Method for improving sensitivity of plant to gibberellin inhibitor and use thereof

11242537 · 2022-02-08

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention discloses a method for increasing the sensitivity of a plant to a gibberellin inhibitor. The method for increasing the sensitivity of a plant to a gibberellin inhibitor provided by the present invention comprises the step of introducing an encoding gene of a protein into a recipient plant to obtain a transgenic plant; the transgenic plant has increased sensitivity to the gibberellin inhibitor compared to the recipient plant; the protein is a protein of the following a) or b) or c): a) a protein whose amino acid sequence is set forth in positions 1-821 of SEQ ID NO: 1; b) a protein whose amino acid sequence is set forth in SEQ ID NO: 1; c) a fusion protein obtained by attaching tag(s) to the N-terminus or/and C-terminus of a) or b). The experiments prove that the method for increasing the sensitivity of a plant to a gibberellin inhibitor of the present invention can be used to increase the sensitivity of plants to gibberellin inhibitors, and the plant height of plants can be regulated by the plant height-related protein HRP of the present invention.

Claims

1. A method for increasing the sensitivity of a plant to a gibberellin inhibitor, the method comprising: introducing a gene encoding a height-related protein (HRP) from Gossypium arboreum into a recipient plant to obtain a transgenic plant; wherein the transgenic plant has increased sensitivity to the gibberellin inhibitor compared to the recipient plant; wherein the plant is a dicotyledon or a monocotyledon; and wherein the height-related protein (HRP) is: a) a protein having the amino acid sequence of positions 1-821 of SEQ ID NO: 1; b) a protein having the amino acid sequence of SEQ ID NO:1; or c) a fusion protein obtained by attaching tag(s) to the N-terminus or/and C-terminus of the protein of a) or b).

2. The method of claim 1, further comprising knocking out the CPS (ent-copalyl diphosphate synthase) gene in the recipient plant when the recipient plant is a monocotyledon.

3. The method of claim 1, wherein the gene encoding the HRP protein is: i) a cDNA molecule or DNA molecule having the nucleotide sequence of positions 1-2463 of SEQ ID NO: 2; ii) a cDNA molecule or DNA molecule having the nucleotide sequence of SEQ ID NO: 2.

4. The method of claim 1, wherein the gibberellin inhibitor is a gibberellin synthesis inhibitor.

5. The method of claim 1, wherein the dicotyledon is Arabidopsis thaliana, and the monocotyledon is maize.

6. The method of claim 3, wherein the encoding sequence is the DNA molecule of SEQ ID NO: 2.

7. A method for cultivating a plant having an increased plant height, the method comprising: introducing a gene encoding a height-related protein (HRP) from Gossypium arboreum into a recipient plant to obtain a transgenic plant; wherein the transgenic plant has increased plant height compared to the recipient plant; wherein the transgenic plant is a dicotyledon or a monocotyledon; and wherein the height-related protein (HRP) is: a) a protein having the amino acid sequence of positions 1-821 of SEQ ID NO: 1; b) a protein having the amino acid sequence of SEQ ID NO:1; or c) a fusion protein obtained by attaching tag(s) to the N-terminus or/and C-terminus of the protein of a) or b).

8. The method of claim 2, wherein the CPS gene comprises SEQ ID NO: 4.

9. A transgenic plant or part thereof with increased sensitivity to a gibberellin inhibitor, wherein the transgenic plant is obtained by a method comprising: introducing a gene encoding a height-related protein (HRP) from Gossypium arboreum into the recipient plant to obtain the transgenic plant; and for a monocotyledon recipient plant, knocking out the CPS (ent-copalyl diphosphate synthase) gene in the recipient plant; wherein the transgenic plant has increased sensitivity to the gibberellin inhibitor compared to the recipient plant; and wherein the height-related protein (HRP) is: a) a protein having the amino acid sequence of positions 1-821 of SEQ ID NO: 1; b) a protein having the amino acid sequence of SEQ ID NO:1; or c) a fusion protein obtained by attaching tag(s) to the N-terminus or/and C-terminus of the protein of a) or b).

10. The plant or plant part thereof according to claim 9, wherein the plant part comprises at least one of the group consisting of cells, tissues, organs and reproductive materials.

11. The plant or plant part thereof according to claim 10, wherein the organs comprise at least one of the group consisting of seeds, leaves, fruits, stems, flowers and roots.

12. The plant or plant part thereof according to claim 10, wherein the reproductive materials comprise at least one of the group consisting of pollen, ovary, ovule, germ, endosperm, egg cell, incise, root, root tip, hypocotyl, cotyledons, stem, leaf, flower, anther, seed, meristematic cell, protoplast, and cell tissue culture.

13. The plant or plant part thereof according to claim 9, wherein the gibberellin inhibitor is a gibberellin synthesis inhibitor.

14. The plant or plant part thereof according to claim 9, wherein the plant is selected from the group consisting of Arabidopsis thaliana and maize.

Description

DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the plant heights of transgenic Arabidopsis thaliana with the HRP gene and the ZmCPS gene before DPC treatment. Wherein, A shows the plant height of ZmCPS::ga1-1, B shows the plant height of HRP::ga1-1, C shows the plant height of ZmCPS::ga1-5, and D shows the plant height of HRP::ga1-5.

(2) FIG. 2 shows the plant heights of differently treated Arabidopsis thaliana. Wherein, A shows the plant heights of ZmCPS::ga1-1 treated with different concentrations of DPC, B shows the plant heights of HRP::ga1-1 treated with different concentrations of DPC, C shows the plant heights of ZmCPS::ga1-5 treated with different concentrations of DPC, and D shows the plant heights of HRP::ga1-5 treated with different concentrations of DPC.

(3) FIG. 3 shows the plant heights of HRP::ga1-1 and HRP::ga1-5 treated with different concentrations of DPC. Wherein, A shows the plant heights of HRP::ga1-1 treated with different concentrations of DPC; B shows the plant heights of HRP::ga1-5 treated with different concentrations of DPC.

(4) FIG. 4 shows the plant phenotypes of ZmCPSKO and WT.

(5) FIG. 5 is a sensitivity analysis of transgenic zmcps-ko plants with the HRP to DPC.

DETAILED DESCRIPTION OF THE INVENTION

(6) The present invention is further described in detail below with reference to the specific embodiments. The examples are given only to illustrate the present invention and are not intended to limit the scope of the present invention.

(7) The experimental methods in the following examples are conventional methods unless otherwise specified.

(8) The materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

(9) The vector pSuper1300 in the following examples is the pSuper1300::GFP in the literature (Lipid transfer protein 3 as a target of MYB96 mediates freezing and drought stress in Arabidopsis, Journal of Experimental Botany, Guo et al., Vol. 64, No. 6, pp. 1755-1767, 2013). This biological material is available to the public from the applicant, and is only used for repeating the related experiments of the present invention and cannot be used for other purposes.

(10) The Agrobacterium tumefaciens GV3101 in the following examples is the Agrobacterium strain GV3101 in the literature (A Plasma Membrane Receptor Kinase, GHR1, Mediates Abscisic Acid- and Hydrogen Peroxide-Regulated Stomatal Movement in Arabidopsis, Hua et al., The Plant Cell, Vol. 24: 2546-2561, June 2012). This biological material is available to the public from the applicant, and is only used for repeating the related experiments of the present invention and cannot be used for other purposes.

(11) The Arabidopsis thaliana mutants ga1-1 and ga1-5 in the following examples are products of the Ohio State University Arabidopsis thaliana Biological Resource Center.

