.51 BDL160 10011.5 P 0.01 0.22 0.15 BDL160 10011.5 Av 1.41 1.2 1.26 BDL160 10011.5 P 0.45 BDL160 10011.5 Av 1.25 BDL160 10011.7 P 0.04 0.01 BDL160 10011.7 Av 1.34 1.95 BDL160 10013.1 P 0.53 BDL160 10013.1 Av 1.11 BDL160 10014.9 P 0.2 0.39 0.61 BDL160 10014.9 Av 1.17 1.15 1.11 BDL160 10015.2 P 0.07 0.12 BDL160 10015.2 Av 1.19 1.22 BDL167 10042.3 P <0.01 BDL167 10042.3 Av 1.3 BDL167 10043.1 P <0.01 0.02 0.14 BDL167 10043.1 Av 1.37 1.18 1.2 BDL167 10043.2 P 0.06 0.13 0.03 BDL167 10043.2 Av 1.61 1.29 1.23 BDL167 10043.3 P 0.01 0.01 <0.01 0.01 BDL167 10043.3 Av 1.93 1.58 1.61 1.25 BDL167 10044.2 P <0.01 0.01 0.02 0.05 0.04 0.03 BDL167 10044.2 Av 1.63 1.43 1.43 1.28 1.23 1.23 BDL167 10043.1 P <0.01 <0.01 0.15 <0.01 0.12 0.47 BDL167 10043.1 Av 1.56 1.53 1.43 1.22 1.1 1.1 BDL167 10044.2 P <0.01 <0.01 <0.01 BDL167 10044.2 Av 1.45 1.18 2.16 BDL168 9881.3 P 0.15 0.04 BDL168 9881.3 Av 1.23 1.67 BDL168 9881.4 P <0.01 <0.01 <0.01 0.02 BDL168 9881.4 Av 1.89 1.72 1.38 2.28 BDL168 9882.1 P 0.01 0.01 0.04 <0.01 BDL168 9882.1 Av 1.9 1.68 1.29 2.57 BDL168 9883.3 P 0.2 BDL168 9883.3 Av 1.38 BDL168 9884.1 P <0.01 <0.01 0.02 0.02 BDL168 9884.1 Av 2.05 1.73 1.38 2.61 BDL169 10744.2 P 0.08 0.02 0.08 0.29 BDL169 10744.2 Av 1.24 1.23 1.19 1.11 BDL169 10747.1 P 0.03 0.09 0.13 BDL169 10747.1 Av 1.15 1.12 1.11 BDL169 10747.5 P 0.06 0.01 <0.01 0.12 BDL169 10747.5 Av 1.62 1.59 1.4 1.73 BDL171 10661.2 P 0.25 0.28 <0.01 <0.01 <0.01 0.03 BDL171 10661.2 Av 1.19 1.23 1.62 1.65 1.39 1.8 BDL171 10661.5 P 0.02 0.04 0.12 BDL171 10661.5 Av 1.45 1.35 1.24 BDL171 10664.1 P 0.31 0.3 0.25 0.15 0.27 0.31 0.44 BDL171 10664.1 Av 1.17 1.18 1.23 1.23 1.15 1.14 1.17 BDL173 9951.2 P 0.18 0.42 0.3 BDL173 9951.2 Av 1.17 1.11 1.17 BDL173 9952.1 P <0.01 <0.01 <0.01 <0.01 BDL173 9952.1 Av 2.17 1.99 1.45 3.32 BDL173 9952.2 P 0.35 <0.01 <0.01 0.01 0.02 BDL173 9952.2 Av 1.12 1.72 1.63 1.24 2.07 BDL174 11082.1 P 0.2 0.06 0.42 BDL174 11082.1 Av 1.14 1.17 1.18 BDL174 11083.1 P <0.01 <0.01 0.07 <0.01 <0.01 0.01 0.01 BDL174 11083.1 Av 1.64 1.32 1.2 1.78 1.67 1.39 1.66 BDL174 11083.2 P 0.04 0.17 0.12 0.14 0.18 BDL174 11083.2 Av 1.2 1.16 1.25 1.34 1.32 BDL174 11084.1 P <0.01 <0.01 <0.01 0.03 0.1 0.03 BDL174 11084.1 Av 2.56 2.29 2.1 1.31 1.31 1.68 BDL174 11085.1 P 0.41 0.07 <0.01 <0.01 <0.01 <0.01 BDL174 11085.1 Av 1.11 1.24 1.95 2.33 1.98 1.71 BDL174 11083.2 P <0.01 <0.01 0.01 0.3 0.31 BDL174 11083.2 Av 1.41 1.35 1.21 1.16 1.27 BDL174 11084.1 P 0.15 <0.01 BDL174 11084.1 Av 1.22 2.13 BDL174 11085.1 P <0.01 0.01 0.04 0.01 BDL174 11085.1 Av 2.04 1.36 1.16 2.33 BDL176 9891.4 P 0.1 0.05 0.06 BDL176 9891.4 Av 1.1 1.17 1.36 BDL176 9893.2 P 0.04 <0.01 0.27 BDL176 9893.2 Av 1.28 1.26 1.22 BDL176 9893.3 P 0.38 BDL176 9893.3 Av 1.13 BDL176 9893.2 P 0.15 BDL176 9893.2 Av 1.2 BDL176 9893.3 P 0.05 0.01 0.36 0.16 BDL176 9893.3 Av 1.42 1.34 1.16 1.42 BDL177 10521.3 P 0.23 BDL177 10521.3 Av 1.16 BDL177 10524.2 P 0.13 BDL177 10524.2 Av 1.16 BDL181 11293.6 P 0.32 BDL181 11293.6 Av 1.18 BDL181 11294.7 P 0.36 BDL181 11294.7 Av 1.13 BDL181 11293.1 P 0.6 BDL181 11293.1 Av 1.11 BDL181 11293.6 P 0.01 <0.01 BDL181 11293.6 Av 1.2 1.27 BDL181 11294.7 P 0.16 0.17 BDL181 11294.7 Av 1.1 1.1 BDL182 10691.8 P 0.03 0.07 0.16 BDL182 10691.8 Av 1.32 1.24 1.18 BDL182 10692.2 P 0.17 0.08 0.19 BDL182 10692.2 Av 1.19 1.27 1.2 BDL182 10693.3 P 0.01 0.07 0.1 0.17 0.1 0.11 BDL182 10693.3 Av 1.55 1.44 1.31 1.17 1.17 1.1 BDL182 10693.5 P 0.04 0.24 0.12 <0.01 <0.01 <0.01 0.48 BDL182 10693.5 Av 1.33 1.15 1.22 1.39 1.33 1.21 1.1 BDL183 9943.4 P 0.02 0.11 0.02 BDL183 9943.4 Av 1.26 1.17 1.61 BDL183 9944.4 P 0.01 <0.01 0.02 0.36 BDL183 9944.4 Av 1.24 1.36 1.21 1.26 BDL189 11351.2 P 0.05 BDL189 11351.2 Av 1.17 BDL189 11353.3 P 0.22 0.04 0.11 BDL189 11353.3 Av 1.19 1.2 1.17 BDL189 11353.5 P 0.26 BDL189 11353.5 Av 1.1 BDL189 11355.4 P 0.12 0.12 0.1 BDL189 11355.4 Av 1.12 1.11 1.11 BDL189 11356.7 P 0.27 BDL189 11356.7 Av 1.11 BDL196 10242.2 P 0.02 0.09 0.05 0.03 0.09 BDL196 10242.2 Av 1.18 1.13 1.29 1.28 1.16 BDL196 10243.4 P 0.09 0.25 0.24 0.13 0.05 0.17 <0.01 BDL196 10243.4 Av 1.16 1.23 1.24 1.11 1.25 1.15 1.74 BDL196 10244.1 P <0.01 0.07 0.23 0.21 BDL196 10244.1 Av 1.21 1.19 1.22 1.33 BDL196 10243.3 P 0.02 0.68 BDL196 10243.3 Av 1.16 1.1 BDL196 10243.4 P 0.01 <0.01 0.23 BDL196 10243.4 Av 1.24 1.49 1.12 BDL197 11362.2 P 0.14 BDL197 11362.2 Av 1.17 BDL197 11363.1 P 0.04 BDL197 11363.1 Av 1.17 BDL197 11363.6 P 0.15 BDL197 11363.6 Av 1.17 BDL197 11364.1 P 0.08 0.01 0.09 BDL197 11364.1 Av 1.14 1.42 1.15 BDL197 11364.5 P 0.09 0.04 BDL197 11364.5 Av 1.12 1.25 BDL197 11363.6 P 0.2 0.07 BDL197 11363.6 Av 1.11 1.19 BDL201 9961.2 P 0.02 0.18 0.39 BDL201 9961.2 Av 1.41 1.18 1.18 BDL201 9961.3 P 0.08 0.13 BDL201 9961.3 Av 1.21 1.28 BDL201 9961.4 P 0.06 0.15 0.43 0.02 BDL201 9961.4 Av 1.37 1.25 1.11 1.76 BDL201 9964.3 P <0.01 0.01 0.02 BDL201 9964.3 Av 1.34 1.24 1.84 BDL220 10331.2 P <0.01 <0.01 0.15 BDL220 10331.2 Av 1.75 1.37 1.15 BDL220 10331.5 P 0.01 0.02 0.05 BDL220 10331.5 Av 1.48 1.64 1.75 BDL220 10334.2 P <0.01 <0.01 0.04 BDL220 10334.2 Av 1.58 1.37 1.21 BDL221 10341.3 P 0.13 0.13 0.06 BDL221 10341.3 Av 1.26 1.19 1.44 BDL221 10341.4 P <0.01 0.01 <0.01 BDL221 10341.4 Av 1.57 1.3 1.35 BDL221 10343.3 P 0.11 0.06 0.01 <0.01 <0.01 0.13 BDL221 10343.3 Av 1.1 1.16 1.37 1.4 1.4 1.55 BDL221 10341.1 P 0.26 0.45 0.19 BDL221 10341.1 Av 1.18 1.15 1.26 BDL221 10342.1 P <0.01 <0.01 0.02 <0.01 <0.01 <0.01 <0.01 BDL221 10342.1 Av 1.9 1.46 1.32 2.02 2.08 1.68 4.31 BDL221 10343.1 P 0.18 0.05 0.07 0.26 <0.01 <0.01 <0.01 BDL221 10343.1 Av 1.3 1.51 1.58 1.12 1.35 1.32 1.67 BDL221 10343.3 P <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 BDL221 10343.3 Av 2.7 1.8 1.59 1.75 2.12 1.87 2.4 BDL221 10343.4 P 0.05 0.11 0.19 0.01 <0.01 0.05 0.02 BDL221 10343.4 Av 1.88 1.56 1.57 1.46 1.65 1.49 2.07 BDL221 10344.3 P 0.02 0.01 0.05 0.1 0.18 <0.01 BDL221 10344.3 Av 1.9 1.61 1.56 1.14 1.12 1.63 BDL223 10793.5 P 0.11 BDL223 10793.5 Av 1.14 BDL223 10793.8 P 0.21 0.17 0.08 BDL223 10793.8 Av 1.18 1.17 1.18 BDL223 10796.2 P <0.01 0.06 BDL223 10796.2 Av 1.22 1.14 BDL223 10791.1 P 0.07 0.12 0.03 BDL223 10791.1 Av 1.21 1.17 1.2 BDL223 10793.3 P 0.01 0.04 0.02 0.14 BDL223 10793.3 Av 1.33 1.3 1.55 1.18 BDL223 10793.5 P 0.07 0.04 BDL223 10793.5 Av 1.14 1.18 BDL223 10793.8 P 0.08 0.08 <0.01 <0.01 <0.01 <0.01 BDL223 10793.8 Av 1.17 1.19 1.54 1.65 1.5 1.64 BDL223 10796.1 P 0.11 BDL223 10796.1 Av 1.15 BDL224 10451.3 P 0.29 BDL224 10451.3 Av 1.11 BDL224 10451.5 P 0.1 BDL224 10451.5 Av 1.15 BDL224 10451.7 P <0.01 <0.01 0.01 0.03 0.07 0.23 0.16 BDL224 10451.7 Av 1.58 1.69 1.8 1.39 1.26 1.19 1.41 BDL226 10861.2 P 0.4 BDL226 10861.2 Av 1.1 BDL227 11491.1 P <0.01 <0.01 0.03 0.01 BDL227 11491.1 Av 1.5 1.46 1.21 1.95 BDL227 11491.3 P <0.01 <0.01 <0.01 0.01 <0.01 0.02 0.04 BDL227 11491.3 Av 2.12 1.6 1.42 1.64 1.65 1.56 2.26 BDL227 11491.5 P <0.01 <0.01 0.02 <0.01 <0.01 0.01 <0.01 BDL227 11491.5 Av 1.84 1.53 1.42 1.78 1.85 1.64 2.73 BDL227 11492.5 P <0.01 <0.01 0.01 0.26 0.03 0.04 0.01 BDL227 11492.5 Av 2.13 1.91 1.72 1.17 1.48 1.32 1.58 BDL227 11493.5 P <0.01 <0.01 0.02 0.33 <0.01 <0.01 0.02 BDL227 11493.5 Av 1.55 1.63 1.74 1.1 1.47 1.47 1.53 BDL230 10671.3 P <0.01 0.06 0.01 BDL230 10671.3 Av 1.36 1.44 1.81 BDL230 10671.5 P 0.33 0.49 0.46 BDL230 10671.5 Av 1.22 1.16 1.11 BDL231 11111.1 P <0.01 <0.01 <0.01 BDL231 11111.1 Av 1.55 1.53 1.51 BDL231 11111.2 P 0.11 0.15 0.04 0.19 0.04 BDL231 11111.2 Av 1.12 1.12 1.28 1.15 1.19 BDL231 11111.3 P <0.01 0.04 0.05 BDL231 11111.3 Av 1.35 1.26 1.37 BDL231 11112.2 P <0.01 0.01 0.03 <0.01 <0.01 <0.01 0.01 BDL231 11112.2 Av 1.72 1.43 1.38 2.08 1.68 1.48 2.34 BDL231 11116.5 P <0.01 <0.01 <0.01 <0.01 0.01 0.03 <0.01 BDL231 11116.5 Av 1.82 1.77 1.76 1.67 1.38 1.31 1.92 BDL231 11111.1 P <0.01 <0.01 <0.01 0.36 0.07 BDL231 11111.1 Av 1.88 1.78 1.49 1.11 1.43 BDL231 11111.2 P 0.01 0.03 0.01 0.01 0.1 0.05 BDL231 11111.2 Av 1.66 1.6 1.45 1.28 1.15 1.51 BDL231 11111.3 P 0.01 0.26 0.53 BDL231 11111.3 Av 1.31 1.1 1.1 BDL231 11112.2 P 0.24 0.17 <0.01 <0.01 <0.01 BDL231 11112.2 Av 1.12 1.12 1.51 1.3 1.97 BDL231 11116.5 P 0.11 0.24 BDL231 11116.5 Av 1.19 1.35 BDL232 10904.1 P 0.61 0.54 0.43 0.23 BDL232 10904.1 Av 1.17 1.2 1.1 1.14 BDL232 10905.1 P 0.02 <0.01 0.05 0.02 BDL232 10905.1 Av 1.5 1.46 1.25 1.4 BDL232 10906.3 P 0.25 0.14 0.59 0.25 BDL232 10906.3 Av 1.29 1.45 1.1 1.21 BDL232 10902.2 P <0.01 <0.01 0.06 0.01 BDL232 10902.2 Av 1.7 1.47 1.24 2.1 BDL232 10905.1 P <0.01 0.01 0.09 0.03 BDL232 10905.1 Av 1.59 1.42 1.2 2.17 BDL233 10825.4 P <0.01 <0.01 <0.01 <0.01 BDL233 10825.4 Av 1.47 1.45 1.35 2.01 BDL233 10822.4 P 0.14 BDL233 10822.4 Av 1.23 BDL233 10824.2 P 0.05 BDL233 10824.2 Av 1.16 BDL233 10825.3 P 0.26 BDL233 10825.3 Av 1.27 BDL233 10825.4 P 0.24 <0.01 <0.01 <0.01 0.19 BDL233 10825.4 Av 1.17 1.56 1.59 1.51 1.3 BDL235 11413.2 P <0.01 0.01 0.03 0.18 BDL235 11413.2 Av 1.63 1.3 1.19 1.43 BDL235 11413.2 P <0.01 <0.01 0.05 0.01 BDL235 11413.2 Av 1.57 1.45 1.29 2.12 BDL237 10892.2 P 0.16 0.28 0.12 0.09 BDL237 10892.2 Av 1.21 1.1 1.12 1.4 BDL237 10893.1 P <0.01 0.02 0.14 0.19 0.28 BDL237 10893.1 Av 1.96 1.39 1.24 1.13 1.14 BDL237 10895.3 P <0.01 <0.01 0.01 0.01 <0.01 <0.01 0.02 BDL237 10895.3 Av 2.2 1.99 1.9 1.84 1.97 1.79 2.09 BDL237 10896.1 P 0.19 0.49 BDL237 10896.1 Av 1.29 1.1 BDL238 10951.4 P 0.08 0.01 BDL238 10951.4 Av 1.2 1.69 BDL238 10952.3 P 0.05 BDL238 10952.3 Av 1.2 BDL238 10953.3 P 0.32 BDL238 10953.3 Av 1.5 BDL238 10954.2 P 0.05 0.59 BDL238 10954.2 Av 1.24 1.13 BDL238 10954.3 P 0.09 0.03 0.17 0.26 0.17 BDL238 10954.3 Av 1.16 1.3 1.12 1.1 1.45 BDL238 10951.4 P 0.13 0.04 0.23 0.17 BDL238 10951.4 Av 1.22 1.24 1.11 1.39 BDL238 10952.3 P 0.02 0.01 0.02 0.11 BDL238 10952.3 Av 1.44 1.43 1.37 1.54 BDL238 10954.2 P 0.02 0.08 0.17 0.22 BDL238 10954.2 Av 1.26 1.2 1.17 1.2 BDL240 10802.2 P <0.01 0.2 0.31 0.16 0.1 0.1 BDL240 10802.2 Av 1.57 1.23 1.17 1.17 1.19 1.25 BDL240 10803.5 P 0.11 0.4 0.31 BDL240 10803.5 Av 1.4 1.11 1.16 BDL240 10806.4 P <0.01 0.18 BDL240 10806.4 Av 1.29 1.16 BDL240 10806.6 P 0.02 0.02 0.04 0.02 0.01 0.01 0.03 BDL240 10806.6 Av 2.29 1.87 1.52 1.59 1.63 1.49 3.75 BDL241 10873.1 P 0.51 BDL241 10873.1 Av 1.2 BDL241 10874.3 P 0.32 BDL241 10874.3 Av 1.42 BDL241 10875.1 P 0.04 0.01 0.13 <0.01 BDL241 10875.1 Av 1.4 1.34 1.21 2.29 BDL241 10874.3 P <0.01 <0.01 0.02 0.1 BDL241 10874.3 Av 1.34 1.34 1.43 1.15 BDL241 10875.1 P <0.01 0.03 0.3 0.03 BDL241 10875.1 Av 1.32 1.29 1.16 1.52 BDL242 10731.3 P 0.03 0.06 0.18 0.11 BDL242 10731.3 Av 1.12 1.14 1.13 1.36 BDL242 10731.5 P 0.4 0.11 0.18 0.32 BDL242 10731.5 Av 1.13 1.16 1.1 1.23 BDL242 10731.2 P 0.36 BDL242 10731.2 Av 1.2 BDL242 10731.3 P <0.01 <0.01 <0.01 0.02 <0.01 0.03 BDL242 10731.3 Av 3.13 2.79 2.3 1.26 1.27 1.65 BDL242 10731.5 P 0.06 0.05 0.05 <0.01 BDL242 10731.5 Av 1.45 1.21 1.16 1.77 BDL242 10731.7 P <0.01 <0.01 <0.01 0.04 <0.01 <0.01 0.14 BDL242 10731.7 Av 2.48 1.8 1.61 1.36 1.41 1.3 1.72 BDL242 10737.2 P 0.03 0.04 <0.01 0.47 BDL242 10737.2 Av 2.07 1.86 1.9 1.1 BDL247 10911.1 P <0.01 0.08 0.23 BDL247 10911.1 Av 1.29 1.2 1.13 BDL247 10912.1 P 0.24 BDL247 10912.1 Av 1.13 BDL247 10912.6 P 0.19 BDL247 10912.6 Av 1.19 BDL247 10915.1 P 0.54 0.42 BDL247 10915.1 Av 1.11 1.12 BDL247 10911.1 P 0.01 0.05 0.02 0.02 0.06 0.05 0.05 BDL247 10911.1 Av 2.19 1.85 1.68 1.46 1.53 1.46 2.05 BDL247 10912.1 P <0.01 <0.01 0.15 0.21 0.22 BDL247 10912.1 Av 1.48 1.28 1.24 1.11 1.12 BDL247 10912.2 P 0.02 0.01 0.01 0.04 <0.01 BDL247 10912.2 Av 1.66 1.57 1.41 1.28 1.38 BDL247 10912.6 P 0.45 0.38 0.37 BDL247 10912.6 Av 1.1 1.1 1.13 BDL247 10915.1 P <0.01 0.01 <0.01 0.35 0.25 BDL247 10915.1 Av 2.22 2.04 1.88 1.15 1.29 BDL248 11051.2 P 0.15 0.1 0.01 0.01 0.01 <0.01 0.09 BDL248 11051.2 Av 1.21 1.26 1.34 1.29 1.44 1.38 1.66 BDL248 11052.2 P <0.01 <0.01 <0.01 0.01 <0.01 0.01 BDL248 11052.2 Av 2.25 2.23 1.94 1.35 1.33 1.39 BDL248 11053.3 P 0.03 0.02 0.01 <0.01 0.01 0.02 <0.01 BDL248 11053.3 Av 1.56 1.5 1.33 1.38 1.44 1.35 2.29 BDL248 11054.3 P 0.38 0.4 0.21 0.09 BDL248 11054.3 Av 1.11 1.13 1.13 1.18 BDL248 11051.2 P 0.05 BDL248 11051.2 Av 1.1 BDL249 11401.2 P <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 0.01 BDL249 11401.2 Av 3.01 2.92 2.73 1.78 1.84 1.71 3.51 BDL249 11401.5 P <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 BDL249 11401.5 Av 2.17 1.83 1.52 1.66 1.64 1.41 3.31 BDL249 11402.4 P 0.01 0.01 0.03 0.18 <0.01 <0.01 0.04 BDL249 11402.4 Av 1.49 1.44 1.39 1.14 1.64 1.49 1.54 BDL249 11403.2 P 0.48 0.19 0.26 BDL249 11403.2 Av 1.12 1.2 1.16 BDL249 11404.3 P 0.09 0.07 0.02 0.12 BDL249 11404.3 Av 1.41 1.4 1.26 1.57 BDL249 11401.2 P 0.29 0.2 0.17 BDL249 11401.2 Av 1.11 1.1 1.21 BDL249 11401.5 P 0.17 0.46 BDL249 11401.5 Av 1.2 1.21 BDL249 11403.2 P 0.04 0.15 0.35 BDL249 11403.2 Av 1.3 1.13 1.23 BDL249 11404.3 P 0.21 0.04 0.12 0.35 BDL249 11404.3 Av 1.11 1.27 1.19 1.14 BDL250 10841.3 P 0.01 0.12 0.17 BDL250 10841.3 Av 1.26 1.23 1.12 BDL250 10842.3 P 0.05 0.23 <0.01 <0.01 <0.01 0.03 BDL250 10842.3 Av 1.16 1.12 1.55 1.5 1.38 1.39 BDL250 10846.2 P <0.01 <0.01 <0.01 BDL250 10846.2 Av 1.36 1.37 1.29 BDL250 10846.3 P 0.09 <0.01 <0.01 0.12 BDL250 10846.3 Av 1.33 1.39 1.29 1.44 BDL250 10841.3 P 0.01 0.1 0.09 <0.01 <0.01 <0.01 0.01 BDL250 10841.3 Av 1.23 1.21 1.22 1.82 1.89 1.68 2.37 BDL250 10842.3 P 0.05 0.15 0.26 <0.01 0.23 0.48 0.02 BDL250 10842.3 Av 1.73 1.59 1.5 1.4 1.26 1.14 2.03 BDL250 10843.2 P 0.01 0.02 0.04 <0.01 0.01 0.01 <0.01 BDL250 10843.2 Av 1.97 1.67 1.61 1.37 1.44 1.37 2.33 BDL250 10846.2 P <0.01 0.01 <0.01 0.11 0.02 <0.01 0.08 BDL250 10846.2 Av 2.3 1.59 1.69 1.21 1.33 1.36 1.39 BDL250 10846.3 P <0.01 <0.01 <0.01 0.01 <0.01 <0.01 0.01 BDL250 10846.3 Av 1.92 1.69 1.78 1.66 1.98 1.79 2.83 BDL252 10881.1 