Methods of use for TRP channel antagonist-based combination cancer therapies
11241442 · 2022-02-08
Assignee
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
G01N33/6872
PHYSICS
A61K45/06
HUMAN NECESSITIES
A61K38/177
HUMAN NECESSITIES
C12N15/1138
CHEMISTRY; METALLURGY
C12Q2600/106
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
A61K31/555
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention relates to methods for treating cancer through combination therapy with a TRP channel antagonist and standard-of-care cancer agents.
Claims
1. A method for the treatment of cancer in a subject, the method comprising: (a) determining the expression level of a gene in a cancer sample from a subject diagnosed with cancer, wherein the gene encodes a transient receptor potential cation channel, subfamily A, member 1 (TRPA1) channel; and (b) administering an anti-cancer agent and an antagonist of the TRPA1 channel to the subject if the expression level of the gene encoding the TRPA1 channel is increased relative to a control biological sample, wherein the anti-cancer agent and the antagonist of the TRPA1 channel are administered in amounts and for durations sufficient to treat cancer in the subject.
2. A method for the treatment of cancer in a subject whose cancer has higher expression levels of a gene encoding a TRPA1 channel relative to a control biological sample, the method comprising administering an anti-cancer agent and an antagonist of the TRPA1 channel to the subject wherein the anti-cancer agent and the antagonist of the TRPA1 channel are administered in amounts and for durations sufficient to treat cancer in the subject.
3. A method for the treatment of cancer in a subject, the method comprising: (a) administering an anti-cancer agent to a subject diagnosed with cancer; (b) determining whether the anti-cancer agent increases the expression level of a gene in a cancer sample from a subject, wherein the gene encodes a TRPA1 channel; and (c) administering the anti-cancer agent and an antagonist of the TRPA1 channel to the subject if the expression level of the gene encoding the TRPA1 channel is higher relative to a control biological sample, wherein the anti-cancer agent and the antagonist of the TRPA1 channel are administered in amounts and for durations sufficient to treat cancer in the subject.
4. The method of claim 1, wherein the cancer is sarcoma, adenocarcinoma, carcinoma, colon cancer, rectal cancer, renal-cell carcinoma, liver cancer, non-small cell carcinoma of the lung (NCSLC), cancer of the small intestine and cancer of the esophagus, bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin Disease, non-Hodgkin lymphoma, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, acute myeloid leukemia (AML), chronic myeloid leukemia, acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia, solid tumors of childhood, lymphocytic lymphoma, cancer of the bladder, cancer of the kidney or ureter, carcinoma of the renal pelvis, neoplasm of the central nervous system (CNS), primary CNS lymphoma, spinal axis tumor, brain stem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid cancer, squamous cell cancer, T-cell lymphoma, an environmentally induced cancer, cancer caused by asbestos, or a combination thereof.
5. The method of claim 1, wherein the antagonist of the TRPA1 channel targets a gene, gene product, or regulatory RNAs of the TRPA1 channel.
6. The method of claim 1, wherein the anti-cancer agent is a chemotherapeutic agent, a cytotoxic agent, a growth inhibitory agent, radiation therapy, surgery, or a combination thereof.
7. The method of claim 6, wherein the anti-cancer agent further comprises doxorubicin, gemcitabine, platinum-based drugs, radiotherapy, tamoxifen, methotrexate, arsenic trioxide, or an aromatase inhibitor.
8. The method of claim 6, wherein the anti-cancer agent is carboplatin.
9. The method of claim 1, wherein the expression level of a gene is determined by determining mRNA expression level, cDNA expression level, or protein expression level.
10. The method of claim 1, wherein the biological sample comprises mRNA, cDNA, or protein from the subject.
11. The method of claim 1, wherein: (a) the TRPA1 channel antagonist and doxorubicin are used in combination for the treatment of ALL, AML, breast cancer, gastric cancer, Hodgkin lymphoma, neuroblastoma, non-Hodgkin lymphoma, ovarian cancer, small cell lung cancer, soft tissue and bone sarcomas, thyroid cancer, transitional cell bladder cancer, or Wilms tumor; (b) the TRPA1 channel antagonist and gemcitabine are used in combination for the treatment of breast cancer, NSCLC, ovarian cancer, or pancreatic cancer; or (c) the TRPA1 channel antagonist, gemcitabine, and paclitaxel are used in combination for the treatment of breast cancer or pancreatic cancer.
12. The method of claim 1, wherein: (a) the TRPA1 channel antagonist, gemcitabine, and cisplatin are used in combination for the treatment of NSCLC; (b) the TRPA1 channel antagonist, gemcitabine, and carboplatin are used in combination for the treatment of ovarian cancer; or (c) the TRPA1 channel antagonist and tamoxifen are used in combination for the treatment of breast cancer.
13. The method of claim 1, wherein: (a) the TRPA1 channel antagonist and methotrexate are used in combination for the treatment of ALL, breast cancer, gestational trophoblastic disease, head and neck cancer, lung cancer, mycosis fungoides, non-Hodgkin lymphoma, or osteosarcoma; (b) the TRPA1 channel antagonist and arsenic trioxide are used in combination for the treatment of acute promyelocytic leukemia; or (c) the TRPA1 channel antagonist and anastrozole are used in combination for the treatment of breast cancer.
14. The method of claim 1, wherein: (a) the TRPA1 channel antagonist and exemestane are used in combination for the treatment of breast cancer; or (b) the TRPA1 channel antagonist and letrozole are used in combination for the treatment of breast cancer.
15. The method of claim 1, wherein: (a) the TRPA1 channel antagonist and formestane are used in combination for the treatment of breast cancer; or (b) the TRPA1 channel antagonist and fadrozole are used in combination for the treatment of breast cancer.
16. The method of claim 1, wherein: (a) the TRPA1 channel antagonist and cisplatin are used in combination for the treatment of bladder cancer, ovarian cancer, or testicular cancer; (b) the TRPA1 channel antagonist and carboplatin are used in combination for the treatment of ovarian cancer; or (c) the TRPA1 channel antagonist and oxaliplatin are used in combination for the treatment of colorectal cancer or colon cancer.
17. The method of claim 1, wherein: (a) the TRPA1 channel antagonist and nedaplatin are used in combination for the treatment of squamous cell lung cancer, NSCLC, esophageal cancer, uterine cervical cancer, head and neck cancer, or urothelial cancer; or (b) the TRPA1 channel antagonist and triplatin tetranitrate are used in combination for the treatment of ovarian cancer, small cell lung cancer, or gastric cancer.
18. The method of claim 1, wherein: (a) the TRPA1 channel antagonist and phenanthriplatin are used in combination for the treatment of leukemias, NSCLC, colon cancer, CNS cancers, melanoma, ovarian cancer, renal cancer, prostate cancer, or breast cancer; (b) the TRPA1 channel antagonist and picoplatin are used in combination for the treatment of lung cancer, ovarian cancer, colorectal cancer, or hormone-refractory prostate cancer; or (c) the TRPA1 channel antagonist and satraplatin are used in combination for the treatment of prostate cancer, lung cancer, or ovarian cancer.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
(58)
(59)
(60)
(61)
(62)
(63)
(64)
(65)
(66)
(67)
(68)
(69)
(70)
(71)
(72)
(73)
(74)
(75)
DETAILED DESCRIPTION OF THE INVENTION
(76) The mammalian family of transient receptor potential (TRP) proteins comprises 28 subtypes of Ca.sup.2+-permeable channels. Among TRP family members, the irritant receptor TRPA1 exhibits the highest sensitivity to ROS due to the presence of hyper-reactive cysteine (Cys) thiols and has a critical role in sensing oxidative stress in sensory neurons. TRPA1 is also activated by cancer therapies in sensory neurons, including platinum-based drugs and aromatase antagonists, and this activation is associated with therapy-induced pain. The invention discloses that TRPA1 is also activated by ROS-associated chemotherapies, including carboplatin, and mediates chemoresistance in breast, lung, and malignant peripheral nerve sheath tumor cells in which TRPA1 is expressed. TRPA1 inhibition suppresses tumor growth and enhances carboplatin sensitivity in breast tumor xenografts.
(77) As TRPA1 antagonists are currently under clinical evaluation as novel pain and respiratory therapies and have not shown any evidence of significant central nervous system or other drug-related side effects, the invention identifies TRP channels, namely TRPA1, as a cancer therapeutic targets in combination with standard-of-care chemotherapies.
(78) TRP Channels
(79) The mammalian family of transient receptor potential (TRP) proteins comprises 28 subtypes of Ca.sup.2+-permeable channels that exhibit an extraordinary diversity of activation triggers, modes of activation, signal transduction, and tissue distributions, and play critical roles in a wide variety of physiological and pathological responses (Table 1). A group of TRP channels has emerged as acute sensors of redox status, mediating Ca.sup.2+ influx in response to changes in the cellular redox environment. In particular, among TRP family members, the irritant receptor TRPA1 exhibits the highest sensitivity to ROS due to the presence of hyper-reactive cysteine (Cys) thiols and plays a critical role in sensing oxidative stress in sensory neurons. Interestingly, TRPA1 is also activated by cancer therapies in sensory neurons, including platinum-based drugs and aromatase antagonists, and this activation is associated with therapy-induced pain. However, despite the known importance of Ca.sup.2+ signaling in a wide range of cellular functions, including cell proliferation and survival, the role of redox-sensitive TRP channels in oxidative stress adaptation and chemoresistance of cancer cells has not been previously examined.
(80) TABLE-US-00001 TABLE 1 TRP Channels TRPC7 TRPC4 TRPM4 TRPM5 TRPM2 PKD2L1 TRPML2 TRPA1 TRPML1 TRPV1 TRPV2 TRPC2 PKD2L2 TRPC5 TRPML3 TRPC3 TRPV3 TRPM3 TRPC6 TRPC1 PKD2 TRPM1 TRPM6 TRPM8 TRPV5 TRPV6 TRPV4 TRPM7
(81) In certain aspects, the present invention provides methods for treating or ameliorating the effects of diseases and conditions using small molecules that inhibit a TRPA1-mediated current and/or a TRPA1-mediated ion flux with an IC.sub.50 of less than 10 μM. Suitable compounds for use in any of the methods of the invention (e.g., to treat any of the diseases or conditions disclosed herein) include compounds having one or more of the structural or functional characteristics disclosed herein (e.g., structure, specificity, potency, solubility, etc.). The present invention contemplates the use of any TRPA1 antagonist possessing one or more of the functional or structural attributes described herein.
(82) TRP Antagonists
(83) In certain embodiments, a suitable compound inhibits an inward and/or outward TRP mediated current with an IC.sub.50 of less than 10 μM. In certain embodiments, a suitable compound additionally or alternatively inhibits TRP mediated ion flux with an IC.sub.50 of less than 10 μM. IC.sub.50 can be calculated, for example, in an in vitro assay. For example, IC.sub.50 can be calculated using electrophysiological determinations of current, such as standard patch clamp analysis. IC.sub.50 can also be evaluated using changes in concentration or flux of ion indicators, such as the calcium flux methods described herein. In particular embodiments, a small molecule TRP antagonist is chosen for use because it is more selective for one TRP isoform than others, e.g., 10-fold, and more preferably at least 20, 40, 50, 60, 70, 80, or at least 100- or even 1000-fold more selective for TRPA1 over one or more of TRPC6, TRPV5, TRPV6, TRPM8, TRPV1, TRPV2, TRPV 4, and/or TRPV3. In other embodiments, the differential is smaller, e.g., it more strongly inhibits TRPA1 than TRPM8, TRPV1, TRPV2, TRPV3, and/or TRPV4, preferably at least twice, three times, five times, or even ten times more strongly. Such comparisons may be made, for example, by comparing IC.sub.50 values. In particular embodiments, a small molecule TRPA1 antagonist is chosen for use because it is more selective for one TRPA1 than for other non-TRP ion channels, e.g., 10-fold, and more preferably at least 20, 40, 50, 60, 70, 80, or at least 100- or even 1000-fold more selective for TRPA1 over one or more of NaV1.2, Cav1.2, Cav3.1, HERG, and/or mitochondrial uniporter. In other embodiments, the differential is smaller, e.g., it more strongly inhibits TRPA1 than NaV1.2, Cav1.2, Cav3.1, HERG, and/or mitochondrial uniporter, preferably at least twice, three times, five times, or even ten times more strongly. Such comparisons may be made, for example, by comparing IC.sub.50 values. Similarly, in particular embodiments, a small molecule is chosen for use because it lacks significant activity against one or more targets other than TRPA1. For example, the compound may have an IC.sub.50 above 500 nM, above 1 μM, or even above 10 μM or 100 μM for inhibiting one or more of TRPC6, TRPV5, TRPV6, Cav1.2, Cav3.1, NaV1.2, HERG, and the mitochondrial uniporter.