(12) The 0 mg/L DPC solution in the following examples is ultrapure water, and the 30 mg/L DPC solution in the following examples is a solution obtained by adding 30 mg of DPC to 1 L of ultrapure water, 500 mg/L DPC solution in the following examples is a solution obtained by adding 500 mg of DPC to 1 L of ultrapure water.

(13) In the following examples, the growth conditions of Arabidopsis thaliana are: culturing in a growth chamber with a photoperiod of 16 h light/8 h dark, a light intensity of 60 μmol/m.sup.2/s, a humidity of 60%-70%, and a temperature of 22° C.

(14) The DPC in the following examples is a product of Jiangsu Runze Agrochemical Co., Ltd., the catalog number is HG/T2856-1997, and the DPC is a gibberellin biosynthesis inhibitor.

Example 1. Regulation of Arabidopsis thaliana Plant Height Using a Set of Reagents Regulating Plant Height

(15) The set of reagents regulating plant height consists of a plant height-related protein and N,N-dimethylpiperidinium chloride (DPC, also known as 1,1-dimethylpiperidinium chloride); the plant height-related protein is named HRP, whose amino acid sequence is positions 1-821 of SEQ ID NO: 1 in the sequence listing. The gene of the plant height-related protein (HRP) is the DNA molecule set forth in positions 1-2463 of SEQ ID NO: 2.

(16) The HRP gene is derived from G. arboreum Shixiyal (SXYI) (Li et al., Genome sequence of the cultivated cotton Gossypium arboreum, Nature GenNetics VOLUME 46 NUMBER 6 Jun. 2014). The gene of the plant height-related protein HRP is the DNA molecule set forth in SEQ ID NO: 2 in the sequence listing.

(17) 1. Construction of Recombinant Vector and Recombinant Agrobacterium

(18) The fragment between the Xba I and Kpn I recognition sequences of the vector pSuper1300 was replaced with the DNA molecule set forth in positions 1-2463 of SEQ ID NO:2 (i.e., the HRP gene) to obtain the recombinant vector pSuper1300-HRP. The only difference between the pSuper1300-HRP and the pSuper1300 is that the DNA fragment between the Xba I and Kpn I recognition sequences of the pSuper1300-HRP is replaced with the DNA molecule set forth in positions 1-2463 of SEQ ID NO:2. The recombinant vector pSuper1300-HRP expresses a fusion protein formed by the plant height-related protein HRP and GFP and set forth in SEQ ID NO: 1.

(19) Wherein, the amino acid sequence of positions 1-821 of SEQ ID NO: 1 is the amino acid sequence of the plant height-related protein HRP, which is encoded by the plant height-related protein HRP gene set forth in positions 1-2463 of SEQ ID NO: 2; the amino acid sequence of positions 824-996 of SEQ ID NO: 1 is the amino acid sequence of GFP, which is encoded by the DNA molecule set forth in positions 2470-2720 of SEQ ID NO: 2.

(20) The fragment between the Spe I and Kpn I recognition sequences of the vector pSuper1300 was replaced with the DNA molecule set forth in positions 1-2565 of SEQ ID NO: 3 to obtain the recombinant vector pSuper1300-ZmCPS. The only difference between the pSuper1300-ZmCPS and the pSuper1300 is that the DNA fragment between the Spe I and Kpn I recognition sequences of the pSuper1300-ZmCPS was replaced with the DNA molecule set forth in SEQ ID NO: 3. The recombinant vector pSuper1300-ZmCPS expresses a fusion protein formed by the protein encoded by positions 1-2565 of SEQ ID NO: 3 and GFP.

(21) Wherein, positions of 1-2565 of SEQ ID NO: 3 is the nucleotide sequence of the ZmCPS gene, and the ZmCPS gene is derived from maize (B73).

(22) The pSuper1300-HRP was introduced into the Agrobacterium tumefaciens GV3101 to obtain a recombinant strain, and the recombinant strain was named GV3101-pSuper1300-HRP; the pSuper1300-ZmCPS was introduced into the Agrobacterium tumefaciens GV3101 to obtain a recombinant strain, and the recombinant strain was named GV3101-pSuper1300-ZmCPS: the pSuper1300 was introduced into the Agrobacterium tumefaciens GV3101 to obtain a recombinant strain, and the recombinant strain was named GV3101-pSuper1300.

(23) 2. Construction of Transgenic Arabidopsis thaliana

(24) The transgenic Arabidopsis thaliana was constructed by transforming the Arabidopsis thaliana mutants ga1-1 and ga1-5 with the GV3101-pSuper1300-HRP, GV3101-pSuper1300-ZmCPS and GV3101-pSuper1300 of step 1, respectively. The method of transforming the Arabidopsis thaliana mutant ga1-1 with the HRP gene was as follows: 2.1 Cultivation of Arabidopsis thaliana: the mutant ga1-1 seeds were vernalized at 4° C. for 72 h, seeded in gibberellin medium (the gibberellin medium was a solid medium having a GA.sub.3 concentration of 10.sup.−4 M, which was obtained by adding gibberellin (GA3) to MS medium), moved in a growth chamber at 22° C., 16 h light/8 h dark, light intensity of 60 μmol/m.sup.2/s and humidity of 60%-70%. When cultured and grown to 4 pieces of euphylla, the mutants were transplanted into planting pots having mixed nutrient soil and vermiculite with equal proportion, wherein the mutants should be sprayed with 10.sup.−4 M GA.sub.3 every two days. 2.2 Preparation of Agrobacterium liquid: the Agrobacterium inoculated with the GV3101-pSuper1300-HRP, which was detected to be correct and subjected to streak-culture, was inoculated into 5 ml of YEP liquid medium (containing antibiotics), and cultured at 28° C., 220 rpm for 30 h. The obtained liquid was transferred to 50 ml of YEP (containing antibiotics) with a volume ratio of 1:100, cultured at 28° C., 220 rpm overnight, until an OD600 of 0.6-0.8 was reached; the resulting culture was centrifuged at 6000 g for 15 min at 4° C., and the bacteria were collected and resuspended in ½ MS+5% sucrose solution, 0.02%-0.05% Silwet L-77 (a surfactant product from AMRESCO, USA) was added before the transformation. 2.3 Transformation: after the Arabidopsis thaliana plant was flowering, the top of the main branch was cut off to promote the development of the lateral branches. Within 6 days after pruning, the inflorescence without revealing white of the Arabidopsis thaliana was wetted using the prepared Agrobacterium. The transformed Arabidopsis thaliana was wrapped in a black plastic bag filled with air, and the black plastic bag was removed after 24 hours of dark. The light was restored and the plants were grown to firmness in the normal manner, and the mature T.sub.1 generation seeds of the transgenic ga1-1 with the HRP gene (HRP::ga1-1) were harvested.

(25) Homozygous line plants of the HRP::ga1-1 were obtained as follows: {circle around (1)} the T.sub.1 generation HRP::ga1-1 seeds were seeded on MS solid medium containing hygromycin for screening, and the hygromycin-resistant positive plants with healthy and dark green euphylla and roots extending into the medium were transferred to soil, and T.sub.2 generation HRP::ga1-1 seeds were harvested; {circle around (2)} the T.sub.2 generation HRP::ga1-1 seeds were seeded on MS solid medium containing hygromycin to obtain T.sub.2 generation HRP::ga1-1 plants, and the plants were screened using hygromycin, and the T.sub.2 generation HRP::ga1-1 plants, in which the ratio of the hygromycin-resistant plants to the hygromycin-sensitive plants was 3:1, were selected and the hygromycin-resistant plants were transplanted into soil, and T.sub.3 generation HRP::ga1-1 seeds were harvested (the hygromycin-resistant plants showed that the euphylla were dark green and the roots were extending into the medium; the hygromycin-sensitive plants showed that the euphylla were yellow and the roots were not extending); {circle around (3)} the T.sub.3 generation HRP::ga1-1 seeds were seeded on MS medium containing hygromycin to obtain T.sub.3 generation HRP::ga1-1 plants, and the plants were screened using hygromycin, the T.sub.3 generation HRP::ga1-1 plants, all of which were resistant to hygromycin, were selected and transplanted into soil to obtain the homozygous line plants of the HRP::ga1-1.