P <0.01 <0.01 <0.01 0.13 0.01 <0.01 0.04 BDL252 10881.1 Av 1.96 1.94 1.72 1.29 1.48 1.42 1.52 BDL252 10882.1 P <0.01 <0.01 <0.01 0.05 0.01 0.01 0.02 BDL252 10882.1 Av 2.97 2.36 2.12 1.65 1.88 1.77 3.43 BDL252 10882.2 P <0.01 <0.01 <0.01 0.03 0.04 <0.01 0.03 BDL252 10882.2 Av 1.89 1.48 1.43 1.47 1.54 1.45 2.04 BDL252 10882.4 P 0.03 <0.01 0.11 <0.01 0.01 0.03 0.01 BDL252 10882.4 Av 1.64 1.4 1.3 1.7 1.48 1.31 2.99 BDL252 10884.1 P <0.01 0.02 0.13 BDL252 10884.1 Av 1.55 1.31 1.17 BDL58 10281.5 P 0.23 0.48 0.16 BDL58 10281.5 Av 1.25 1.18 1.3 BDL58 10282.3 P <0.01 <0.01 0.01 0.12 <0.01 <0.01 0.26 BDL58 10282.3 Av 1.79 1.72 1.77 1.27 1.62 1.62 1.43 BDL62 10682.1 P 0.53 BDL62 10682.1 Av 1.16 BDL62 10684.2 P 0.01 0.22 BDL62 10684.2 Av 1.43 1.3 BDL62 10682.1 P 0.37 0.56 BDL62 10682.1 Av 1.17 1.16 BDL62 10684.2 P 0.09 BDL62 10684.2 Av 1.13 BDL64 10651.5 P 0.08 0.27 BDL64 10651.5 Av 1.26 1.56 BDL64 10653.1 P 0.01 0.06 0.01 BDL64 10653.1 Av 1.24 1.23 1.53 BDL64 10654.3 P 0.32 0.3 0.2 0.04 0.09 BDL64 10654.3 Av 1.21 1.38 1.11 1.4 1.4 BDL64 10651.1 P 0.53 BDL64 10651.1 Av 1.11 BDL64 10653.1 P 0.11 0.02 0.05 0.01 <0.01 0.01 0.14 BDL64 10653.1 Av 1.34 1.57 1.61 1.34 1.42 1.28 1.34 BDL64 10654.3 P 0.01 <0.01 <0.01 <0.01 <0.01 0.01 0.29 BDL64 10654.3 Av 1.41 1.49 1.46 1.28 1.29 1.23 1.27 BDL64 10651.1 P <0.01 <0.01 0.02 0.15 0.2 BDL64 10651.1 Av 1.5 1.31 1.41 1.13 1.44 BDL64 10651.3 P <0.01 <0.01 0.13 <0.01 BDL64 10651.3 Av 1.96 1.41 1.15 3.02 BDL64 10653.1 P 0.03 0.3 0.08 BDL64 10653.1 Av 1.64 1.18 1.64 BDL64 10654.3 P <0.01 0.22 0.04 BDL64 10654.3 Av 1.82 1.23 2.34 BDL79 11041.1 P 0.62 BDL79 11041.1 Av 1.12 BDL79 11042.1 P 0.61 BDL79 11042.1 Av 1.13 BDL79 11043.1 P 0.08 BDL79 11043.1 Av 1.64 BDL79 11042.3 P 0.33 BDL79 11042.3 Av 1.12 BDL79 11043.1 P 0.04 0.17 <0.01 0.01 0.37 BDL79 11043.1 Av 1.23 1.19 1.36 1.29 1.19 BDL81 10372.2 P <0.01 0.35 0.43 BDL81 10372.2 Av 1.25 1.11 1.13 BDL81 10374.1 P 0.3 BDL81 10374.1 Av 1.24 BDL85 10411.3 P 0.08 0.03 BDL85 10411.3 Av 1.15 1.12 BDL85 10414.1 P 0.2 0.04 BDL85 10414.1 Av 1.16 1.26 BDL85 10414.2 P 0.19 0.02 <0.01 BDL85 10414.2 Av 1.1 1.2 1.35 BDL88 10291.2 P 0.01 0.03 0.03 0.07 BDL88 10291.2 Av 1.88 1.59 1.52 1.13 BDL88 10291.4 P 0.02 <0.01 <0.01 0.03 <0.01 BDL88 10291.4 Av 1.45 1.43 1.53 1.21 1.28 BDL88 10291.5 P 0.12 0.15 0.37 0.67 BDL88 10291.5 Av 1.43 1.35 1.17 1.11 BDL88 10293.3 P <0.01 <0.01 <0.01 0.57 BDL88 10293.3 Av 2.76 2.34 2.24 1.12 BDL88 10291.2 P <0.01 <0.01 <0.01 BDL88 10291.2 Av 1.64 1.57 1.58 BDL88 10291.4 P <0.01 <0.01 <0.01 BDL88 10291.4 Av 1.67 1.5 1.53 BDL88 10291.5 P <0.01 <0.01 <0.01 BDL88 10291.5 Av 1.8 1.7 1.84 BDL88 10293.3 P 0.03 0.05 0.06 BDL88 10293.3 Av 1.19 1.16 1.22 BDL88 10294.2 P <0.01 0.01 0.02 BDL88 10294.2 Av 1.82 1.66 1.78 BDL90 10924.2 P 0.05 0.01 <0.01 0.16 BDL90 10924.2 Av 1.43 1.55 1.48 1.9 BDL90 10925.4 P <0.01 <0.01 <0.01 0.07 BDL90 10925.4 Av 1.95 1.91 1.62 2.22 BDL90 10924.2 P 0.12 0.2 0.09 0.02 0.01 0.01 0.04 BDL90 10924.2 Av 1.32 1.23 1.22 1.31 1.31 1.31 1.93 BDL90 10925.4 P 0.04 0.12 <0.01 <0.01 <0.01 0.02 BDL90 10925.4 Av 1.25 1.15 1.68 1.61 1.51 2.25 BDL90 10921.6 P 0.1 BDL90 10921.6 Av 1.19 BDL90 10924.2 P 0.38 <0.01 <0.01 <0.01 0.03 BDL90 10924.2 Av 1.13 1.48 1.6 1.51 1.41 BDL90 10925.4 P <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 BDL90 10925.4 Av 1.6 1.66 1.8 1.85 1.81 1.71 2.9 BDL94 11721.4 P 0.04 0.03 0.07 BDL94 11721.4 Av 1.41 1.39 1.16 BDL94 11725.2 P 0.04 BDL94 11725.2 Av 1.16 BDL94 11725.3 P 0.04 BDL94 11725.3 Av 1.21 BDL94 11725.5 P 0.14 BDL94 11725.5 Av 1.1 BDL94 11725.3 P 0.01 BDL94 11725.3 Av 1.29 Table 21. “P” = P-value; “Av” = ratio between the averages of event and control. Note that when the average ratio is higher than “1” the effect of exogenous expression of the gene is an increase of the desired trait; “Par” = Parameter according to the measured parameters; “Ev” = event. TP1 = Time point 1; TP2 = Time point 2; TP3 = Time point 3.
(390) TABLE-US-00022 TABLE 22 Results obtained in a tissue culture assay Roots Roots RGR RGR RGR Coverage Coverage Of Leaf Of Root Of Roots Fresh Dry Gene Ev. Par. TP2 TP3 Area Coverage Length Weight Weight BDL102 10471.1 P 0.08 0.05 0.11 0.36 BDL102 10471.1 Av 1.58 1.35 1.26 1.11 BDL102 10471.3 P 0.08 0.15 0.02 0.15 BDL102 10471.3 Av 1.72 1.58 1.57 1.18 BDL102 10472.1 P 0.19 0.28 0.25 0.29 BDL102 10472.1 Av 1.28 1.22 1.19 1.18 BDL102 10474.2 P 0.33 0.16 0.01 0.02 0.07 0.21 0.26 BDL102 10474.2 Av 1.22 1.38 1.4 1.44 1.19 1.53 1.5 BDL102 10474.6 P 0.2 0.31 0.14 BDL102 10474.6 Av 1.19 1.15 1.22 BDL118 10481.2 P 0.13 0.24 <0.01 0.14 0.28 0.03 0.01 BDL118 10481.2 Av 1.2 1.19 1.99 1.23 1.15 2.14 1.99 BDL118 10481.5 P 0.01 0.02 0.01 BDL118 10481.5 Av 1.36 2.03 1.97 BDL118 10483.4 P 0.07 0.03 BDL118 10483.4 Av 1.93 1.65 BDL118 10484.3 P <0.01 <0.01 <0.01 BDL118 10484.3 Av 1.6 1.98 2.01 BDL140 10421.3 P 0.14 0.06 <0.01 <0.01 0.03 0.13 BDL140 10421.3 Av 1.45 1.64 1.7 1.68 1.81 1.57 BDL140 10423.1 P 0.21 0.28 0.22 0.16 0.41 0.33 BDL140 10423.1 Av 1.31 1.25 1.21 1.25 1.17 1.16 BDL140 10424.4 P 0.18 <0.01 0.2 0.08 0.45 BDL140 10424.4 Av 1.13 1.66 1.18 1.46 1.2 BDL152 10431.4 P 0.21 0.24 0.13 0.23 0.02 BDL152 10431.4 Av 1.23 1.18 1.27 1.18 1.27 BDL152 10432.5 P 0.1 0.04 0.03 BDL152 10432.5 Av 1.25 1.31 1.32 BDL152 10434.4 P 0.02 <0.01 <0.01 0.03 BDL152 10434.4 Av 1.76 1.51 1.44 1.23 BDL153 10142.2 P 0.04 0.58 BDL153 10142.2 Av 1.57 1.1 BDL153 10144.1 P 0.09 0.12 0.02 0.09 0.12 0.36 BDL153 10144.1 Av 1.51 1.32 1.42 1.35 1.18 1.18 BDL154 10703.1 P 0.38 0.47 0.52 0.44 BDL154 10703.1 Av 1.13 1.18 1.15 1.13 BDL154 10703.3 P 0.34 BDL154 10703.3 Av 1.17 BDL154 10703.5 P 0.38 0.16 BDL154 10703.5 Av 1.11 1.16 BDL154 10703.1 P 0.03 0.05 <0.01 0.01 0.01 0.01 0.01 BDL154 10703.1 Av 1.48 1.55 1.71 1.7 1.37 1.36 1.57 BDL154 10703.5 P 0.1 0.04 0.11 0.01 <0.01 0.34 0.11 BDL154 10703.5 Av 1.75 1.7 1.29 1.73 1.59 1.24 1.38 BDL154 10703.6 P 0.07 0.04 0.07 0.14 BDL154 10703.6 Av 1.63 1.47 1.45 1.28 BDL155 9991.2 P 0.22 0.45 BDL155 9991.2 Av 1.44 1.27 BDL155 9993.2 P 0.55 BDL155 9993.2 Av 1.45 BDL155 9994.4 P 0.19 BDL155 9994.4 Av 1.13 BDL156 10852.6 P 0.41 0.51 0.19 0.09 BDL156 10852.6 Av 1.1 1.12 1.21 1.22 BDL156 10852.7 P 0.35 BDL156 10852.7 Av 1.13 BDL156 10853.6 P 0.58 0.25 0.07 0.07 0.16 0.28 0.04 BDL156 10853.6 Av 1.13 1.24 1.21 1.33 1.19 1.2 1.26 BDL156 10852.6 P 0.05 0.59 0.33 0.35 0.21 BDL156 10852.6 Av 1.29 1.13 1.16 1.12 1.24 BDL156 10853.6 P 0.42 0.25 <0.01 0.05 0.06 <0.01 0.01 BDL156 10853.6 Av 1.29 1.69 1.97 1.83 1.43 1.78 2.26 BDL156 10854.4 P 0.03 <0.01 <0.01 <0.01 <0.01 <0.01 BDL156 10854.4 Av 1.59 1.87 1.76 1.53 1.61 1.94 BDL156 10855.3 P 0.32 <0.01 <0.01 <0.01 0.01 0.46 0.05 BDL156 10855.3 Av 1.17 1.78 1.49 1.99 1.44 1.18 1.42 BDL158 9973.3 P 0.26 BDL158 9973.3 Av 1.22 BDL158 9971.3 P 0.12 0.45 0.03 0.3 BDL158 9971.3 Av 1.27 1.11 1.34 1.11 BDL158 9973.1 P 0.04 0.1 BDL158 9973.1 Av 1.25 1.24 BDL158 9973.3 P 0.04 0.27 0.32 BDL158 9973.3 Av 1.43 1.23 1.16 BDL158 9974.2 P 0.01 0.03 0.34 <0.01 0.49 BDL158 9974.2 Av 1.48 1.41 1.14 1.45 1.1 BDL158 9974.3 P 0.08 0.05 0.02 <0.01 0.01 0.01 BDL158 9974.3 Av 1.5 1.49 1.54 1.54 1.5 1.54 BDL158 9971.3 P 0.33 0.06 0.13 <0.01 BDL158 9971.3 Av 1.13 1.25 1.24 1.46 BDL158 9973.1 P 0.09 0.25 0.02 0.45 0.29 0.16 BDL158 9973.1 Av 1.22 1.22 1.37 1.13 1.13 1.2 BDL158 9973.3 P 0.02 0.1 0.03 <0.01 BDL158 9973.3 Av 1.62 1.43 1.42 1.4 BDL158 9974.2 P 0.06 0.02 0.03 BDL158 9974.2 Av 1.21 1.24 1.32 BDL158 9974.3 P 0.51 BDL158 9974.3 Av 1.11 BDL160 10011.5 P 0.24 <0.01 0.53 BDL160 10011.5 Av 1.23 1.48 1.33 BDL160 10011.6 P 0.51 0.66 BDL160 10011.6 Av 1.18 1.1 BDL160 10011.7 P 0.56 BDL160 10011.7 Av 1.28 BDL160 10015.1 P 0.03 0.12 BDL160 10015.1 Av 1.57 1.25 BDL160 10011.5 P 0.61 0.38 0.42 BDL160 10011.5 Av 1.11 1.14 1.14 BDL160 10013.1 P 0.32 BDL160 10013.1 Av 1.16 BDL160 10014.9 P 0.52 0.37 BDL160 10014.9 Av 1.16 1.18 BDL160 10015.2 P 0.05 0.1 0.11 BDL160 10015.2 Av 1.28 1.29 1.42 BDL167 10042.3 P 0.12 BDL167 10042.3 Av 1.17 BDL167 10043.1 P 0.58 0.13 0.21 0.23 BDL167 10043.1 Av 1.17 1.16 1.25 1.18 BDL167 10043.2 P 0.18 0.34 0.09 BDL167 10043.2 Av 1.14 1.1 1.19 BDL167 10043.3 P 0.1 <0.01 <0.01 <0.01 <0.01 BDL167 10043.3 Av 1.27 1.67 1.54 1.79 1.46 BDL167 10044.2 P 0.05 <0.01 <0.01 <0.01 0.08 0.61 BDL167 10044.2 Av 1.26 1.48 1.38 1.55 1.2 1.12 BDL167 10043.1 P <0.01 0.17 0.04 0.16 0.14 0.06 BDL167 10043.1 Av 1.63 1.27 1.4 1.3 1.17 1.6 BDL167 10044.2 P 0.01 BDL167 10044.2 Av 1.39 BDL168 9881.4 P <0.01 0.14 0.08 0.05 BDL168 9881.4 Av 1.74 1.47 1.42 1.21 BDL168 9882.1 P 0.08 0.69 BDL168 9882.1 Av 1.85 1.11 BDL168 9884.1 P <0.01 0.11 0.34 0.22 BDL168 9884.1 Av 1.84 1.29 1.2 1.15 BDL169 10744.2 P 0.02 0.17 0.13 0.24 BDL169 10744.2 Av 1.34 1.21 1.22 1.16 BDL169 10747.1 P 0.39 0.4 BDL169 10747.1 Av 1.1 1.11 BDL169 10747.5 P 0.04 0.02 0.02 0.07 BDL169 10747.5 Av 1.59 1.41 1.37 1.28 BDL171 10661.2 P 0.03 0.01 0.19 <0.01 0.01 0.06 0.02 BDL171 10661.2 Av 2.26 2.17 1.28 2.22 1.3 1.73 2.47 BDL171 10661.5 P 0.14 0.32 0.04 0.02 <0.01 BDL171 10661.5 Av 1.33 1.19 1.38 1.35 2.02 BDL171 10662.3 P 0.32 0.19 0.56 BDL171 10662.3 Av 1.12 1.18 1.13 BDL171 10663.3 P 0.45 0.39 BDL171 10663.3 Av 1.14 1.19 BDL171 10664.1 P 0.26 0.25 0.1 0.46 0.03 0.03 BDL171 10664.1 Av 1.33 1.24 1.35 1.1 1.39 1.89 BDL173 9951.2 P 0.37 0.27 BDL173 9951.2 Av 1.32 1.43 BDL173 9952.1 P 0.04 0.02 0.01 0.08 BDL173 9952.1 Av 2.68 1.72 1.61 1.21 BDL173 9952.2 P 0.15 0.56 BDL173 9952.2 Av 1.44 1.11 BDL173 9954.3 P 0.14 BDL173 9954.3 Av 1.46 BDL174 11082.1 P 0.29 0.39 0.43 0.05 BDL174 11082.1 Av 1.24 1.15 1.14 1.26 BDL174 11083.1 P 0.07 0.11 0.41 0.05 0.15 0.48 0.37 BDL174 11083.1 Av 1.76 1.43 1.13 1.42 1.21 1.1 1.2 BDL174 11083.2 P 0.17 0.25 0.13 0.09 0.04 0.2 0.4 BDL174 11083.2 Av 1.27 1.36 1.26 1.38 1.44 1.21 1.19 BDL174 11084.1 P 0.04 0.06 <0.01 <0.01 0.01 0.06 0.05 BDL174 11084.1 Av 2.13 1.94 2.01 1.96 1.42 2.06 2.27 BDL174 11085.1 P <0.01 <0.01 0.1 <0.01 <0.01 0.2 0.24 BDL174 11085.1 Av 2.66 2.13 1.27 2.17 2 1.24 1.37 BDL174 11083.2 P 0.19 0.12 0.29 BDL174 11083.2 Av 1.15 1.2 1.14 BDL174 11084.1 P 0.6 BDL174 11084.1 Av 1.1 BDL174 11085.1 P 0.05 0.32 BDL174 11085.1 Av 1.42 1.14 BDL176 9891.4 P 0.67 0.01 0.47 0.06 BDL176 9891.4 Av 1.11 1.45 1.17 2.02 BDL176 9893.2 P 0.21 0.4 0.22 0.26 0.15 BDL176 9893.2 Av 1.37 1.22 1.21 1.25 1.38 BDL176 9893.3 P 0.47 0.23 0.12 0.14 0.48 BDL176 9893.3 Av 1.17 1.31 1.3 1.29 1.22 BDL177 10521.3 P 0.66 0.34 0.28 0.06 BDL177 10521.3 Av 1.1 1.15 1.17 1.3 BDL181 11293.6 P 0.59 0.1 0.37 0.45 0.39 0.37 BDL181 11293.6 Av 1.15 1.3 1.24 1.15 1.17 1.26 BDL181 11294.7 P 0.04 0.12 0.11 0.1 BDL181 11294.7 Av 1.36 1.28 1.26 1.38 BDL181 11293.1 P 0.25 0.4 0.02 0.05 0.02 BDL181 11293.1 Av 1.19 1.11 1.22 1.59 1.58 BDL181 11293.6 P 0.23 0.15 <0.01 0.09 0.03 <0.01 <0.01 BDL181 11293.6 Av 1.23 1.22 1.34 1.25 1.18 1.48 1.45 BDL181 11294.7 P 0.02 0.21 0.3 0.05 0.01 0.57 BDL181 11294.7 Av 1.55 1.26 1.11 1.3 1.23 1.1 BDL182 10691.8 P 0.42 0.06 0.01 BDL182 10691.8 Av 1.15 1.53 2.11 BDL182 10692.2 P 0.53 0.2 0.28 0.07 0.28 0.15 BDL182 10692.2 Av 1.12 1.21 1.21 1.28 1.47 1.93 BDL182 10692.3 P 0.63 0.3 0.43 BDL182 10692.3 Av 1.13 1.21 1.1 BDL182 10693.3 P 0.02 0.03 0.22 <0.01 0.17 0.01 BDL182 10693.3 Av 1.37 1.55 1.25 1.62 1.41 1.88 BDL182 10693.5 P 0.02 <0.01 0.32 <0.01 0.13 0.06 0.01 BDL182 10693.5 Av 1.47 1.72 1.19 1.8 1.13 1.38 1.91 BDL183 9943.4 P 0.19 0.3 0.48 BDL183 9943.4 Av 1.3 1.16 1.13 BDL183 9944.4 P 0.02 0.52 0.46 0.06 0.44 BDL183 9944.4 Av 1.37 1.15 1.15 1.2 1.16 BDL189 11353.3 P 0.17 0.18 0.18 0.46 BDL189 11353.3 Av 1.18 1.16 1.2 1.1 BDL189 11351.2 P 0.43 0.4 BDL189 11351.2 Av 1.1 1.17 BDL189 11353.3 P 0.24 0.22 0.11 0.33 BDL189 11353.3 Av 1.15 1.11 1.22 1.1 BDL189 11353.5 P 0.65 BDL189 11353.5 Av 1.1 BDL189 11355.4 P 0.22 0.28 0.32 BDL189 11355.4 Av 1.11 1.36 1.13 BDL196 10242.2 P 0.28 0.49 BDL196 10242.2 Av 1.13 1.15 BDL196 10243.4 P <0.01 0.12 0.12 0.13 0.17 0.57 BDL196 10243.4 Av 1.45 1.36 1.27 1.34 1.17 1.11 BDL196 10244.1 P 0.16 0.43 0.28 0.02 BDL196 10244.1 Av 1.65 1.27 1.27 1.45 BDL196 10242.2 P 0.47 BDL196 10242.2 Av 1.1 BDL196 10243.3 P 0.6 0.43 0.23 BDL196 10243.3 Av 1.1 1.13 1.23 BDL196 10243.4 P 0.51 0.15 <0.01 0.11 0.16 0.13 0.03 BDL196 10243.4 Av 1.12 1.23 1.65 1.27 1.18 1.42 1.69 BDL197 11362.2 P 0.33 0.03 0.18 0.14 0.38 BDL197 11362.2 Av 1.18 1.35 1.32 1.24 1.19 BDL197 11363.1 P 0.23 0.12 <0.01 BDL197 11363.1 Av 1.25 1.38 1.53 BDL197 11363.6 P 0.39 0.01 0.05 <0.01 0.04 0.02 0.04 BDL197 11363.6 Av 1.19 1.59 1.31 1.77 1.36 1.41 1.61 BDL197 11364.1 P 0.04 <0.01 <0.01 <0.01 0.08 <0.01 BDL197 11364.1 Av 1.67 1.63 1.85 1.48 1.44 1.91 BDL197 11364.5 P 0.02 0.47 0.11 0.04 BDL197 11364.5 Av 1.37 1.16 1.18 1.42 BDL197 11363.1 P 0.1 0.53 0.17 BDL197 11363.1 Av 1.12 1.1 1.23 BDL197 11363.6 P 0.11 0.03 0.01 <0.01 <0.01 0.06 0.04 BDL197 11363.6 Av 1.39 1.49 1.3 1.58 1.24 1.45 1.55 BDL197 11364.1 P 0.3 0.53 0.62 0.07 BDL197 11364.1 Av 1.18 1.11 1.16 1.75 BDL197 11364.5 P 0.12 0.49 BDL197 11364.5 Av 1.12 1.13 BDL201 9961.2 P 0.47 0.57 0.47 BDL201 9961.2 Av 1.13 1.1 1.15 BDL201 9961.3 P 0.13 BDL201 9961.3 Av 1.39 BDL201 9961.4 P 0.19 0.41 BDL201 9961.4 Av 1.3 1.14 BDL201 9964.3 P 0.17 0.05 0.27 BDL201 9964.3 Av 1.25 1.21 1.15 BDL203 9831.14 P 0.62 0.42 BDL203 9831.14 Av 1.13 1.27 BDL203 9831.7 P 0.11 BDL203 9831.7 Av 1.22 BDL203 9833.6 P 0.71 BDL203 9833.6 Av 1.14 BDL203 9835.2 P 0.33 BDL203 9835.2 Av 1.14 BDL220 10331.2 P <0.01 0.06 BDL220 10331.2 Av 1.51 1.25 BDL220 10331.5 P 0.22 <0.01 0.1 0.27 0.05 0.11 BDL220 10331.5 Av 1.22 1.81 1.28 1.11 1.97 1.6 BDL220 10333.5 P 0.47 0.41 BDL220 10333.5 Av 1.16 1.18 BDL220 10334.2 P 0.34 0.35 BDL220 10334.2 Av 1.13 1.14 BDL221 10341.1 P 0.19 BDL221 10341.1 