(84) In certain embodiments of any of the foregoing, the small molecule may be chosen because it inhibits a TRP function with an IC.sub.50 less than or equal to 1 μM, or even less than or equal to 700, 600, 500, 400, 300, 250, 200, or 100 nM. In other embodiments, the small molecule is chosen because it inhibits a TRPA1 function with an IC.sub.50 less than or equal to 75 nM, less than or equal to 50 nM, or even less than or equal to 25, 10, 5, or 1 nM. In certain other embodiments of any of the foregoing, the small molecule inhibits TRP function with an IC50 less than or equal to 10 μM or less than or equal to 5 μM or less than or equal to 2.5 μM or less than or equal to 1.5 μM. In certain embodiments of any of the foregoing, the compound may be chosen based on the rate of inhibition of a TRP function. In one embodiment, the compound inhibits a TRP function in less than 5 minutes, preferably less than 4, 3, or 2 minutes. In another embodiment, the compound inhibits a TRP function in less than about 1 minute. In yet another embodiment, the compound inhibits a TRP function in less than about 30 seconds.
(85) In certain embodiments of any of the foregoing, inhibition of a TRP function means that a function, for example a TRP mediated current, is decreased by greater than 50% in the presence of an effective amount of a compound in comparison to in the absence of the compound or in comparison to an ineffective amount of a compound. In certain other embodiments, the inhibition of a TRP function means that a function, for example a TRP mediated current or TRP mediated ion flux, is decreased by at least 50%, 60%, 70%, 75%, 80%, 85%, or 90% in the presence of an effective amount of a compound in comparison to in the absence of the compound. In still other embodiments, the inhibition of a TRP function means that a function, for example a TRP mediated current, is decreased by at least 92%, 95%, 97%, 98%, 99%, or 100% in the presence of an effective amount of a compound in comparison to in the absence of the compound.
(86) Without being bound by theory, a compound may inhibit a function of a TRP channel by binding covalently or non-covalently to a portion of a TRP channel. Alternatively, a compound may inhibit a function of a TRP channel indirectly, for example, by associating with a protein or non-protein cofactor necessary for a function of a TRP channel. One of skill in the art will readily appreciate that an inhibitory compound may associate reversibly or irreversibly with a TRP channel or a cofactor thereof. Compounds that reversibly associate with a TRP channel or a cofactor thereof may continue to inhibit a function of a TRP channel even after dissociation. In certain embodiments of any of the foregoing, the compound that inhibits a function of a TRP channel is a small organic molecule or a small inorganic molecule. Small molecules include, but are not limited to, small molecules that bind to a TRP channel and inhibit one or more functions of a TRP channel. The subject TRP antagonists can be used alone or in combination with other pharmaceutically active agents.
(87) A. TRP Antagonists
(88) TRPA1 antagonists include HC-030031 as described in McNamara et al., Proc. Natl. Acad. Sci. USA, 104: 13525-13530, 2007, AP18 as described in Petrus et al., Mol. Pain, 3:40, A-967079, 2007, as described in Chen et al., Pain, 152:1165-1172, 2011, compound 10 as described in Copeland et al., Bioorg. Med. Chem. Lett., 24:3464-3468, 2014, AM-0902 as described in Schenkel et al., J. Med. Chem., 59:2794-2809, 2016, compounds 1-48 as described in Preti et al., Pharm. Pat. Anal. 4:75-94, 2015, and the TRPA1 antagonists described in WO 2007073505, WO 2010138879, WO 2009140519, WO 2009002933, WO 2010075353, WO 2010132838, WO 2009158719, WO 2014113671, WO 2009118596, US 20090325987, WO 2010109287, WO 2010109328, WO 2010109334, WO 2010125469, WO 2011132017, WO 2011114184, WO 2009144548, WO 2009147079, WO 2010141805, WO 2014049047, WO 2014076038, WO 2014056958, WO 2014072325, WO 2014076021, WO 2007098252, WO 2009089082, WO 2009089083, WO 2011043954, WO 2012050512, WO 2012152983, WO 2014053694, WO 2016128529, and WO 2014135617, each of which is herein incorporated by reference.
(89) TRPM2 antagonists include flufenamic acid and 2-aminoethoxydiphenyl borate (2-APB).
(90) TRPM3 antagonists include fenamates (e.g., mefenamic acid), ononetin (1-(2,4-Dihydroxyphenyl)-2-(4-methoxyphenyl)ethanone), isosakuranetin, liquiritigenin, naringenin, eriodictyol, troglitazone, pioglitazone, and hesperetin.
(91) TRPM4 antagonists include flufenamic acid, 9-phenanthrol, and spermine.
(92) TRPM5 antagonists include flufenamic acid and spermine.
(93) TRPM7 antagonists include spermine, sphingosine, fingolimod, NS8593, waixenicin A, 2-APB, carvacrol, and nafamostat (see, e.g., Chubanov et al., Br. J. Pharmacol., 166:1357-1376, 2012).
(94) TRPM8 antagonists include capsazepine, 5-benzyloxytryptamine, linoleic acid, anandamide, Δ.sup.9-tetrahydrocannabinol, and cannabidiol.
(95) TRPC1 antagonists include GsMTx4 (GCLEFWWKCNPNDDKCCRPKLKCSKLFKLCNFSF) (SEQ ID NO: 81), SKF96365 (1-[2-(4-Methoxyphenyl)-2-[3-(4-methoxyphenyl) propoxy]ethyl]imidazole, 1-[β-(3-(4-Methoxyphenyl)propoxy)-4-methoxyphenethyl]-1H-imidazole hydrochloride), and 2-APB.
(96) TRPC2 antagonists include 2-APB and U73122 (1-[6-[((17β)-3-Methoxyestra-1,3,5[10]-trien-17-yl)amino]hexyl]-1H-pyrrole-2,5-dione).
(97) TRPC3 antagonists include Pyr3 (1-[4-[(2,3,3-Trichloro-1-oxo-2-propen-1-yl)amino]phenyl]-5-(trifluoromethyl)-1H-pyrazole-4-carboxylic acid) and KB-R7943 (2-[4-[(4-nitrophenyl)methoxy]phenyl]ethyl ester, methanesulfonate (1:1), Carbamimidothioic acid).
(98) TRPC4 antagonists include ML204 (4-Methyl-2-(1-piperidinyl)-quinoline), niflumic acid, and 2-APB.
(99) TRPC5 antagonists include clemizole hydrochloride (1-[(4-Chlorophenyl)methyl]-2-(1-pyrrolidinylmethyl)-1H-benzimidazole hydrochloride), M 084 hydrochloride (N-Butyl-1H-benzimidazol-2-amine hydrochloride), bromoenol lactone, flufenamic acid, and chlorpromazine.
(100) TRPC6 antagonists include SKF96365, amiloride, 2-APB, GsMTx-4, and KB-R7943.
(101) TRPC7 antagonists include SKF96365, amiloride, and 2-APB.
(102) TRPV1 antagonists include capsazepine (N-[2-(4-Chlorophenyl)ethyl]-1,3,4,5-tetrahydro-7,8-dihydroxy-2H-2-benzazepine-2-carbothioamide), 1,3-di(arylalkyl)thioureas (e.g., JYL1421), capsaicin analogs of the urea type (e.g., phenylacetylrinvanil, BCTC, neurogen, A-425619 (1-isoquinolin-5-yl-3-(4-trifluoromethyl-benzyl)-urea), SB-705498 ((R)-1-(2-bromophenyl)-3-(1-(5-(trifluoromethyl)pyridin-2-yl)pyrrolidin-3-yl)urea), SB-452533 (N-(2-Bromophenyl)-N′-[2-[ethyl(3-methylphenyl)amino]ethyl]urea), and ABT-102 ((R)-1-(5-tert-Butyl-2,3-dihydro-1H-inden-1-yl)-3-(1H-indazol-4-yl)urea)), cinnamides (e.g., SB-366791 (N-(3-Methoxyphenyl)-4-chlorocinnamide), AMG9810 (2E-N-(2,3-Dihydro-1,4-benzodioxin-6-yl)-3-[4-(1,1-dimethylethyl)phenyl]-2-Propenamide), and AMG0347 (N-(7-hydroxy-5,6,7,8-tetrahydronaphthalen-1-yl)-3-(2-(piperidin-1-yl)-6-(trifluoromethyl)pyridin-3-yl)acrylamide)), carboxamides (e.g., SB-782443 (6-(4-fluorophenyl)-2-methyl-N-(2-methylbenzothiazol-5-yl)nicotinamide)), JNJ 17203212 (4-[3-(Trifluoromethyl)-2-pyridinyl]-N-[5-(trifluoromethyl)-2-pyridinyl]-1-piperazinecarboxamide), arachidonyl serotonin, AZD1386 (see, e.g., US 2009176851), and AMG517 (N-(4-(6-(4-trifluoromethylphenyl)pyrimidin-4-yloxy)benzothiazol-2-yl)acetamide).
(103) TRPV2 antagonists include tetraethylammonium, fampridine, ruthenium red, amiloride, and SKF96365.
(104) TRPV3 antagonists include compound 74a ((1R,3r)-3-(4-tert-butylpyridin-2-yl)-3-[(S)-hydroxy(pyridin-2-yl)methyl]-1-methylcyclobutan-1-ol) (see, e.g., U.S. Pat. No. 8,940,771), ruthenium red, and diphenyltetrahydrofuran.
(105) TRPV4 antagonists include RN 9893 hydrochloride (N-[4-[[4-(1-Methylethyl)-1-piperazinyl]sulfonyl]phenyl]-2-nitro-4-(trifluoromethyl)benzamide hydrochloride), GSK 2193874 (3-([1,4′-Bipiperidin]-1′-ylmethyl)-7-bromo-N-(1-phenylcyclopropyl)-2-[3-(trifluoromethyl)phenyl]-4-quinolinecarboxamide), HC 067047 (2-Methyl-1-[3-(4-morpholinyl)propyl]-5-phenyl-N-[3-(trifluoromethyl)phenyl]-1H-pyrrole-3-carboxamide), and ruthenium red.
(106) TRPV5 antagonists include ruthenium red.
(107) PKD2L1 antagonists include flufenamic acid, phenamil, benzamil, ethylisopropylamiloride, amiloride, and flufenamate.
(108) PKD2 antagonists include SKF96365.
(109) Methods to Identify Subjects Responsive to TRP Antagonists
(110) The present invention provides methods for identifying and/or monitoring subjects likely to be responsive to TRP antagonist (e.g., a TRPA1 antagonist) therapy. The methods are useful, inter alia, for increasing the likelihood that administration of a TRP antagonist (e.g., a TRPA1 antagonist) to a subject will be efficacious. The methods include detecting expression of one or more genetic biomarkers in a biological sample from a subject, wherein the expression of one or more such biomarkers is indicative of whether the subject is sensitive or responsive to TRP antagonists.
(111) More particularly, determining the expression level of at least one of the genes set forth in Table 1 below (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 of the genes listed in Table 1) in a sample from a subject is useful for monitoring whether the subject is responsive or sensitive to a TRP antagonist. For any of the methods described herein, one could, for example, determine the expression levels of any combination of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 genes selected from the genes listed in Table 1. Alternatively, for any of the methods described herein, the expression level of all 28 genes (TRPC7, TRPC4, TRPM7, TRPM4, TRPM5, TRPM2, PKD2L1, TRPML2, TRPA1, TRPML1, TRPV1, TRPV2, TRPC2, PKD2L2, TRPC5, TRPML3, TRPC3, TRPV3, TRPM3, TRPC6, TRPC1, PKD2, TRPM1, TRPM6, TRPM8, TRPV5, TRPV6, and TRPV4) listed in Table 1 can be determined.