(26) According to the above method, the ga1-1 was replaced with the ga1-5, and the other steps were unchanged, and the transgenic ga1-1 with the HRP gene which was named HRP::ga1-1 and its homozygous line plants were respectively obtained.

(27) According to the above method, the GV3101-pSuper1300-HRP was replaced with the GV3101-pSuper1300-ZmCPS and GV3101-pSuper1300, respectively, and the other steps were unchanged and the transgenic ga1-1 with the ZmCPS gene which was named ZmCPS::ga1-1 and its homozygous line plants and the transgenic ga1-1 with the empty vector which was named pSuper1300::ga1-1 and its homozygous line plants were obtained, respectively.

(28) According to the above method, the ga1-1 was replaced with the ga1-5, the GV3101-pSuper1300-HRP was replaced with the GV3101-pSuper1300-ZmCPS and GV3101-pSuper1300 and the other steps were unchanged, and the transgenic ga1-5 with the ZmCPS gene which was named ZmCPS::ga1-5 and its homozygous line plants and the transgenic ga1-5 with the empty vector which was named pSuper1300::ga1-5 and its homozygous line plants were obtained, respectively.

(29) 3. Identification of Transgenic Plants

(30) 3.1 Detection of HRP Gene Expression in Homozygous Line Transgenic Arabidopsis Thaliana with the HRP Gene

(31) The expression level of the HRP gene in the homozygous line plant of the HRP::ga1-1 and the homozygous line plant of the HRP::ga1-5 in step 2 and the expression level of the ZmCPS gene in the homozygous line plant of the ZmCPS::ga1-1 and the homozygous line plant of the ZmCPS::ga1-5 in step 2 were identified by Real-Time PCR. The primers for detecting the expression level of the HRP gene were 5′-ACCGAGGACTCGCAGAGTTA-3′ (SEQ ID NO: 5) and 5′-ACCTTTAGCATTTGGCGATG-3′ (SEQ ID NO: 6), and the primers for detecting the expression level of the ZmCPS gene were 5′-TGCAGCCACTTATCGACCAG-3′ (SEQ ID NO: 7) and 5′-AGGCGAGGGTGTTGATCATG-3′ (SEQ ID NO: 8). The internal reference was the AtUbI gene, and the primers of the internal reference were 5′-ATTACCCGATGGGCAAGTCA-3′ (SEQ ID NO: 9) and 5′-CACAAACGAGGGCTGGAACA-3′ (SEQ ID NO: 10). The results showed that the HRP gene expressed in both homozygous line plant of the HRP::ga1-1 and the homozygous line plant of the HRP::ga1-5, and the ZmCPS gene expressed in both the homozygous line plant of the ZmCPS::ga1-1 and homozygous line plant of the ZmCPS::ga1-5.

(32) 3.2 Detection of the HRP in the Homozygous Line Transgenic Arabidopsis thaliana with the HRP Gene

(33) Western blot was used to identify the HRP protein in the homozygous line plant of the HRP::ga1-1 and the homozygous line plant of the HRP::ga1-5 of step 2, and the ZmCPS protein in the pure line plant of the ZmCPS::ga1-1 and the homozygous line plant of the ZmCPS::ga1-5 and the primary antibody was Anti-GFP Tag Rabbit (a product from Roche, catalog number: 14717400). The results showed that the HRP protein expressed in both the homozygous line plant of the HRP::ga1-1 and the homozygous line plant of the HRP::ga1-5, the ZmCPS protein expressed in both the homozygous line plant of the ZmCPS::ga1-1 and the homozygous line plant of the ZmCPS::ga1-5.

(34) 4. Effect of DPC on the Plant Height of the Transgenic Arabidopsis thaliana with the HRP Gene

(35) The experiment was repeated three times, and the specific steps of each repeated experiment were as follows:

(36) 4.1 DPC Could Reduce the Plant Height of the Transgenic Arabidopsis thaliana with the HRP Gene

(37) Thirty homozygous line plants of the HRP::ga1-1 of step 2 were randomly selected and randomly divided into three groups, ten plants in each group. On the 33rd day of sowing (the day of sowing was recorded as the first day of sowing), the plants of these three groups were treated as follows, respectively one group was sprayed with water (i.e., 0 mg/L DPC solution) and cultured for 12 days to obtain untreated HRP::ga1-1; one group was sprayed with 30 mg/L DPC solution and cultured for 12 days to obtain 30 mg/L DPC-treated HRP::ga1-1; the last group was sprayed with 500 mg/L aqueous DPC solution and cultured for 12 days to obtain 500 mg/L DPC-treated HRP::ga1-1.

(38) According to the above method, the homozygous line plants of the HRP::ga1-1 were replaced with the homozygous line plants of the HRP::ga1-5, the homozygous line plants of the ZmCPS::ga1-1, the homozygous line plants of the ZmCPS::ga1-5, the homozygous line plants of the PsSuper1300::ga1-1 and the homozygous line plants of the PsSuper1300::ga1-5 respectively, the other steps were unchanged, and untreated HRP::ga1-5, 30 mg/L DPC-treated HRP::ga1-5, 500 mg/L DPC-treated HRP::ga1-5, untreated ZmCPS::ga1-1, 30 mg/L DPC-treated ZmCPS::ga1-1, 500 mg/L DPC-treated ZmCPS::ga1-1, untreated ZmCPS::ga1-5, 30 mg/L DPC-treated ZmCPS::ga1-5, 500 mg/L DPC-treated ZmCPS::ga1-5, untreated PsSuper1300::ga1-1, 30 mg/L DPC-treated PsSuper1300::ga1-1, 500 mg/L DPC-treated PsSuper1300::ga1-1, untreated PsSuper1300::ga1-5, 30 mg/L DPC-treated PsSuper1300::ga1-5 and 500 mg/L DPC-treated PsSuper1300::ga1-5 were obtained, respectively.

(39) When the ga1-1 was cultured to the 33rd day of sowing (the day of sowing was recorded as the first day of sowing), 30 plants were taken and randomly divided into three groups, ten plants in each group and the plants of these three groups were treated as follows, respectively: one group was sprayed with 0 mg/L DPC solution and cultured for 12 days to obtain untreated ga1-1; one group was sprayed with 30 mg/L aqueous DPC solution and cultured for 12 days to obtain 30 mg/L DPC-treated ga1-1; the last group was sprayed with 500 mg/L DPC solution and cultured for 12 days to obtain 500 mg/L DPC-treated ga1-1.

(40) According to the above method, the ga1-1 was replaced with the ga1-5, the other steps were unchanged, and untreated ga1-5, 30 mg/L DPC-treated ga1-5, and 500 mg/L DPC-treated ga1-5 were obtained, respectively.

(41) The plant heights of the above Arabidopsis thaliana before the treatment (FIG. 1) and after different treatments (FIG. 2 and Table 2) were measured.