Av 1.3 BDL221 10341.3 P 0.01 0.01 <0.01 BDL221 10341.3 Av 1.5 1.92 2.18 BDL221 10341.4 P 0.02 <0.01 0.01 BDL221 10341.4 Av 1.29 1.98 2.04 BDL221 10343.3 P 0.03 0.01 0.07 <0.01 <0.01 BDL221 10343.3 Av 1.55 1.6 1.21 1.6 1.41 BDL221 10344.3 P 0.41 BDL221 10344.3 Av 1.11 BDL221 10341.1 P 0.15 0.59 BDL221 10341.1 Av 1.27 1.16 BDL221 10342.1 P <0.01 <0.01 0.17 <0.01 <0.01 0.25 0.42 BDL221 10342.1 Av 3.03 2.06 1.22 1.88 1.52 1.24 1.24 BDL221 10343.1 P 0.01 <0.01 0.01 <0.01 <0.01 0.15 0.33 BDL221 10343.1 Av 1.8 1.61 1.62 1.6 1.41 1.46 1.51 BDL221 10343.3 P 0.01 0.02 0.03 <0.01 <0.01 BDL221 10343.3 Av 3.03 2.69 1.4 2.71 1.92 BDL221 10343.4 P 0.03 0.08 0.07 <0.01 0.01 0.14 0.08 BDL221 10343.4 Av 2.15 2.07 1.51 2.07 1.49 1.44 1.53 BDL221 10344.3 P 0.01 0.07 0.02 0.02 0.09 0.17 0.12 BDL221 10344.3 Av 1.67 1.49 1.49 1.48 1.23 1.39 1.33 BDL223 10791.1 P 0.33 BDL223 10791.1 Av 1.13 BDL223 10793.5 P 0.1 0.01 0.01 0.02 BDL223 10793.5 Av 1.21 1.32 1.38 1.33 BDL223 10793.8 P 0.21 BDL223 10793.8 Av 1.18 BDL223 10796.1 P 0.58 0.41 BDL223 10796.1 Av 1.1 1.12 BDL223 10796.2 P 0.41 0.33 0.34 0.16 BDL223 10796.2 Av 1.11 1.13 1.14 1.4 BDL223 10791.1 P 0.03 0.02 0.05 0.06 0.3 BDL223 10791.1 Av 1.38 1.34 1.43 1.3 1.24 BDL223 10793.3 P 0.34 <0.01 0.08 0.01 0.24 0.16 BDL223 10793.3 Av 1.45 1.64 1.62 1.48 1.15 1.39 BDL223 10793.5 P 0.47 0.23 0.44 0.15 0.04 BDL223 10793.5 Av 1.13 1.29 1.11 1.34 1.31 BDL223 10793.8 P <0.01 <0.01 0.07 <0.01 <0.01 0.21 BDL223 10793.8 Av 1.75 1.71 1.26 1.72 1.47 1.26 BDL223 10796.1 P 0.01 0.03 0.01 0.07 0.3 BDL223 10796.1 Av 1.47 1.31 1.61 1.29 1.2 BDL224 10451.5 P 0.17 0.21 0.2 BDL224 10451.5 Av 1.19 1.28 1.25 BDL224 10451.7 P 0.11 0.16 <0.01 0.01 0.35 0.11 0.19 BDL224 10451.7 Av 1.48 1.67 1.85 1.69 1.13 1.48 1.29 BDL224 10451.8 P 0.5 BDL224 10451.8 Av 1.13 BDL226 10861.2 P 0.41 0.41 0.15 0.08 BDL226 10861.2 Av 1.18 1.1 1.26 1.26 BDL226 10861.4 P 0.18 0.03 0.04 0.23 BDL226 10861.4 Av 1.27 1.37 1.28 1.2 BDL226 10862.2 P 0.56 0.23 0.19 BDL226 10862.2 Av 1.11 1.2 1.18 BDL227 11491.1 P <0.01 0.12 0.25 BDL227 11491.1 Av 1.59 1.25 1.2 BDL227 11491.3 P 0.01 0.05 0.06 <0.01 <0.01 0.42 0.35 BDL227 11491.3 Av 1.87 1.71 1.29 1.66 1.52 1.12 1.23 BDL227 11491.5 P 0.01 0.03 0.04 <0.01 <0.01 0.36 0.15 BDL227 11491.5 Av 2.24 2 1.34 1.94 1.58 1.24 1.34 BDL227 11492.5 P <0.01 0.03 <0.01 <0.01 0.02 0.13 0.12 BDL227 11492.5 Av 2.09 1.71 1.64 1.72 1.39 2.07 1.86 BDL227 11493.5 P <0.01 0.01 <0.01 <0.01 <0.01 0.16 0.08 BDL227 11493.5 Av 2.13 2.02 1.78 2.05 1.64 1.55 1.73 BDL230 10671.3 P <0.01 <0.01 <0.01 BDL230 10671.3 Av 1.95 1.84 2.02 BDL231 11111.1 P 0.58 0.12 <0.01 0.1 0.51 0.14 0.55 BDL231 11111.1 Av 1.1 1.24 1.5 1.27 1.1 1.24 1.1 BDL231 11111.2 P 0.24 0.09 <0.01 0.09 0.16 BDL231 11111.2 Av 1.18 1.24 1.31 1.27 1.2 BDL231 11111.3 P 0.33 0.08 <0.01 0.03 0.31 0.35 BDL231 11111.3 Av 1.13 1.36 1.38 1.39 1.15 1.2 BDL231 11112.2 P <0.01 0.01 0.01 <0.01 0.05 0.52 BDL231 11112.2 Av 1.89 1.61 1.3 1.55 1.27 1.21 BDL231 11116.5 P <0.01 <0.01 <0.01 <0.01 0.23 0.21 0.05 BDL231 11116.5 Av 1.97 1.79 1.74 1.78 1.18 1.28 1.45 BDL231 11111.1 P 0.09 0.31 <0.01 0.38 0.51 0.1 0.16 BDL231 11111.1 Av 1.25 1.18 1.41 1.16 1.1 1.23 1.2 BDL231 11111.2 P 0.02 0.2 0.01 0.32 0.07 0.28 BDL231 11111.2 Av 1.31 1.19 1.4 1.17 1.46 1.24 BDL231 11112.2 P 0.1 BDL231 11112.2 Av 1.42 BDL232 10904.1 P 0.6 0.26 0.33 0.16 0.11 0.71 0.5 BDL232 10904.1 Av 1.25 1.36 1.29 1.44 1.29 1.14 1.37 BDL232 10905.1 P 0.27 0.24 0.3 BDL232 10905.1 Av 1.18 1.26 1.23 BDL232 10906.3 P 0.48 0.24 0.02 0.07 0.06 0.14 0.13 BDL232 10906.3 Av 1.37 1.63 1.61 1.75 1.44 1.48 1.77 BDL232 10902.2 P 0.02 0.22 0.43 BDL232 10902.2 Av 1.65 1.24 1.12 BDL232 10905.1 P 0.18 BDL232 10905.1 Av 1.28 BDL232 10906.4 P 0.06 BDL232 10906.4 Av 1.15 BDL233 10822.4 P 0.28 BDL233 10822.4 Av 1.13 BDL233 10824.2 P 0.05 BDL233 10824.2 Av 1.25 BDL233 10825.3 P 0.1 BDL233 10825.3 Av 1.21 BDL233 10825.4 P <0.01 0.01 <0.01 0.03 BDL233 10825.4 Av 1.78 1.49 1.43 1.29 BDL233 10822.4 P 0.04 0.19 0.26 0.37 BDL233 10822.4 Av 1.37 1.21 1.18 1.24 BDL233 10824.1 P 0.43 0.48 BDL233 10824.1 Av 1.11 1.1 BDL233 10824.2 P 0.38 0.3 0.19 <0.01 BDL233 10824.2 Av 1.16 1.16 1.29 1.5 BDL233 10825.4 P 0.22 0.02 0.18 0.04 0.01 0.42 BDL233 10825.4 Av 1.23 1.44 1.23 1.46 1.47 1.14 BDL235 11412.2 P 0.34 0.33 0.4 BDL235 11412.2 Av 1.14 1.17 1.11 BDL235 11413.2 P 0.07 0.06 0.03 BDL235 11413.2 Av 1.43 1.39 1.38 BDL235 11413.3 P 0.51 0.3 BDL235 11413.3 Av 1.15 1.18 BDL235 11411.2 P 0.08 0.62 BDL235 11411.2 Av 1.16 1.15 BDL235 11413.2 P <0.01 0.08 0.12 0.15 BDL235 11413.2 Av 1.61 1.33 1.22 1.15 BDL235 11413.3 P 0.09 BDL235 11413.3 Av 1.16 BDL237 10892.1 P 0.05 0.14 BDL237 10892.1 Av 1.43 1.33 BDL237 10892.2 P 0.18 0.19 0.4 0.18 BDL237 10892.2 Av 1.23 1.16 1.14 1.18 BDL237 10893.1 P 0.23 0.29 0.51 0.28 0.09 BDL237 10893.1 Av 1.2 1.17 1.11 1.19 1.25 BDL237 10895.3 P 0.01 0.01 <0.01 <0.01 <0.01 0.09 0.05 BDL237 10895.3 Av 2.68 2.3 1.85 2.32 1.77 1.59 1.71 BDL237 10896.1 P 0.71 0.57 0.27 BDL237 10896.1 Av 1.11 1.13 1.21 BDL238 10951.4 P 0.51 BDL238 10951.4 Av 1.13 BDL238 10952.3 P 0.12 0.12 0.25 0.09 BDL238 10952.3 Av 1.3 1.29 1.25 1.32 BDL238 10953.1 P 0.37 0.37 BDL238 10953.1 Av 1.14 1.15 BDL238 10954.2 P 0.52 0.61 0.5 BDL238 10954.2 Av 1.13 1.11 1.12 BDL238 10954.3 P 0.67 BDL238 10954.3 Av 1.12 BDL240 10802.2 P 0.47 BDL240 10802.2 Av 1.1 BDL240 10806.6 P 0.33 0.43 0.27 0.19 BDL240 10806.6 Av 1.28 1.19 1.2 1.18 BDL240 10802.2 P 0.38 0.1 BDL240 10802.2 Av 1.17 1.24 BDL240 10803.5 P 0.48 0.17 BDL240 10803.5 Av 1.12 1.18 BDL240 10806.6 P 0.01 0.03 0.05 <0.01 0.01 0.15 0.26 BDL240 10806.6 Av 2.85 2.11 1.38 1.97 1.44 1.32 1.34 BDL241 10875.1 P 0.1 0.46 BDL241 10875.1 Av 1.25 1.13 BDL241 10873.1 P 0.22 0.61 BDL241 10873.1 Av 1.19 1.11 BDL241 10874.2 P 0.45 BDL241 10874.2 Av 1.11 BDL241 10874.3 P 0.54 0.05 0.01 0.03 0.05 0.08 0.01 BDL241 10874.3 Av 1.1 1.43 1.47 1.53 1.32 1.21 1.55 BDL241 10875.1 P 0.09 0.53 BDL241 10875.1 Av 1.36 1.13 BDL242 10731.3 P <0.01 0.2 0.19 0.12 0.2 BDL242 10731.3 Av 1.38 1.21 1.19 1.21 1.22 BDL242 10731.5 P 0.1 0.31 0.32 BDL242 10731.5 Av 1.34 1.16 1.15 BDL242 10737.1 P 0.32 BDL242 10737.1 Av 1.14 BDL242 10731.3 P <0.01 0.01 <0.01 <0.01 <0.01 0.05 0.04 BDL242 10731.3 Av 1.75 1.62 2.15 1.62 1.39 2.12 2.23 BDL242 10731.5 P 0.06 BDL242 10731.5 Av 1.29 BDL242 10731.7 P <0.01 <0.01 0.01 0.01 0.03 0.01 0.04 BDL242 10731.7 Av 1.85 1.49 1.45 1.47 1.28 1.64 1.86 BDL242 10737.2 P 0.47 0.23 <0.01 0.07 0.05 <0.01 0.01 BDL242 10737.2 Av 1.26 1.38 1.86 1.43 1.32 1.91 2.05 BDL245 10811.2 P 0.54 0.17 0.08 0.21 0.3 BDL245 10811.2 Av 1.1 1.22 1.28 1.16 1.14 BDL245 10813.3 P 0.09 BDL245 10813.3 Av 1.22 BDL245 10816.3 P 0.14 BDL245 10816.3 Av 1.18 BDL247 10912.1 P 0.08 0.02 0.01 BDL247 10912.1 Av 1.31 1.4 1.37 BDL247 10912.2 P 0.08 BDL247 10912.2 Av 1.22 BDL247 10915.1 P 0.45 0.22 0.14 0.02 0.53 BDL247 10915.1 Av 1.19 1.2 1.28 1.4 1.12 BDL247 10911.1 P 0.15 0.1 0.01 0.01 0.02 0.3 0.23 BDL247 10911.1 Av 1.96 1.8 1.6 1.79 1.45 1.38 1.5 BDL247 10912.1 P 0.32 0.4 0.24 0.25 0.13 0.32 0.14 BDL247 10912.1 Av 1.15 1.22 1.2 1.24 1.21 1.27 1.56 BDL247 10912.2 P 0.04 0.01 0.03 <0.01 <0.01 0.09 0.3 BDL247 10912.2 Av 1.73 1.74 1.36 1.81 1.62 1.41 1.35 BDL247 10912.6 P 0.61 0.57 0.39 0.21 0.48 BDL247 10912.6 Av 1.11 1.11 1.13 1.37 1.3 BDL247 10915.1 P 0.23 0.14 <0.01 0.03 0.08 0.02 0.06 BDL247 10915.1 Av 1.47 1.52 1.81 1.54 1.3 1.74 1.58 BDL248 11051.2 P <0.01 0.01 0.03 0.02 <0.01 0.21 BDL248 11051.2 Av 1.61 1.45 1.36 1.43 1.42 1.22 BDL248 11052.2 P <0.01 <0.01 <0.01 <0.01 <0.01 0.04 0.01 BDL248 11052.2 Av 1.89 1.68 1.89 1.7 1.44 1.74 1.81 BDL248 11053.3 P <0.01 <0.01 0.07 <0.01 0.03 0.46 0.65 BDL248 11053.3 Av 2.04 1.62 1.29 1.57 1.34 1.13 1.14 BDL248 11054.3 P 0.15 0.15 0.24 0.04 BDL248 11054.3 Av 1.18 1.18 1.19 1.29 BDL248 11051.2 P 0.18 BDL248 11051.2 Av 1.1 BDL248 11054.2 P 0.18 BDL248 11054.2 Av 1.1 BDL249 11401.2 P <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 BDL249 11401.2 Av 3.19 2.43 2.68 2.35 1.67 2.55 3.02 BDL249 11401.5 P <0.01 0.01 0.02 <0.01 0.02 0.39 0.44 BDL249 11401.5 Av 2.63 1.94 1.4 1.83 1.3 1.19 1.23 BDL249 11402.4 P <0.01 <0.01 0.03 <0.01 <0.01 0.03 0.1 BDL249 11402.4 Av 2.42 1.99 1.38 2.02 1.65 1.37 1.43 BDL249 11403.2 P 0.46 0.34 0.27 0.2 0.56 BDL249 11403.2 Av 1.22 1.17 1.25 1.21 1.11 BDL249 11404.3 P 0.01 0.07 0.23 0.22 BDL249 11404.3 Av 1.43 1.22 1.19 1.19 BDL249 11401.5 P 0.31 0.45 BDL249 11401.5 Av 1.1 1.11 BDL249 11404.3 P 0.03 0.22 0.2 0.04 BDL249 11404.3 Av 1.33 1.18 1.18 1.23 BDL250 10842.3 P <0.01 0.01 0.21 <0.01 0.02 0.34 BDL250 10842.3 Av 1.69 1.54 1.15 1.56 1.29 1.24 BDL250 10846.2 P 0.01 <0.01 0.29 <0.01 0.05 0.4 0.21 BDL250 10846.2 Av 1.43 1.41 1.12 1.45 1.25 1.19 1.33 BDL250 10846.3 P 0.02 0.36 0.05 BDL250 10846.3 Av 1.37 1.11 1.26 BDL250 10841.3 P 0.01 0.02 0.17 <0.01 <0.01 BDL250 10841.3 Av 1.99 1.66 1.22 1.61 1.62 BDL250 10842.3 P 0.23 0.52 0.12 0.44 0.41 0.59 BDL250 10842.3 Av 1.57 1.28 1.45 1.22 1.6 1.27 BDL250 10843.2 P 0.03 0.07 0.01 0.01 0.01 0.02 0.1 BDL250 10843.2 Av 1.85 1.67 1.55 1.62 1.37 1.53 1.6 BDL250 10846.2 P 0.04 <0.01 <0.01 <0.01 <0.01 0.45 0.67 BDL250 10846.2 Av 1.46 1.68 1.58 1.7 1.43 1.22 1.15 BDL250 10846.3 P <0.01 <0.01 <0.01 <0.01 <0.01 0.05 0.03 BDL250 10846.3 Av 2.79 2.32 1.76 2.28 1.84 1.8 1.87 BDL252 10881.1 P 0.01 <0.01 <0.01 <0.01 <0.01 0.09 0.19 BDL252 10881.1 Av 2.1 1.87 1.68 1.9 1.48 1.43 1.68 BDL252 10882.1 P 0.01 0.01 <0.01 <0.01 <0.01 0.18 0.18 BDL252 10882.1 Av 3.11 2.51 1.97 2.43 1.82 1.4 1.51 BDL252 10882.2 P 0.05 <0.01 0.04 <0.01 0.01 0.62 BDL252 10882.2 Av 1.87 1.74 1.35 1.72 1.44 1.11 BDL252 10882.4 P 0.01 0.01 0.17 0.01 0.38 BDL252 10882.4 Av 2.06 1.62 1.24 1.52 1.13 BDL252 10884.1 P 0.5 0.24 0.24 BDL252 10884.1 Av 1.1 1.22 1.3 BDL58 10281.5 P 0.07 0.46 0.15 0.55 0.02 BDL58 10281.5 Av 1.32 1.15 1.18 1.14 1.37 BDL58 10282.3 P <0.01 0.01 <0.01 <0.01 <0.01 <0.01 <0.01 BDL58 10282.3 Av 1.94 2.18 1.77 2.29 1.81 1.79 1.83 BDL58 10285.3 P 0.06 BDL58 10285.3 Av 1.21 BDL62 10682.1 P 0.31 0.43 0.12 0.4 BDL62 10682.1 Av 1.35 1.19 1.46 1.33 BDL62 10684.2 P 0.43 0.33 0.08 0.58 BDL62 10684.2 Av 1.17 1.23 1.26 1.11 BDL62 10684.5 P 0.41 0.64 0.31 0.67 0.64 BDL62 10684.5 Av 1.14 1.11 1.15 1.13 1.13 BDL64 10651.5 P 0.02 0.39 0.07 0.17 0.26 BDL64 10651.5 Av 1.77 1.14 1.19 1.54 1.52 BDL64 10653.1 P 0.14 <0.01 0.13 <0.01 0.03 BDL64 10653.1 Av 1.21 1.62 1.24 1.42 1.51 BDL64 10653.3 P 0.01 BDL64 10653.3 Av 1.25 BDL64 10654.3 P 0.15 0.23 0.06 0.02 <0.01 0.37 0.27 BDL64 10654.3 Av 1.53 1.6 1.5 1.71 1.55 1.45 1.44 BDL64 10651.1 P 0.5 0.31 0.16 BDL64 10651.1 Av 1.13 1.45 1.91 BDL64 10651.2 P 0.62 BDL64 10651.2 Av 1.13 BDL64 10651.5 P 0.48 BDL64 10651.5 Av 1.15 BDL64 10653.1 P 0.01 0.02 0.01 <0.01 0.02 0.05 0.03 BDL64 10653.1 Av 2.18 2.28 1.69 2.43 1.25 2.27 3.13 BDL64 10654.3 P <0.01 <0.01 0.02 <0.01 0.03 0.01 <0.01 BDL64 10654.3 Av 1.78 1.9 1.46 1.97 1.2 1.7 2.53 BDL64 10651.1 P 0.11 BDL64 10651.1 Av 1.27 BDL64 10651.3 P 0.14 0.32 0.46 BDL64 10651.3 Av 1.43 1.22 1.14 BDL79 11042.3 P 0.5 BDL79 11042.3 Av 1.1 BDL79 11042.3 P 0.44 0.28 0.04 BDL79 11042.3 Av 1.18 1.26 1.36 BDL79 11042.7 P 0.4 0.55 BDL79 11042.7 Av 1.12 1.11 BDL79 11043.1 P 0.27 0.03 0.25 0.03 0.29 0.22 BDL79 11043.1 Av 1.28 1.35 1.3 1.35 1.18 1.22 BDL85 10411.1 P 0.74 0.55 0.42 BDL85 10411.1 Av 1.1 1.14 1.16 BDL85 10411.3 P 0.14 0.01 0.03 0.17 BDL85 10411.3 Av 1.24 1.28 1.32 1.13 BDL85 10412.2 P 0.44 0.06 0.15 BDL85 10412.2 Av 1.1 1.22 1.24 BDL85 10414.1 P 0.01 0.05 0.02 0.08 0.38 0.47 BDL85 10414.1 Av 1.3 1.29 1.39 1.18 1.17 1.11 BDL85 10414.2 P 0.27 <0.01 0.07 0.07 <0.01 0.08 BDL85 10414.2 Av 1.15 1.42 1.28 1.17 1.55 1.5 BDL88 10291.2 P 0.31 0.15 0.02 0.08 0.08 0.06 0.11 BDL88 10291.2 Av 1.26 1.33 1.45 1.36 1.24 1.35 1.36 BDL88 10291.4 P 0.01 0.02 <0.01 <0.01 <0.01 0.23 0.25 BDL88 10291.4 Av 1.72 1.57 1.54 1.62 1.42 1.44 1.35 BDL88 10291.5 P 0.59 0.44 0.48 0.38 BDL88 10291.5 Av 1.13 1.17 1.13 1.17 BDL88 10293.3 P 0.14 0.28 <0.01 0.11 0.26 0.16 0.08 BDL88 10293.3 Av 1.34 1.35 2.15 1.36 1.19 1.58 1.97 BDL88 10291.2 P 0.16 0.05 <0.01 0.01 0.21 0.33 0.47 BDL88 10291.2 Av 1.32 1.45 1.56 1.48 1.18 1.17 1.16 BDL88 10291.4 P <0.01 BDL88 10291.4 Av 1.49 BDL88 10291.5 P <0.01 0.15 0.38 BDL88 10291.5 Av 1.84 1.25 1.22 BDL88 10293.3 P 0.02 0.47 BDL88 10293.3 Av 1.23 1.15 BDL88 10294.2 P <0.01 0.3 0.55 BDL88 10294.2 Av 1.76 1.23 1.16 BDL90 10921.3 P 0.22 BDL90 10921.3 Av 1.18 BDL90 10921.6 P 0.09 BDL90 10921.6 Av 1.28 BDL90 10924.2 P 0.06 0.04 <0.01 <0.01 BDL90 10924.2 Av 2 1.75 1.73 1.5 BDL90 10924.4 P 0.33 BDL90 10924.4 Av 1.12 BDL90 10925.4 P 0.02 0.03 <0.01 <0.01 BDL90 10925.4 Av 2.27 1.81 1.76 1.46 BDL90 10923.4 P 0.27 BDL90 10923.4 Av 1.17 BDL90 10924.2 P 0.06 0.28 0.22 0.33 0.06 BDL90 10924.2 Av 1.43 1.26 1.19 1.22 1.3 BDL90 10925.4 P 0.02 0.04 0.03 0.01 BDL90 10925.4 Av 1.7 1.58 1.54 1.43 BDL90 10921.6 P 0.75 0.04 0.42 0.02 0.13 BDL90 10921.6 Av 1.11 1.32 1.24 1.41 1.28 BDL90 10923.4 P 0.51 0.12 0.58 BDL90 10923.4 Av 1.15 1.25 1.15 BDL90 10924.2 P 0.16 0.01 0.28 0.01 <0.01 BDL90 10924.2 Av 1.4 1.65 1.18 1.7 1.54 BDL90 10925.4 P <0.01 <0.01 <0.01 <0.01 <0.01 0.05 0.03 BDL90 10925.4 Av 2.34 2.48 1.88 2.4 1.61 1.55 1.78 BDL94 11721.4 P 0.45 0.09 0.26 BDL94 11721.4 Av 1.11 1.29 1.16 BDL94 11725.3 P 0.17 BDL94 11725.3 Av 1.2 BDL94 11725.3 P 0.31 BDL94 11725.3 Av 1.29 Table 22. “P” = P-value; “Av” = ratio between the averages of event and control. Note that when the average ratio is higher than “1” the effect of exogenous expression of the gene is an increase of the desired trait; “Par” = Parameter according to the measured parameters; “Ev” = event. TP1 = Time point 1; TP2 = Time point 2; TP3 = Time point 3; RGR = relative growth rate.