(112) In one example, determining the expression level of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 of the genes listed in Table 1 in a sample from a subject is useful for monitoring whether the subject is responsive or sensitive to a TRP antagonist, such as a TRPA1 antagonist. In one example, determining the expression level of all 28 genes listed in Table 1 in a sample from a subject is useful for monitoring whether the subject is responsive or sensitive to a TRP antagonist, such as a TRPA1 antagonist. In some instances, for any of the methods described herein, the expression level of at least 2 genes (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or more genes) in total can be determined.
(113) The disclosed methods and assays provide for convenient, efficient, and potentially cost-effective means to obtain data and information useful in assessing appropriate or effective therapies for treating subjects. For example, a subject can provide a tissue sample (e.g., a tumor biopsy or a blood sample) before and/or after treatment with a TRP antagonist and the sample can be examined by way of various in vitro assays to determine whether the subject's cells are sensitive to a TRP antagonist, such as a TRPA1 antagonist.
(114) The invention also provides methods for monitoring the sensitivity or responsiveness of a subject to a TRP antagonist (e.g., a TRPA1 antagonist). The methods may be conducted in a variety of assay formats, including assays detecting genetic or protein expression (such as PCR and enzyme immunoassays) and biochemical assays detecting appropriate activity. Determination of expression or the presence of such biomarkers in subject samples is predictive of whether a subject is sensitive to the biological effects of a TRP antagonist, such as a TRPA1 antagonist. Applicants' invention herein is that a difference or change (i.e., an increase or decrease) in the expression of the 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 of the genes listed in Table 1 in a sample from a subject having a cancer relative to a reference level (including, e.g., the median expression level of the biomarker in a sample from a group/population of subjects being tested for responsiveness to a TRP antagonist or the median expression level of the biomarker in a sample from a group/population of subjects having cancers and identified as not responding to TRP antagonist treatment) correlates with treatment of such a subject with a TRP antagonist, such as a TRPA1 antagonist.
(115) In some embodiments, the reference expression level is the median level of expression of the at least one gene in subjects having glioblastomas and identified as not responding to TRP antagonist (e.g., a TRPA1 antagonist) treatment. In some embodiments, the reference expression level is the expression level of the at least one gene in a sample previously obtained from the individual at a prior time. In other embodiments, the individuals are subjects who received prior treatment with a TRP antagonist in a primary tumor setting. In some embodiments, the individuals are subjects who are experiencing metastasis. Individuals who have an expression level that is greater than or less than the reference expression level of at least one biomarker gene as described herein are identified as subjects likely to respond to treatment with a TRP antagonist. Subjects who exhibit gene expression levels at, for example, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% relative to (i.e., higher or lower than) the median are identified as subjects likely to respond to treatment with a TRP antagonist (e.g., a TRPA1 antagonist). The subjects may be informed that they have an increased likelihood of being responsive to treatment with a TRP antagonist and/or provided a recommendation that anti-cancer therapy include a TRP antagonist. The gene expression level can be determined using at least one of the biomarker genes as described herein, or any linear combination of the biomarker genes as described herein (e.g., mean, weighted mean, or median) using methods known in the art.
(116) Those of skill in the medical arts, particularly pertaining to the application of diagnostic tests and treatment with therapeutics, will recognize that biological systems are somewhat variable and not always entirely predictable, and thus many good diagnostic tests or therapeutics are occasionally ineffective. Thus, it is ultimately up to the judgment of the attending physician to determine the most appropriate course of treatment for an individual subject, based upon test results, subject condition and history, and his or her own experience. There may even be occasions, for example, when a physician will choose to treat a subject with a TRP antagonist, such as a TRPA1 antagonist, even when a subject is not predicted to be particularly sensitive to TRPA1 antagonists, based on data from diagnostic tests or from other criteria, particularly if all or most of the other obvious treatment options have failed, or if some synergy is anticipated when given with another treatment.
(117) In further expressed embodiments, the present invention provides a method of predicting the sensitivity of a subject to treatment with a TRP antagonist, such as a TRPA1 antagonist, or predicting whether a subject will respond effectively to treatment with a TRP antagonist, comprising assessing the level of one or more of the genetic biomarkers identified herein expressed in the sample; and predicting the sensitivity of the subject to inhibition by a TRP antagonist, wherein expression levels of one or more of these genetic biomarkers correlates with high sensitivity of the subject to effective response to treatment with a TRP antagonist.
(118) The sample may be taken from a subject who is suspected of having, or is diagnosed as having a cancer, and hence is likely in need of treatment, or from a normal individual who is not suspected of having any disorder. For assessment of marker expression, subject samples, such as those containing cells, or proteins or nucleic acids produced by these cells, may be used in the methods of the present invention. In the methods of this invention, the level of a biomarker can be determined by assessing the amount (e.g., the absolute amount or concentration) of the markers in a sample, preferably a tissue sample (e.g., a tumor tissue sample, such as a biopsy). In addition, the level of a biomarker can be assessed in bodily fluids or excretions containing detectable levels of biomarkers. Bodily fluids or secretions useful as samples in the present invention include, e.g., blood, urine, saliva, stool, pleural fluid, lymphatic fluid, sputum, ascites, prostatic fluid, cerebrospinal fluid (CSF), or any other bodily secretion or derivative thereof. The word “blood” is meant to include whole blood, plasma, serum, or any derivative of blood. Assessment of a biomarker in such bodily fluids or excretions can sometimes be preferred in circumstances where an invasive sampling method is inappropriate or inconvenient. However, in the case of samples that are bodily fluids, the sample to be tested herein is preferably blood, synovial tissue, or synovial fluid, most preferably blood.
(119) The sample may be frozen, fresh, fixed (e.g., formalin fixed), centrifuged, and/or embedded (e.g., paraffin embedded), etc. The cell sample can, of course, be subjected to a variety of well-known post-collection preparative and storage techniques (e.g., nucleic acid and/or protein extraction, fixation, storage, freezing, ultrafiltration, concentration, evaporation, centrifugation, etc.) prior to assessing the amount of the marker in the sample. Likewise, biopsies may also be subjected to post-collection preparative and storage techniques, e.g., fixation.
(120) In any of the methods described herein, the subject may be informed of an higher or lower likelihood of being sensitive or responsive to treatment with a TRP antagonist (e.g., a TRPA1 antagonist); provided a recommendation of an anti-cancer therapy (e.g., an anti-cancer therapy that includes or does not include a TRP antagonist); and/or selected a suitable therapy (e.g., a TRP antagonist and/or other anti-cancer agent).
(121) A. Detection of Gene Expression
(122) The genetic biomarkers described herein can be detected using any method known in the art. For example, tissue or cell samples from mammals can be conveniently assayed for, e.g., mRNAs or DNAs from a genetic biomarker of interest using Northern, dot-blot, or polymerase chain reaction (PCR) analysis, array hybridization, RNase protection assay, or using DNA SNP chip microarrays, which are commercially available, including DNA microarray snapshots. For example, real-time PCR (RT-PCR) assays such as quantitative PCR assays are well known in the art. In an illustrative embodiment of the invention, a method for detecting mRNA from a genetic biomarker of interest in a biological sample, such as a tumor sample (e.g., a glioblastoma tumor sample), comprises producing cDNA from the sample by reverse transcription using at least one primer; amplifying the cDNA so produced; and detecting the presence of the amplified cDNA. In addition, such methods can include one or more steps that allow one to determine the levels of mRNA in a biological sample (e.g., by simultaneously examining the levels a comparative control mRNA sequence of a “housekeeping” gene such as an actin family member). Optionally, the sequence of the amplified cDNA can be determined.
(123) 1. Detection of Nucleic Acids
(124) In one specific embodiment, expression of the biomarker genes as described herein can be performed by RT-PCR technology. Probes used for PCR may be labeled with a detectable marker, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator, or enzyme. Such probes and primers can be used to detect the presence of expressed genes set forth in Table 1 in a sample. As will be understood by the skilled artisan, a great many different primers and probes may be prepared and used effectively to amplify, clone and/or determine the presence and/or levels expressed of one or more of the genes listed in Table 1.
(125) Other methods include protocols that examine or detect mRNAs from at least one of the genes listed in Table 1 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 of the genes listed in Table 1) in a tissue (e.g., a tumor tissue) or cell sample by microarray technologies. Using nucleic acid microarrays, test and control mRNA samples from test and control tissue samples are reverse transcribed and labeled to generate cDNA probes. The probes are then hybridized to an array of nucleic acids immobilized on a solid support. The array is configured such that the sequence and position of each member of the array is known. For example, a selection of genes that have potential to be expressed in certain disease states may be arrayed on a solid support. Hybridization of a labeled probe with a particular array member indicates that the sample from which the probe was derived expresses that gene. Differential gene expression analysis of disease tissue can provide valuable information. Microarray technology utilizes nucleic acid hybridization techniques and computing technology to evaluate the mRNA expression profile of thousands of genes within a single experiment.
(126) In addition, the DNA profiling and detection method utilizing microarrays may be employed. This method rapidly identifies and distinguishes between different DNA sequences utilizing short tandem repeat (STR) analysis and DNA microarrays. In an embodiment, a labeled STR target sequence is hybridized to a DNA microarray carrying complementary probes. These probes vary in length to cover the range of possible STRs. The labeled single-stranded regions of the DNA hybrids are selectively removed from the microarray surface utilizing a post-hybridization enzymatic digestion. The number of repeats in the unknown target is deduced based on the pattern of target DNA that remains hybridized to the microarray.
(127) One example of a microarray processor is the Affymetrix GENECHIP® system, which is commercially available and comprises arrays fabricated by direct synthesis of oligonucleotides on a glass surface. Other systems may be used as known to one skilled in the art.
(128) Other methods for determining the level of the biomarker besides RT-PCR or another PCR-based method include proteomics techniques, as well as individualized genetic profiles that are necessary to treat cancer based on subject response at a molecular level. The specialized microarrays herein, e.g., oligonucleotide microarrays or cDNA microarrays, may comprise one or more biomarkers having expression profiles that correlate with either sensitivity or resistance to one or more TRP antagonists. Other methods that can be used to detect nucleic acids, for use in the invention, involve high throughput RNA sequence expression analysis, including RNA-based genomic analysis, such as, for example, RNASeq.
(129) 2. Detection of Proteins
(130) As to detection of protein biomarkers such as a protein biomarker corresponding to at least one of the genes listed in Table 1 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 of the genes listed in Table 1), for example, various protein assays are available including, for example, antibody-based methods as well as mass spectroscopy and other similar means known in the art. In the case of antibody-based methods, for example, the sample may be contacted with an antibody specific for said biomarker under conditions sufficient for an antibody-biomarker complex to form, and then detecting said complex. Detection of the presence of the protein biomarker may be accomplished in a number of ways, such as by western blotting (with or without immunoprecipitation), 2-dimensional SDS-PAGE, immunoprecipitation, fluorescence activated cell sorting (FACS), flow cytometry, and ELISA procedures for assaying a wide variety of tissues and samples, including plasma or serum. A wide range of immunoassay techniques using such an assay format are available, including both single-site and two-site or “sandwich” assays of the non-competitive types, as well as in the traditional competitive binding assays. These assays also include direct binding of a labeled antibody to a target biomarker.
(131) Treatment with the TRP Antagonist
(132) A. Dosage and Administration
(133) Once a subject responsive or sensitive to treatment with a TRP antagonist (e.g., a TRPA1 antagonist) as described herein has been identified, treatment with the TRP antagonist, alone or in combination with other medicaments, can be carried out. Such treatment may result in, for example, a reduction in tumor size (e.g., glioblastoma tumor size) or an increase in progression free survival (PFS) and/or overall survival (OS). Moreover, treatment with the combination of a TRP antagonist (e.g., a TRPA1 antagonist) and at least one second medicament(s) preferably results in an additive, more preferably synergistic (or greater than additive), therapeutic benefit to the subject. Preferably, in this combination method the timing between at least one administration of the second medicament and at least one administration of the antagonist herein is about one month or less, more preferably, about two weeks or less.