(42) TABLE-US-00002 TABLE 2 Plant height and plant height reduction rate of differently treated Arabidopsis thaliana DPC concentration (mg/L) 0 30 500 Plant Plant Plant height Plant Plant height height height reduction height reduction Plant (cm) (cm) rate (cm) rate HRP::gal-1 16.95 ± 0.21  11.2 ± 0.24 33.92% 6.75 ± 0.38 60.18% ZmCPS::gal-1 16.5 ± 0.23 16.52 ± 0.31  −0.12% 16.45 ± 0.21  0.30% pSuper1300::gal-1 4.55 ± 0.25 4.33 ± 0.27 4.84% 3.98 ± 0.17 12.53% gal-1 4.78 ± 0.30 4.13 ± 0.25 13.60% 3.95 ± 0.10 17.36% HRP::gal-5 15.88 ± 0.29  10.80 ± 0.43  31.99% 6.41 ± 0.18 59.63% ZmCPS::gal-5 16.8 ± 0.24 16.79 ± 0.13  0.06% 16.66 ± 0.31  0.83% pSuper1300::gal-5 6.95 ± 0.44 6.54 ± 0.20 5.90% 6.21 ± 0.14 10.65% gal-5 7.03 ± 0.68 6.55 ± 0.10 6.83% 6.40 ± 0.12 8.96%

(43) The results showed that under the same DPC concentration, the difference in plant height reduction rate between the pSuper1300::ga1-1 and the ga1-1 after DPC treatment was not significant, and basically DPC had no effect on ZmCPS::ga1-1, and the plant height reduction rate of the DPC-treated HRP::ga1-1 was much higher than the pSuper1300::ga1-1 and ga1-1 treated with the corresponding DPC concentration; the plant height reduction rate of the 30 mg/L DPC-treated HRP::ga1-1 was 2.49 times that of the ga1-1; the plant height reduction rate of the 500 mg/L DPC-treated HRP::ga1-1 was 3.47 times that of the ga1-1. Under the same DPC concentration, the difference in plant height reduction rate between the pSuper1300::ga1-5 and the ga1-5 after DPC treatment was not significant, and basically DPC had no effect on ZmCPS::ga1-5, and the plant height reduction rate of the DPC-treated HRP::ga1-5 was much higher than the pSuper1300::ga1-5 and ga1-5 treated with the corresponding DPC concentration; the plant height reduction rate of the 30 mg/L DPC-treated HRP::ga1-5 was 4.68 times that of ga1-5; the plant height reduction rate of the 500 mg/L DPC-treated HRP::ga1-5 was 6.66 times that of ga1-5. It was indicated that the HRP could increase the sensitivity of Arabidopsis thaliana to DPC.

(44) The results showed that the plant height-related protein HRP of the present invention could increase the plant height of Arabidopsis thaliana: the plant heights of the untreated HRP::ga1-1, 30 mg/L DPC-treated HRP::ga1-1 and 500 mg/L DPC-treated HRP::ga1-1 were 1.03 times, 0.68 times and 0.41 times that of the correspondingly treated ZmCPS::ga1-1, respectively, and 3.54 times, 2.71 times and 1.71 times that of the correspondingly treated ga1-1, respectively; the plant heights of the untreated HRP::ga1-5, 30 mg/L DPC-treated HRP::ga1-5 and 500 mg/L DPC-treated HRP::ga1-5 were 0.95 times, 0.64 times and 0.38 times that of the correspondingly treated ZmCPS::ga1-5, respectively, and 2.26 times, 1.65 times and 1.00 times that of the correspondingly treated ga1-5, respectively.

(45) 4.2 Effects of Different Concentrations of DPC on Plant Height of the Transgenic Arabidopsis thaliana with the HRP Gene

(46) Seventy homozygous line plants of the HRP::ga1-1 of step 2 were randomly selected and randomly divided into seven groups, ten plants in each group. On the 33rd day of sowing (the day of sowing was recorded as the first day of sowing), the plants of these seven groups were treated as follows, respectively: one group was sprayed with water (i.e., 0 mg/L aqueous DPC solution) and cultured for 12 days to obtain untreated HRP::ga1-1; one group was sprayed with 30 mg/L aqueous DPC solution and cultured for 12 days to obtain 30 mg/L DPC-treated HRP::ga1-1; one group was sprayed with 50 mg/L aqueous DPC solution and cultured for 12 days to obtain 50 mg/L DPC-treated HRP::ga1-1; one group was sprayed with 100 mg/L aqueous DPC solution and cultured for 12 days to obtain 100 mg/L DPC-treated HRP::ga1-1; one group was sprayed with 300 mg/L aqueous DPC solution and cultured for 12 days to obtain 300 mg/L DPC-treated HRP::ga1-1; one group was sprayed with 500 mg/L aqueous DPC solution and cultured for 12 days to obtain 500 mg/L DPC-treated HRP::ga1-1; one group was sprayed with 1000 mg/L aqueous DPC solution and cultured for 12 days to obtain 1000 mg/L DPC-treated HRP::ga1-1.

(47) According to the above method, the homozygous line plant of the HRP::ga1-1 was replaced with the pure homozygous line plant of the HRP::ga1-5, and the other steps were unchanged to obtain untreated HRP::ga1-5, 30 mg/L DPC-treated HRP::ga1-5, 50 mg/L DPC-treated HRP::ga1-5, 100 mg/L DPC-treated HRP::ga1-5, 300 mg/L DPC-treated HRP::ga1-5, 500 mg/L DPC-treated HRP::ga1-5 and 1000 mg/L DPC-treated HRP::ga1-5, respectively.

(48) The plant heights of the differently treated Arabidopsis thaliana were measured respectively (FIG. 3), and the average plant heights are shown in Table 3.

(49) The results showed that the plant height of the transgenic Arabidopsis thaliana with the HRP gene was affected by the concentration of DPC, and the plant height of the transgenic Arabidopsis thaliana with the HRP gene decreased with the increase of DPC concentration.

(50) TABLE-US-00003 TABLE 3 Plant height (cm) of the transgenic Arabidopsis thaliana with the HRP gene treated with different concentrations of DPC DPC concentration (mg/L) Plant 0 30 50 100 300 500 1000 HRP::gal-1 16.07143 9.714286 9.314286 9.342857 8.857143 8.585714 7.242857 HRP::gal-5 15.98571 11.92857 9.842857 10.14286 9.957143 9.857143 7.357143

Example 2: Sensitivity Analysis of the Transgenic Zmcps-Ko Plants with the HRP to DPC

(51) I. Dwarf Zmcps Ko Mutant Plants were Obtained Using CRISPR Technology.

(52) The pBUE411-2gR CRISPR-Cas9 ZmCPS vector was successfully constructed, and the vector was successfully transformed into the maize embryos using the method of infecting the immature embryos of the maize inbred line B73 (Schnable P S, Wilson R K. The B73 maize genome: complexity, diversity, and dynamics. [J]. Science, 2009, 326 (5956): 1112.) (WT) with the Agrobacterium, the ZmCPS was knocked out and the target sequence used was AGCTGAAGCGGATCCCAAG (SEQ ID NO: 11). After screening, the zmcps Knock out mutant (ZmCPSKO, Zmcps-ko) plants were successfully obtained.

(53) Please refer to the method of Professor Chen Qijun of China Agricultural University (Xing H L, Dong L, Wang Z P, et al. A CRISPR/Cas9 toolkit for multiplex genome editing in plants [J]. BMC Plant Biology, 2014, 14(1): 327.) for the CRISPR protocol—the construction of the pBUE411-2gR vector, PCR identification and sequencing confirmation.