(391) Greenhouse Assays—
(392) Table 23 specifies the parameters that were measured in the greenhouse assays and which are presented in Tables 24, 25, 26 and 27. In cases where a certain event appears more than once, the event was tested in several independent experiments. The parameters were measured as follows:
(393) The plants were analyzed for their overall size, growth rate, flowering, seed yield, weight of 1,000 seeds, dry matter and harvest index (HI— seed yield/dry matter). Transgenic plants performance was compared to control plants grown in parallel under the same conditions. Mock-transgenic plants expressing the uidA reporter gene (GUS-Intron) or with no gene at all, under the same promoter were used as control.
(394) The experiment was planned in nested randomized plot distribution. For each gene of the invention three to five independent transformation events were analyzed from each construct.
(395) Digital Imaging—
(396) A laboratory image acquisition system, which consists of a digital reflex camera (Canon EOS 300D) attached with a 55 mm focal length lens (Canon EF-S series), mounted on a reproduction device (Kaiser RS), which included 4 light units (4×150 Watts light bulb) is used for capturing images of plant samples.
(397) The image capturing process was repeated every 2 days starting from day 1 after transplanting till day 16. Same camera, placed in a custom made iron mount, was used for capturing images of larger plants sawn in white tubs in an environmental controlled greenhouse. The tubs were square shape include 1.7 liter trays. During the capture process, the tubs were placed beneath the iron mount, while avoiding direct sun light and casting of shadows.
(398) An image analysis system was used, which consists of a personal desktop computer (Intel P4 3.0 GHz processor) and a public domain program—ImageJ 1.39 (Java based image processing program which was developed at the U.S National Institutes of Health and freely available on the internet at Hypertext Transfer Protocol://rsbweb(dot)nih(dot)gov/). Images were captured in resolution of 10 Mega Pixels (3888×2592 pixels) and stored in a low compression JPEG (Joint Photographic Experts Group standard) format. Next, analyzed data was saved to text files and processed using the JMP statistical analysis software (SAS institute).
(399) Leaf Growth Analysis—
(400) Using the digital analysis leaves data was calculated, including leaf number, rosette area, rosette diameter, leaf blade area, plot coverage, leaf petiole length.
(401) The Vegetative Growth Rate of the Plant was Defined by Formulas IX, X, XI and XII.
Relative growth rate of leaf blade area=Regression coefficient of leaf area along time course. Formula IX:
Relative growth rate of rosette area=Regression coefficient of rosette area along time course. Formula X:
Relative growth rate of rosette diameter=Regression coefficient of rosette diameter along time course. Formula XI
Relative growth rate of plot coverage=Regression coefficient of plot coverage along time course. Formula XII
(402) Seeds Average Weight (Seed Weight or 1000 Seed Weight)—
(403) At the end of the experiment all seeds were collected. The seeds were scattered on a glass tray and a picture was taken. Using the digital analysis, the number of seeds in each sample was calculated.
(404) Plant Dry Weight and Seed Yield—
(405) On about day 80 from sowing, the plants were harvested and left to dry at 30° C. in a drying chamber. The biomass and seed weight of each plot were measured and divided by the number of plants in each plot. Dry weight=total weight of the vegetative portion above ground (excluding roots) after drying at 30° C. in a drying chamber;
(406) Seed yield per plant=total seed weight per plant (gr.).
(407) 1000 seed weight (the weight of 1000 seeds) (gr.).
(408) The harvest index was calculated using Formula IV (Harvest Index=Average seed yield per plant/Average dry weight) as described above.
(409) Oil Percentage in Seeds—
(410) At the end of the experiment all seeds from plots A-C were collected. Columbia seeds from 3 plots were mixed grounded and then mounted onto the extraction chamber. 210 ml of n-Hexane (Cat No. 080951 Biolab Ltd.) were used as the solvent. The extraction was performed for 30 hours at medium heat 50° C. Once the extraction has ended the n-Hexane was evaporated using the evaporator at 35° C. and vacuum conditions. The process was repeated twice. The information gained from the Soxhlet extractor (Soxhlet, F. Die gewichtsanalytische Bestimmung des Milchfettes, Polytechnisches J. (Dingler's) 1879, 232, 461) was used to create a calibration curve for the Low Resonance NMR. The content of oil of all seed samples was determined using the Low Resonance NMR (MARAN Ultra—Oxford Instrument) and its MultiQuant sowftware package.
(411) Oil Yield—
(412) The oil yield was calculated using Formula VII (described above).
(413) Silique Length Analysis—
(414) On day 50 from sowing, 30 siliques from different plants in each plot were sampled in block A. The chosen siliques were green-yellow in color and were collected from the bottom parts of a grown plant's stem. A digital photograph was taken to determine silique's length.
(415) Statistical Analyses—
(416) To identify genes conferring significantly improved tolerance to abiotic stresses, the results obtained from the transgenic plants were compared to those obtained from control plants. To identify outperforming genes and constructs, results from the independent transformation events tested were analyzed separately. Data was analyzed using Student's t-test and results were considered significant if the p value was less than 0.1. The JMP statistics software package was used (Version 5.2.1, SAS Institute Inc., Cary, N.C., USA).
(417) TABLE-US-00023 TABLE 23 Parameters measured in greenhouse assays Parameter Number Rosette Diameter TP2 1 Rosette Diameter TP3 2 Rosette Diameter TP4 3 Rosette Area TP2 4 Rosette Area TP3 5 Rosette Area TP4 6 Plot Coverage TP2 7 Plot Coverage TP3 8 Plot Coverage TP4 9 Leaf Number TP2 10 Leaf Number TP3 11 Leaf Number TP4 12 Leaf Blade Area TP2 13 Leaf Blade Area TP3 14 Leaf Blade Area TP4 15 Leaf Petiole Length TP2 16 Leaf Petiole Length TP3 17 Leaf Petiole Length TP4 18 Blade Relative Area TP2 19 Blade Relative Area TP3 20 Blade Relative Area TP4 21 Petiole Relative Area TP2 22 Petiole Relative Area TP3 23 Petiole Relative Area TP4 24 RGR Of Leaf Blade Area 25 RGR Of Leaf Number 26 RGR Of Rosette Area 27 RGR Of Rosette Diameter 28 RGR Of Plot Coverage 29 Dry Weight 30 Fresh Weight 31 Inflorescence Emergence 32 Flowering 33 Seed Yield 34 Harvest Index 35 Seeds Weight 36 Oil Content 37 Table 23. Provided are the parameters measured in greenhouse experiments which are presented in Tables 24-27 hereinbelow. TP1 = Time point 1; TP2 = Time point 2; TP3 = Time point 3; RGR = relative growth rate.
(418) TABLE-US-00024 TABLE 24 Results from greenhouse experiments Gene Ev. Par: 1 2 3 4 5 6 7 8 9 10 BDL102 10471.1 P <0.01 <0.01 0.13 0.34 0.03 0.13 0.34 0.03 BDL102 10471.1 Av 1.24 1.14 1.31 1.21 1.15 1.31 1.21 1.15 BDL102 10472.1 P 0.13 0.11 0.33 0.25 0.02 0.32 0.25 0.02 0.32 BDL102 10472.1 Av 1.26 1.19 1.14 1.37 1.26 1.26 1.37 1.26 1.26 BDL102 10474.1 P 0.22 0.23 0.26 0.19 0.2 0.23 0.19 0.2 0.23 0.19 BDL102 10474.1 Av 1.35 1.33 1.2 1.65 1.87 1.49 1.65 1.87 1.49 1.1 BDL102 10474.2 P 0.17 0.02 0.01 0.1 0.05 <0.01 0.1 0.05 <0.01 <0.01 BDL102 10474.2 Av 1.3 1.23 1.11 1.59 1.53 1.27 1.59 1.53 1.27 1.11 BDL102 10474.6 P 0.02 0.23 0.23 BDL102 10474.6 Av 1.11 1.15 1.15 BDL117 10071.2 P 0.62 0.59 BDL117 10071.2 Av 1.14 1.16 BDL117 10074.1 P 0.28 0.22 0.16 0.29 0.3 0.3 0.28 0.29 0.29 0.34 BDL117 10074.1 Av 1.26 1.23 1.24 1.58 1.47 1.44 1.6 1.49 1.46 1.15 BDL117 10074.4 P 0.35 0.34 0.41 0.38 0.39 0.41 0.38 0.37 0.39 0.28 BDL117 10074.4 Av 1.21 1.14 1.15 1.41 1.29 1.26 1.43 1.3 1.28 1.13 BDL117 10073.1 P 0.57 0.58 0.64 BDL117 10073.1 Av 1.13 1.17 1.14 BDL117 10073.2 P 0.45 0.7 0.55 0.48 0.7 0.55 0.48 BDL117 10073.2 Av 1.14 1.1 1.21 1.22 1.1 1.21 1.22 BDL117 10074.1 P 0.41 0.4 0.39 0.44 0.37 0.38 0.44 0.37 0.38 0.13 BDL117 10074.1 Av 1.1 1.15 1.15 1.17 1.32 1.29 1.17 1.32 1.29 1.15 BDL117 10074.4 P 0.1 0.4 0.34 0.4 0.34 BDL117 10074.4 Av 1.09 1.1 1.13 1.1 1.13 BDL138 9812.1 P 0.04 BDL138 9812.1 Av 1.06 BDL138 9812.3 P 0.06 0.04 BDL138 9812.3 Av 1.18 1.19 BDL140 10423.1 P 0.02 0.01 0.22 0.01 0.22 BDL140 10423.1 Av 1.16 1.39 1.22 1.39 1.22 BDL140 10424.4 P 0.62 0.62 0.1 BDL140 10424.4 Av 1.18 1.18 1.08 BDL147 10301.5 P 0.1 BDL147 10301.5 Av 1.08 BDL147 10303.1 P <0.01 0.01 0.06 0.04 0.08 0.06 0.04 0.08 0.05 BDL147 10303.1 Av 1.23 1.21 1.65 1.36 1.24 1.65 1.36 1.24 1.11 BDL147 10303.6 P 0.63 0.4 0.63 0.4 BDL147 10303.6 Av 1.14 1.11 1.14 1.11 BDL147 10304.2 P 0.33 0.33 BDL147 10304.2 Av 1.19 1.19 BDL147 10304.2 P 0.44 0.36 0.44 0.36 BDL147 10304.2 Av 1.17 1.11 1.17 1.11 BDL149 9823.3 P 0.22 0.08 0.33 0.13 0.29 0.03 BDL149 9823.3 Av 1.14 1.1 1.14 1.18 1.14 1.11 BDL149 9824.4 P 0.01 <0.01 <0.01 0.08 <0.01 0.04 0.09 <0.01 0.04 0.03 BDL149 9824.4 Av 1.16 1.13 1.13 1.35 1.26 1.29 1.37 1.28 1.31 1.05 BDL149 9823.3 P 0.65 0.67 0.63 0.65 0.67 0.63 BDL149 9823.3 Av 1.17 1.1 1.13 1.17 1.1 1.13 BDL152 10431.1 P 0.28 0.28 BDL152 10431.1 Av 1.13 1.13 BDL152 10431.4 P 0.2 0.45 0.2 0.45 BDL152 10431.4 Av 1.12 1.11 1.12 1.11 BDL152 10434.4 P 0.22 0.72 0.41 0.72 0.41 0.09 BDL152 10434.4 Av 1.12 1.12 1.2 1.12 1.2 1.07 BDL153 10141.3 P <0.01 <0.01 <0.01 0.04 <0.01 <0.01 0.05 <0.01 <0.01 BDL153 10141.3 Av 1.21 1.17 1.17 1.41 1.33 1.34 1.43 1.34 1.36 BDL153 10142.2 P 0.21 0.41 0.38 0.33 0.38 0.38 0.32 0.37 0.38 0.49 BDL153 10142.2 Av 1.33 1.2 1.25 1.64 1.55 1.57 1.66 1.58 1.6 1.15 BDL153 10143.1 P 0.03 0.14 0.07 0.37 0.14 0.04 0.34 BDL153 10143.1 Av 1.07 1.22 1.12 1.14 1.23 1.13 1.16 BDL153 10144.1 P 0.08 0.08 0.1 0.03 0.03 0.04 BDL153 10144.1 Av 1.11 1.1 1.11 1.13 1.11 1.13 BDL153 10141.3 P 0.1 <0.01 0.01 0.01 0.01 BDL153 10141.3 Av 1.14 1.15 1.06 1.14 1.14 BDL153 10142.2 P 0.01 0.01 0.14 0.15 0.44 0.14 0.15 0.44 0.14 BDL153 10142.2 Av 1.17 1.16 1.16 1.18 1.19 1.31 1.18 1.19 1.31 BDL153 10142.3 P 0.4 0.4 BDL153 10142.3 Av 1.15 1.15 BDL153 10143.1 P 0.38 BDL153 10143.1 Av 1.12 BDL153 10143.2 P 0.25 0.11 0.25 0.11 BDL153 10143.2 Av 1.11 1.12 1.11 1.12 BDL153 10144.1 P 0.3 0.17 0.39 0.34 0.39 0.34 BDL153 10144.1 Av 1.23 1.1 1.44 1.13 1.44 1.13 BDL154 10703.8 P <0.01 0.03 0.12 0.07 0.43 0.12 0.07 0.43 BDL154 10703.8 Av 1.29 1.2 1.53 1.37 1.13 1.53 1.37 1.13 BDL155 9991.5 P 0.22 0.07 0.1 0.31 0.31 0.31 0.31 0.03 BDL155 9991.5 Av 1.13 1.12 1.12 1.14 1.12 1.14 1.12 1.09 BDL155 9994.3 P 0.17 0.02 0.08 0.16 0.06 0.17 0.16 0.06 0.17 0.09 BDL155 9994.3 Av 1.15 1.17 1.12 1.17 1.27 1.21 1.17 1.27 1.21 1.07 BDL162 10492.2 P 0.32 0.16 0.25 0.11 0.16 0.25 0.11 0.59 BDL162 10492.2 Av 1.13 1.22 1.15 1.34 1.22 1.15 1.34 1.11 BDL167 10044.2 P 0.17 0.6 BDL167 10044.2 Av 1.17 1.1 BDL167 10043.3 P 0.39 0.39 BDL167 10043.3 Av 1.1 1.1 BDL167 10044.2 P 0.21 0.17 0.31 0.21 0.17 0.31 0.03 BDL167 10044.2 Av 1.14 1.15 1.2 1.14 1.15 1.2 1.09 BDL168 9881.3 P 0.1 0.11 0.09 0.18 0.14 0.09 0.18 0.14 0.1 0.22 BDL168 9881.3 Av 1.22 1.19 1.24 1.48 1.44 1.49 1.5 1.46 1.52 1.14 BDL168 9881.4 P 0.14 0.24 0.18 0.05 0.11 0.27 0.05 0.11 0.26 0.4 BDL168 9881.4 Av 1.23 1.17 1.19 1.43 1.38 1.34 1.45 1.4 1.35 1.1 BDL168 9882.1 P 0.04 0.05 0.12 0.01 0.02 0.05 BDL168 9882.1 Av 1.14 1.12 1.1 1.15 1.13 1.11 BDL168 9882.3 P 0.58 0.64 0.49 0.51 0.55 0.51 0.49 0.53 0.5 0.54 BDL168 9882.3 Av 1.1 1.11 1.17 1.3 1.24 1.33 1.32 1.26 1.35 1.1 BDL168 9884.4 P 0.72 0.76 0.74 BDL168 9884.4 Av 1.11 1.13 1.15 BDL168 9881.4 P 0.02 0.51 0.51 BDL168 9881.4 Av 1.09 1.15 1.15 BDL168 9882.1 P 0.04 0.15 0.22 BDL168 9882.1 Av 1.07 1.12 1.13 BDL168 9884.1 P 0.01 BDL168 9884.1 Av 1.1 BDL169 10743.4 P 0.43 0.55 0.56 0.54 0.7 0.72 BDL169 10743.4 Av 1.27 1.2 1.19 1.17 1.11 1.1 BDL169 10744.1 P 0.41 0.37 0.55 0.3 0.45 0.69 0.43 BDL169 10744.1 Av 1.1 1.27 1.18 1.35 1.25 1.1 1.13 BDL169 10747.1 P 0.29 0.47 0.64 0.42 0.54 <0.01 BDL169 10747.1 Av 1.15 1.34 1.15 1.42 1.22 1.17 BDL169 10747.5 P 0.08 0.01 0.02 0.24 0.01 0.01 0.13 <0.01 BDL169 10747.5 Av 1.09 1.4 1.28 1.11 1.49 1.36 1.18 1.16 BDL169 10741.3 P 0.58 0.43 0.43 BDL169 10741.3 Av 1.13 1.2 1.2 BDL169 10744.2 P 0.43 0.25 0.18 0.34 0.31 0.33 0.34 0.31 0.33 0.44 BDL169 10744.2 Av 1.24 1.26 1.21 1.6 1.61 1.42 1.6 1.61 1.42 1.12 BDL169 10747.1 P 0.01 0.14 0.33 0.09 0.53 0.33 0.09 0.53 BDL169 10747.1 Av 1.16 1.15 1.44 1.3 1.17 1.44 1.3 1.17 BDL169 10747.5 P 0.05 0.1 0.01 0.16 0.19 0.05 0.16 0.19 0.05 BDL169 10747.5 Av 1.13 1.08 1.09 1.28 1.24 1.12 1.28 1.24 1.12 BDL171 10661.2 P 0.7 0.44 0.59 0.7 0.56 0.59 0.7 0.56 BDL171 10661.2 Av 1.1 1.1 1.23 1.17 1.22 1.23 1.17 1.22 BDL171 10662.3 P 0.48 0.44 0.35 0.53 0.35 0.53 BDL171 10662.3 Av 1.12 1.13 1.26 1.19 1.26 1.19 BDL171 10664.1 P 0.01 <0.01 0.24 <0.01 0.01 0.42 <0.01 0.01 0.42 <0.01 BDL171 10664.1 Av 1.36 1.31 1.23 1.72 1.56 1.49 1.72 1.56 1.49 1.21 BDL171 10664.3 P 0.16 0.16 0.38 0.24 0.15 0.42 0.24 0.15 0.42 0.03 BDL171 10664.3 Av 1.26 1.22 1.14 1.49 1.44 1.36 1.49 1.44 1.36 1.19 BDL171 10661.5 P 0.29 0.38 0.42 BDL171 10661.5 Av 1.15 1.1 1.12 BDL171 10662.2 P 0.01 0.07 0.18 0.11 0.15 BDL171 10662.2 Av 1.16 1.1 1.2 1.28 1.18 BDL171 10662.3 P 0.02 <0.01 <0.01 <0.01 <0.01 0.01 <0.01 <0.01 <0.01 <0.01 BDL171 10662.3 Av 1.28 1.29 1.2 1.57 1.52 1.33 1.67 1.61 1.41 1.25 BDL171 10663.3 P <0.01 <0.01 <0.01 0.04 <0.01 0.02 0.03 BDL171 10663.3 Av 1.26 1.18 1.32 1.21 1.4 1.28 1.18 BDL171 10664.1 P 0.76 0.81 0.69 0.75 0.85 BDL171 10664.1 Av 1.19 1.14 1.26 1.21 1.11 BDL171 10664.3 P 0.01 0.12 0.14 0.17 0.58 0.11 0.12 0.47 0.07 BDL171 10664.3 Av 1.23 1.15 1.44 1.3 1.16 1.52 1.37 1.23 1.25 BDL173 9952.1 P 0.67 0.64 BDL173 9952.1 Av 1.11 1.13 BDL177 10521.3 P 0.56 0.56 BDL177 10521.3 Av 1.15 1.15 BDL177 10524.2 P 0.09 0.44 0.09 0.44 BDL177 10524.2 Av 1.2 1.1 1.2 1.1 BDL182 10691.2 P 0.27 0.27 0.46 BDL182 10691.2 Av 1.12 1.12 1.11 BDL182 10692.3 P 0.44 0.43 0.37 0.43 0.37 0.05 BDL182 10692.3 Av 1.11 1.25 1.12 1.25 1.12 1.08 BDL182 10693.2 P 0.65 0.65 BDL182 10693.2 Av 1.1 1.1 BDL182 10693.3 P 0.03 0.08 0.16 0.06 0.38 0.16 0.06 0.38 BDL182 10693.3 Av 1.19 1.15 1.22 1.18 1.12 