(134) It will be appreciated by those of skill in the medical arts that the exact manner of administering a therapeutically effective amount of a TRP antagonist (e.g., a TRPA1 antagonist) to a subject following diagnosis of their likely responsiveness to the TRP antagonist will be at the discretion of the attending physician. The mode of administration, including dosage, combination with other agents, timing and frequency of administration, and the like, may be affected by the diagnosis of a subject's likely responsiveness to such TRP antagonist, as well as the subject's condition and history. Thus, even subjects having cancers who are predicted to be relatively insensitive to a TRP antagonist may still benefit from treatment therewith, particularly in combination with other agents, including agents that may alter a subject's responsiveness to the antagonist.
(135) A composition comprising a TRP antagonist will be formulated, dosed, and administered in a fashion consistent with good medical practice. Factors for consideration in this context include the particular type of cancer being treated (e.g., a newly diagnosed cancer or a recurrent cancer), the particular mammal being treated (e.g., human), the clinical condition of the individual subject, the cause of the cancer, the site of delivery of the agent, possible side-effects, the type of antagonist, the method of administration, the scheduling of administration, and other factors known to medical practitioners. The effective amount of the TRP antagonist to be administered will be governed by such considerations.
(136) A physician having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required, depending on such factors as the particular antagonist type. For example, the physician could start with doses of such a TRP antagonist (e.g., a TRPA1 antagonist), employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. The effectiveness of a given dose or treatment regimen of the antagonist can be determined, for example, by assessing signs and symptoms in the subject using standard measures of efficacy.
(137) In certain examples, the subject is treated with the same TRP antagonist (e.g., a TRPA1 antagonist) at least twice. Thus, the initial and second TRP antagonist exposures are preferably with the same antagonist, and more preferably all TRP antagonist exposures are with the same TRP antagonist, i.e., treatment for the first two exposures, and preferably all exposures, is with one type of TRP antagonist, for example, an antagonist that binds to TRP, such as a TRPA1 antagonist.
(138) As a general proposition, the effective amount of the TRP antagonist administered parenterally per dose will be in the range of about 20 mg to about 5000 mg, by one or more dosages. Dosage regimens for antibodies, such as TRP antagonists (e.g., a TRPA1 antagonist), include 100 or 400 mg every 1, 2, 3, or 4 weeks or is administered a dose of about 1, 3, 5, 10, 15, or 20 mg/kg every 1, 2, 3, or 4 weeks. For example, an effective amount of a TRP antagonist (e.g., a TRPA1 antagonist) can be administered at 10 mg/kg every two weeks, optionally, by intravenous (i.v.) administration. In another example, an effective amount of a TRP antagonist (e.g., a TRPA1 antagonist) can be administered at 15 mg/kg every three weeks, optionally, by i.v. administration. The dose may be administered as a single dose or as multiple doses (e.g., 2 or 3 doses), such as infusions.
(139) In some instances, depending on the type and severity of the disease, about 1 μg/kg to 100 mg/kg (e.g., 0.1-20 mg/kg) of the TRP antagonist (e.g., a TRPA1 antagonist) as an initial candidate dosage for administration to the subject, whether, for example, by one or more separate administrations, or by continuous infusion. In one embodiment, desirable dosages include, for example, 6 mg/kg, 8 mg/kg, 10 mg/kg, and 15 mg/kg. For repeated administrations or cycles over several days or longer, depending on the condition, the treatment is sustained until the cancer is treated, as measured by the methods described above or known in the art. However, other dosage regimens may be useful. In one example, the TRP antagonist is administered once every week, every two weeks, or every three weeks, at a dose range from about 6 mg/kg to about 15 mg/kg, including but not limited to 6 mg/kg, 8 mg/kg, 10 mg/kg or 15 mg/kg. The progress of the therapy of the invention is easily monitored by conventional techniques and assays. In other embodiments, such dosing regimen is used in combination with a chemotherapy regimen in glioblastoma.
(140) If multiple exposures of TRP antagonist are provided, each exposure may be provided using the same or a different administration means. In one embodiment, each exposure is by intravenous administration. In another embodiment, each exposure is given by subcutaneous administration. In yet another embodiment, the exposures are given by both intravenous and subcutaneous administration.
(141) The duration of therapy can be continued for as long as medically indicated or until a desired therapeutic effect (e.g., those described herein) is achieved. In certain embodiments, the therapy is continued for 1 month, 2 months, 4 months, 6 months, 8 months, 10 months, 1 year, 2 years, 3 years, 4 years, 5 years, or for a period of years up to the lifetime of the subject.
(142) As noted above, however, these suggested amounts of TRP antagonist are subject to a great deal of therapeutic discretion. The key factor in selecting an appropriate dose and scheduling is the result obtained, as indicated above. In some embodiments, the TRP antagonist is administered as close to the first sign, diagnosis, appearance, or occurrence of the cancer as possible.
(143) 1. Routes of Administration
(144) The TRP antagonist (e.g., a TRPA1 antagonist) can be administered by any suitable means, including peroral, parenteral, topical, subcutaneous, intraperitoneal, intrapulmonary, intranasal, and/or intralesional administration. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. Intrathecal administration is also contemplated. In addition, the TRP antagonist may suitably be administered by pulse infusion, e.g., with declining doses of the TRP antagonist. Most preferably, the dosing is given by intravenous injections.
(145) If multiple exposures of TRP antagonist are provided, each exposure may be provided using the same or a different administration means. In one embodiment, each exposure is by i.v) administration. For example, a TRP antagonist (e.g., a TRPA1 antagonist), can be infused through a dedicated line. For example, a TRP antagonist (e.g., a TRPA1 antagonist), can be administered initially intravenously over about 90 minutes, with subsequent infusions over about 60 minutes and then about 30 minutes. In another embodiment, each exposure is given by subcutaneous (s.c.) administration. In yet another embodiment, the exposures are given by both i.v. and s.c. administration.
(146) 2. Combination Therapy
(147) In some embodiments, a TRP antagonist (e.g., a TRPA1 antagonist) may be used in combination with one or more additional anti-cancer agents or therapies. Examples of anti-cancer therapies include, without limitation, surgery, radiation therapy (radiotherapy), biotherapy, chemotherapy, or a combination of these therapies. In addition, cytotoxic agents, anti-angiogenic and anti-proliferative agents can be used in combination with the TRP antagonist. The one or more additional anti-cancer agents or therapies preferably have complementary activities to the TRP antagonist such that they do not adversely affect each other. The combined administration includes co-administration, using separate formulations or a single pharmaceutical formulation, and consecutive administration in either order, wherein preferably there is a time period while both (or all) active agents simultaneously exert their biological activities.
(148) The one or more additional anti-cancer agents may be a chemotherapeutic agent, a cytotoxic agent, a cytokine, a growth inhibitory agent, an anti-hormonal agent, and combinations thereof. Such molecules are suitably present in combination in amounts that are effective for the purpose intended. A pharmaceutical composition containing a TRP antagonist (e.g., a TRPA1 antagonist) may also comprise a therapeutically effective amount of an anti-cancer agent.
(149) Other therapeutic regimens in accordance with this invention may include administration of an anti-cancer agent and, including without limitation radiation therapy and/or bone marrow and peripheral blood transplants, and/or a cytotoxic agent, a chemotherapeutic agent, or a growth inhibitory agent. In one of such embodiments, a chemotherapeutic agent is an agent or a combination of agents such as, for example, cyclophosphamide, hydroxydaunorubicin, adriamycin, doxorubincin, vincristine (ONCOVIN™) prednisolone, CHOP, CVP, or COP. In another embodiment, the combination includes docetaxel, doxorubicin, and cyclophosphamide. The combination therapy may be administered as a simultaneous or sequential regimen. When administered sequentially, the combination may be administered in two or more administrations. The combined administration includes coadministration, using separate formulations or a single pharmaceutical formulation, and consecutive administration in either order, wherein preferably there is a time period while both (or all) active agents simultaneously exert their biological activities.
(150) In one embodiment, treatment with a TRP antagonist (e.g., a TRPA1 antagonist) involves the combined administration of an anti-cancer agent identified herein, and one or more chemotherapeutic agents or growth inhibitory agents, including coadministration of cocktails of different chemotherapeutic agents. Chemotherapeutic agents include taxanes (such as paclitaxel and docetaxel) and/or anthracycline antibiotics. Preparation and dosing schedules for such chemotherapeutic agents may be used according to manufacturer's instructions or as determined empirically by the skilled practitioner.
(151) Suitable dosages for any of the above co-administered agents are those presently used and may be lowered due to the combined action (synergy) of the TRP antagonist and other chemotherapeutic agents or treatments.
(152) The combination therapy may provide “synergy” and prove “synergistic,” i.e., the effect achieved when the active ingredients used together is greater than the sum of the effects that results from using the compounds separately. A synergistic effect may be attained when the active ingredients are: (1) co-formulated and administered or delivered simultaneously in a combined, unit dosage formulation; (2) delivered by alternation or in parallel as separate formulations; or (3) by some other regimen. When delivered in alternation therapy, a synergistic effect may be attained when the compounds are administered or delivered sequentially, e.g., by different injections in separate syringes. In general, during alternation therapy, an effective dosage of each active ingredient is administered sequentially, i.e., serially, whereas in combination therapy, effective dosages of two or more active ingredients are administered together.
(153) In general, for the prevention or treatment of disease, the appropriate dosage of the additional therapeutic agent will depend on the type of disease to be treated, the type of antibody, the severity and course of the disease, whether the TRP antagonist (e.g., a TRPA1 antagonist) and additional agent are administered for preventive or therapeutic purposes, previous therapy, the subject's clinical history and response to the TRP antagonist and additional agent, and the discretion of the attending physician. The TRP antagonist and additional agent are suitably administered to the subject at one time or over a series of treatments. The TRP antagonist is typically administered as set forth above. Depending on the type and severity of the disease, about 20 mg/m.sup.2 to 600 mg/m.sup.2 of the additional agent is an initial candidate dosage for administration to the subject, whether, for example, by one or more separate administrations, or by continuous infusion. One typical daily dosage might range from about or about 20 mg/m.sup.2, 85 mg/m.sup.2, 90 mg/m.sup.2, 125 mg/m.sup.2, 200 mg/m.sup.2, 400 mg/m.sup.2, 500 mg/m.sup.2 or more, depending on the factors mentioned above. For repeated administrations over several days or longer, depending on the condition, the treatment is sustained until a desired suppression of disease symptoms occurs. Thus, one or more doses of about 20 mg/m.sup.2, 85 mg/m.sup.2, 90 mg/m.sup.2, 125 mg/m.sup.2, 200 mg/m.sup.2, 400 mg/m.sup.2, 500 mg/m.sup.2, 600 mg/m.sup.2 (or any combination thereof) may be administered to the subject. Such doses may be administered intermittently, e.g., every week or every two, three weeks, four, five, or six (e.g., such that the subject receives from about two to about twenty, e.g., about six doses of the additional agent). An initial higher loading dose, followed by one or more lower doses may be administered. However, other dosage regimens may be useful. The progress of this therapy is easily monitored by conventional techniques and assays.
(154) In one embodiment, the subject has never been previously administered any drug(s) to treat cancer. In another embodiment, the subject has been previously administered one or more medicaments(s) to treat cancer. In a further embodiment, the subject was not responsive to one or more of the medicaments that had been previously administered. Such drugs to which the subject may be non-responsive include, for example, anti-neoplastic agents, chemotherapeutic agents, ROS-inducing agents, cytotoxic agents, and/or growth inhibitory agents. More particularly, the drugs to which the subject may be non-responsive include TRP antagonists (e.g., a TRPA1 antagonist).
(155) 3. Pharmaceutical Formulations
(156) Therapeutic formulations of the antagonists used in accordance with the present invention are prepared for storage by mixing the antagonist having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients, or stabilizers in the form of lyophilized formulations or aqueous solutions. For general information concerning formulations, see, e.g., Remington's The Science and Practice of Pharmacy (22nd edition), ed. L. Allen, Jr., 2012, Pharmaceutical Press, London, UK.