(54) ZmCPS Gene Sequence:

(55) TABLE-US-00004 (SEQ ID NO: 4) ATGAAGCTCCTCTCGCCGGCGGCCGCACCGTCGTCCTCGCCGTT GTTCCCTCCTCGCATCGTCGAAGCTGCAGCTCGTCAATCAGGTC CATGCCGTATCCGCATCCGTATCCGTGGCAAAGCAGCAGCAGCA GGAGGAGGAGGAGGCGCGGGCGCGACGGGGCCCCGCGGCAGCCT CAGGCTCGCCGGGTGGTGGAGAGCGCAGCAGCAGGCCCCGGCCA CGGCGACGACAACGCAGCAGCCTGACAACGTCTCCAGTGCTAAA GTGTTCCAGACCAGCCGTGTGGAAACCGAGTCCGAAATTGCGAA ATGGCCAGGGAAACCACAAGTAGCGGGAGATCCCGAGTGCTGAG GAGGCAGAGCTGCAGCCACTTATCGACCAGGTGAGGGCGATGCT ACGGTCGATGAACGACGGGGATACCAGCGCCTCGGCGTACGACA CGGCGTGGGTGGCGATGGTGCCGAAGGTGGGCGGCGACGGCGGC GCCCAGCCCCAGTTCCCGGCCACCGTGCGCTGGATCGTGGACC ACCAGCTGCCCGACGGCTCCTGGGGCGACTCGGCCCTGTTCTCC GCCTACGACCGCATGATCAACACCCTCGCCTGCGTCGTCGCGCT GACCAAGTGGTCGCTGGAGCCCGCGAGGTGCGAGGCGGGGCTCT CGTTCCTGCACGAGAACATGTGGAGGCTAGCGGAGGAGGAGGCG GAGTCGATGCCCATCGGCTTCGAGATCGCCTTCCCTTCTCTCAT CCAGACGGCTAGGGACCTGGGCGTCGTCGACTTCCCGTACGGAC ACCCGGCGCTGCAGAGCATATACGCCAACAGGGAAGTCAAGCT GAAGCGGATCCCAAGGGACATGATGCACAGGGTCCCGAC GTCCATCCTGCACAGCCTTGAAGGGATGCCTGACCTGGACT GGCCGAGGCTTCTGAACCTCCAGTCCTGCGACGGCTCCTTCTT GTTCTCTCCTTCGGCTACCGCTTACGCGCTGATGCAAACCGGT GACAAGAAGTGCTTCGAATACATCGACAGGATTGTCAAAAAA TTCAACGGGGGAGTCCCCAATGTTTATCCGGTCGATCTTTT CGAGCACATCTGGGTTGTGGATCGGTTGGAGCGACTCGGGATCT CCCGCTACTTCCAACGAGAGATTGAGCAGTGCATGGACTATGT GAACAGGCACTGGACTGAAGATGGGATTTGCTGGGCTAGGAAAT CCAATGTGAAGGATGTGGATGACACAGCTATGGCTTTCCGACTACT AAGGCTACATGGATACAATGTCTCTCCAAGTGTGTTTAAGAACTTT GAGAAAGATGGAGAGTTCTTTTGTTTTGTGGGCCAATCGACTCA AGCCGTCACTGGGATGTATAACCTCAACAGAGCCTCTCAGATAAG TTTTCAAGGAGAGGATGTATTGCAGTGCTAGGGTTTTCTCGTATG AGTTTCTGAGACAGAGAGAAGAACAAGGCATGATCCGTGATAAAT GGATCGTTGCCAAGGATCTACCTGGCGAGGTGCAATATACACTAG ACTTCCCTTGGTATGCAAGCTTGCCTCGTGTAGAGGCAAGAACCTA TCTAGATCAATATGGTGGTAAAGATGACGTTTGGATTGGAAAGACA CTCTACAGGATGCCTCTTGTGAATAACGACACATATCTAGAGTTGG CAATAAGGGATTTCAACCATTGCCAAGCTCTGCATCAGCTTGAG TGTAATGGGCTGCAAACGTGGTACAAGGATAATTGCCTTGACGCT TTTGGAGTAGAACCACAAGATGTTTTAAGATCTTACTTTTTAGCT GCTGCTTGCATTTTTGAACCTAGCCGTGCTGCTGAGCGGCTTGCAT GGGCTAGAACGTCAATGATTGCCAATGCCATTTCTACACATCTTCG TGACATTTCGGAAGACAAGAAGAGATTGGAATGTTTCGTGCACTG TCTCTATGAAGAAAACGATGTATCATGGCTTAAACGAAATCCTAA TGATGTTATTCTTGAGAGGGCACTTCGAAGATTAATTAACTTATTA GCACAAGAAGCATTGCCAATTCATGAAGGACAAAGATTCATACACA GTCTATTGAGTCTTGCATGGACCGAATGGATGTTGCAAAAGGCA AATAAAGAAGAAAACAAATATCACAAATGCAGTGGTATAGAACC ACAATACATGGTTCATGATAGGCAAACATACTTACTTTTAGTTCAG GTTATTGAGATTTGTGCTGGACGAATTGGTGAGGCTGTGTCAATGA TAAACAACAAGGATAATGATTGGTTTATTCAACTCACATGTGCT ACTTGTGACAGTCTTAACCATAGGATGTTACTGTCCCAGGATACTA TGAAGAATGAAGCAAGAATAAATTGGATTGAGAAGGAAATCGAGTT GAATATGCAAGAGCTTGCTCAATCTCTCCTTTTGAGATGTGATGAG AAAACTAGCAATAAGAAGACCAAGAAAACCTTATGGGATGTCCTAA GAAGTTTATACTATGCTACTCATTCCCCACAACATATGATCGAT AGACATGTTTCCAGAGTTATCTTTGAGCCTGTTTAA
The Primers were as Follows:

(56) TABLE-US-00005 MT1-BsF: (SEQ ID NO: 12) ATATATGGTCTCTGGCGAAATTGCGAAATGGCCAGGTT MT1-F0: (SEQ ID NO: 13) TGAAATTGCGAAATGGCCAGGTTTTAGAGCTAGAAATAGC MT2-R0: (SEQ ID NO: 14) AACCTTGGGATCCGCTTCAGCTGCTTCTTGGTGCC MT2-BsR: (SEQ ID NO: 15) ATTATTGGTCTCTAAACCTTGGGATCCGCTTCAGCT

(57) The underlined were the recognition sequences of Msc1 and BamH1.

(58) PCR amplification: the 100-fold dilution of pCBC-MT1T2 (Xing H L, Dong L, Wang Z P et al. A CRISPR/Cas9 toolkit for multiplex genome editing in plants [J]. BMC Plant Biology, 2014, 14(1): 327.) was used as the template for a four primer PCR amplification. −BsF/−BsR concentration was within the normal primer range, −F0/−R0 was diluted 20 times.

(59) The PCR product was purified and recovered and the following restriction-ligation system was established:

(60) TABLE-US-00006 Component Volume Reaction conditions 1. PCR fragment (964-bp) 2 5 hours at 37° C. 2. pBUE411 2 5 min at 50° C. 3. 10xNEB T4 Buffer 1.5 10 min at 80° C. 4. 10xBSA 1.5 5. BsaI (NEB) 1 6. T4 Ligase (NEB)/high concentration 1 7. ddH2O 6 8. Total 15

(61) 5 μl of the PCR product was taken to transform the E. coli competent cells. Kan plate was used for screening. OsU3-FD3+TaU3-RD=831 bp, colony PCR identification was performed, and OsU3-FD3 and TaU3-FD2 were confirmed by sequencing.