1.22 1.18 1.12 BDL182 10693.5 P 0.48 0.48 BDL182 10693.5 Av 1.1 1.1 BDL182 10691.4 P 0.51 0.43 0.39 0.44 0.47 0.6 0.32 BDL182 10691.4 Av 1.11 1.11 1.36 1.21 1.26 1.13 1.19 BDL182 10691.8 P 0.87 BDL182 10691.8 Av 1.1 BDL183 9941.1 P 0.21 0.16 0.16 BDL183 9941.1 Av 1.11 1.11 1.13 BDL183 9943.4 P 0.3 BDL183 9943.4 Av 1.1 BDL183 9944.1 P 0.09 0.03 0.1 0.15 0.22 0.1 0.15 0.21 BDL183 9944.1 Av 1.16 1.12 1.27 1.23 1.22 1.29 1.25 1.24 BDL183 9941.1 P 0.65 0.65 BDL183 9941.1 Av 1.11 1.11 BDL183 9942.1 P 0.02 0.02 0.16 0.33 0.38 0.16 0.33 0.38 BDL183 9942.1 Av 1.16 1.1 1.12 1.17 1.13 1.12 1.17 1.13 BDL186 10002.2 P 0.1 0.05 <0.01 0.02 <0.01 BDL186 10002.2 Av 1.07 1.13 1.25 1.14 1.27 BDL186 10004.3 P 0.6 0.69 0.66 BDL186 10004.3 Av 1.11 1.15 1.17 BDL186 10001.3 P 0.53 BDL186 10001.3 Av 1.11 BDL186 10004.6 P 0.43 0.43 0.1 BDL186 10004.6 Av 1.2 1.2 1.08 BDL187 10502.2 P 0.29 0.6 BDL187 10502.2 Av 1.2 1.13 BDL187 10503.1 P 0.09 0.27 0.09 0.27 BDL187 10503.1 Av 1.26 1.1 1.26 1.1 BDL187 10503.3 P 0.66 0.66 BDL187 10503.3 Av 1.16 1.16 BDL187 10503.5 P 0.26 BDL187 10503.5 Av 1.1 BDL188 10462.4 P 0.14 0.07 0.14 0.07 0.32 BDL188 10462.4 Av 1.13 1.09 1.13 1.09 1.13 BDL188 10462.1 P 0.02 0.11 0.04 0.11 0.4 0.04 0.11 0.4 BDL188 10462.1 Av 1.2 1.14 1.3 1.27 1.21 1.3 1.27 1.21 BDL188 10462.4 P 0.03 0.03 0.14 0.09 0.1 0.09 0.1 BDL188 10462.4 Av 1.16 1.16 1.1 1.24 1.23 1.24 1.23 BDL190 10232.2 P 0.01 0.01 <0.01 0.43 0.09 0.14 0.43 0.09 0.14 BDL190 10232.2 Av 1.18 1.15 1.13 1.17 1.25 1.24 1.17 1.25 1.24 BDL190 10233.2 P 0.03 <0.01 0.09 0.03 0.01 <0.01 0.03 0.01 <0.01 BDL190 10233.2 Av 1.14 1.16 1.18 1.19 1.35 1.29 1.19 1.35 1.29 BDL190 10233.4 P 0.11 0.18 <0.01 0.18 <0.01 BDL190 10233.4 Av 1.11 1.11 1.17 1.11 1.17 BDL190 10234.2 P 0.09 0.05 0.05 BDL190 10234.2 Av 1.06 1.18 1.18 BDL192 9921.6 P 0.26 0.4 0.48 0.23 0.37 0.44 BDL192 9921.6 Av 1.14 1.14 1.13 1.16 1.15 1.14 BDL192 9922.1 P 0.11 0.35 0.33 0.28 0.33 0.3 0.22 BDL192 9922.1 Av 1.1 1.21 1.14 1.1 1.23 1.15 1.12 BDL192 9921.6 P 0.21 0.14 0.41 0.21 0.14 0.41 BDL192 9921.6 Av 1.12 1.14 1.14 1.12 1.14 1.14 BDL192 9922.5 P 0.35 0.33 0.3 0.65 0.62 BDL192 9922.5 Av 1.18 1.2 1.13 1.11 1.13 BDL193 10152.2 P 0.08 0.06 0.17 0.01 BDL193 10152.2 Av 1.15 1.16 1.1 1.06 BDL193 10153.2 P 0.6 BDL193 10153.2 Av 1.11 BDL193 10153.4 P 0.04 0.4 0.37 0.21 0.38 0.34 0.18 BDL193 10153.4 Av 1.08 1.23 1.16 1.16 1.25 1.18 1.17 BDL193 10153.3 P 0.41 0.14 0.4 0.01 0.4 0.4 0.01 0.4 0.33 BDL193 10153.3 Av 1.12 1.15 1.21 1.31 1.14 1.21 1.31 1.14 1.13 BDL193 10153.4 P 0.33 0.25 0.51 0.27 0.17 0.51 0.27 0.17 BDL193 10153.4 Av 1.1 1.11 1.14 1.23 1.14 1.14 1.23 1.14 BDL196 10243.1 P 0.61 0.66 0.6 0.66 0.66 0.6 0.66 0.66 BDL196 10243.1 Av 1.14 1.1 1.2 1.16 1.15 1.2 1.16 1.15 BDL196 10243.1 P 0.02 BDL196 10243.1 Av 1.05 BDL201 9961.3 P 0.26 0.22 0.38 0.11 0.23 0.44 0.11 0.23 0.44 0.09 BDL201 9961.3 Av 1.13 1.11 1.16 1.33 1.23 1.35 1.33 1.23 1.35 1.07 BDL220 10333.5 P 0.48 BDL220 10333.5 Av 1.1 BDL223 10793.5 P 0.09 0.01 0.01 0.39 0.12 0.26 0.39 0.12 0.26 0.02 BDL223 10793.5 Av 1.15 1.12 1.1 1.12 1.25 1.13 1.12 1.25 1.13 1.06 BDL223 10793.8 P <0.01 0.01 0.2 0.19 0.2 0.19 BDL223 10793.8 Av 1.17 1.1 1.31 1.18 1.31 1.18 BDL224 10451.7 P 0.59 0.59 0.05 BDL224 10451.7 Av 1.12 1.12 1.08 BDL226 10861.2 P 0.05 0.05 0.01 0.07 0.01 0.04 0.03 BDL226 10861.2 Av 1.12 1.12 1.26 1.17 1.34 1.24 1.21 BDL226 10861.4 P 0.65 0.31 BDL226 10861.4 Av 1.13 1.12 BDL226 10864.2 P 0.01 0.01 0.09 <0.01 <0.01 0.07 <0.01 <0.01 0.04 0.22 BDL226 10864.2 Av 1.2 1.15 1.09 1.49 1.34 1.21 1.59 1.42 1.29 1.13 BDL227 11491.3 P 0.21 0.01 0.08 0.27 0.07 0.27 0.07 BDL227 11491.3 Av 1.11 1.09 1.09 1.12 1.21 1.12 1.21 BDL227 11492.3 P <0.01 <0.01 0.01 0.05 0.01 0.05 BDL227 11492.3 Av 1.17 1.12 1.23 1.12 1.23 1.12 BDL233 10822.1 P 0.63 0.63 BDL233 10822.1 Av 1.12 1.12 BDL233 10825.4 P 0.4 0.4 0.37 0.63 0.35 0.48 0.63 0.35 0.48 BDL233 10825.4 Av 1.16 1.16 1.16 1.14 1.39 1.25 1.14 1.39 1.25 BDL237 10893.1 P 0.09 0.09 BDL237 10893.1 Av 1.12 1.12 BDL237 10895.1 P 0.37 0.29 0.05 0.56 0.55 0.05 0.56 0.55 BDL237 10895.1 Av 1.13 1.1 1.13 1.15 1.11 1.13 1.15 1.11 BDL237 10895.2 P 0.29 0.29 BDL237 10895.2 Av 1.12 1.12 BDL237 10895.3 P 0.55 0.56 0.56 BDL237 10895.3 Av 1.13 1.12 1.12 BDL238 10951.4 P 0.35 0.1 0.1 BDL238 10951.4 Av 1.11 1.14 1.14 BDL238 10952.3 P 0.68 0.68 BDL238 10952.3 Av 1.1 1.1 BDL238 10954.2 P 0.04 <0.01 <0.01 0.08 <0.01 <0.01 0.08 <0.01 <0.01 <0.01 BDL238 10954.2 Av 1.33 1.28 1.23 1.73 1.76 1.52 1.73 1.76 1.52 1.13 BDL238 10954.3 P 0.74 0.74 BDL238 10954.3 Av 1.13 1.13 BDL240 10802.2 P 0.02 0.03 0.12 0.1 0.02 0.04 0.1 0.02 0.04 BDL240 10802.2 Av 1.22 1.26 1.18 1.34 1.54 1.35 1.34 1.54 1.35 BDL241 10873.1 P 0.02 0.13 0.11 <0.01 0.38 0.02 <0.01 0.38 0.02 BDL241 10873.1 Av 1.19 1.18 1.15 1.41 1.3 1.34 1.41 1.3 1.34 BDL242 10731.2 P 0.4 0.52 0.14 0.46 0.58 0.14 0.46 0.58 BDL242 10731.2 Av 1.13 1.12 1.22 1.28 1.14 1.22 1.28 1.14 BDL242 10731.5 P 0.1 0.1 BDL242 10731.5 Av 1.11 1.11 BDL242 10731.6 P <0.01 <0.01 0.18 0.03 0.25 0.08 0.03 0.25 0.08 BDL242 10731.6 Av 1.21 1.22 1.19 1.48 1.45 1.36 1.48 1.45 1.36 BDL242 10731.7 P 0.06 0.06 BDL242 10731.7 Av 1.12 1.12 BDL245 10813.3 P 0.03 BDL245 10813.3 Av 1.08 BDL250 10841.3 P 0.02 0.18 0.26 0.06 0.22 0.32 0.06 0.22 0.32 0.05 BDL250 10841.3 Av 1.24 1.18 1.11 1.36 1.41 1.17 1.36 1.41 1.17 1.08 BDL250 10846.2 P 0.48 0.64 0.41 0.64 0.41 BDL250 10846.2 Av 1.1 1.12 1.16 1.12 1.16 BDL250 10846.3 P 0.38 0.36 0.48 0.58 0.46 0.62 0.58 0.46 0.62 BDL250 10846.3 Av 1.11 1.17 1.11 1.17 1.34 1.19 1.17 1.34 1.19 BDL252 10882.1 P 0.3 0.41 0.44 0.32 0.26 0.34 0.32 0.26 0.34 <0.01 BDL252 10882.1 Av 1.19 1.19 1.17 1.38 1.42 1.24 1.38 1.42 1.24 1.1 BDL48 10274.4 P 0.23 0.02 0.02 0.81 0.09 0.08 0.81 0.09 0.08 BDL48 10274.4 Av 1.14 1.15 1.2 1.1 1.23 1.36 1.1 1.23 1.36 BDL48 10271.1 P 0.06 <0.01 0.27 0.03 <0.01 0.27 0.03 <0.01 BDL48 10271.1 Av 1.08 1.16 1.11 1.22 1.27 1.11 1.22 1.27 BDL48 10274.3 P 0.07 0.01 <0.01 0.02 0.01 <0.01 0.02 0.01 <0.01 BDL48 10274.3 Av 1.21 1.19 1.09 1.25 1.35 1.22 1.25 1.35 1.22 BDL48 10274.4 P 0.29 0.2 0.13 0.22 0.03 0.22 0.22 0.03 0.22 BDL48 10274.4 Av 1.14 1.15 1.14 1.14 1.21 1.26 1.14 1.21 1.26 BDL48 10274.5 P 0.04 0.28 0.45 0.26 0.49 0.44 0.26 0.49 0.44 BDL48 10274.5 Av 1.11 1.13 1.11 1.14 1.22 1.22 1.14 1.22 1.22 BDL63 10381.1 P 0.12 0.02 <0.01 0.11 0.21 <0.01 0.11 0.21 <0.01 BDL63 10381.1 Av 1.2 1.18 1.17 1.2 1.39 1.37 1.2 1.39 1.37 BDL63 10381.2 P 0.03 0.25 0.37 0.31 0.6 0.42 0.31 0.6 0.42 BDL63 10381.2 Av 1.13 1.15 1.19 1.19 1.26 1.32 1.19 1.26 1.32 BDL63 10384.8 P 0.02 <0.01 0.06 <0.01 0.06 <0.01 BDL63 10384.8 Av 1.09 1.14 1.2 1.24 1.2 1.24 BDL79 11042.1 P 0.08 0.04 0.52 0.04 0.52 BDL79 11042.1 Av 1.06 1.16 1.1 1.16 1.1 BDL79 11044.3 P <0.01 0.03 0.14 0.14 BDL79 11044.3 Av 1.17 1.11 1.14 1.14 BDL81 10371.8 P 0.34 0.34 BDL81 10371.8 Av 1.12 1.12 BDL81 10374.1 P 0.22 0.22 BDL81 10374.1 Av 1.16 1.16 BDL81 10371.5 P 0.02 0.17 0.21 0.21 BDL81 10371.5 Av 1.08 1.11 1.13 1.13 BDL81 10371.8 P 0.6 0.8 0.57 0.8 0.57 BDL81 10371.8 Av 1.13 1.13 1.22 1.13 1.22 BDL81 10374.1 P 0.26 0.31 0.44 0.16 0.19 0.32 0.16 0.19 0.32 0.26 BDL81 10374.1 Av 1.23 1.22 1.19 1.44 1.45 1.49 1.44 1.45 1.49 1.12 BDL85 10411.1 P 0.25 0.34 0.15 0.13 0.39 0.33 0.13 0.39 0.33 0.12 BDL85 10411.1 Av 1.2 1.16 1.14 1.39 1.29 1.28 1.39 1.29 1.28 1.16 Table 24. Results of the greenhouse experiments. Provided are the measured values of each parameter [parameters (Par.) 1-10 according to the parameters described in Table 23 above] in plants expressing the indicated polynucleotides. “Ev” = event; “P” = P-value; “Av” = ratio between the averages of event and control. Note that when the average ratio is higher than “1” the effect of exogenous expression of the gene is an increase of the desired trait;
(419) TABLE-US-00025 TABLE 25 Results from greenhouse experiments Gene Ev. Par 11 12 13 14 15 16 17 18 19 20 BDL102 10471.1 P 0.1 0.27 0.03 0.04 0.29 BDL102 10471.1 Av 1.35 1.23 1.18 1.27 1.1 BDL102 10472.1 P 0.17 0.35 0.25 0.21 0.22 BDL102 10472.1 Av 1.36 1.23 1.3 1.29 1.15 BDL102 10474.1 P 0.18 0.19 0.16 0.17 0.3 0.02 BDL102 10474.1 Av 1.56 1.82 1.54 1.4 1.3 1.03 BDL102 10474.2 P 0.04 <0.01 0.01 0.15 <0.01 BDL102 10474.2 Av 1.51 1.48 1.34 1.42 1.22 BDL102 10474.6 P 0.23 0.11 BDL102 10474.6 Av 1.19 1.12 BDL117 10071.2 P 0.1 BDL117 10071.2 Av 1.03 BDL117 10073.2 P 0.02 0.15 BDL117 10073.2 Av 1.1 1.1 BDL117 10074.1 P 0.21 0.27 0.29 0.26 0.18 0.12 0.04 BDL117 10074.1 Av 1.19 1.46 1.38 1.33 1.59 1.35 1.17 BDL117 10074.4 P 0.05 0.37 0.38 0.49 0.3 0.25 0.31 0.03 BDL117 10074.4 Av 1.06 1.12 1.28 1.16 1.19 1.43 1.28 1.02 BDL117 10073.1 P 0.62 0.52 0.63 BDL117 10073.1 Av 1.1 1.16 1.15 BDL117 10073.2 P 0.56 0.37 0.35 0.53 0.51 BDL117 10073.2 Av 1.19 1.25 1.14 1.13 1.15 BDL117 10074.1 P 0.01 0.53 0.37 0.36 0.33 0.42 0.43 BDL117 10074.1 Av 1.09 1.11 1.29 1.24 1.21 1.17 1.2 BDL117 10074.4 P 0.37 0.26 0.24 0.16 BDL117 10074.4 Av 1.1 1.12 1.13 1.11 BDL138 9811.4 P 0.06 BDL138 9811.4 Av 1.09 BDL138 9812.1 P <0.01 0.02 BDL138 9812.1 Av 1.16 1.11 BDL138 9812.3 P 0.05 0.11 0.37 0.52 0.01 BDL138 9812.3 Av 1.04 1.13 1.14 1.1 1.03 BDL138 9811.1 P 0.02 <0.01 BDL138 9811.1 Av 1.04 1.04 BDL138 9813.4 P <0.01 BDL138 9813.4 Av 1.04 BDL140 10423.1 P 0.01 0.22 BDL140 10423.1 Av 1.29 1.19 BDL140 10424.3 P 0.49 BDL140 10424.3 Av 1.27 BDL140 10424.4 P 0.64 0.68 BDL140 10424.4 Av 1.14 1.17 BDL140 10423.1 P 0.03 BDL140 10423.1 Av 1.04 BDL147 10303.1 P 0.11 0.07 0.11 0.12 0.01 BDL147 10303.1 Av 1.49 1.31 1.18 1.28 1.43 BDL147 10303.6 P 0.38 0.37 BDL147 10303.6 Av 1.11 1.12 BDL147 10304.2 P 0.33 0.05 BDL147 10304.2 Av 1.18 1.04 BDL147 10303.5 P 0.41 BDL147 10303.5 Av 1.1 BDL147 10304.2 P 0.48 BDL147 10304.2 Av 1.17 BDL149 9823.3 P 0.23 <0.01 0.01 BDL149 9823.3 Av 1.13 1.38 1.21 BDL149 9824.3 P 0.09 BDL149 9824.3 Av 1.04 BDL149 9824.4 P 0.02 0.12 0.03 0.17 <0.01 <0.01 0.02 BDL149 9824.4 Av 1.1 1.28 1.12 1.2 1.23 1.22 1.11 BDL149 9823.3 P 0.62 0.47 0.56 BDL149 9823.3 Av 1.13 1.16 1.12 BDL152 10431.1 P 0.31 BDL152 10431.1 Av 1.1 BDL152 10431.4 P 0.16 0.47 0.27 0.09 0.03 BDL152 10431.4 Av 1.1 1.1 1.18 1.18 1.02 BDL152 10432.5 P 0.18 0.62 BDL152 10432.5 Av 1.1 1.16 BDL152 10434.1 P 0.76 BDL152 10434.1 Av 1.11 BDL152 10434.4 P 0.32 0.25 0.04 0.16 BDL152 10434.4 Av 1.2 1.13 1.37 1.12 BDL152 10434.1 P 0.03 BDL152 10434.1 Av 1.04 BDL152 10434.4 P 0.05 BDL152 10434.4 Av 1.04 BDL153 10141.3 P <0.01 <0.01 <0.01 0.25 0.05 <0.01 BDL153 10141.3 Av 1.32 1.24 1.27 1.33 1.26 1.15 BDL153 10142.2 P 0.03 0.33 0.28 0.54 0.41 0.2 0.33 0.55 0.07 BDL153 10142.2 Av 1.15 1.16 1.44 1.28 1.41 1.54 1.34 1.12 1.02 BDL153 10143.1 P 0.01 0.21 0.32 0.05 0.01 <0.01 BDL153 10143.1 Av 1.12 1.2 1.14 1.11 1.02 1.02 BDL153 10144.1 P <0.01 0.05 0.08 0.07 BDL153 10144.1 Av 1.09 1.13 1.1 1.1 BDL153 10141.3 P 0.06 0.02 0.02 0.24 BDL153 10141.3 Av 1.14 1.1 1.26 1.19 BDL153 10142.2 P 0.1 0.17 0.35 0.06 0.02 0.05 0.04 BDL153 10142.2 Av 1.05 1.1 1.17 1.22 1.48 1.31 1.26 BDL153 10142.3 P 0.36 0.23 BDL153 10142.3 Av 1.14 1.1 BDL153 10143.1 P 0.15 BDL153 10143.1 Av 1.14 BDL153 10143.2 P 0.04 0.15 0.07 <0.01 BDL153 10143.2 Av 1.06 1.11 1.2 1.15 BDL153 10144.1 P 0.4 0.48 0.24 0.08 BDL153 10144.1 Av 1.43 1.11 1.34 1.13 BDL153 10144.4 P 0.54 BDL153 10144.4 Av 1.1 BDL154 10703.6 P 0.66 BDL154 10703.6 Av 1.1 BDL154 10703.8 P 0.08 0.09 0.54 <0.01 0.09 BDL154 10703.8 Av 1.47 1.41 1.13 1.47 1.22 BDL155 9991.5 P 0.36 0.09 0.31 0.41 BDL155 9991.5 Av 1.11 1.18 1.29 1.35 BDL155 9991.9 P 0.27 BDL155 9991.9 Av 1.17 BDL155 9993.2 P 0.64 BDL155 9993.2 Av 1.12 BDL155 9994.3 P 0.16 0.31 0.08 0.12 0.12 0.09 0.41 BDL155 9994.3 Av 1.14 1.1 1.16 1.17 1.43 1.44 1.12 BDL155 9993.2 P 0.06 BDL155 9993.2 Av 1.03 BDL155 9994.3 P 0.03 BDL155 9994.3 Av 1.04 BDL157 9911.4 P 0.09 BDL157 9911.4 Av 1.03 BDL157 9914.2 P 0.12 0.09 BDL157 9914.2 Av 1.11 1.06 BDL162 10492.2 P 0.12 0.44 BDL162 10492.2 Av 1.39 1.15 BDL162 10492.4 P 0.82 BDL162 10492.4 Av 1.13 BDL162 10494.1 P 0.1 0.13 BDL162 10494.1 Av 1.21 1.21 BDL167 10043.1 P 0.17 BDL167 10043.1 Av 1.21 BDL167 10043.2 P <0.01 0.01 BDL167 10043.2 Av 1.04 1.03 BDL167 10044.2 P 0.05 0.07 0.03 BDL167 10044.2 Av 1.15 1.16 1.02 BDL167 10042.3 P 0.1 0.2 BDL167 10042.3 Av 1.05 1.12 BDL167 10043.3 P 0.35 0.19 0.38 0.41 BDL167 10043.3 Av 1.11 1.1 1.14 1.11 BDL167 10044.2 P 0.51 0.28 0.27 0.31 0.18 BDL167 10044.2 Av 1.1 1.14 1.15 1.17 1.17 BDL168 9881.3 P 0.08 <0.01 0.24 0.17 0.1 0.11 0.21 0.3 <0.01 BDL168 9881.3 Av 1.09 1.1 1.32 1.36 1.44 1.17 1.21 1.15 1.02 BDL168 9881.4 P 0.01 0.1 0.32 0.05 0.16 0.36 0.44 BDL168 9881.4 Av 1.15 1.3 1.23 1.32 1.45 1.25 1.14 BDL168 9882.3 P 0.61 0.54 0.49 0.66 0.71 0.66 BDL168 9882.3 Av 1.15 1.2 1.3 1.2 1.13 1.1 BDL168 9884.4 P 0.7 BDL168 9884.4 Av 1.15 BDL168 9881.4 P 0.57 0.57 0.37 0.4 BDL168 9881.4 Av 1.11 1.1 1.17 1.14 BDL168 9882.1 P 0.1 0.22 0.48 <0.01 BDL168 9882.1 Av 1.12 1.11 1.14 1.16 BDL168 9882.3 P 0.39 0.22 BDL168 9882.3 Av 1.12 1.11 BDL168 9884.1 P 0.11 BDL168 9884.1 Av 1.12 BDL169 10743.4 P 0.55 0.5 0.69 0.44 BDL169 10743.4 Av 1.16 1.19 1.12 1.17 BDL169 10744.1 P 0.41 0.38 0.29 0.31 BDL169 10744.1 Av 1.15 1.19 1.4 1.24 BDL169 10747.1 P 0.09 0.58 0.01 BDL169 10747.1 Av 1.11 1.22 1.42 BDL169 10747.5 P <0.01 0.14 0.06 BDL169 10747.5 Av 1.11 1.29 1.15 BDL169 10741.3 P 0.42 0.68 0.53 BDL169 10741.3 Av 1.17 1.11 1.16 BDL169 10744.2 P 0.02 0.26 0.31 0.32 0.37 0.24 0.02 0.02 BDL169 10744.2 Av 1.04 1.48 1.56 1.44 1.37 1.26 1.23 1.03 BDL169 10747.1 P 0.34 <0.01 0.36 0.02 0.02 BDL169 10747.1 Av 1.39 1.32 1.2 1.16 1.17 BDL169 10747.3 P 0.45 BDL169 10747.3 Av 1.1 BDL169 10747.5 P 0.11 0.14 <0.01 <0.01 BDL169 10747.5 Av 1.2 1.26 1.27 1.22 BDL171 10661.2 P 0.6 0.63 0.74 0.35 0.84 0.55 BDL171 10661.2 Av 1.11 1.17 1.1 1.19 1.1 1.33 BDL171 10662.3 P 0.4 0.67 0.5 0.15 BDL171 10662.3 Av 1.21 1.11 1.18 1.46 BDL171 10664.1 P 0.09 <0.01 <0.01 0.48 0.03 <0.01 0.01 BDL171 10664.1 Av 1.15 1.56 1.44 1.42 1.57 1.6 1.29 BDL171 10664.3 P 0.34 0.47 0.24 0.04 0.46 0.08 0.38 0.48 BDL171 10664.3 Av 1.19 1.12 1.3 1.29 1.18 1.39 1.43 1.26 BDL171 10661.5 P 0.51 0.76 0.68 BDL171 10661.5 Av 1.1 1.11 1.12 BDL171 10662.2 P 0.39 0.06 0.42 BDL171 10662.2 Av 1.11 1.47 1.14 BDL171 10662.3 P 0.09 <0.01 0.02 <0.01 0.24 0.17 <0.01 BDL171 10662.3 Av 1.3 1.39 1.5 1.33 1.46 1.37 1.23 BDL171 10663.3 P <0.01 0.04 0.07 <0.01 0.08 BDL171 