(157) Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes); and/or non-ionic surfactants such as TWEEN™, PLURONICS™, or polyethylene glycol (PEG).
(158) The active ingredients may also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly-(methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions. Such techniques are disclosed in Remington's The Science and Practice of Pharmacy (22nd edition), ed. L. Allen, Jr., 2012, Pharmaceutical Press, London, UK.
(159) Cancers
(160) The terms “cancer” and “cancerous” refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Included in this definition are benign and malignant cancers as well as dormant tumors or micrometastases. Cancers include but are not limited to, carcinoma, adenocarcinomas, lymphoma, blastoma, sarcoma, and leukemia. Other cancers include, for example, including colon cancers, rectal cancer, renal-cell carcinoma, liver cancer, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus, bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin Disease, non-Hodgkin lymphoma, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, chronic or acute leukemia including acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, solid tumors of childhood, lymphocytic lymphoma, cancer of the bladder, cancer of the kidney or ureter, carcinoma of the renal pelvis, neoplasm of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis tumor, brain stem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid cancer, squamous cell cancer, T-cell lymphoma, environmentally induced cancers including those induced by asbestos, and combinations of the cancers.
(161) Cancer Treatments
(162) In the invention, chemotherapeutic agents representing the standard-of-care, as known to those of skill in the art and to a physician treating a subject with cancer, may be administered to the subject in combination with a TRP channel antagonist, as determined by the method of the invention. Chemotherapeutic agents include alkylating agents, such as, for example, temozolomide (TMZ), the imidazotetrazine derivative of the alkylating agent dacarbazine. Additional examples of chemotherapeutics agents include, e.g., paclitaxel or topotecan or pegylated liposomal doxorubicin (PLD). Other examples of chemotherapeutic agents include alkylating agents such as thiotepa and CYTOXAN® cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide and trimethylolomelamine; acetogenins (e.g., bullatacin and bullatacinone); a camptothecin; bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (e.g., cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, calicheamicin gammal I, and calicheamicin omegal1); dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores), aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, ADRIAMYCIN® doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate; folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK® polysaccharide complex (JHS Natural Products, Eugene, Oreg.); razoxane; rhizoxin; sizofuran; spirogermanium; tenuazonic acid; triaziquone; 2,2′,2″-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside (“Ara-C”); cyclophosphamide; thiotepa; taxoids, e.g., TAXOL® paclitaxel (Bristol-Myers Squibb Oncology, Princeton, N.J.), ABRAXANE® Cremophor-free, albumin-engineered nanoparticle formulation of paclitaxel (American Pharmaceutical Partners, Schaumberg, Ill.), and TAXOTERE® docetaxel (Rhone-Poulenc Rorer, Antony, France); chloranbucil; GEMZAR® gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin, oxaliplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; NAVELBINE® vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO); retinoids such as retinoic acid; capecitabine; combretastatin; leucovorin (LV); oxaliplatin, including the oxaliplatin treatment regimen (FOLFOX); lapatinib (Tykerb®); inhibitors of PKC-alpha, Raf, H-Ras, EGFR (e.g., erlotinib (Tarceva®)) and VEGF-A that reduce cell proliferation and pharmaceutically acceptable salts, acids or derivatives of any of the above.
(163) Examples of ROS-inducing agents include phenethylisothiocyanate (PEITC), parthenolide, piperlongumine, erastin, lanperisone, Aminoflavone (5-amino-2-(4-amino-3-fluorophenyl(-6,8-difluoro-7-methylchromen-4-one), combination therapy of gemcitabine with trichostatin A, and benzyl isothiocyanate (BITC).
(164) Examples of growth inhibitory agents include agents that block cell cycle progression (at a place other than S phase), such as agents that induce G1 arrest and M-phase arrest. Classical M-phase blockers include the vincas (vincristine and vinblastine), taxanes, and topoisomerase II inhibitors such as the anthracycline antibiotic doxorubicin ((8S-cis)-10-[(3-amino-2,3,6-trideoxy-α-L-lyxo-hexapyranosyl)oxy]-7,8,9,10-tetrahydro-6,8,11-trihydroxy-8-(hydroxyacetyl)-1-methoxy-5,12-naphthacenedione), epirubicin, daunorubicin, etoposide, and bleomycin. Those agents that arrest G1 also spill over into S-phase arrest, for example, DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, and ara-C. Further information can be found in The Molecular Basis of Cancer, (Mendelsohn et al. The Molecular Basis of Cancer E-Book. Elsevier Health Sciences, 2014) and Israel, eds., Chapter 1, entitled “Cell cycle regulation, oncogenes, and antineoplastic drugs” by Murakami et al. (WB Saunders: Philadelphia, 1995), especially p. 13. The taxanes (paclitaxel and docetaxel) are anticancer drugs both derived from the yew tree. Docetaxel (TAXOTERE®, Rhone-Poulenc Rorer), derived from the European yew, is a semisynthetic analogue of paclitaxel (TAXOL®, Bristol-Myers Squibb). Paclitaxel and docetaxel promote the assembly of microtubules from tubulin dimers and stabilize microtubules by preventing depolymerization, which results in the inhibition of mitosis in cells.
(165) Examples of cancer type(s) that would be susceptible to treatment with combinations of anti-cancer agents combined with TRP antagonists are listed in Table 2 (based on National Cancer Institute (www.cancer.gov/) cancer treatment listings).
(166) TABLE-US-00002 TABLE 2 Anti-Cancer Agents for Various Cancer Types Anti-cancer agent combined with TRP antagonist Cancer type(s) Doxorubicin Acute lymphoblastic leukemia (ALL). Acute myeloid leukemia (AML). Breast cancer. Gastric cancer. Hodgkin lymphoma. Neuroblastoma. Non-Hodgkin lymphoma. Ovarian cancer. Small cell lung cancer. Soft tissue and bone sarcomas. Thyroid cancer. Transitional cell bladder cancer. Wilms tumor. Gemcitabine Breast cancer. Non-small cell lung cancer (NSCLC). Ovarian cancer. Pancreatic cancer. Gemcitabine + Paclitaxel Breast cancer. Pancreatic cancer. Gemcitabine + Cisplatin NSCLC. Gemcitabine + Carboplatin Ovarian cancer. Tamoxifen Breast cancer. Methotrexate ALL. Breast cancer. Gestational trophoblastic disease. Head and neck cancer. Lung cancer. Mycosis fungoides. Non-Hodgkin lymphoma. Osteosarcoma. Arsenic trioxide Acute promyelocytic leukemia. Anastrozole Breast cancer in postmenopausal women who have any of the following types of breast cancer: Early-stage, hormone receptor positive (HR+) breast cancer. Locally advanced or metastatic breast cancer that is HR+ or hormone receptor unknown (it is not known whether it is HR+ or hormone receptor negative). Advanced breast cancer that has gotten worse after treatment with tamoxifen citrate. Exemestane Breast cancer (e.g., that is advanced or that is early-stage and estrogen receptor positive). Letrozole Breast cancer in postmenopausal women who have any of the following types of breast cancer: Early-stage, hormone receptor positive (HR+) breast cancer in women who have already received other treatment. Early-stage breast cancer that has been treated with tamoxifen citrate for at least five years. Breast cancer that is locally advanced or has metastasized, is HER2 positive (HER2+) and HR+. Breast cancer that is locally advanced or has metastasized and it is not known whether the cancer is HR+ or hormone receptor negative (HR−). Advanced breast cancer that has gotten worse after antiestrogen therapy. Formestane Breast cancer (e.g., that is estrogen receptor positive). Fadrozole Breast cancer. Cisplatin Bladder cancer (e.g., that cannot be treated with surgery or radiation therapy). Ovarian cancer (e.g., that has metastasized). Testicular cancer (e.g., that has metastasized in patients who have already had surgery or radiation therapy). Carboplatin Ovarian cancer that is advanced. It is used with other chemotherapy as first-line treatment. It is used alone as palliative treatment for disease that has recurred (come back) after earlier chemotherapy. Oxaliplatin Colorectal cancer (e.g., that is advanced or has recurred). Colon cancer. Nedaplatin (see, e.g., Shimada et al, Squamous cell lung cancer. Cancer Manag. Res. 8: 67-76, 2013) NSCLC. Esophageal cancer. Uterine cervical cancer. Head and neck cancer. Urothelial cancer. Triplatin tetranitrate (see, e.g., Wheate et Ovarian cancer. al, Dalton Trans, 39: 8113-8127, 2010) Small cell lung cancer. Gastric cancer. Phenanthriplatin Leukemias. NSCLC. Colon cancer. Central nervous system cancers. Melanoma. Ovarian cancer. Renal cancer. Prostate cancer. Breast cancer. Picoplatin Lung cancer. Ovarian cancer. Colorectal cancer. Hormone-refractory prostate cancer. Satraplatin Prostate cancer. Lung cancer. Ovarian cancer.
EXAMPLES
(167) The following examples are provided to illustrate, but not to limit the presently claimed invention.
Example 1: Materials and Methods
(168) Animals and In Vivo Procedures
(169) All animal studies were performed according to protocols approved by the Institutional Animal Care and Use Committee, the Standing Committee on Animals at Harvard University. One million HCC1569 cells stably expressing either TRPA1 or GFP (control) shRNAs were injected into cleared mammary fatpads of 8-week-old female NOD-Rag1.sup.null IL2rg.sup.null (NRG) mice. Tumor volume (mm.sup.3) was monitored by caliper measurements in two perpendicular dimensions (the formula: (d.sup.2×D)/2, where d and D represent the shortest and longest diameters, respectively) at the indicated time points. After tumors reached 3 to 5 mm in diameter, animals were randomized into the following treatment arms: (i) 37.5 mg/kg carboplatin or (ii) its vehicle (H.sub.2O) administrated via intraperitoneal injection for HCC1569 cell-transplanted animals; (i) oral administration of 30.0 mg/kg AM-0902, (ii) intraperitoneal administration of 37.5 mg/kg carboplatin, (iii) oral administration of 30.0 mg/kg AM-0902 plus intraperitoneal administration of 37.5 mg/kg carboplatin, or (iv) oral administration of 1% Tween 80/2% HPMC/97% water/methanesulfonic acid pH 2.2 (vehicle for AM-0902) plus intraperitoneal administration of H.sub.2O (vehicle for carboplatin) for EL-12-58 cell-transplanted animals. Power calculations are based on the standard deviation and effect size from pilot experiments in HCC1569 cells. The sample size of seven mice per group provides greater than 95% power to detect a ˜80% difference in change in tumor volume between control and shTRPA1-treated cells with a two-sided type I error rate of 5%. Averaged tumor volume represents mean±SEM.
(170) Development of Subject Derived HCl-002 Cell Line
(171) Subject-derived xenograft HCl-002 was expanded in mammary fat pads of NOD-SCID mice to 1 cm diameter (DeRose et al., Nat. Med., 17:1514-1520, 2011). Tumors were mechanically dissociated then digested with collagenase/hyaluoronidase (Stem Cell Technologies) followed by TrypLE Express (Thermo Fisher Scientific) with DNase (Roche Diagnostics). The resultant organoid suspension was plated in conditioned media from irradiated J2 3T3 fibroblasts with Rho kinase inhibitor as previously described. Contaminating fibroblasts were minimized by a combined approach of differential trypsinization and differential adhesion over passages 1-3 with a highly pure human epithelial population (>95% EPCAM-positive by FACS). The cell culture remained phenotypically stable over multiple passages and recapitulated the histologic appearance of the parent subject-derived xenograft upon orthotopic implantation into mammary fat pads of immunocompromised mice. Early-passage cultures (passage 4-8) were used for all experiments.