(62) Note 1: Colony PCR and Sequencing Primers:

(63) TABLE-US-00007 OsU3-FD3: (SEQ ID NO: 16) GACAGGCGTCTTCTACTGGTGCTAC TaU3-RD: (SEQ ID NO: 17) CTCACAAATTATCAGCACGCTAGTC (SEQ ID NO: 18) [rc: GACTAGCGTGCTGATAATTTGTGAG] TaU3-FD: (SEQ ID NO: 19) TTAGTCCCACCTCGCCAGTTTACAG TaU3-FD2: (SEQ ID NO: 20) TTGACTAGCGTGCTGATAATTTGTG

(64) The steps of Agrobacterium-mediated transformation of maize immature embryos were as follows:

(65) 1. Materials and Methods

(66) 1.1 Experimental Materials

(67) 1.1.1 Plant Material

(68) Maize (Zea mays L.) inbred line B73 (Schnable P S, Wilson R K. The B73 maize genome: complexity, diversity, and dynamics. [J]. Science, 2009, 326 (5956): 1112.)

(69) 1.1.2 Experimental Strain

(70) Agrobacterium EHA105 (with high infection rate to monocotyledons)

(71) 1.1.3 Plasmid Vector

(72) The CRISPR/Cas9 system-related plasmids were provided by Professor Chen Qijun: pBUE411; pCBC-MT1T1T2.

(73) 1.2 Configuration of Common Media and Solutions

(74) 1.2.1 Configuration of Common Media

(75) LB medium: 10 g of tryptone, 10 g of NaCl, 5 g of yeast extract. In case of a solid medium, 15 g of agar was further added. The final volume was made up to 1 L.

(76) YEP medium: 10 g of tryptone, 5 g of NaCl, 10 g of yeast extract. In case of a solid medium, 15 g ofagar was further added. The final volume was made up to 1 L.

(77) YEB medium: 10 g of tryptone, 5 g of sucrose, 1 g of yeast extract, 0.5 g of MgS04}7H2O. In case of a solid medium, 15 g of agar was further added. The final volume was made up to 1 L.

(78) 1.2.2 Configuration of Mother Liquors

(79) (1) N6 macro-elements (mother liquor concentration 20×): 2 L

(80) TABLE-US-00008 Final concentration Mass Component (mg/L) (g) CaCl.sub.2•2H.sub.2O 166 6.64 KNO.sub.3 2830 113.2 (NH.sub.4).sub.2SO.sub.4 463 18.52 KH.sub.2PO.sub.4 400 16.00 MgSO.sub.4•7H.sub.2O 185 7.40

(81) Preparation method of 2 L mother liquor: 6.64 g of CaCl.sub.2.2H.sub.2O was weighed and dissolved in 700 mL of distilled water, and then the remaining four components were weighed and dissolved in 700 mL of distilled water. After the two solutions were completely dissolved, they were mixed and the final volume was made up to 2 L. (2) B5 micro-elements (mother liquor concentration 100×): 1 L

(82) TABLE-US-00009 Final concentration Mass Component (mg/L) (g) MnSO.sub.4•H.sub.2O 10.00 2.00 ZnSO.sub.4•7H.sub.20 2.00 0.40 CoCl.sub.2•6H.sub.2O 0.025 0.005 CuSO.sub.4•5H.sub.2O 0.025 0.005 NaMoO.sub.4•2H.sub.2O 0.25 0.05 KI 0.75 0.15 H.sub.3BO.sub.3 3.00 0.60 (3) Fe salt (mother liquor concentration 100×) 1 L

(83) TABLE-US-00010 Final concentration Mass Component (mg/L) (g) FeSO.sub.4•7H.sub.2O 27.80 2.78 Na.sub.2EDTA 37.30 3.73

(84) Method: Na.sub.2EDTA was dissolved in hot water and then FeSO.sub.4.7H.sub.2O was gradually dissolved in the Na.sub.2EDTA solution and the final volume was made up to 1 L. (4) RT V (mother liquor concentration 200×): 1 L

(85) TABLE-US-00011 Final concentration Mass Component (mg/L) (g) Choline chloride 0.0977 0.0195 Riboflavin 0.0489 0.0098 Biotin 0.1002 0.02 Folic acid 0.0485 0.0097 Niacin 0.1994 0.0399 Vitamin B1 0.4722 0.0944 D-calcium 0.10 0.02 pantothenate Pyridoxine 0.1994 0.0399 Hydrochloride Vitamin B12 0.0001 0.00675 g dissolved in 100 mLwater (+400 μL) Para- 0.0494 0.0099 aminobenzoic acid

(86) The above various vitamins were dissolved in water, and the folic acid was first dissolved in 1 mL of dilute ammonia water, and then distilled water was added to a final volume of 1 L. (5) MS macro-elements (mother liquor concentration 20×): 1 L

(87) TABLE-US-00012 Component Mass (g) CaCl.sub.2•2H.sub.2O 8.80 NH.sub.4NO.sub.3 33 KNO.sub.3 38 MgSO.sub.4•7H.sub.2O 7.4 KH.sub.2PO.sub.4 3.4 (6) MS micro-elements (mother liquor concentration 200×): 500 mL

(88) TABLE-US-00013 Component Mass (g) KI 0.083 H.sub.3BO.sub.3 0.62 MnSO.sub.4•H.sub.2O 2.23 ZnSO.sub.4•7H.sub.20 0.86 NaMoO.sub.4•2H.sub.2O 0.025 CuSO.sub.4•5H.sub.2O 0.0025 CoCl.sub.2•6H.sub.2O 0.0025 (7) MS organic matter (mother liquor concentration 200×): 500 mL

(89) TABLE-US-00014 Component Mass (g) Myo-inositol 10 Niacin 0.05 Pyridoxine 0.05 hydrochloride Thiamin 0.01 hydrochloride Glycine 0.2 (8) Fe salt (mother liquor concentration 100×): 1 L

(90) TABLE-US-00015 Component Mass (g) FeSO.sub.4•7H.sub.2O 2.78 Na.sub.2EDTA 3.73

(91) Method: Na.sub.2EDTA was dissolved in hot water and then FeSO.sub.4.7H.sub.2O was gradually dissolved in the Na.sub.2EDTA solution and water was added to a final volume of 1 L.

(92) 1.2.3 Configuration of the Media Used to Transform the Maize

(93) TABLE-US-00016 Co- Amount (Calculated in 1 L) Basic Infection culture Recover Screening Induciton Differentiation Rootage N6 macro-elements (20×) 50 mL 50 mL 50 mL 50 mL 50 mL 50 mL 50 mL — B5 micro-elements (200×) 5 mL 5 mL 5 mL 5 mL 5 mL 5 mL 5 mL — MS macro-elements (20×) — — — — — — — 25 mL MS micro-elements (200×) — — — — — — — 2.5 mL MS organic matter (200×) — — — — — — — 2.5 mL Fe salt (100×) 10 mL 10 mL 10 mL 10 mL 10 mL 10 mL 10 mL 10 mL RTV organic matter (200×) 5 mL 5 mL 5 mL 5 mL 5 mL 5 mL 5 mL — Glycine 40 mg 40 mg 40 mg 40 mg 40 mg 40 mg 40 mg Casein hydrolysate 0.2 g 0.2 g 0.2 g 0.2 g 0.2 g 0.2 g 0.2 g — L-proline 0.7 g 0.7 g 0.7 g 0.7 g 0.7 g 0.7 g 0.7 g — Myo-inositol 0.1 g 0.1 g 0.1 g 0.1 g 0.1 g 0.1 g 0.1 g — Sucrose 30 g 68.5 g 30 g 30 g 30 g 50 g 30 g 15 g Glucose 36 g — — — — Hygromycin (5 mg/L) — — — — 100 μL 100 μL 100 μL — Glufosinate (10 mg/L) 5-10 mg 5 mg 5 mg — 2,4-D (1 mg/mL) 2.0 mg 2.0 mg 2.0 mg 2.0 mg 2.0 mg NAA(1 mg/mL) — — — — — — — 0.2 mg Cef (100 mg/mL) — — — 2.5 mL 2.5 mL 2.5 mL — AS (200 mmoL/L) — 500 μL 500 μL — — — — — AgNO.sub.3(5 mg/mL) — 170 μL 170 μL 170 μL — — — — DTT(0.15 mg/mL) 1 mL 1 mL Cys(300 mg/mL) 1 mL 1 mL pH 5.8 5.2 5.8 5.8 5.8 5.8 5.8 5.8 Plant gel — 3 g 3 g 3 g 3 g 3 g 3 g 3 g Agar powder 7.5 g — — — — — — —
1.2.4 Configuration of the Common Solutions