10663.3 Av 1.2 1.2 1.17 1.54 1.24 BDL171 10664.1 P 0.71 0.79 0.01 BDL171 10664.1 Av 1.18 1.13 1.03 BDL171 10664.3 P 0.08 0.18 0.22 0.01 0.33 0.09 BDL171 10664.3 Av 1.18 1.29 1.22 1.54 1.23 1.03 BDL173 9951.2 P <0.01 BDL173 9951.2 Av 1.03 BDL173 9952.1 P 0.61 BDL173 9952.1 Av 1.13 BDL173 9954.3 P <0.01 0.02 BDL173 9954.3 Av 1.05 1.04 BDL173 9953.4 P <0.01 BDL173 9953.4 Av 1.03 BDL177 10521.3 P 0.37 0.2 BDL177 10521.3 Av 1.22 1.16 BDL177 10522.2 P <0.01 BDL177 10522.2 Av 1.05 BDL177 10524.2 P 0.16 0.21 0.28 BDL177 10524.2 Av 1.14 1.14 1.17 BDL182 10691.2 P 0.14 0.59 0.08 BDL182 10691.2 Av 1.11 1.12 1.2 BDL182 10692.3 P 0.53 0.2 0.73 BDL182 10692.3 Av 1.16 1.15 1.13 BDL182 10693.2 P 0.34 0.18 0.67 BDL182 10693.2 Av 1.13 1.24 1.11 BDL182 10693.3 P 0.25 0.07 0.05 0.25 BDL182 10693.3 Av 1.18 1.14 1.42 1.35 BDL182 10693.5 P 0.15 0.05 BDL182 10693.5 Av 1.18 1.29 BDL182 10691.2 P 0.02 0.01 BDL182 10691.2 Av 1.06 1.04 BDL182 10691.4 P <0.01 0.2 0.56 0.65 <0.01 0.13 BDL182 10691.4 Av 1.25 1.15 1.19 1.12 1.48 1.29 BDL182 10691.8 P 0.79 0.84 BDL182 10691.8 Av 1.14 1.14 BDL182 10693.2 P 0.02 BDL182 10693.2 Av 1.05 BDL182 10693.3 P 0.85 BDL182 10693.3 Av 1.13 BDL183 9941.1 P <0.01 0.26 BDL183 9941.1 Av 1.09 1.13 BDL183 9942.4 P 0.02 <0.01 BDL183 9942.4 Av 1.17 1.16 BDL183 9943.4 P 0.21 0.15 BDL183 9943.4 Av 1.11 1.14 BDL183 9944.1 P 0.05 <0.01 0.09 0.01 0.3 <0.01 0.02 BDL183 9944.1 Av 1.04 1.1 1.19 1.15 1.13 1.31 1.21 BDL183 9941.1 P 0.64 0.56 BDL183 9941.1 Av 1.11 1.16 BDL183 9942.1 P 0.12 0.31 0.46 0.02 BDL183 9942.1 Av 1.13 1.19 1.12 1.26 BDL186 10002.2 P 0.01 <0.01 0.1 BDL186 10002.2 Av 1.14 1.21 1.12 BDL186 10004.3 P 0.71 0.59 0.09 <0.01 BDL186 10004.3 Av 1.13 1.15 1.02 1.02 BDL186 10001.3 P 0.3 BDL186 10001.3 Av 1.25 BDL186 10004.6 P 0.54 BDL186 10004.6 Av 1.16 BDL187 10502.2 P 0.38 BDL187 10502.2 Av 1.12 BDL187 10502.4 P 0.59 BDL187 10502.4 Av 1.1 BDL187 10503.1 P 0.05 0.26 BDL187 10503.1 Av 1.26 1.15 BDL187 10503.3 P 0.29 0.3 BDL187 10503.3 Av 1.25 1.14 BDL187 10503.5 P 0.2 0.08 BDL187 10503.5 Av 1.36 1.25 BDL188 10462.4 P 0.09 BDL188 10462.4 Av 1.06 BDL188 10462.1 P 0.02 0.11 0.44 0.25 0.29 BDL188 10462.1 Av 1.28 1.32 1.19 1.15 1.14 BDL188 10462.4 P 0.02 0.09 0.01 0.25 BDL188 10462.4 Av 1.19 1.22 1.36 1.24 BDL188 10464.5 P 0.33 BDL188 10464.5 Av 1.19 BDL190 10234.1 P 0.5 BDL190 10234.1 Av 1.11 BDL190 10234.2 P 0.57 0.01 BDL190 10234.2 Av 1.1 1.03 BDL190 10231.1 P 0.21 BDL190 10231.1 Av 1.13 BDL190 10231.2 P 0.02 BDL190 10231.2 Av 1.24 BDL190 10232.2 P 0.44 0.08 0.16 0.1 0.39 0.25 BDL190 10232.2 Av 1.18 1.23 1.18 1.29 1.16 1.16 BDL190 10233.2 P 0.05 0.02 <0.01 0.02 0.05 0.05 0.04 BDL190 10233.2 Av 1.18 1.31 1.21 1.25 1.15 1.31 1.02 BDL190 10233.4 P 0.02 0.45 0.5 <0.01 BDL190 10233.4 Av 1.2 1.16 1.12 1.16 BDL190 10234.2 P 0.07 0.05 BDL190 10234.2 Av 1.17 1.19 BDL192 9921.3 P 0.38 BDL192 9921.3 Av 1.13 BDL192 9921.6 P 0.12 0.36 0.55 BDL192 9921.6 Av 1.15 1.13 1.11 BDL192 9922.1 P 0.11 0.12 0.57 0.56 BDL192 9922.1 Av 1.18 1.11 1.17 1.11 BDL192 9921.6 P 0.09 0.19 0.51 BDL192 9921.6 Av 1.07 1.1 1.13 BDL192 9922.5 P 0.01 0.35 0.29 0.5 BDL192 9922.5 Av 1.06 1.18 1.2 1.11 BDL193 10152.2 P 0.05 0.23 0.05 0.14 BDL193 10152.2 Av 1.04 1.1 1.17 1.11 BDL193 10152.3 P 0.02 BDL193 10152.3 Av 1.02 BDL193 10153.2 P 0.32 BDL193 10153.2 Av 1.1 BDL193 10153.4 P 0.37 0.29 0.46 0.09 <0.01 BDL193 10153.4 Av 1.14 1.15 1.1 1.09 1.02 BDL193 10153.2 P 0.42 0.07 <0.01 BDL193 10153.2 Av 1.12 1.02 1.03 BDL193 10153.3 P 0.07 0.37 0.01 0.2 0.22 0.09 BDL193 10153.3 Av 1.1 1.15 1.27 1.2 1.18 1.16 BDL193 10153.4 P 0.41 0.24 0.16 0.63 BDL193 10153.4 Av 1.13 1.16 1.1 1.11 BDL196 10243.1 P 0.65 0.77 0.63 0.71 BDL196 10243.1 Av 1.2 1.11 1.22 1.11 BDL201 9961.3 P 0.22 0.04 0.18 0.29 0.43 0.46 0.07 0.09 BDL201 9961.3 Av 1.1 1.06 1.28 1.16 1.33 1.12 1.25 1.02 BDL220 10331.5 P <0.01 BDL220 10331.5 Av 1.05 BDL220 10331.7 P 0.39 BDL220 10331.7 Av 1.1 BDL220 10333.5 P 0.49 BDL220 10333.5 Av 1.18 BDL223 10793.3 P 0.1 BDL223 10793.3 Av 1.1 BDL223 10793.5 P <0.01 0.47 0.01 0.02 0.1 0.21 0.12 0.08 BDL223 10793.5 Av 1.08 1.1 1.23 1.15 1.22 1.16 1.12 1.02 BDL223 10793.8 P 0.08 0.08 0.09 0.06 0.1 0.23 BDL223 10793.8 Av 1.03 1.28 1.2 1.11 1.21 1.1 BDL224 10451.7 P 0.57 BDL224 10451.7 Av 1.11 BDL224 10453.3 P 0.5 BDL224 10453.3 Av 1.12 BDL225 10401.4 P 0.07 BDL225 10401.4 Av 1.04 BDL226 10861.2 P 0.03 0.04 0.08 0.25 0.08 0.29 0.01 BDL226 10861.2 Av 1.19 1.17 1.14 1.37 1.31 1.12 1.06 BDL226 10864.2 P <0.01 0.07 <0.01 0.01 0.11 0.06 <0.01 BDL226 10864.2 Av 1.17 1.08 1.38 1.24 1.13 1.43 1.36 BDL227 11491.3 P <0.01 0.5 0.37 BDL227 11491.3 Av 1.23 1.12 1.12 BDL227 11492.3 P 0.04 <0.01 0.06 0.03 0.04 0.35 BDL227 11492.3 Av 1.16 1.25 1.14 1.21 1.19 1.14 BDL233 10822.1 P <0.01 BDL233 10822.1 Av 1.21 BDL233 10825.4 P 0.39 0.47 0.32 0.5 0.02 BDL233 10825.4 Av 1.32 1.29 1.27 1.18 1.12 BDL237 10893.1 P 0.07 BDL237 10893.1 Av 1.17 BDL237 10895.1 P 0.09 0.44 0.16 0.26 BDL237 10895.1 Av 1.11 1.18 1.22 1.1 BDL237 10895.2 P 0.2 0.66 BDL237 10895.2 Av 1.13 1.12 BDL237 10895.3 P 0.51 0.36 0.64 BDL237 10895.3 Av 1.12 1.26 1.11 BDL237 10896.1 P 0.11 0.52 BDL237 10896.1 Av 1.13 1.1 BDL238 10951.4 P 0.09 0.22 0.18 BDL238 10951.4 Av 1.11 1.13 1.12 BDL238 10952.3 P 0.69 0.7 BDL238 10952.3 Av 1.1 1.1 BDL238 10954.2 P 0.08 <0.01 <0.01 0.11 <0.01 BDL238 10954.2 Av 1.59 1.7 1.46 1.34 1.29 BDL238 10954.3 P 0.67 0.58 BDL238 10954.3 Av 1.15 1.1 BDL240 10802.2 P 0.05 0.04 <0.01 <0.01 0.08 0.05 BDL240 10802.2 Av 1.34 1.61 1.3 1.22 1.27 1.17 BDL240 10806.2 P 0.3 BDL240 10806.2 Av 1.1 BDL240 10806.6 P 0.01 0.09 BDL240 10806.6 Av 1.06 1.04 BDL241 10873.1 P <0.01 0.52 0.1 0.09 0.06 BDL241 10873.1 Av 1.41 1.24 1.33 1.23 1.23 BDL242 10731.2 P 0.05 0.45 0.62 0.49 0.45 BDL242 10731.2 Av 1.26 1.27 1.11 1.11 1.11 BDL242 10731.5 P 0.05 BDL242 10731.5 Av 1.13 BDL242 10731.6 P 0.01 0.19 0.02 <0.01 0.09 0.03 BDL242 10731.6 Av 1.46 1.43 1.37 1.29 1.21 1.02 BDL242 10731.7 P 0.04 0.25 BDL242 10731.7 Av 1.14 1.15 BDL245 10813.3 P 0.04 0.02 0.27 0.08 0.2 BDL245 10813.3 Av 1.07 1.08 1.14 1.2 1.15 BDL245 10816.3 P 0.02 BDL245 10816.3 Av 1.03 BDL245 10812.3 P 0.07 BDL245 10812.3 Av 1.09 BDL245 10813.3 P 0.12 0.03 0.01 BDL245 10813.3 Av 1.14 1.11 1.16 BDL247 10911.4 P 0.01 BDL247 10911.4 Av 1.03 BDL247 10912.6 P 0.02 BDL247 10912.6 Av 1.02 BDL248 11051.1 P 0.04 BDL248 11051.1 Av 1.03 BDL248 11054.1 P 0.06 BDL248 11054.1 Av 1.04 BDL250 10841.3 P 0.05 0.23 0.45 0.05 0.01 0.21 BDL250 10841.3 Av 1.31 1.31 1.12 1.38 1.32 1.1 BDL250 10842.3 P 0.17 BDL250 10842.3 Av 1.11 BDL250 10846.2 P 0.47 0.32 0.41 BDL250 10846.2 Av 1.13 1.2 1.11 BDL250 10846.3 P 0.54 0.46 0.51 0.14 0.26 BDL250 10846.3 Av 1.15 1.3 1.22 1.25 1.15 BDL252 10882.1 P 0.26 0.25 0.24 0.33 0.51 0.54 0.01 BDL252 10882.1 Av 1.35 1.36 1.22 1.35 1.28 1.21 1.02 BDL252 10882.4 P 0.49 BDL252 10882.4 Av 1.14 BDL48 10274.4 P 0.04 0.01 0.06 0.01 0.13 BDL48 10274.4 Av 1.11 1.33 1.4 1.49 1.14 BDL48 10271.1 P 0.18 0.02 <0.01 0.29 0.18 0.02 0.06 BDL48 10271.1 Av 1.13 1.21 1.24 1.11 1.22 1.02 1.02 BDL48 10271.5 P 0.51 BDL48 10271.5 Av 1.1 BDL48 10274.3 P 0.01 <0.01 <0.01 <0.01 <0.01 <0.01 BDL48 10274.3 Av 1.24 1.33 1.16 1.44 1.32 1.17 BDL48 10274.4 P 0.11 0.02 0.15 0.53 0.15 0.3 BDL48 10274.4 Av 1.21 1.23 1.2 1.18 1.25 1.21 BDL48 10274.5 P 0.41 0.48 0.59 0.27 0.02 0.21 BDL48 10274.5 Av 1.12 1.23 1.12 1.24 1.2 1.23 BDL63 10381.2 P 0.48 BDL63 10381.2 Av 1.29 BDL63 10381.1 P 0.04 0.1 0.21 0.23 0.04 0.19 0.01 <0.01 BDL63 10381.1 Av 1.1 1.05 1.22 1.34 1.29 1.34 1.26 1.25 BDL63 10381.2 P 0.21 0.5 0.48 0.17 0.01 0.23 BDL63 10381.2 Av 1.21 1.28 1.25 1.26 1.22 1.21 BDL63 10384.8 P 0.1 0.04 <0.01 0.33 0.14 <0.01 BDL63 10384.8 Av 1.05 1.2 1.2 1.15 1.1 1.25 BDL79 11042.1 P <0.01 0.12 0.2 0.03 BDL79 11042.1 Av 1.08 1.1 1.14 1.11 BDL79 11044.3 P 0.12 <0.01 0.01 0.41 BDL79 11044.3 Av 1.12 1.24 1.15 1.18 BDL81 10371.8 P 0.18 BDL81 10371.8 Av 1.15 BDL81 10374.1 P 0.24 BDL81 10374.1 Av 1.13 BDL81 10371.5 P 0.2 0.32 0.06 0.02 BDL81 10371.5 Av 1.15 1.15 1.18 1.1 BDL81 10371.8 P 0.72 0.62 0.68 0.57 0.49 BDL81 10371.8 Av 1.16 1.19 1.15 1.11 1.23 BDL81 10374.1 P 0.18 0.17 0.35 0.1 0.15 0.41 BDL81 10374.1 Av 1.41 1.41 1.35 1.3 1.35 1.26 BDL85 10411.1 P 0.16 0.34 0.26 0.23 0.62 <0.01 BDL85 10411.1 Av 1.29 1.3 1.28 1.32 1.12 1.1 BDL85 10414.1 P 0.07 BDL85 10414.1 Av 1.02 BDL85 10414.2 P 0.71 BDL85 10414.2 Av 1.1 Table 25. Results of the greenhouse experiments. Provided are the measured values of each parameter [parameters (Par.) 11-20 according to the parameters described in Table 23 above] in plants expressing the indicated polynucleotides. “Ev” = event; “P” = P-value; “Av” = ratio between the averages of event and control. Note that when the average ratio is higher than “1” the effect of exogenous expression of the gene is an increase of the desired trait;
(420) TABLE-US-00026 TABLE 26 Results from greenhouse experiments Gene Ev. Par 21 22 23 24 25 26 27 28 29 30 BDL102 10471.1 P 0.18 0.42 0.39 0.46 0.46 BDL102 10471.1 Av 1.15 1.82 1.16 1.13 1.13 BDL102 10471.3 P 0.48 BDL102 10471.3 Av 1.38 BDL102 10472.1 P 0.01 0.54 0.17 0.22 0.22 0.43 BDL102 10472.1 Av 1.26 2.05 1.28 1.24 1.24 1.11 BDL102 10474.1 P 0.06 0.29 0.01 0.02 0.17 0.02 0.1 BDL102 10474.1 Av 1.15 1.43 1.54 1.48 1.14 1.48 1.29 BDL102 10474.2 P 0.03 0.1 0.18 0.18 BDL102 10474.2 Av 1.14 1.32 1.25 1.25 BDL102 10474.6 P 0.02 0.55 BDL102 10474.6 Av 1.02 1.76 BDL117 10071.2 P 0.24 BDL117 10071.2 Av 1.15 BDL117 10073.2 P 0.46 0.01 0.01 BDL117 10073.2 Av 1.19 1.2 1.14 BDL117 10074.1 P 0.53 0.08 0.08 0.03 0.11 0.02 BDL117 10074.1 Av 1.13 1.28 1.22 1.42 1.18 1.44 BDL117 10074.4 P 0.33 0.19 0.14 BDL117 10074.4 Av 1.16 1.24 1.26 BDL117 10071.2 P 0.21 BDL117 10071.2 Av 1.16 BDL117 10073.1 P 0.35 0.43 0.47 BDL117 10073.1 Av 1.17 1.14 1.16 BDL117 10073.2 P 0.09 0.16 0.08 0.16 BDL117 10073.2 Av 1.3 1.25 1.2 1.25 BDL117 10074.1 P 0.16 0.29 0.08 0.1 0.08 BDL117 10074.1 Av 1.24 1.12 1.31 1.17 1.31 BDL117 10074.4 P 0.71 0.54 0.43 0.27 0.43 BDL117 10074.4 Av 1.14 1.1 1.13 1.1 1.13 BDL138 9811.1 P 0.15 BDL138 9811.1 Av 1.13 BDL138 9811.4 P 0.41 0.03 <0.01 BDL138 9811.4 Av 1.21 1.07 1.26 BDL138 9812.1 P <0.01 0.42 <0.01 BDL138 9812.1 Av 1.14 1.16 1.2 BDL138 9812.3 P 0.07 BDL138 9812.3 Av 1.02 BDL138 9813.1 P 0.28 BDL138 9813.1 Av 1.13 BDL138 9813.3 P 0.06 0.55 BDL138 9813.3 Av 1.3 1.12 BDL138 9811.1 P 0.04 BDL138 9811.1 Av 1.02 BDL138 9813.1 P 0.56 0.1 BDL138 9813.1 Av 1.19 1.18 BDL138 9813.4 P 0.75 BDL138 9813.4 Av 1.14 BDL138 9811.4 P 0.29 BDL138 9811.4 Av 1.1 BDL138 9812.1 P 0.39 BDL138 9812.1 Av 1.61 BDL138 9813.1 P 0.14 0.29 BDL138 9813.1 Av 1.33 1.12 BDL138 9813.3 P 0.36 0.09 BDL138 9813.3 Av 1.87 1.07 BDL140 10421.3 P 0.84 0.37 BDL140 10421.3 Av 1.16 1.18 BDL140 10424.3 P 0.47 BDL140 10424.3 Av 1.18 BDL140 10421.2 P 0.02 0.22 BDL140 10421.2 Av 1.14 1.12 BDL140 10423.1 P 0.08 BDL140 10423.1 Av 1.03 BDL147 10301.3 P 0.54 BDL147 10301.3 Av 1.17 BDL147 10303.1 P 0.01 0.53 0.32 0.32 BDL147 10303.1 Av 1.02 1.11 1.18 1.18 BDL147 10303.6 P 0.07 BDL147 10303.6 Av 1.02 BDL147 10304.2 P <0.01 0.55 BDL147 10304.2 Av 1.04 1.1 BDL147 10301.5 P 0.36 BDL147 10301.5 Av 1.15 BDL147 10301.6 P 0.02 BDL147 10301.6 Av 1.14 BDL147 10303.1 P 0.01 BDL147 10303.1 Av 1.29 BDL147 10303.5 P 0.02 0.43 0.31 0.08 BDL147 10303.5 Av 1.17 1.17 1.12 1.09 BDL147 10304.2 P 0.04 0.36 0.36 BDL147 10304.2 Av 1.23 1.14 1.14 BDL149 9823.1 P 0.04 0.05 0.11 BDL149 9823.1 Av 1.17 1.19 1.17 BDL149 9823.3 P <0.01 <0.01 0.23 0.34 0.42 BDL149 9823.3 Av 1.17 1.14 1.12 1.12 1.14 BDL149 9824.3 P 0.34 BDL149 9824.3 Av 1.11 BDL149 9824.4 P 0.28 0.11 0.08 <0.01 BDL149 9824.4 Av 1.17 1.28 1.3 1.15 BDL149 9823.3 P 0.48 0.48 0.48 0.1 BDL149 9823.3 Av 1.12 1.12 1.12 1.08 BDL149 9824.3 P 0.27 BDL149 9824.3 Av 1.14 BDL152 10431.1 P 0.01 BDL152 10431.1 Av 1.02 BDL152 10432.5 P 0.37 BDL152 10432.5 Av 1.17 BDL152 10434.1 P 0.05 BDL152 10434.1 Av 1.16 BDL152 10434.4 P 0.58 0.27 0.3 0.32 0.31 0.32 0.56 BDL152 10434.4 Av 1.14 1.17 1.19 1.19 1.15 1.19 1.1 BDL152 10431.1 P 0.43 0.58 BDL152 10431.1 Av 1.18 1.1 BDL152 10431.3 P 0.02 BDL152 10431.3 Av 1.18 BDL152 10434.1 P 0.42 BDL152 10434.1 Av 1.1 BDL152 10434.4 P 0.09 BDL152 10434.4 Av 1.03 BDL153 10141.3 P 0.09 0.12 0.07 0.23 0.05 BDL153 10141.3 Av 1.02 1.25 1.33 1.13 1.35 BDL153 10142.2 P 0.04 0.09 0.01 0.11 <0.01 BDL153 10142.2 Av 1.37 1.22 1.56 1.2 1.58 BDL153 10143.1 P 0.45 0.48 0.4 BDL153 10143.1 Av 1.12 1.12 1.14 BDL153 10144.1 P 0.52 0.25 0.53 0.45 BDL153 10144.1 Av 1.1 1.13 1.11 1.12 BDL153 10141.3 P 0.22 0.67 0.48 0.39 0.39 BDL153 10141.3 Av 1.28 1.12 1.11 1.14 1.14 BDL153 10142.2 P 0.05 <0.01 0.63 0.11 0.06 0.04 0.06 BDL153 10142.2 Av 1.36 1.2 1.1 1.26 1.33 1.18 1.33 BDL153 10142.3 P 0.26 0.29 0.2 0.29 BDL153 10142.3 Av 1.19 1.18 1.12 1.18 BDL153 10143.1 P 0.09 0.25 BDL153 10143.1 Av 1.09 1.11 BDL153 10143.2 P 0.05 0.47 0.22 0.36 0.23 0.36 0.23 BDL153 10143.2 Av 1.11 1.11 1.15 1.15 1.1 1.15 1.13 BDL153 10144.1 P 0.28 0.26 0.06 0.26 BDL153 10144.1 Av 1.17 1.18 1.17 1.18 BDL154 10703.1 P 0.11 0.64 0.67 BDL154 10703.1 Av 1.1 1.2 1.27 BDL154 10703.5 P 0.37 0.44 0.66 BDL154 10703.5 Av 1.18 1.26 1.13 BDL154 10703.6 P 0.25 0.59 0.59 BDL154 10703.6 Av 1.28 1.47 1.29 BDL154 10703.8 P 0.29 0.58 0.58 0.58 BDL154 10703.8 Av 1.17 1.1 1.1 1.1 BDL155 9991.3 P 0.65 BDL155 9991.3 Av 1.11 BDL155 9991.5 P 0.5 0.34 0.57 0.4 0.57 0.32 BDL155 9991.5 Av 1.23 1.17 1.11 1.12 1.11 1.22 BDL155 9991.9 P 0.39 BDL155 9991.9 Av 1.22 BDL155 9994.3 P 0.49 0.56 0.4 0.31 0.49 0.31 BDL155 9994.3 Av 1.1 1.14 1.15 1.19 1.1 1.19 BDL155 9994.5 P 0.41 BDL155 9994.5 Av 1.14 BDL157 9911.3 P 0.25 0.14 BDL157 9911.3 Av 1.54 1.11 BDL157 9911.4 P <0.01 BDL157 9911.4 Av 1.26 BDL157 9914.2 P 0.37 BDL157 9914.2 Av 1.23 BDL157 9911.3 P 0.08 0.28 BDL157 9911.3 Av 1.15 1.25 BDL157 9911.4 P 0.46 BDL157 9911.4 Av 1.23 BDL157 9913.3 P 0.37 BDL157 9913.3 Av 1.21 BDL157 9914.2 P 0.45 BDL157 9914.2 Av 1.16 BDL160 10011.5 P 0.34 0.54 0.35 BDL160 10011.5 Av 1.59 1.26 1.15 BDL160 10011.6 P 0.03 0.61 0.67 BDL160 10011.6 Av 1.15 1.23 1.16 BDL160 10011.7 P 0.02 BDL160 10011.7 Av 1.16 BDL160 10013.1 P 0.01 0.41 BDL160 10013.1 Av 1.32 1.27 BDL160 10015.1 P 0.09 0.09 BDL160 10015.1 Av 1.1 1.14 BDL162 10491.1 P 0.42 BDL162 10491.1 Av 1.44 BDL162 10492.2 P 0.04 0.09 0.27 0.09 0.05 BDL162 10492.2 Av 1.4 1.34 1.17 1.34 1.44 BDL162 10492.4 P 0.37 