(172) Cell Culture
(173) MCF-10A cells were cultured in DMEM/F12 (Life Technologies) supplemented with 5% horse serum, 20 ng/ml epidermal growth factor (EGF), 10 μg/ml insulin, 0.5 μg/mL hydrocortisone, 100 ng/mL cholera toxin, and penicillin and streptomycin (P/S) (Life Technologies). HCC1569, HCC38, HCC202, HCC70, HCC1500, MDAMB-175, T47D, BT-549, H1792, H647, A549, and H23 cells were cultured in RPMI (Life Technologies)+10% fetal bovine serum (FBS) (Life Technologies) with P/S (Life Technologies). HLF-a cells were cultured in Eagle's Minimum Essential Medium (ATCC)+10% FBS with P/S. sNF96.2, 90-BTL, 88-14, and S462 cells were cultured in Dulbecco's Modified Eagle Medium (DMEM; Life Technology)+10% FBS with P/S, 1 mM sodium pyruvate (Thermo Fisher Scientific), and 2 mM L-glutamine (Thermo Fisher Scientific). EL-12-58 and HCl-002 cells were cultured in F-12 (Lonza)/DMEM (3:1 mixture)+5% FBS with P/S, hydrocortisone (0.4 μg/mL, Sigma), cholera toxin (8.4 ng/mL, Sigma), insulin (5 μg/mL, Sigma), EGF (10 ng/mL, PeproTech), and Y-27632 (5 μM, ENZO life sciences). All cells were routinely cultured in 37° C. with 5% CO.sub.2. For 3D culture, MCF-10A cells were plated on Matrigel-coated glass bottom 24-well plates in DMEM/F12 (Life Technologies), 2% horse serum (Life Technologies), EGF (5 ng/mL), hydrocortisone (0.5 μg/mL), cholera toxin (100 ng/mL), insulin (10 μg/mL), and P/S supplemented with 2% Growth Factor Reduced Matrigel (BD Biosciences). HCC1569 cells were plated on Matrigel-coated glass bottom 24-well plates in the regular HCC1569 growth media supplemented with 2% Growth Factor Reduced Matrigel (BD Biosciences). The cells were refed with fresh media every three days. For suspension culture, MCF-10A and HCC1569 cells were plated on poly HEMA (poly-2-hydroxyethyl methacrylate, Sigma)-coated plates in the regular MCF-10A or HCC1569 growth media. In 3D and suspension culture, cells were maintained in 37° C. with 5% CO.sub.2 and 6% O.sub.2 (physiological partial pressure of O.sub.2).
(174) Immunohistochemistry Staining
(175) Unstained breast cancer and normal breast tissue arrays were purchased from US Biomax (BR1504a for breast tumors, BN08111 for normal breast tissues). Formalin-fixed tumor samples derived from mouse xenografts were processed and embedded in paraffin. Tissue sections were deparaffinized and antigen retrieval was achieved by use of heat-induced epitope retrieval with pH 6.0 citrate buffer (Sigma). Tissue sections were stained with hematoxylin and eosin (H&E), anti-TRPA1 antibody (Sigma), or anti-Cleaved Caspase-3 (Asp175) antibody (Cell Signaling). TRPA1 antibody was validated using sections from tumors that expressed TRPA1 shRNA vectors. Immunostained slides were counterstained with hematoxylin (Sigma). Tumor slides stained for TRPA1, blinded and were evaluated by light microscopy and scored by a veterinary pathologist. Images of tissue sections were captured at 4× magnification to create a merged image of the entire section and at 20× magnification for quantification of cleaved caspase-3-positive nuclei, using a Olympus VS120 Slide Scanner. Images of tumor sections stained with H&E or cleaved caspase-3 are representative of two independent experiments. Relative apoptosis was quantified by determining the percentage of cleaved caspase-3-positive cells from more than five random fields, per section, from each tumor in the group, and normalized to the shGFP-expressing tumors treated with vehicle. Data is mean±SEM from the sum of two independent experiments.
(176) Plasmids, siRNAs, shRNAs, and Virus Production
(177) The pC1-HyPer-2 (Cat #42211) and pC1-HyPer-C199S (Cat #42213) plasmids were obtained by Addgene. The lentiviral constructs of pCDH (Puro or Hygromycin B)-HyPer-2 and pCDH (Puro or Hygromycin B)-Hyper-C199S were conducted by transferring the NheI and BamHI digested fragments of HyPer-2 and HyPer-C199S from the pC1 constructs into the NheI and BamHI digested pCDH (Puro or Hygromycin B) vector. pENTR223.1-TRPA1 was purchased from GE Healthcare and cloned into a Gateway compatible pLX304 vector. LentiCRISPR plasmids were constructed using lentiCRISPRv2 containing two expression cassettes, hSpCas9 and the chimeric guide RNA. Design of gRNAs and off-target sites prediction were performed by using the Zhang laboratory CRISPR design tool (crispr.mit.edu). TRPA1 mutants were constructed according to standard Quickchange protocol. Primers used for the construction are shown in Table 3. The nucleotide sequences of the mutants were verified by sequencing the corresponding cDNA. TRPA1 shRNAs were acquired from the RNAi Consortium, and have 100% sequence homology for TRPA1 (shRNA #1 is TRCN0000044801 and shRNA #2 is TRCN0000434290). shRNA against GFP was purchased from Addgene (plasmid #: 30323). Lentiviruses for shRNAs against TRPA1 or GFP and plasmids for TRPA1 or Hyper-2 constructs were made in 293T cells according to standard protocol and selected with Blasticidin, Puromycin, or Hygromycin B for at least 1 week. SMARTpool siRNA for Pyk2 (L-003165-00), NFE2L2 (L-003755-00), and siGENOME Non-Targeting siRNA Pool #2 (D-001206-14) were purchased from GE Healthcare and was transfected according to standard protocol and experiments were performed within 48-72 h of transfection. MCF-10A cells expressing HER2 were generated as described previously (Schafer et al., Nature, 461:109-113, 2009).
(178) TABLE-US-00003 TABLE 3 Primer Sequences Used for the Construction of TRPA1 Mutants Genes Mutants Mutation primer sequences (5′.fwdarw.3′) TRPA1 L259P for: GATCAAAATGTGCCCGGACAATGGTG C (SEQ ID NO: 1) rev: GCACCATTGTCCGGGCACATTTTGAT C (SEQ ID NO: 2) S296F for: CTGATGATATCGTCCTATTTTGGTAG CGTGG (SEQ ID NO: 3) rev: CCACGCTACCAAAATAGGACGATATC ATCAG (SEQ ID NO: 4) N431S for: CTGGTTCTGTAAATTCCCTACTTGGC TTTAATGTGTCC (SEQ ID NO: 5) rev: GGACACATTAAAGCCAAGTAGGGAAT TTACAGAACCAG (SEQ ID NO: 6) K491N for: CCATCTGGCAGCAAACAATGGACATG (SEQ ID NO: 7) rev: CATGTCCATTGTTTGCTGCCAGATGG (SEQ ID NO: 8) G505S for: CAGCTTCTTCTGAAAAAATCTGCATT GTTTCTCAGTG (SEQ ID NO: 9) rev: CACTGAGAAACAATGCAGATTTTTTC AGAAGAAGCTG (SEQ ID NO: 10) E681K for: CACCTACACAGGATGTTATATATAAA CCGCTTACAGCCCTC (SEQ ID NO: 11) rev: GAGGGCTGTAAGCGGTTTATATATAA CATCCTGTGTAGGTG (SEQ ID NO: 12) K771Q for: CCACGAATTCATATCTAATACAAACT TGTATGATTTTAGTG (SEQ ID NO: 13) rev: CACTAAAATCATACAAGTTTGTATTA GATATGAATTCGTGG (SEQ ID NO: 14) for: forward primer; rev: reverse primer
H.sub.2O.sub.2 Measurement
(179) For the measurement of [H.sub.2O.sub.2].sub.i levels in MCF-10A acini and HCC1569 spheroids, cells were transduced with a lentiviral vector encoding Hyper-2 or Hyper-2 (C199S). The Hyper-2 fluorescence was measured at 37° C. in HEPES-buffered saline (HBS) containing the following (in mM): 150 NaCl, 6 KCl, 1.2 MgSO.sub.4, 2 CaCl.sub.2, 11.5 glucose, and 25 HEPES (pH adjusted to 7.4 with NaOH). Fluorescence images of the cells were acquired through the Eclipse Ti-E microscope (Nikon) with ORCA-R2 cooled CCD camera (Hamamatsu Photonics) and analyzed with Metafluor image acquisition software (Molecular Devices). The 488:405-nm ratio images were obtained on a pixel-by-pixel basis. 3D images are shown as one section from midstructure. For the measurement of [H.sub.2O.sub.2].sub.i levels in MCF-10A cells cultured in suspension, cell clumps were dissociated with trypsin and stained with 10 μM peroxy green-1 for 30 min at 37° C. Cells were then subjected to flow cytometric analysis (FACSCalibur; BD Biosciences). ROS levels determined by flow cytometry are reported as mean fluorescence intensity expressed in arbitrary units. Hyper-2 ratio images are representative from two independent experiments and averaged Hyper-2 ratio represents mean±SD from the sum of two independent experiments.
(180) Ca.sup.2+ Measurement
(181) For the measurement of [Ca.sup.2+].sub.i levels in cells cultured in 2D or 3D (in Matrigel), cells were stained with 3.5 μM fura-2-AM (Life Technology) in the presence of 2.5 mM probenecid (Sigma) and 0.02% Pluronic F-127 (Sigma) for 45 min at 37° C. The fura-2 fluorescence was measured in HBS solution containing 1.25 mM probenecid at 37° C. Fluorescence images of the cells were acquired through the Eclipse Ti-E microscope with ORCA-R2 cooled CCD camera and analyzed with Metafluor. The 340:380-nm ratio images were obtained on a pixel-by-pixel basis and were converted to Ca.sup.2+ concentrations by in vivo calibration using 5 μM ionomycin as described previously (Nishida et al., Biochem. Biophys. Res. Commun., 262:350-354, 1999). 3D images are shown as one section from midstructure. For the measurement of [Ca.sup.2+].sub.i levels in cells cultured in suspension, cell clumps were dissociated with trypsin and [Ca.sup.2+].sub.i levels were determined by using Fluo-4 NW Calcium Assay Kit (Molecular Probes). Cells were stained with Fluo-4 according to the manufacturer's instructions and subjected to flow cytometric analysis (FACSCalibur) using HBS as sheath fluid. [Ca.sup.2+].sub.i levels determined by flow cytometry are reported as mean fluorescence intensity expressed in arbitrary units. Time courses of [Ca.sup.2+].sub.i rises in 2D culture are representative of three independent experiments and averaged Δ[Ca.sup.2+].sub.i represents mean±SEM from the sum of three independent experiments. Fura-2 ratio images in 3D culture are representative of two independent experiments and averaged [Ca.sup.2+].sub.i in 3D culture represents mean±SEM from the sum of two independent experiments.
(182) Immunofluorescence Staining
(183) MCF-10A acini and HCC1569 spheroids were fixed with 4% paraformaldehyde at room temperature for 20 min and permeabilized in 0.15% Triton X-100 in PBS containing 5% goat serum at room temperature for 2 h. Antibodies used were Ki67 (DAKO) and Cleaved Caspase-3 (Asp175) antibody (Cell Signaling). Fluorescent images were acquired through the Eclipse Ti-E microscopes with A1R point scanning confocal (Nikon). Data are processed with NIS Elements software (Nikon). 3D images are shown as one section from midstructure. Images shown are representative of at least three independent experiments. For examination of luminal filling, spheroids were scored as clear (˜90-100% clear), mostly clear (˜50-90% clear), mostly filled (˜10-50% clear), or clear (˜0-10% clear), as previously reported (Schafer et al., Nature, 461:109-113, 2009).