(94) Amp (100 mg/mL): 5 g of Amp was weighed and dissolved in sterile water and the final volume was made up to 50 mL. The solution was filtered, sterilized, subpackaged and stored at −20° C.

(95) Kan (100 mg/mL): 5 g of Kan was weighed and dissolved in sterile water and the final volume was made up to 50 mL. The solution was filtered, sterilized, subpackaged and stored at −20° C.

(96) Rif (50 mg/mL): 0.5 g of Rif was weighed and dissolved in DMSO and the final volume was made up to 10 mL. The solution was filtered, sterilized, subpackaged and stored at −20° C.

(97) AS (200 mmoL/L): 0.3924 g of AS drug was weighed and dissolved in DMSO and the final volume was made up to 10 mL. The solution was filtered, sterilized, subpackaged and stored at −20° C. without light.

(98) Cef (100 mg/mL): 25 g of Cef was weighed and dissolved in sterile water and the final volume was made up to 250 mL. The solution was filtered, sterilized, subpackaged and stored at −20° C.

(99) Cb (100 mg/mL): 25 g of Cb was weighed and dissolved in sterile water and the final volume was made up to 250 mL. The solution was filtered, sterilized, subpackaged and stored at −20° C.

(100) AgNO.sub.3 (5 mg/mL): 50 mg of AgNO.sub.3 was weighed and dissolved in sterile water and the final volume was made up to 10 mL. The solution was filtered, sterilized, subpackaged and stored at −20° C. without light. Note: Wear gloves when configuring.

(101) Glufosinate (10 mg/L): 100 mg of glufosinate was weighed and dissolved in 10 ml of sterile water, filtered, sterilized, subpackaged and stored at −20° C.

(102) 6-BA (2 mg/mL): 0.2 g of 6-BA was weighed and dissolved in 1 mol/L NaOH. After 6-BA was completely dissolved, water was added to a final volume of 100 mL. The solution was filtered, sterilized, subpackaged and stored at 4° C.

(103) 2,4-D (1 mg/mL): 100 mg of 2,4-D was weighed and dissolved in a small amount of absolute ethanol, and sterile water was added to a final volume of 100 mL. The solution was filtered, sterilized, subpackaged and stored at 4° C.

(104) NAA (1 mg/mL): 100 mg of NAA was weighed and dissolved in a small amount of 1 mol/L NaOH. After NAA was completely dissolved, sterile water was added to a final volume of 100 mL. The solution was filtered, sterilized, subpackaged and stored at 4° C.

(105) 1.3 Transformation of Maize Immature Embryos with Agrobacterium

(106) 1.3.1 Pollination of Maize

(107) (1) When the female ear appeared, it was bagged in time. After the filament drew out, the female ear was pollinated. The bag was kept until the harvest; (2) After the pollination, a small card recording the male parent and the female parent or pollination method and pollination date was hung. The maize was harvested after 10-12 days.
1.3.2 Peeling of Immature Embryos (1) B73 female ear with an immature embryo of 1.5-2.0 mm was taken at 10-12 days after pollination; (2) The bract, filament and the head and tail of the female ear were removed from the newly harvested female ear; a gun-type tweezer was inserted from the top into the female ear; after the maize was sprayed with alcohol, it was taken to the clean bench and soaked in a wild-mouth bottle containing 70% alcohol for 3 minutes; (3) The female ear was taken out and placed in an empty petri dish for later use; (4) The tweezer was hold in the left hand and the upper part of the grain was cut using a scalpel equipped with a No. 22 blade in the right hand; (5) Using a No. 10 blade, the tip of the blade was inserted between the peel and the endosperm of the lower part of the grain, the endosperm was picked out, the immature embryo was gently peeled, and placed in a 2 mL centrifuge tube containing the infecting solution (containing AS and AgNO.sub.3);
Precautions in the Process of Peeling the Embryo: (1) The infecting solution is configured in advance, AS is added before use (500 μL of AS is added to 1 L of infecting solution, AS is added before use, the infecting solution is dispensed into vials before use to avoid cross-contamination; the infecting solution should not be placed for too long, and if precipitation occurs, the solution needs to be reconfigured; (2) The infecting solution with AS added needs to be dispensed into 2 mL centrifuge tubes, and the sterilized centrifuge tubes are prepared in advance; generally, one centrifuge tube was for one plant of maize; the centrifuge tubes should be protected from light and covered with newspaper; AS must be added before use because its activation takes time; (3) When peeling the embryo, pollution should be avoided; generally, after the embryo is peeled, it is washed with the infecting solution at least twice, 30 seconds each time.
1.3.3 Preparation of Agrobacterium Liquid

(108) The preserved Agrobacterium liquid was taken out from the −80° C. refrigerator in advance, and after sufficient thawing, 200 μl of the Agrobacterium liquid was added to 30 mL of LB medium (containing Kan, Rif), and cultured at 26° C. and 180 rpm overnight. On the next day, when the culture became cloudy, it was taken out from the shaker and the secondary activation was conducted. 3-5 mL of the culture was added to 30 mL of LB medium, cultured on a shaker (180 rpm) at 26° C. for 4-6 hours. Be sure to add AS to the liquid (3 μl AS per 30 mL liquid) one hour before use. The culture prepared by the shake cultivation was separately poured into two 50 mL centrifuge tubes and centrifuged, and the centrifuge was set at 26° C., 4000 rpm, 10 min. After centrifugation, the supernatant was discarded, and then the bacteria were resuspended by adding the infecting solution and the OD value was adjusted to 0.6-0.8. Note that when adding the infecting solution, add a small amount first, if not enough, add more infecting solution and if the OD value is high, add more infecting solution to adjust it for later use.