0.39 0.55 BDL162 10492.4 Av 1.83 1.25 1.11 BDL162 10494.1 P 0.63 BDL162 10494.1 Av 1.13 BDL167 10042.3 P 0.19 BDL167 10042.3 Av 1.21 BDL167 10042.3 P 0.24 BDL167 10042.3 Av 1.15 BDL167 10043.2 P 0.13 0.6 BDL167 10043.2 Av 1.13 1.14 BDL167 10043.3 P 0.44 0.27 BDL167 10043.3 Av 1.12 1.12 BDL167 10043.4 P 0.05 0.33 0.14 BDL167 10043.4 Av 1.16 1.12 1.46 BDL167 10044.2 P 0.2 0.27 0.2 0.2 0.24 BDL167 10044.2 Av 1.18 1.18 1.21 1.21 1.19 BDL168 9881.3 P 0.01 0.01 0.04 0.01 BDL168 9881.3 Av 1.44 1.48 1.23 1.5 BDL168 9881.4 P 0.36 0.06 0.05 0.07 0.11 0.05 BDL168 9881.4 Av 1.14 1.31 1.24 1.33 1.18 1.35 BDL168 9882.1 P 0.51 BDL168 9882.1 Av 1.11 BDL168 9882.3 P 0.08 0.09 0.16 0.07 BDL168 9882.3 Av 1.31 1.33 1.17 1.35 BDL168 9884.4 P <0.01 0.32 0.46 0.2 0.39 BDL168 9884.4 Av 1.03 1.17 1.14 1.16 1.16 BDL168 9881.3 P 0.66 <0.01 BDL168 9881.3 Av 1.1 1.19 BDL168 9881.4 P 0.12 0.44 0.34 0.14 0.34 BDL168 9881.4 Av 1.17 1.13 1.16 1.13 1.16 BDL168 9882.1 P 0.53 0.39 0.58 BDL168 9882.1 Av 1.1 1.14 1.13 BDL168 9882.3 P 0.01 0.42 0.35 0.18 BDL168 9882.3 Av 1.19 1.1 1.12 1.2 BDL168 9883.3 P 0.06 BDL168 9883.3 Av 1.09 BDL168 9884.1 P 0.07 BDL168 9884.1 Av 1.17 BDL169 10743.4 P 0.54 0.37 0.65 BDL169 10743.4 Av 1.11 1.18 1.1 BDL169 10744.1 P 0.28 0.3 BDL169 10744.1 Av 1.12 1.13 BDL169 10747.1 P 0.6 0.53 BDL169 10747.1 Av 1.12 1.17 BDL169 10747.5 P 0.61 0.44 BDL169 10747.5 Av 1.1 1.16 BDL169 10741.3 P 0.73 BDL169 10741.3 Av 1.1 BDL169 10744.2 P 0.04 0.05 0.07 0.05 0.84 BDL169 10744.2 Av 1.43 1.41 1.19 1.41 1.1 BDL169 10747.1 P 0.65 0.43 0.35 0.43 0.43 BDL169 10747.1 Av 1.21 1.24 1.18 1.15 1.15 BDL169 10747.3 P 0.4 BDL169 10747.3 Av 2.16 BDL169 10747.5 P 0.16 0.53 0.53 BDL169 10747.5 Av 1.27 1.11 1.11 BDL171 10661.2 P 0.3 0.31 0.54 0.31 0.34 BDL171 10661.2 Av 1.19 1.21 1.1 1.21 1.3 BDL171 10661.5 P 0.36 BDL171 10661.5 Av 1.13 BDL171 10664.1 P 0.02 0.07 0.03 0.28 0.03 0.67 BDL171 10664.1 Av 1.19 1.39 1.48 1.17 1.48 1.22 BDL171 10664.3 P 0.34 0.08 0.46 0.08 0.61 BDL171 10664.3 Av 1.17 1.36 1.11 1.36 1.25 BDL171 10662.2 P 0.09 0.07 BDL171 10662.2 Av 1.45 1.45 BDL171 10662.3 P 0.42 0.07 0.11 0.21 0.07 0.6 BDL171 10662.3 Av 1.2 1.33 1.32 1.16 1.4 1.15 BDL171 10663.3 P 0.22 0.01 0.56 BDL171 10663.3 Av 1.19 1.51 1.14 BDL171 10664.1 P 0.68 BDL171 10664.1 Av 1.1 BDL171 10664.3 P 0.09 0.07 0.48 0.34 BDL171 10664.3 Av 1.02 1.22 1.14 1.21 BDL173 9952.1 P 0.18 0.39 0.22 0.51 0.44 BDL173 9952.1 Av 1.13 1.14 1.15 1.12 1.13 BDL173 9954.2 P 0.09 0.35 BDL173 9954.2 Av 1.08 1.11 BDL173 9953.4 P 0.03 0.23 BDL173 9953.4 Av 1.02 1.3 BDL173 9954.2 P 0.02 0.1 BDL173 9954.2 Av 1.02 1.11 BDL176 9891.2 P 0.6 0.58 BDL176 9891.2 Av 1.24 1.19 BDL176 9892.3 P 0.38 BDL176 9892.3 Av 1.89 BDL176 9893.2 P 0.73 BDL176 9893.2 Av 1.11 BDL176 9893.3 P 0.01 0.37 BDL176 9893.3 Av 1.02 1.12 BDL177 10521.3 P 0.41 0.53 BDL177 10521.3 Av 1.15 1.1 BDL177 10522.2 P 0.44 BDL177 10522.2 Av 1.19 BDL182 10691.2 P 0.45 0.35 0.57 0.52 0.57 BDL182 10691.2 Av 1.11 1.17 1.11 1.1 1.11 BDL182 10693.2 P 0.12 BDL182 10693.2 Av 1.28 BDL182 10693.3 P 0.55 0.55 BDL182 10693.3 Av 1.11 1.11 BDL182 10693.5 P 0.01 0.07 BDL182 10693.5 Av 1.28 1.08 BDL182 10691.2 P 0.58 BDL182 10691.2 Av 1.12 BDL182 10691.4 P 0.09 0.29 0.11 BDL182 10691.4 Av 1.02 1.27 1.2 BDL182 10691.8 P 0.61 BDL182 10691.8 Av 1.11 BDL182 10693.2 P 0.38 0.57 0.37 BDL182 10693.2 Av 1.1 1.13 1.12 BDL182 10693.3 P 0.69 0.43 0.46 BDL182 10693.3 Av 1.25 1.59 1.25 BDL183 9941.1 P 0.37 0.25 0.5 0.42 BDL183 9941.1 Av 1.14 1.14 1.12 1.13 BDL183 9942.1 P 0.55 BDL183 9942.1 Av 1.12 BDL183 9942.4 P 0.22 0.09 0.01 0.07 0.53 BDL183 9942.4 Av 1.24 1.17 1.13 1.21 1.11 BDL183 9943.4 P 0.31 0.53 0.37 BDL183 9943.4 Av 1.16 1.11 1.1 BDL183 9944.1 P 0.46 0.23 0.18 BDL183 9944.1 Av 1.12 1.21 1.23 BDL183 9944.4 P <0.01 BDL183 9944.4 Av 1.03 BDL183 9941.1 P 0.38 0.42 0.21 0.42 BDL183 9941.1 Av 1.15 1.13 1.13 1.13 BDL183 9942.1 P 0.17 0.48 0.42 0.42 BDL183 9942.1 Av 1.15 1.11 1.13 1.13 BDL183 9942.4 P 0.02 0.21 BDL183 9942.4 Av 1.16 1.13 BDL183 9943.4 P 0.35 0.33 0.12 BDL183 9943.4 Av 1.24 1.13 1.16 BDL183 9944.2 P 0.59 0.5 BDL183 9944.2 Av 1.12 1.14 BDL186 10002.2 P 0.15 0.23 0.14 0.24 0.1 BDL186 10002.2 Av 1.23 1.14 1.26 1.13 1.28 BDL186 10004.3 P 0.32 0.39 0.2 0.33 BDL186 10004.3 Av 1.16 1.16 1.16 1.18 BDL186 10001.3 P 0.46 BDL186 10001.3 Av 1.1 BDL186 10004.3 P 0.55 BDL186 10004.3 Av 1.15 BDL187 10502.2 P 0.43 BDL187 10502.2 Av 1.21 BDL187 10501.2 P 0.01 0.58 BDL187 10501.2 Av 1.02 1.38 BDL187 10502.4 P 0.66 BDL187 10502.4 Av 1.1 BDL187 10503.5 P 0.38 0.2 0.34 BDL187 10503.5 Av 1.13 1.24 1.12 BDL188 10462.1 P 0.46 BDL188 10462.1 Av 1.41 BDL188 10464.5 P 0.33 BDL188 10464.5 Av 1.12 BDL188 10462.1 P 0.38 0.35 0.35 BDL188 10462.1 Av 1.16 1.18 1.18 BDL188 10462.4 P 0.02 0.41 0.26 0.24 0.24 BDL188 10462.4 Av 1.02 1.32 1.2 1.22 1.22 BDL188 10464.3 P 0.66 BDL188 10464.3 Av 1.24 BDL188 10464.5 P 0.29 0.1 BDL188 10464.5 Av 1.38 1.12 BDL190 10232.2 P 0.6 BDL190 10232.2 Av 1.1 BDL190 10233.4 P 0.01 BDL190 10233.4 Av 1.2 BDL190 10234.1 P 0.01 0.4 BDL190 10234.1 Av 1.02 1.14 BDL190 10231.1 P 0.42 0.24 BDL190 10231.1 Av 1.18 1.21 BDL190 10231.2 P 0.64 0.5 BDL190 10231.2 Av 1.14 1.2 BDL190 10232.2 P <0.01 0.26 0.14 0.14 BDL190 10232.2 Av 1.29 1.18 1.25 1.25 BDL190 10233.2 P 0.1 0.29 0.05 0.01 0.05 BDL190 10233.2 Av 1.25 1.13 1.32 1.24 1.32 BDL190 10233.4 P 0.16 0.29 0.29 0.29 BDL190 10233.4 Av 1.23 1.17 1.1 1.17 BDL190 10234.2 P 0.04 0.02 BDL190 10234.2 Av 1.11 1.09 BDL192 9921.3 P 0.54 0.56 0.16 BDL192 9921.3 Av 1.19 1.11 1.16 BDL192 9921.6 P 0.51 0.47 0.4 BDL192 9921.6 Av 1.1 1.12 1.14 BDL192 9922.1 P 0.52 BDL192 9922.1 Av 1.11 BDL192 9922.2 P <0.01 BDL192 9922.2 Av 1.02 BDL192 9921.6 P 0.49 0.03 0.45 0.45 BDL192 9921.6 Av 1.15 1.25 1.16 1.16 BDL192 9922.5 P 0.54 0.51 BDL192 9922.5 Av 1.13 1.15 BDL193 10152.2 P 0.15 BDL193 10152.2 Av 1.17 BDL193 10152.3 P 0.3 0.1 BDL193 10152.3 Av 1.11 1.2 BDL193 10153.2 P 0.24 BDL193 10153.2 Av 1.14 BDL193 10153.4 P 0.04 0.39 0.4 0.33 BDL193 10153.4 Av 1.02 1.14 1.14 1.16 BDL193 10152.2 P 0.7 BDL193 10152.2 Av 1.12 BDL193 10152.3 P 0.14 BDL193 10152.3 Av 1.16 BDL193 10153.2 P 0.01 BDL193 10153.2 Av 1.02 BDL193 10153.3 P 0.35 0.4 0.48 0.48 BDL193 10153.3 Av 1.22 1.1 1.14 1.14 BDL193 10153.4 P 0.63 0.5 0.5 BDL193 10153.4 Av 1.1 1.14 1.14 BDL196 10241.3 P 0.5 BDL196 10241.3 Av 1.1 BDL196 10243.1 P 0.01 0.56 0.56 BDL196 10243.1 Av 1.08 1.14 1.14 BDL196 10243.2 P 0.37 BDL196 10243.2 Av 1.29 BDL196 10244.1 P 0.02 0.22 0.82 0.02 BDL196 10244.1 Av 1.21 1.11 1.1 1.13 BDL201 9961.3 P 0.12 0.12 0.31 0.12 BDL201 9961.3 Av 1.31 1.32 1.16 1.32 BDL201 9961.4 P 0.62 BDL201 9961.4 Av 1.14 BDL201 9961.6 P 0.01 0.01 BDL201 9961.6 Av 1.02 1.54 BDL201 9963.6 P 0.46 0.37 0.21 BDL201 9963.6 Av 1.29 1.13 1.15 BDL220 10331.5 P 0.76 BDL220 10331.5 Av 1.13 BDL220 10331.7 P 0.62 0.42 0.29 BDL220 10331.7 Av 1.21 1.17 1.18 BDL220 10333.2 P 0.62 BDL220 10333.2 Av 1.49 BDL220 10333.5 P 0.01 0.25 0.26 0.65 BDL220 10333.5 Av 1.13 1.22 1.18 1.14 BDL220 10334.1 P <0.01 0.36 0.64 BDL220 10334.1 Av 1.04 1.31 1.11 BDL223 10791.1 P 0.51 BDL223 10791.1 Av 1.78 BDL223 10793.1 P 0.02 0.58 BDL223 10793.1 Av 1.16 1.34 BDL223 10793.3 P 0.7 BDL223 10793.3 Av 1.1 BDL223 10793.5 P 0.01 <0.01 0.42 0.48 0.48 0.18 BDL223 10793.5 Av 1.18 1.41 1.15 1.13 1.13 1.17 BDL223 10793.8 P 0.6 BDL223 10793.8 Av 1.36 BDL224 10451.3 P 0.61 0.5 0.61 BDL224 10451.3 Av 1.1 1.11 1.1 BDL224 10451.7 P 0.78 BDL224 10451.7 Av 1.11 BDL224 10451.8 P 0.03 0.54 BDL224 10451.8 Av 1.78 1.11 BDL224 10453.1 P 0.77 BDL224 10453.1 Av 1.11 BDL224 10453.3 P 0.62 0.39 BDL224 10453.3 Av 1.82 1.14 BDL225 10401.4 P 0.18 BDL225 10401.4 Av 1.17 BDL225 10402.2 P 0.29 0.74 BDL225 10402.2 Av 1.28 1.1 BDL225 10402.5 P 0.38 BDL225 10402.5 Av 1.13 BDL225 10401.4 P 0.5 0.65 BDL225 10401.4 Av 1.12 1.15 BDL225 10402.2 P 0.42 0.38 BDL225 10402.2 Av 1.1 1.15 BDL225 10402.6 P 0.38 BDL225 10402.6 Av 1.15 BDL225 10402.9 P 0.07 0.01 BDL225 10402.9 Av 1.14 1.15 BDL226 10861.2 P 0.53 0.54 BDL226 10861.2 Av 1.22 1.12 BDL226 10862.2 P 0.03 BDL226 10862.2 Av 1.03 BDL226 10864.2 P 0.44 0.58 0.32 0.21 BDL226 10864.2 Av 1.17 1.1 1.2 1.27 BDL226 10861.1 P 0.68 0.72 BDL226 10861.1 Av 1.27 1.21 BDL226 10861.4 P 0.04 0.41 BDL226 10861.4 Av 1.13 1.44 BDL226 10862.2 P 0.21 BDL226 10862.2 Av 1.51 BDL226 10863.4 P 0.53 BDL226 10863.4 Av 2.04 BDL227 11491.1 P 0.08 0.45 BDL227 11491.1 Av 1.17 2.04 BDL227 11491.3 P 0.13 0.34 0.08 BDL227 11491.3 Av 1.1 1.78 1.15 BDL227 11491.5 P 0.66 BDL227 11491.5 Av 1.15 BDL227 11492.3 P 0.04 0.71 0.48 0.49 0.49 0.02 BDL227 11492.3 Av 1.13 1.15 1.13 1.12 1.12 1.2 BDL227 11492.5 P 0.66 BDL227 11492.5 Av 1.29 BDL227 11493.5 P 0.65 BDL227 11493.5 Av 1.38 BDL230 10672.4 P 0.79 BDL230 10672.4 Av 1.1 BDL230 10673.2 P 0.42 BDL230 10673.2 Av 1.1 BDL233 10822.1 P 0.14 BDL233 10822.1 Av 1.37 BDL233 10822.2 P 0.02 0.46 BDL233 10822.2 Av 1.16 1.4 BDL233 10824.2 P 0.46 BDL233 10824.2 Av 1.69 BDL233 10825.4 P 0.03 0.16 0.15 0.19 0.12 0.19 BDL233 10825.4 Av 1.16 1.15 1.3 1.26 1.17 1.26 BDL237 10892.2 P 0.23 BDL237 10892.2 Av 1.15 BDL237 10893.1 P 0.48 BDL237 10893.1 Av 2.25 BDL237 10895.1 P 0.57 0.48 0.47 0.54 0.54 BDL237 10895.1 Av 1.11 1.28 1.35 1.11 1.11 BDL237 10895.2 P 0.61 BDL237 10895.2 Av 1.11 BDL237 10895.3 P 0.03 0.48 BDL237 10895.3 Av 1.18 2.07 BDL238 10951.4 P 0.03 BDL238 10951.4 Av 1.16 BDL238 10952.3 P 0.12 0.16 BDL238 10952.3 Av 1.15 1.16 BDL238 10953.1 P 0.43 BDL238 10953.1 Av 1.2 BDL238 10953.3 P 0.36 BDL238 10953.3 Av 1.18 BDL238 10954.2 P 0.02 0.01 0.05 0.01 0.04 BDL238 10954.2 Av 1.45 1.5 1.19 1.5 1.25 BDL238 10954.3 P 0.16 BDL238 10954.3 Av 1.77 BDL240 10802.2 P 0.24 0.44 0.1 0.07 0.06 0.07 0.25 BDL240 10802.2 Av 1.15 1.45 1.3 1.35 1.18 1.35 1.28 BDL240 10803.1 P 0.62 BDL240 10803.1 Av 1.45 BDL240 10803.5 P 0.63 BDL240 10803.5 Av 1.4 BDL240 10806.2 P 0.09 0.39 BDL240 10806.2 Av 1.1 1.11 BDL241 10873.1 P 0.55 0.11 0.09 0.17 0.09 0.34 BDL241 10873.1 Av 1.86 1.32 1.33 1.13 1.33 1.25 BDL241 10873.4 P 0.44 BDL241 10873.4 Av 1.73 BDL241 10874.2 P <0.01 BDL241 10874.2 Av 1.03 BDL241 10875.1 P 0.33 BDL241 10875.1 Av 1.57 BDL241 10875.2 P 0.58 0.09 BDL241 10875.2 Av 1.48 1.19 BDL242 10731.2 P 0.59 0.46 0.46 BDL242 10731.2 Av 1.1 1.14 1.14 BDL242 10731.3 P <0.01 BDL242 10731.3 Av 1.74 BDL242 10731.5 P 0.7 BDL242 10731.5 Av 1.18 BDL242 10731.6 P 0.63 0.07 0.07 0.09 0.07 0.04 BDL242 10731.6 Av 1.48 1.36 1.35 1.17 1.35 1.16 BDL242 10731.7 P 0.18 BDL242 10731.7 Av 2.28 BDL242 10737.2 P 0.07 BDL242 10737.2 Av 1.22 BDL245 10811.3 P 0.22 0.05 <0.01 0.2 BDL245 10811.3 Av 1.47 1.25 1.25 1.16 BDL245 10813.3 P 0.28 0.02 0.22 BDL245 10813.3 Av 1.17 1.33 1.15 BDL245 10811.2 P 0.37 0.3 BDL245 10811.2 Av 1.22 1.49 BDL245 10811.3 P 0.21 0.12 0.5 BDL245 10811.3 Av 1.18 1.44 1.79 BDL245 10812.3 P 0.55 0.11 BDL245 10812.3 Av 2.2 1.12 BDL245 10813.3 P 0.37 0.45 0.04 BDL245 10813.3 Av 1.19 1.1 1.26 BDL245 10816.3 P 0.52 0.23 BDL245 10816.3 Av 1.81 1.14 BDL247 10911.4 P 0.42 BDL247 10911.4 Av 1.1 BDL247 10912.1 P 0.48 0.58 BDL247 10912.1 Av 1.26 1.16 BDL247 10912.6 P 0.6 BDL247 10912.6 Av 1.33 BDL248 11051.2 P 0.45 BDL248 11051.2 Av 1.14 BDL250 10841.3 P 0.2 0.13 0.58 0.36 0.36 BDL250 10841.3 Av 1.14 1.16 1.1 1.17 1.17 BDL250 10842.1 P 0.45 0.37 BDL250 10842.1 Av 1.12 1.31 BDL250 10842.3 P 0.02 0.46 BDL250 10842.3 Av 1.15 1.14 BDL250 10843.2 P 0.42 BDL250 10843.2 Av 1.19 BDL250 10846.2 P 0.01 0.06 BDL250 10846.2 Av 1.17 1.22 BDL250 10846.3 P 0.48 0.22 0.26 0.34 0.25 0.34 BDL250 10846.3 Av 1.13 1.11 1.23 1.19 1.12 1.19 BDL252 10881.1 P 0.54 BDL252 10881.1 Av 2.4 BDL252 10882.1 P 0.59 0.24 0.2 0.14 0.2 BDL252 10882.1 Av 1.24 1.22 1.24 1.16 1.24 BDL252 10882.2 P 0.5 0.71 BDL252 10882.2 Av 1.52 1.27 BDL252 10882.4 P 0.52 BDL252 10882.4 Av 2.2 BDL252 10884.1 P 0.22 0.27 BDL252 10884.1 Av 1.16 1.28 BDL48 10271.1 P 0.01 0.34 BDL48 10271.1 Av 1.22 1.3 BDL48 10271.3 P 0.33 0.31 BDL48 10271.3 Av 1.23 1.17 BDL48 10271.5 P <0.01 BDL48 10271.5 Av 1.03 BDL48 10274.4 P 0.5 0.02 0.01 0.07 0.52 0.06 0.15 0.06 0.01 BDL48 10274.4 Av 2.17 1.24 1.13 1.34 1.11 1.37 1.22 1.37 1.51 BDL48 10271.1 P 0.13 0.12 0.08 0.03 0.08 BDL48 10271.1 Av 1.25 1.17 1.29 1.2 1.29 BDL48 10271.3 P 0.21 BDL48 10271.3 Av 1.1 BDL48 10271.5 P <0.01 BDL48 10271.5 Av 1.26 BDL48 10274.3 P 0.01 0.31 0.18 0.18 BDL48 10274.3 Av 1.18 1.15 1.21 1.21 BDL48 10274.4 P 0.57 0.22 0.12 0.18 0.12 BDL48 10274.4 Av 1.13 1.2 1.27 1.12 1.27 BDL48 10274.5 P <0.01 0.45 0.35 0.2 0.3 0.2 BDL48 10274.5 Av 1.16 1.13 1.11 1.22 1.1 1.22 BDL58 10281.2 P 0.26 0.27 BDL58 10281.2 Av 1.11 1.19 BDL58 10281.3 P 0.65 0.64 BDL58 10281.3 Av 1.23 1.2 BDL58 10281.5 P 0.01 BDL58 10281.5 Av 1.12 BDL58 10282.3 P 0.02 BDL58 10282.3 Av 1.11 BDL63 10381.1 P 0.62 0.25 0.39 BDL63 10381.1 Av 1.35 1.28 1.11 BDL63 10381.2 P 0.1 0.19 0.39 BDL63 10381.2 Av 1.67 1.19 1.12 BDL63 10384.5 P 0.54 0.05 0.29 BDL63 10384.5 Av 1.95 1.09 1.19 BDL63 10381.1 P 0.06 0.02 0.04 0.02 <0.01 BDL63 10381.1 Av 1.31 1.4 1.18 1.4 1.16 BDL63 10381.2 P 0.06 0.19 0.1 0.07 0.1 BDL63 10381.2 Av 1.02 1.25 1.32 1.2 1.32 BDL63 10384.2 P 0.41 0.45 <0.01 BDL63 10384.2 Av 1.14 1.12 1.17 BDL63 10384.3 P 0.3 BDL63 10384.3 Av 1.14 BDL63 10384.7 P 0.04 <0.01 BDL63 10384.7 Av 1.12 1.16 BDL63 10384.8 P 0.12 0.11 0.06 0.11 0.31 BDL63 10384.8 Av 1.25 1.26 1.17 1.26 1.12 BDL79 11041.1 P 0.13 0.49 0.77 BDL79 11041.1 Av 1.11 2.06 1.1 BDL79 11042.1 P 0.09 0.2 0.54 0.54 BDL79 11042.1 Av 1.15 1.16 1.11 1.11 BDL79 11042.3 P 0.46 BDL79 11042.3 Av 1.37 BDL79 11043.1 P 0.47 BDL79 11043.1 Av 1.92 BDL79 11044.3 P 0.01 0.15 BDL79 11044.3 Av 1.21 1.23 BDL81 10371.5 P 0.6 BDL81 10371.5 Av 1.27 BDL81 10371.8 P 0.51 BDL81 10371.8 Av 2.2 BDL81 10372.1 P 0.54 BDL81 10372.1 Av 2.43 BDL81 10372.2 P 0.06 0.66 BDL81 10372.2 Av 1.12 1.28 BDL81 10374.1 P 0.42 BDL81 10374.1 Av 1.99 BDL81 10371.5 P 0.01 0.25 0.37 0.14 0.37 0.07 BDL81 10371.5 Av 1.13 1.18 1.14 1.13 1.14 1.11 BDL81 10371.8 P 0.2 0.05 0.02 0.33 0.23 0.19 0.23 0.04 BDL81 10371.8 Av 1.12 1.1 1.1 1.19 1.24 1.18 1.24 1.07 BDL81 10372.1 P 0.05 BDL81 10372.1 Av 1.1 BDL81 10372.2 P 0.33 0.4 0.59 BDL81 10372.2 Av 1.13 1.29 1.18 BDL81 10373.2 P 0.01 BDL81 10373.2 Av 1.19 BDL81 10374.1 P 0.06 0.02 0.23 0.02 0.04 BDL81 10374.1 Av 1.35 1.48 1.14 1.48 1.15 BDL85 10411.1 P 0.01 0.12 0.12 0.26 0.12 0.07 BDL85 10411.1 Av 1.09 1.29 1.28 1.12 1.28 1.16 BDL85 10411.3 P 0.59 BDL85 10411.3 Av 1.51 BDL85 10412.2 P 0.62 BDL85 10412.2 Av 1.6 BDL85 10414.1 P 0.1 BDL85 10414.1 Av 1.03 BDL85 10414.2 P 0.62 BDL85 10414.2 Av 1.19 Table 26. Results of the greenhouse experiments. Provided are the measured values of each parameter [parameters (Par.) 21-30 according to the parameters described in Table 23 above] in plants expressing the indicated polynucleotides. “Ev” = event; “P” = P-value; “Av” = ratio between the averages of event and control. Note that when the average ratio is higher than “1” the effect of exogenous expression of the gene is an increase of the desired trait;