(184) Cell Viability, Apoptosis, and Cell Cycle Assays
(185) For the measurements of live cell number and cell death under treatment with H.sub.2O.sub.2, diamide, or chemotherapies, cells were cultured on 96-well plates in the presence or absence of these drugs for indicated times and stained with 5 μM bisBenzimide H 33342 trihydrochloride (Hoechst; Sigma) and 5 μM propidium iodide (PI; Sigma) for 1 h at 37° C. Hoechst- and/or PI-positive cells were counted using a laser scanning cytometer, Acumen Cellista (TTPLabTech). Apoptotic cells induced by H.sub.2O.sub.2 treatment were measured by staining with Annexin V-Alexa Fluor® 488 conjugate (Life Technologies) and PI in Ca.sup.2+-containing solution (10 mM HEPES pH 7.4, 140 mM NaCl; 2.5 mM CaCl.sub.2), followed by flow cytometric measurement of fluorescence using a FACSCalibur. Flow cytometry plots are representative of three independent experiments. For the counting of viable cells cultured in suspension, cell clumps were dissociated with trypsin and stained with trypan blue. Viable cells were counted using the Countless Automated Cell Counters (Thermo Fisher Scientific). For the measurement of percentage of dead cells cultured in suspension, cells were cultured on poly HEMA-coated 96-well plates and stained with 5 μM Hoechst and 5 μM PI for 1 h at 37° C. without enzymatic dissociation of cell clumps. Hoechst- and/or PI-positive areas were measured using Acumen Cellista. Apoptotic cells induced by detachment were measured by staining with 5 μM Hoechst and 5 μM of CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) for 1 h at 37° C. without enzymatic dissociation of cell clumps. Hoechst- and/or CellEvent™ Caspase-3/7 Green Detection Reagent-positive areas were measured using Acumen Cellista. For the cell cycle analysis, enzymatically dissociated cells were fixed with ice-cold 70% EtOH for at least 30 min at 4° C., washed three times with PBS at 4° C., resuspended in PBS, treated with 100 μg/ml RNase A (Sigma), and stained with 50 μg/ml PI. The stained samples were subjected to flow cytometric analysis (FACSCalibur).
(186) Soft Agar Assay
(187) Cells were added to the regular MCF-10A or HCC1569 growth media (±AP-18, A-967079, or Trolox) plus 0.4% low-melt agarose (Sigma) and layered onto a bed of growth media plus 0.5% low-melt agarose. Cells were fed every 4 days with growth media (±AP-18, A-967079, or Trolox) plus 0.4% low-melt agarose. At the indicated times, viable colonies were stained with iodonitrotetrazolium chloride (Sigma). Colony number and colony size were determined using ImageJ. Images shown are representative of at least three independent experiments.
(188) RPPA and Immunoblot Assay
(189) For RPPA assay, sample preparation and probing with antibodies to the indicated proteins, normalization of data points, and analysis were performed as previously described. For immunoblot analysis for all the indicated proteins except for TRPA1, cells were lysed in cell lysis buffer (1% Triton X-100, 150 mM NaCl, 1.5 mM MgCl.sub.2, 1 mM EGTA, 100 mM NaF, 10 mM Na pyrophosphate, 10% glycerol, 50 mM HEPES pH 7.4) with protease and phosphatase inhibitor cocktails (Roche) and 1 mM Na.sub.3VO.sub.4 (Sigma). Protein concentrations were determined by BCA protein assay (Life Technologies). Equal protein amounts were denatured in SDS sample buffer (10% Glycerol, 2% SDS, 62.5 mM Tris-HCL, pH 6.8) with 1% β-mercaptoethanol for 10 min at 95° C. For immunoblot analysis for TRPA1 protein, membrane fraction was isolated by using Mem-PER™ Plus Membrane Protein Extraction Kit (Life Technologies) according to the manufacturer's instructions. Equal protein amounts were denatured in SDS sample buffer with 50 mM dithiothreitol using a vortex mixer for 30 min at room temperature. Proteins were analyzed by SDS-PAGE and immunoblot using the indicated antibodies. Blots were imaged with the Odyssey CLx infrared imaging system (LI-COR) and are representative of at least two independent experiments where indicated. Ras activities were assessed using the Active Ras Pull-Down and Detection Kit (Thermo Fisher Scientific) according to the manufacturer's instructions.
(190) Quantitative PCR
(191) mRNA prepared from cell extracts using the RNeasy Mini Kit (QIAGEN) was reverse-transcribed into cDNA using the qScript cDNA synthesis kit (Quanta Biosciences). Real-time PCR was performed on an ABI PRISM 7900HT or QuantStudio 7 Flex Real-Time PCR System (Life Technologies) with Power SYBR Green PCR Mix (Life Technologies). Primers used for the analysis are shown in Table 4.
(192) TABLE-US-00004 TABLE 4 Primer sequences used for Real-time PCR Genes or ID Mutation primer sequences (5′.fwdarw.3′) TRPA1 for: ATCAGAAATCCACCATCGTG (SEQ ID NO: 15) rev: TTGACTGCTCTCAACACAGTATTC (SEQ ID NO: 16) B-Actin for: GACAGGATGCAGAAGGAGATC (SEQ ID NO: 17) rev: TGCTGATCCACATCTGCTG (SEQ ID NO: 18) RF2 for: GAGAGCCCAGTCTTCATTGC (SEQ ID NO: 19) rev: TTGGCTTCTGGACTTGGAAC (SEQ ID NO: 20) NQO1 for: TGAAGAAGAAAGGATGGGAGGT (SEQ ID NO: 21) rev: GGCCTTCTTTATAAGCCAGAACA (SEQ ID NO: 22) Peak1 region for: ATGTTTATTGCTGTGGTTTGAG (SEQ ID NO: 23) rev: CTTCCGCAATGATGACTCAG (SEQ ID NO: 24) Peak2 region for: AAGTGAGAGCCAGACAGTCC (SEQ ID NO: 25) rev: GGAATTGAGAAGAGAAGACAGATTG (SEQ ID NO: 26) Peak3 region for: CCCAGAAATAGGATTTAAGACAGG (SEQ ID NO: 27) rev: AGGAACTTACAAGATTCTAAAGCTG (SEQ ID NO: 28) Non-Peak region for: GTGTACAGAATGCGGAAAAC (SEQ ID NO: 29) rev: CCCAAAGTGCTAGGATTACAG (SEQ ID NO: 30) NQO1 promoter for: AAGTGCAGAATCTGAATCTTG (SEQ ID NO: 31) rev: AGATTCTGCTGAGTCACTGTG (SEQ ID NO: 32) for: forward primer; rev: reverse primer
Chromatin Immunoprecipitation
(193) H1792 cells overexpressing Flag-NRF2 were cross-linked in the culture medium with 1% formaldehyde for 10 min at room temperature. The reaction was stopped by the addition of 100 mM glycine, followed by 5 mg/mL BSA in PBS and then two washing in cold PBS. Cells were harvested and resuspended in lysis buffer [50 mM Tris.HCl, pH 8.0, 10 mM EDTA, 1% SDS, 1× Protease Inhibitor Cocktail (Selleck Chemicals)], and then sonicated with a Sonic Dismembrator (Fisher Scientific, Model FB120) to obtain a fragment size of 300-500 bp. Fragmented chromatin was diluted in IP buffer (20 mM Tris.HCl, pH 8.0, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 1× Protease Inhibitor Cocktail) and incubated overnight at 4° C. with Protein G magnetic beads (Dynabeads; Thermo Fisher Scientific) that had been pre-incubated with monoclonal anti-Flag M2 antibody (Sigma, F1804) or mouse IgG (Thermo Fisher Scientific). Immunoprecipitates were washed three times with wash buffer (50 mM Hepes, pH 7.6, 0.5 M LiCl, 1 mM EDTA, 0.7% Na deoxycholate, and 1% Nonidet P-40) and twice with TE buffer. Immunoprecipitated (or no IP input) DNA was recovered in Elution Buffer (1% SDS and 0.1 M NaHCO3) over 6 h at 65° C., and then column-purified with QiaQuick columns (Qiagen). Quantitative PCR was performed with Fast SYBR Green Master Mix (Life Technologies) on a QuantStudio 7 Flex Real-Time PCR System (Life Technologies). Primer sequences are listed in Table 5.
(194) TABLE-US-00005 TABLE 5 Primer Sequences Used for the Construction of LentiCRISPR Plasmids Plasmid ID Mutation primer sequences (5′.fwdarw.3′) sgPeak1 #1 for: caccgTGAGTCATCATTGCGGAAGT (SEQ ID NO: 33) rev: aaacACTTCCGCAATGATGACTCAc (SEQ ID NO: 34) sgPeak1 #2 for: caccgACTTCCGCAATGATGACTCA (SEQ ID NO: 35) rev: aaacTGAGTCATCATTGCGGAAGTc (SEQ ID NO: 36) sgPeak1 #3 for: caccgAACTTCCGCAATGATGACTC (SEQ ID NO: 37) rev: aaacGAGTCATCATTGCGGAAGTTc (SEQ ID NO: 38) sgPeak1 #4 for: caccgGAAGCCCTGAGTCATCATTG (SEQ ID NO: 39) rev: aaacCAATGATGACTCAGGGCTTCc (SEQ ID NO: 40) sgPeak1 #5 for: caccgAGGACCTCTATTTATTCAGC (SEQ ID NO: 41) rev: aaacGCTGAATAAATAGAGGTCCTc (SEQ ID NO: 42) sgPeak1 #6 for: caccgATGGTGGAATTTGTGTTACT (SEQ ID NO: 43) rev: aaacAGTAACACAAATTCCACCATc (SEQ ID NO: 44) sgPeak1 #7 for: caccgTACCATAAAGGTTTACTAAT (SEQ ID NO: 45) rev: aaacATTAGTAAACCTTTATGGTAc (SEQ ID NO: 46) sgPeak1 #8 for: caccgCCACTGTATTTCAAAAGCTT (SEQ ID NO: 47) rev: aaacAAGCTTTTGAAATACAGTGGc (SEQ ID NO: 48) sgPeak2 #1 for: caccgTAAGAGCTGAATGGTAGCAC (SEQ ID NO: 49) rev: aaacGTGCTACCATTCAGCTCTTAc (SEQ ID NO: 50) sgPeak2 #2 for: caccgTTGAACTCAGGCATAGTGCT (SEQ ID NO: 51) rev: aaacAGCACTATGCCTGAGTTCAAc (SEQ ID NO: 52) sgPeak2 #3 for: caccgAAGAGCTGAATGGTAGCACA (SEQ ID NO: 53) rev: aaacTGTGCTACCATTCAGCTCTTc (SEQ ID NO: 54) sgPeak2 #4 for: caccgAGTGGGGCAGAAGTTTGGAC (SEQ ID NO: 55) rev: aaacGTCCAAACTTCTGCCCCACTc (SEQ ID NO: 56) sgPeak2 #5 for: caccgGAGAGAATGACTCAGCAGAT (SEQ ID NO: 57) rev: aaacATCTGCTGAGTCATTCTCTCc (SEQ ID NO: 58) sgPeak2 #6 for: caccgTTGGACTGGTAAGAGCTGAA (SEQ ID NO: 59) rev: aaacTTCAGCTCTTACCAGTCCAAc (SEQ ID NO: 60) sgPeak2 #7 for: caccgGAATGGTAGCACAGGGCAGC (SEQ ID NO: 61) rev: aaacGCTGCCCTGTGCTACCATTCc (SEQ ID NO: 62) sgPeak2 #8 for: caccgAGAGAGAATGACTCAGCAGA (SEQ ID NO: 63) rev: aaacTCTGCTGAGTCATTCTCTCTc (SEQ ID NO: 64) sgPeak3 #1 for: caccgTTCAGGCACTGTCACACCCT (SEQ ID NO: 65) rev: aaacAGGGTGTGACAGTGCCTGAAc (SEQ ID NO: 66) sgPeak3 #2 for: caccgATAGGATTTAAGACAGGTTC (SEQ ID NO: 67) rev: aaacGAACCTGTCTTAAATCCTATc (SEQ ID NO: 68) sgPeak3 #3 for: caccgCTTGGCTCTGTCATTATTAG (SEQ ID NO: 69) rev: aaacCTAATAATGACAGAGCCAAGc (SEQ ID NO: 70) sgPeak3 #4 for: caccgACATATATAGTGACTCAGCA (SEQ ID NO: 71) rev: aaacTGCTGAGTCACTATATATGTc (SEQ ID NO: 72) sgPeak3 #5 for: caccgCACTAATAATGACAGAGCCA (SEQ ID NO: 73) rev: aaacTGGCTCTGTCATTATTAGTGc (SEQ ID NO: 74) sgPeak3 #6 for: caccgACTAATAATGACAGAGCCAA (SEQ ID NO: 75) rev: aaacTTGGCTCTGTCATTATTAGTc (SEQ ID NO: 76) sgPeak3 #7 for: caccgTACAAGATTCTAAAGCTGAA (SEQ ID NO: 77) rev: aaacTTCAGCTTTAGAATCTTGTAc (SEQ ID NO: 78) sgPeak3 #8 for: caccgTAATAAGTCATCTTTGTCAA (SEQ ID NO: 79) rev: aaacTTGACAAAGATGACTTATTAc (SEQ ID NO: 80) for: forward primer; rev: reverse primer
ATP and Glucose Uptake Assay
(195) For the measurement of ATP levels, the ATPlite assay kit (PerkinElmer) was used. Cells were plated in poly HEMA-coated (or uncoated) 96-well plates. After 24 h, ATP assay was conducted according to the manufacturer's protocol. ATP levels were measured through the detection of luminescent signals by using the SpectraMax M5 (Molecular Devices) and were normalized by total cell number. For the analysis of glucose uptake, the Amplex Red Glucose Assay Kit (Invitrogen) was used. Cells were plated in poly HEMA-coated (or uncoated) 96-well plates. After 24 h, the media was collected and the amount of glucose was determined through the detection of fluorescent signals using the SpectraMax M5, according to the manufacturer's protocol. Glucose uptake was determined by subtracting the amount of glucose in each sample from the total amount of glucose in the media (without cells). The data were normalized by total cell number.