(109) 1.3.4 Agrobacterium Infection of Immature Embryos

(110) (1) The infecting solution in the centrifuge tube for storing the immature embryos was sucked out and 1.5 ml of the prepared Agrobacterium liquid was added; the centrifuge tube stood vertically for 15 minutes; (2) A sterilized empty dish was prepared, 2-3 layers of filter paper were spread inside, and then a layer of filter paper was spread in the maize co-culture medium; (3) After 15 minutes, the immature embryos were poured together with the Agrobacterium liquid in a petri dish with sterile filter papers, and dried in a clean bench, but the immature embryos were not dehydrated; (4) The blow-dried immature embryos were transferred to the co-culture medium with the scutellum facing up, and co-cultured for three days in the dark at 24° C.;
1.3.5 Recovery, Screening, Differentiation and Rooting of Maize Transformation Materials (1) Recovery culture: the immature embryos co-cultured for three days were transferred to the recovery medium (if the co-cultured immature embryos are polluted with bacteria, carefully pick the immature embryos polluted with bacteria into 2 ml sterilized centrifuge tubes or flasks and wash the bacteria with sterile water until the water is clear, then wash with sterile water containing 100 mg/mL cephalosporin for 30 min, and finally pour the immature embryos into the culture dish with sterile filter papers, then transfer the immature embryos to the recovery medium) and cultured in the dark at 28° C. for 7 days; (2) Screening culture: the immature embryos obtained in the recovery culture were transferred to the screening medium for dark culture, subcultured every two weeks; the number of screening and screening concentration depends on the situation (in this method, the conditions were: PPT screening, twice to 3 times, screening pressure was 5-10 mg/L); (3) Inducing differentiation culture: the screened callus was transferred to the induction medium (high sugar medium), and cultured in the dark for two weeks; (4) Differentiation culture: the resistant callus obtained after two weeks of recovery culture was transferred to the differentiation medium, subjected to light culture (light cycle was light/dark: 16 h/8 h), and subcultured every two weeks; (5) Rooting culture: when the differentiated seedlings grew to have more than 1 to 2 leaves, the seedlings were cut from the resistant callus and transferred to a wild-mouth bottle for rooting culture; when the regeneration seedlings grew to the mouth of the bottle and enough lateral roots grew on the roots, hardening-seedling could be performed; (6) Hardening-seedling and transplantation of the regeneration seedlings: after the seedlings were moved to the greenhouse for 2-3 days, the sealing film was opened, a layer of sterile water was added, and then the seedlings were cultured for 2-3 days; then the seedlings were transplanted into small pots and before transplanting, the medium on the roots of the seedlings was rinsed with tap water; after the seedlings were relatively strong, they were moved into the big pots in the greenhouse for further culture.
1.4 Detection of Positive Plant

(111) After the seedlings grew to 4 leaf expansion phase, the young leaves were taken for detection and identification.

(112) PCR amplification and sequencing were performed to identify the target fragment.

(113) The primers for PCR and sequencing detection for the mutant transgenic material:

(114) TABLE-US-00017 Target1F (SEQ ID NO: 21) ATCAACCGTACTGCTGCAAACAG Target1R (SEQ ID NO: 22) CGCTAGCCTCCACATGTTCTCGT Target2F (SEQ ID NO: 23) AAGACCTTGAGGATGAGCACCAG Target2R (SEQ ID NO: 24) AAGTAGCGGGAGATCCCGAGT

(115) The primers for the detection of the target fragment of the transgenic plant:

(116) TABLE-US-00018 Cotton HRP-CDS-F (SEQ ID NO: 25) CTAGTCTAGAATGTTTTCCCATTCCTTCCT Cotton HRP-CDS-R (SEQ ID NO: 26) CGGGGTACCGCGTACTTTCTCAAAG

(117) Compared with WT, the plant sequenced to have a mutated sequence had an inserted base, resulting in the entire protein being misinterpreted. The target sequence AGCTGAAGCGGATCCCAAG (SEQ ID NO: 27) was mutated to AGCTGAAGCGGATCTCCAAG (SEQ ID NO: 28). The other sequences of the ZmCPS gene could not encode, and finally the active CPS protein could not be synthesized, resulting in the gibberellin could not be synthesized in the downstream of the GA synthesis pathway which in turn caused dwarfing of the plant (FIG. 4).

(118) 2. Sensitivity Analysis of the Transgenic Zmcps-Ko Line with HRP to DPC

(119) The GV3101-pSuper1300-HRP of Example 1 was transformed into the ZmCPSKO maize embryos of step 1.1 by using the Agrobacterium to infect the maize immature embryos, and positive transgenic maize with the HRP was obtained by screening, and the transgenic maize with the HRP contained the target gene HRP. The GV3101-pSuper1300-ZmCPS and GV3101-pSuper1300 were used as controls, and the ZmCPS control maize and empty vector control maize were obtained, respectively.

(120) The WT and transgenic plants were sprayed with DPC during jointing stage to test their DPC sensitivity: the whole plant was sprayed with 500 ppm (5 mM) DPC when the maize was grown to 7 leaf expansion phase and 12 leaf expansion phase. Plant height and ear height were measured 2 weeks after treatment and after tasseling.

(121) The results indicated that WT was insensitive to DPC, whereas the complementary plant became sensitive to DPC (FIG. 5, as shown in the results of line No. 443). From Table 4, there was no difference in the plant height between the transgenic Zmcps-ko line and the wild type (B73) under normal conditions, but DPC treatment significantly reduced the plant height and ear position of the transgenic line, but the wild type was insensitive to DPC.

(122) TABLE-US-00019 TABLE 4 Regulation of DPC to the plant type of the transgenic zmcps-ko line with the HRP Plant Phenotype height Plant at the at 2 weeks height at Line seedling DPC after tasseling Ear No. stage treatment treatment stage height 443 Normal plant DPC 128.9 187.9 80.0 height Normal plant CK 144.2 204.4 93.5 height 614 Normal plant DPC 133.2 197.9 80.5 height Normal plant CK 141.9 210.5 90.5 height 623 Normal plant DPC 133.5 182.8 75.2 height Normal plant CK 139.2 186.7 84.3 height B73 Normal plant DPC 151 207.5 91.3 height Normal plant CK 149.8 209.4 90.8 height

INDUSTRIAL APPLICATION

(123) The experiments prove that the method for increasing the sensitivity of a plant to a gibberellin inhibitor of the present invention can improve the sensitivity of plants to gibberellin inhibitors. The plant height-related protein HRP and DPC in the method for increasing the sensitivity of a plant to a gibberellin inhibitor of the present invention can regulate the plant height of Arabidopsis thaliana, and the plant height of transgenic Arabidopsis thaliana decreases with increasing DPC concentration. The plant height reduction rate of the DPC-treated HRP::ga1-1 is much higher than the ZmCPS::ga1-1, pSuper1300::ga1-1 and ga1-1 treated with the corresponding DPC concentration; the plant height reduction rate of the 30 mg/L DPC-treated HRP::ga1-1 is 2.49 times that of the ga1-1; the plant height reduction rate of the 500 mg/L DPC-treated HRP::ga1-1 is 3.47 times that of the ga1-1. The plant height reduction rate of the DPC-treated HRP::ga1-5 is much higher than the ZmCPS::ga1-1, pSuper1300::ga1-5 and ga1-5 treated with the corresponding DPC concentration; the plant height reduction rate of the 30 mg/L DPC-treated HRP::ga1-5 is 4.68 times that of the ga1-5; the plant height reduction rate of the 500 mg/L DPC-treated HRP::ga1-5 is 6.66 times that of the ga1-5.

(124) The experiments prove that the plant height-related protein HRP of the present invention can increase the plant height of Arabidopsis thaliana: the plant heights of the untreated HRP::ga1-1, 30 mg/L DPC-treated HRP::ga1-1 and 500 mg/L DPC-treated HRP::ga1-1 were 3.54 times, 2.71 times and 1.71 times that of the correspondingly treated ga1-1, respectively; the plant heights of the untreated HRP::ga1-5, 30 mg/L DPC-treated HRP::ga1-5 and 500 mg/L DPC-treated HRP::ga1-5 were 2.26 times, 1.65 times and 1.00 times that of the correspondingly treated ga1-5, respectively.

(125) The experiments prove that the method for increasing the sensitivity of a plant to a gibberellin inhibitor of the present invention can be used to increase the sensitivity of plants to gibberellin inhibitors, and the plant height of plants can be regulated by the plant height-related protein HRP of the present invention.