(421) TABLE-US-00027 TABLE 27 Results from greenhouse experiments Gene Ev. Par 31 32 33 34 35 36 37 BDL102 10471.1 P 0.12 BDL102 10471.1 Av 1.12 BDL102 10474.1 P 0.26 BDL102 10474.1 Av 1.35 BDL117 10074.1 P 0.69 BDL117 10074.1 Av 1.1 BDL117 10074.4 P 0.45 BDL117 10074.4 Av 1.14 BDL138 9811.1 P 0.06 0.11 0.22 BDL138 9811.1 Av 1.18 1.11 1.1 BDL138 9811.4 P <0.01 0.19 0.48 BDL138 9811.4 Av 1.21 1.11 1.2 BDL138 9813.1 P 0.1 0.02 BDL138 9813.1 Av 1.17 1.05 BDL138 9813.4 P 0.01 BDL138 9813.4 Av 1.08 BDL138 9811.1 P 0.26 0.58 BDL138 9811.1 Av 1.15 1.13 BDL138 9811.4 P <0.01 0.02 BDL138 9811.4 Av 1.18 1.18 BDL138 9812.1 P 0.01 0.03 0.1 BDL138 9812.1 Av 1.13 1.1 1.07 BDL138 9813.1 P 0.02 0.09 BDL138 9813.1 Av 1.09 1.08 BDL138 9813.3 P 0.09 0.03 BDL138 9813.3 Av 1.17 1.16 BDL140 10423.1 P 0.71 BDL140 10423.1 Av 1.11 BDL147 10301.5 P 0.01 BDL147 10301.5 Av 1.1 BDL147 10301.6 P 0.06 0.02 BDL147 10301.6 Av 1.14 1.09 BDL147 10303.1 P 0.16 0.66 BDL147 10303.1 Av 1.11 1.14 BDL147 10303.5 P 0.01 0.01 BDL147 10303.5 Av 1.13 1.11 BDL147 10303.6 P 0.1 BDL147 10303.6 Av 1.13 BDL149 9824.4 P 0.01 BDL149 9824.4 Av 1.19 BDL152 10434.4 P 0.8 BDL152 10434.4 Av 1.13 BDL153 10143.1 P 0.65 0.52 BDL153 10143.1 Av 1.1 1.19 BDL153 10143.2 P 0.26 0.05 BDL153 10143.2 Av 1.1 1.02 BDL155 9991.5 P 0.56 BDL155 9991.5 Av 1.23 BDL155 9991.9 P 0.1 BDL155 9991.9 Av 1.31 BDL155 9993.2 P 0.62 BDL155 9993.2 Av 1.1 BDL155 9994.3 P 0.47 BDL155 9994.3 Av 1.14 BDL157 9911.3 P 0.02 0.33 BDL157 9911.3 Av 1.32 1.19 BDL157 9911.4 P 0.64 BDL157 9911.4 Av 1.14 BDL157 9913.1 P 0.01 <0.01 BDL157 9913.1 Av 1.19 1.08 BDL157 9913.3 P 0.11 BDL157 9913.3 Av 1.17 BDL157 9914.2 P 0.13 0.4 BDL157 9914.2 Av 1.18 1.1 BDL157 9911.3 P 0.15 BDL157 9911.3 Av 1.13 BDL157 9913.1 P 0.36 BDL157 9913.1 Av 1.15 BDL157 9913.3 P 0.03 BDL157 9913.3 Av 1.06 BDL157 9914.2 P 0.22 BDL157 9914.2 Av 1.18 BDL162 10492.2 P 0.1 BDL162 10492.2 Av 1.8 BDL167 10042.3 P 0.14 BDL167 10042.3 Av 1.15 BDL167 10042.4 P 0.01 0.01 0.19 0.01 BDL167 10042.4 Av 1.15 1.05 1.1 1.06 BDL167 10043.1 P 0.01 0.04 <0.01 BDL167 10043.1 Av 1.16 1.06 1.1 BDL167 10043.3 P 0.04 0.08 0.01 BDL167 10043.3 Av 1.15 1.05 1.06 BDL167 10044.2 P 0.52 BDL167 10044.2 Av 1.11 BDL167 10043.2 P 0.44 0.07 BDL167 10043.2 Av 1.22 1.08 BDL167 10043.3 P <0.01 BDL167 10043.3 Av 1.2 BDL167 10043.4 P 0.22 0.2 BDL167 10043.4 Av 1.21 1.2 BDL167 10044.2 P 0.1 0.05 BDL167 10044.2 Av 1.22 1.03 BDL168 9881.3 P <0.01 BDL168 9881.3 Av 1.27 BDL168 9881.4 P 0.4 0.42 BDL168 9881.4 Av 1.21 1.2 BDL168 9882.1 P 0.11 BDL168 9882.1 Av 1.39 BDL168 9882.3 P 0.18 BDL168 9882.3 Av 1.32 BDL169 10744.2 P 0.57 BDL169 10744.2 Av 1.16 BDL169 10747.1 P 0.46 BDL169 10747.1 Av 1.11 BDL169 10747.5 P 0.28 BDL169 10747.5 Av 1.16 BDL171 10661.2 P 0.7 BDL171 10661.2 Av 1.23 BDL171 10664.1 P 0.6 BDL171 10664.1 Av 1.39 BDL173 9951.2 P 0.66 BDL173 9951.2 Av 1.13 BDL173 9952.1 P 0.21 0.12 BDL173 9952.1 Av 1.23 1.14 BDL173 9952.2 P 0.14 0.64 0.34 0.04 BDL173 9952.2 Av 1.1 1.15 1.11 1.04 BDL173 9953.4 P 0.58 <0.01 0.47 0.06 BDL173 9953.4 Av 1.13 1.41 1.1 1.1 BDL173 9954.2 P 0.12 0.05 0.22 BDL173 9954.2 Av 1.17 1.08 1.1 BDL173 9954.5 P <0.01 0.04 0.57 0.07 BDL173 9954.5 Av 1.21 1.09 1.13 1.03 BDL176 9891.2 P 0.01 <0.01 0.31 0.01 <0.01 BDL176 9891.2 Av 1.17 1.06 1.22 1.14 1.06 BDL176 9891.4 P <0.01 0.05 BDL176 9891.4 Av 1.23 1.11 BDL176 9892.3 P <0.01 <0.01 0.09 BDL176 9892.3 Av 1.34 1.17 1.03 BDL176 9893.2 P 0.08 0.16 0.25 BDL176 9893.2 Av 1.23 1.15 1.13 BDL176 9893.3 P <0.01 0.01 0.12 BDL176 9893.3 Av 1.2 1.36 1.22 BDL177 10521.3 P 0.03 BDL177 10521.3 Av 1.43 BDL177 10524.2 P 0.22 BDL177 10524.2 Av 1.28 BDL183 9941.1 P 0.58 BDL183 9941.1 Av 1.1 BDL183 9942.1 P 0.08 BDL183 9942.1 Av 1.11 BDL183 9943.4 P <0.01 BDL183 9943.4 Av 1.25 BDL183 9944.2 P 0.29 BDL183 9944.2 Av 1.24 BDL190 10232.2 P 0.27 0.54 BDL190 10232.2 Av 1.14 1.13 BDL190 10233.2 P 0.38 0.03 BDL190 10233.2 Av 1.13 1.04 BDL190 10233.4 P 0.03 <0.01 0.05 BDL190 10233.4 Av 1.13 1.34 1.12 BDL190 10234.1 P 0.21 0.03 0.53 BDL190 10234.1 Av 1.16 1.03 1.19 BDL190 10231.1 P 0.07 0.07 0.01 BDL190 10231.1 Av 1.06 1.09 1.15 BDL190 10231.2 P 0.33 BDL190 10231.2 Av 1.4 BDL190 10232.2 P 0.04 BDL190 10232.2 Av 1.08 BDL190 10233.2 P 0.25 BDL190 10233.2 Av 1.25 BDL192 9921.1 P 0.22 0.11 0.07 BDL192 9921.1 Av 1.18 1.1 1.03 BDL192 9922.1 P 0.01 0.04 BDL192 9922.1 Av 1.15 1.06 BDL192 9922.2 P 0.02 0.04 <0.01 BDL192 9922.2 Av 1.21 1.09 1.12 BDL192 9922.5 P 0.68 BDL192 9922.5 Av 1.1 BDL193 10152.2 P 0.08 BDL193 10152.2 Av 1.04 BDL196 10243.2 P 0.01 BDL196 10243.2 Av 1.14 BDL201 9963.6 P 0.15 BDL201 9963.6 Av 1.28 BDL201 9964.3 P 0.15 BDL201 9964.3 Av 1.36 BDL220 10333.5 P 0.35 BDL220 10333.5 Av 1.19 BDL223 10793.5 P 0.05 BDL223 10793.5 Av 1.15 BDL224 10451.8 P 0.02 BDL224 10451.8 Av 1.5 BDL225 10401.1 P 0.08 BDL225 10401.1 Av 1.32 BDL225 10401.4 P 0.01 BDL225 10401.4 Av 1.52 BDL225 10402.2 P 0.03 BDL225 10402.2 Av 1.43 BDL225 10402.5 P 0.26 BDL225 10402.5 Av 1.39 BDL225 10402.6 P 0.08 BDL225 10402.6 Av 1.57 BDL225 10402.9 P 0.12 BDL225 10402.9 Av 1.36 BDL226 10861.2 P 0.35 BDL226 10861.2 Av 1.1 BDL227 11492.3 P 0.05 BDL227 11492.3 Av 1.15 BDL233 10825.4 P 0.53 BDL233 10825.4 Av 1.13 BDL238 10954.2 P <0.01 BDL238 10954.2 Av 1.34 BDL240 10802.2 P 0.23 BDL240 10802.2 Av 1.3 BDL241 10873.1 P 0.07 BDL241 10873.1 Av 1.29 BDL242 10731.2 P 0.62 BDL242 10731.2 Av 1.1 BDL242 10731.6 P 0.04 BDL242 10731.6 Av 1.21 BDL250 10846.3 P 0.53 BDL250 10846.3 Av 1.15 BDL48 10271.1 P 0.2 BDL48 10271.1 Av 1.23 BDL48 10271.3 P 0.08 BDL48 10271.3 Av 1.48 BDL48 10273.2 P 0.58 BDL48 10273.2 Av 1.12 BDL48 10274.4 P 0.01 BDL48 10274.4 Av 1.95 BDL48 10271.3 P 0.01 0.01 BDL48 10271.3 Av 1.12 1.1 BDL48 10271.5 P 0.06 0.1 BDL48 10271.5 Av 1.06 1.05 BDL48 10274.3 P <0.01 BDL48 10274.3 Av 1.44 BDL48 10274.4 P 0.08 BDL48 10274.4 Av 1.05 BDL58 10282.3 P 0.63 BDL58 10282.3 Av 1.19 BDL63 10384.3 P 0.26 BDL63 10384.3 Av 1.27 BDL63 10381.1 P <0.01 0.06 BDL63 10381.1 Av 1.26 1.08 BDL63 10381.2 P 0.56 BDL63 10381.2 Av 1.14 BDL63 10384.2 P <0.01 0.04 BDL63 10384.2 Av 1.27 1.08 BDL63 10384.3 P 0.01 0.02 0.3 0.01 BDL63 10384.3 Av 1.12 1.09 1.15 1.04 BDL63 10384.7 P 0.05 0.06 0.08 BDL63 10384.7 Av 1.07 1.07 1.15 BDL63 10384.8 P 0.51 BDL63 10384.8 Av 1.13 BDL81 10371.5 P <0.01 0.01 <0.01 0.23 0.04 BDL81 10371.5 Av 1.13 1.1 1.15 1.14 1.02 BDL81 10371.8 P 0.03 BDL81 10371.8 Av 1.08 BDL81 10372.1 P <0.01 0.01 BDL81 10372.1 Av 1.17 1.1 BDL81 10372.2 P 0.22 0.1 0.59 BDL81 10372.2 Av 1.11 1.11 1.14 BDL81 10373.2 P 0.05 BDL81 10373.2 Av 1.07 BDL81 10374.1 P 0.05 BDL81 10374.1 Av 1.2 BDL85 10411.1 P 0.1 BDL85 10411.1 Av 1.21 Table 27. Results of the greenhouse experiments. Provided are the measured values of each parameter [parameters (Par.) 31-37 according to the parameters described in Table 23 above] in plants expressing the indicated polynucleotides. “Ev” = event; “P” = P-value; “Av” = ratio between the averages of event and control. Note that when the average ratio is higher than “1” the effect of exogenous expression of the gene is an increase of the desired trait;
Example 10
Production of Tomato Transcriptom and High Throughput Correlation Analysis of Yield and/or Vigor Related Parameters Using 44K Tomato Oligonucleotide Micro-Array: Tomato Field Experiments
(422) In order to produce a high throughput correlation analysis, the present inventors utilized a Tomato oligonucleotide micro-array, produced by Agilent Technologies [Hypertext Transfer Protocol://World Wide Web(dot)chem.(dot)agilent(dot)com/Scripts/PDS(dot)asp?1 Page=50879]. The array oligonucleotide represents about 44,000 Toamto genes and transcripts. In order to define correlations between the levels of RNA expression with yield components, ABST or vigor related parameters various plant characteristics of 18 different Tomato varieties were analyzed. Among them, 10 varieties encompassing the observed variance were selected for RNA expression analysis. The correlation between the RNA levels and the characterized parameters in field experiments was analyzed using Pearson correlation test [Hypertext Transfer Protocol://World Wide Web(dot)davidmlane(dot)com/hyperstat/A34739(dot)html].
Experimental Procedures
(423) Growth Procedure in Tomato Field Experiments—
(424) Tomato varieties were grown under normal conditions (4-6 Liters/m.sup.2 per day) until flower stage.
(425) RNA Extraction—
(426) Leaves at different developmental stages, representing different plant characteristics, were sampled and RNA was extracted using TRIzol Reagent from Invitrogen [Hypertext Transfer Protocol://World Wide Web(dot) invitrogen(dot)com/content(dot)cfm?pageid=469].
(427) Approximately 30-50 mg of tissue was taken from samples. The weighted tissues were ground using pestle and mortar in liquid nitrogen and resuspended in 500 μl of TRIzol Reagent. To the homogenized lysate, 100 μl of chloroform was added followed by precipitation using isopropanol and two washes with 75% ethanol. The RNA was eluted in 30 μl of RNase-free water. RNA samples were cleaned up using Qiagen's RNeasy minikit clean-up protocol as per the manufacturer's protocol (QIAGEN Inc, CA USA).
(428) Ripe Fruit Average Weight (Grams)—
(429) At the end of the experiment [when 50% of the fruit were ripe (red)] all fruits from plots within blocks A-C were collected. The total fruits were counted and weighted. The average fruits weight was calculated by dividing the total fruit weight by the number of fruits.
Experimental Results
(430) 10 different Tomato varieties were grown and characterized for ripe fruit average weight (grams) as described above and the measured parameter [Ripe fruit average weight (gr.) at Normal Irrigation] is presented in Table 28 below.
(431) TABLE-US-00028 TABLE 28 Measured parameters Tomato accessions Normal Irrigation; Ripe fruit Variety average weight (gr.) 612 0.05 613 0.01 617 0.01 618 0.05 622 0.01 623 0.01 626 0.03 629 0.00 630 0.00 631 0.01 Table 28: Provided are the measured yield components (Ripe fruit average weight under normal irrigation) for the tomato accessions (Varieties).
(432) Subsequent correlation analysis between the leaf transcriptom set of BDL83_H74 Gene (SEQ ID NO:282) and the ripe fruit average weight under normal irrigation conditions was conducted and the correlation coefficient (R) was found to be 0.734.
Example 11
Production of Tomato Transcriptom and High Throughput Correlation Analysis of Vigor Related Parameters Using 44K Tomato Oligonucleotide Micro-Array
Experimental Procedures
(433) Growth Conditions for Tomato Experiments
(434) Correlation of Early Vigor Traits Across Collection of Tomato Ecotypes—
(435) Ten Tomato varieties were grown in 3 repetitive plots, each containing 17 plants, at a net house under semi-hydroponics conditions. Briefly, the growing protocol was as follows: Tomato seeds were sown in trays filled with a mix of vermiculite and peat in a 1:1 ratio. Following germination, the trays were transferred to normal growth solution [full Hogland; KNO.sub.3—0.808 grams/liter, MgSO.sub.4—0.12 grams/liter, KH2 PO.sub.4—0.172 grams/liter and 0.01% (volume/volume) of ‘Super coratin’ micro elements (Iron-EDDHA [ethylenediamine-N,N′-bis(2-hydroxyphenylacetic acid)]-40.5 grams/liter; Mn—20.2 grams/liter; Zn 10.1 grams/liter; Co 1.5 grams/liter; and Mo 1.1 grams/liter), solution's pH should be 6.5-6.8] at a temperature of 20-24° C.
(436) RNA Extraction—
(437) All 10 selected Tomato varieties were sampled. Leaves from plant under Normal conditions were sampled and RNA was extracted using TRIzol Reagent from Invitrogen [Hypertext Transfer Protocol://World Wide Web(dot) invitrogen(dot)com/content(dot)cfm?pageid=469].
(438) Tomato Vigor Related Parameters—
(439) following 5 weeks of growing, plant were harvested and analyzed for leaf number. The analyzed data was saved to text files and processed using the JMP statistical analysis software (SAS institute).
Experimental Results
(440) 10 different Tomato varieties were grown and characterized for leaf number as described above. The average leaf number was calculated using the JMP software and values are summarized in Tables 29 below.
(441) TABLE-US-00029 TABLE 29 Measured parameters Tomato accessions Variety Leaf number 1139 6.56 2078 6.89 2958 7.33 5077 6.22 5080 6.33 5084 6.44 5085 5.89 5088 5.56 5089 6.11 5092 5.67 Table 29. Provided are the measured vigor related parameter (leaf number) for the tomato accessions (Varieties).
(442) Subsequent correlation analysis between the leaf transcriptom set of BDL83_H73 gene (SEQ ID NO:281) with the average leaf number was conducted, the correlation coefficient (R) was −0.794.
(443) The genes identified herein improve plant yield in general, and more specifically oil yield, seed yield, oil content, plant growth rate, plant biomass, root measurements, and plant vigor. The output of the bioinformatics method described herein is a set of genes highly predicted to improve yield (seed yield, oil yield and content, biomass) and/or other agronomic important yields by modifying their expression. Although each gene is predicted to have its own impact, modifying the mode of expression of more than one gene is expected to provide an additive or synergistic effect on the plant yield, plant growth rate, root measurements, plant vigor and/or other agronomic important yields performance. Altering the expression of each gene described here alone or set of genes together increases the overall yield plant growth rate, root measurements, plant vigor and/or
(444) Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
(445) All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.