(196) Bioinformatics and Statistical Analysis
(197) Analysis of the TCGA invasive breast carcinoma data was conducted on processed data downloaded through Oncomine (www.oncomine.com). mRNA and protein heatmaps were generated in Cluster 3.0 as a hierarchical cluster using Pearson Correlation and a center metric. The resulting heatmap was visualized in Java Treeview. Published NSCLC and MPNST datasets were downloaded from Hou et al. (GSE19188, Gene Expression Omnibus www.ncbi.nlm.nih.gov/geo) and Miller et al. (GSE14038, GEO). Error bars represent either the SD or SEM, as described in the figure legends. The sample size for each experiment, n, is included in the associated figure legend. Statistical significance was determined by the Student's t test and the one-way or two-way ANOVA followed by Tukey's test using Graph Pad Prism 7.0. P-values<0.05 were considered significant. P values for each experiment are also included in the associated figure legends.
Example 2: TRPA1 is Highly Expressed in Breast Tumors
(198) To assess the expression of TRP channel subtypes in breast tumors, we first analyzed their mRNA expression profiles using the Cancer Genome Atlas (TCGA) dataset. A subset of TRP channels exhibited altered expression in breast tumors relative to normal mammary tissues (
Example 3: TRPA1 Expression Promotes Cell Survival in Response to Exogenous Oxidative Stress or Loss of Matrix Attachment
(199) We investigated the impact of exogenous TRPA1 expression on viability of MCF-10A mammary epithelial cells in response to treatment with H.sub.2O.sub.2, a stable, membrane permeable cellular ROS molecule. H.sub.2O.sub.2 elicited enhanced [Ca.sup.2+].sub.i increases in TRPA1-expressing cells in a concentration-dependent manner (
(200) We next examined the effects of TRPA1 on the intracellular concentration of H.sub.2O.sub.2 ([H.sub.2O.sub.2].sub.i), [Ca.sup.2+].sub.i, and survival in ECM-detached cells cultured on non-adherent (poly-HEMA-coated) plates. Flow cytometry analysis with the H.sub.2O.sub.2-specific probe peroxy green-1 showed that detachment induced a significant increase in [H.sub.2O.sub.2].sub.i (
Example 4: Breast Cancer-Associated TRPA1 Mutations Affect TRPA1-Mediated Redox Adaptation in an Activity-Dependent Manner
(201) To investigate whether the ability of TRPA1 to promote redox adaptation is dependent on its Ca.sup.2+ channel activity and to evaluate the functional activity of TRPA1 mutations associated with breast cancer, we analyzed seven TRPA1 missense mutations that were identified in breast tumors by TCGA. Most of the mutations either reduced or failed to affect Ca.sup.2+ responses of TRPA1 to H.sub.2O.sub.2 (
(202) We next examined whether the activity of the TRPA1 mutant variants affected their ability to protect cells from cell death induced by H.sub.2O.sub.2 or matrix detachment. The ability of the TRPA1 mutants to promote cell viability in response to H.sub.2O.sub.2 mirrored their observed Ca.sup.2+ responses elicited by this treatment, with those mutants with impaired activity showing reduced cell viability, and only E681K, the lone mutant with enhanced activity, showing improved cell viability compared to wild-type TRPA1 (
Example 5: TRPA1 Expression in MCF-10A Acini Elevates [Ca.SUP.2+.].SUB.i .in the Inner ECM-Deprived Cells and Promotes Their Viability in Response to ROS
(203) To extend our analysis to a model with more physiological relevance, we investigated the impact of TRPA1 expression on [Ca.sup.2+].sub.i and cell viability in MCF-10A three-dimensional (3D) acini cultured with reconstituted basement membrane (Matrigel), a well-suited model to examine putative regulators and effectors of oxidative stress because centrally localized cells that lack ECM attachment accumulate ROS which contribute to the induction of cell death, mimicking the developing mammary gland. To assess the level of [H.sub.2O.sub.2].sub.i in the inner ECM-deprived cells of MCF-10A acini, we used the genetically-encoded ratiometric H.sub.2O.sub.2 probe Hyper-2. Hyper-2 showed increased signal in the inner ECM-deprived cells of MCF-10A acini (
(204) To understand the implications of TRPA1-dependent [Ca.sup.2+].sub.i rises with regard to cell viability in the MCF-10A 3D model, we examined the effects of TRPA1 expression on apoptosis and proliferation of the inner ECM-deprived cells. TRPA1 expression prominently suppressed apoptosis (marked by cleaved caspase-3 staining) and enhanced proliferation (marked by Ki67 staining) of the cells localized in the inner region of the MCF-10A acini, indicating that TRPA1 promotes anchorage-independent survival (
(205) The evidence that TRPA1 expression can promote anchorage-independent survival raises the question of whether it could promote the transforming activity of mammary epithelial cells. To examine this, we assayed anchorage-independent colony formation in soft agar. As reported previously, MCF-10A cells require the expression of oncogenes to form colonies in soft agar even in the presence of the antioxidant Trolox (a water-soluble vitamin E derivative). Therefore, we investigated the effects of TRPA1 on the colony forming ability of MCF-10A cells expressing HER2, which exhibit relatively weak activity in this assay. Trolox treatment strongly increased both colony number and size (
Example 6: TRPA1 Confers Anchorage-Independent Survival on Breast Cancer Cells
(206) We next examined the impact of shRNA-mediated TRPA1 knockdown (
(207) In 3D culture, HCC1569 cells formed filled spheroid structures that, even after days in culture, never developed a hollow lumen. Nevertheless, Hyper-2 analysis revealed that [H.sub.2O.sub.2].sub.i was substantially increased in the inner region of these spheroids and this increase was unaffected by either TRPA1 knockdown, AP-18, or A-967079, but was abolished by NAC (
Example 7: TRPA1 Confers Therapy Resistance on Breast and Lung Cancer and MPNST Cells
(208) We investigated the effects of TRPA1 expression on carboplatin sensitivity. In HCC1569 cell treated with carboplatin, TRPA1 knockdown or treatment with either AP-18 or A-967079 significantly suppressed both [Ca.sup.2+].sub.i rises and oscillatory Ca.sup.2+ responses (
(209) In addition to breast cancer cell lines, we also examined the effects of TRPA1 in lung cancer and malignant peripheral nerve sheath tumor (MPNST) cells, as TRPA1 is upregulated in non-small cell lung cancers (NSCLCs), including adenocarcinomas (ADC), squamous cell carcinoma (SCC), and large cell carcinoma (LCC), and is highly upregulated in MPNST (
(210) Given the fact that many standard-of-care therapies induce high levels of oxidative stress that causes apoptosis, we investigated whether other ROS-associated chemotherapies, such as gemcitabine, doxorubicin, and 5-Fluorouracil (5-FU), induce TRPA1 activation and whether this activation allows breast cancer cells to adapt to chemotherapy. TRPA1 knockdown significantly suppressed both [Ca.sup.2+].sub.i rises and oscillatory Ca.sup.2+ responses induced by gemcitabine and doxorubicin, but not by 5-FU, in HCC1569 cells (
Example 8: TRPA1 Regulates Tumor Growth and Chemoresistance in a Breast Xenograft Tumor Model
(211) To investigate whether TRPA1 contributes to tumor growth and chemoresistance in vivo, HCC1569 cells stably expressing TRPA1 shRNAs were transplanted into cleared mammary fat pads of immunocompromised NOD-Rag1.sup.null IL2rg.sup.null (NRG) mice and tumor growth was measured. TRPA1 knockdown substantially suppressed tumor growth (compare vehicle controls,
(212) We next examined the effect of pharmacological TRPA1 inhibition on tumor growth in a PDX model. While numerous types of TRPA1 inhibitors have been developed as novel pain and respiratory therapies, their pharmacokinetics are not optimal. We used an oral bioactive TRPA1 inhibitor, AM-0902, which has the best pharmacokinetics reported to date, but still exhibits a short plasma half-life (T.sub.1/2=2.8 h). Despite this limitation, oral administration of AM-0902 twice daily reduced both tumor volume and mass in EL-12-58 xenograft models without significant side toxicities (0.188±2.42% weight loss at day 32) (
Example 9: TRPA1 Expression in Tumor Cells is Regulated by the ROS-Activated Transcription Factor, NRF2
(213) We next asked whether cancer cells upregulate TRPA1 expression in response to oxidative stress as an oxidative-stress defense program. In breast cancer BT-549 and lung cancer H358 cells, which exhibited low TRPA1 expression, H.sub.2O.sub.2 treatment increased TRPA1 expression substantially in serum-starved conditions (0.1% FBS) (
(214) Mutations or deletions in NFE2L2 (encoding NRF2), KEAP1 (encoding a negative regulator of NRF2), or CUL3 (encoding another negative regulator of NRF2), which lead to a constitutive activation of NRF2, are frequently observed in lung squamous carcinoma (32.8%) and adenocarcinoma (22.6%) and head-neck squamous carcinoma (14.3%), but rarely occur in breast carcinoma (1.8%). Notably, in lung and head-neck squamous carcinoma, TRPA1 expression was highly upregulated in tumors harboring NFE2L2 or KEAP1 mutations (
(215) To address whether enhanced expression of TRPA1 in lung cancer cell lines is due to constitutive activation of NRF2, we examined the effect of NRF2 knockdown on TRPA1 expression. NRF2 knockdown strongly suppressed expression of TRPA1 as well as NQO1, a known NRF2 target gene, in lung cancer H1792, H647 and A549 cells, but not in breast cancer HCC1569 cells (
(216) Based on chromatin immunoprecipitation-coupled deep sequencing (ChIP-Seq) dataset provided by Cistrome (cistrome.org), there are three putative NRF2 binding sites (Peak1, Peak2, and Peak3), which overlap with H3K27Ac, H3K4me1, and H3K4me2 signals (markers of promoter and enhancer regions), around the TRPA1 locus (
(217) Finally, to explore how much of the ability to adapt to oxidative stress is contributed by TRPA1-dependent and TRPA1-independent programs, we investigated the effect of inhibition of TRPA1, NRF2, or both on cell survival in breast cancer HCC1569 and lung cancer H1792 and H647 cells, where TRPA1 expression was not affected by H.sub.2O.sub.2 (
Other Embodiments
(218) Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, the descriptions and examples should not be construed as limiting the scope of the invention. The disclosures of all patents, patent applications, scientific references, and GenBank Accession Nos. cited herein are expressly incorporated by reference in their entirety for all purposes as if each patent, patent application, scientific reference, and GenBank Accession No. were specifically and individually incorporated by reference.