Biomarkers for Cervical Cancer

Abstract

The invention relates to methods, reagents and kits for detecting the susceptibility to cervical cancer. In particular, it relates to novel methylation markers to improve screening for cervical intraepithelial neoplasia grade 2/3 (CIN2/3) and the use thereof for identifying a cervical cell as neoplastic or predisposed to neoplasia in an isolated sample.

Claims

1. A method of identifying a cervical cell as neoplastic or predisposed to neoplasia in an isolated sample, comprising determining the methylation status of at least two marker genes selected from the group consisting of KCNIP4, GATA4, GFRA1, ST6GALNAC5, CDH6, ZSCAN1, ANKRD18CP and LHX8.

2. The method according to claim 1, comprising determining whether said marker genes are hypermethylated.

3. The method according to claim 1 or 2, comprising determining the methylation status of at least three, preferably at least four, more preferably at least five marker genes selected from the group consisting of KCNIP4, GATA4, GFRA1, ST6GALNAC5, CDH6, ZSCAN1, ANKRD18CP and LHX8.

4. The method according to any one of claims 1 to 3, comprising determining the methylation status of at least KCNIP4, ST6GALNAC5 and/or ZSCAN1.

5. The method according to any one of the preceding claims, comprising determining the methylation status of at least one of CDH6, GATA4 and LHX8.

6. The method according to any one of the preceding claims, comprising determining the methylation status of KCNIP4, GATA4, GFRA1, ST6GALNAC5, CDH6, ZSCAN1, ANKRD18CP and LHX8.

7. The method according to any one of the preceding claims, wherein the panel of marker genes also comprises at least one of JAM3, EPB41L3 and C13ORF18.

8. The method according to claim 7, comprising determining the methylation status of the genes of at least one of the following panels of marker genes: ANKRD18CP/CDH6/EPB41L3; GFRA1/EPB41L3/CDH6; GFRA1/ANKRD18CP/CDH6; ANKRD18CP/CDH6; GFRA1/EPB41L3/ANKRD18CP; JAM3/GFRA1/ANKRD18CP; GFRA1/CDH6; and GFRA1/ANKRD18CP.

9. A method of identifying a cervical cell as neoplastic or predisposed to neoplasia in an isolated sample, comprising determining the methylation status of a panel of at least two marker genes, wherein the at least first marker gene is selected from the group consisting of KCNIP4, GFRA1, ST6GALNAC5, CDH6, ZSCAN1, ANKRD18CP and LHX8, and wherein the at least second marker gene is selected from JAM3, EPB41L3 and C13ORF18, preferably wherein the marker gene panel comprises at least one of the following combinations of marker genes: JAM3/CDH6; ANKRD18CP/CDH6/EPB41L3; GFRA1/EPB41L3/CDH6; CDH6/EPB41L3; JAM3/EPB41L3/ANKRD18CP; C13ORF18/JAM3/ANKRD18CP; GFRA1/EPB41L3/ANKRD18CP; ANKRD18CP/EPB41L3; C13ORF18/CDH6; JAM3/GFRA1/ANKRD18CP; GFRA1/CDH6; JAM3/ANKRD18CP; JAM3/EPB41L3/GFRA1; GFRA1/EPB41L3; C13ORF18/JAM3/GFRA1; JAM3/GFRA1; and C13ORF18/ANKRD18CP.

10. The method according to any one of the preceding claims, wherein the method allows detection of CIN2 or higher (CIN2+) cervical cancer with a sensitivity and/or a specificity of at least 65%, preferably at least 70%.

11. The method according to any one of claims 1 to 10, wherein the methylation status of the gene(s) is determined using methylation specific PCR (MSP), preferably quantitative methylation specific PCR (QMSP).

12. The method according to any one of claims 1 to 11, wherein the methylation status is determined using a set of primers comprising or consisting of a sequence selected from entries 1-16 of Table 1A and/or a probe comprising or consisting of a sequence selected from entries 17-24 of Table 1B.

13. The method according to any of the preceding claims wherein the sample is a cervical scraping, preferably a self-collected vaginal swap, or wherein the sample is a liquid based cytology sample.

14. A kit for use in identifying a cervical cell as neoplastic or predisposed to neoplasia, preferably cervical neoplasia (CIN2/3), in an isolated sample, the kit comprising: gene specific primers for at least two marker genes selected from the group consisting of KCNIP4, GATA4, GFRA1, ST6GALNAC5, CDH6, ZSCAN1, ANKRD18CP and LHX8; gene specific probes for said at least two marker genes; optionally an Ayre's spatula and/or an endocervical brush for removing cervical cells from a subject.

15. A kit for use in identifying a cervical cell as neoplastic or predisposed to neoplasia, preferably cervical neoplasia (CIN2/3), in an isolated sample, the kit comprising: gene specific primers for of at least two marker genes, wherein the at least first marker gene is selected from the group consisting of KCNIP4, GFRA1, ST6GALNAC5, CDH6, ZSCAN1, ANKRD18CP and LHX8, and wherein the at least second marker gene is selected from JAM3, EPB41L3 and C13ORF18, gene specific probes for said at least two marker genes; optionally an Ayre's spatula and/or an endocervical brush for removing cervical cells from a subject.

16. The kit according to claim 15, comprising gene specific primers for at least one of the following combinations of marker genes: JAM3/CDH6; ANKRD18CP/CDH6/EPB41L3; GFRA1/EPB41L3/CDH6; CDH6/EPB41L3; JAM3/EPB41L3/ANKRD18CP; C13ORF18/JAM3/ANKRD18CP; GFRA1/EPB41L3/ANKRD18CP; ANKRD18CP/EPB41L3; C13ORF18/CDH6; JAM3/GFRA1/ANKRD18CP; GFRA1/CDH6; JAM3/ANKRD18CP; JAM3/EPB41L3/GFRA1; GFRA1/EPB41L3; C13ORF18/JAM3/GFRA1; JAM3/GFRA1; and C13ORF18/ANKRD18CP.

17. The kit according to any one of claims 14-16, comprising at least one gene specific primer comprising or consisting of a sequence selected from entries 1-16 of Table 1A.

18. The kit according to any one of claims 14 to 17, comprising at least one gene specific probe comprising or consisting of a sequence selected from entries 17-24 of Table 1B.

19. The kit according to any one of claims 14-18, additionally comprising gene specific reagents for further gene(s) whose methylation status is linked to the incidence of cervical cancer, preferably wherein said further gene(s) comprise JAM3, EPB41L3 and/or C13ORF18.

20. A method for cervical cancer detection or screening comprising the steps of: a) performing cytology evaluation on a test sample comprising cervical cells or nucleic acids from cervical cells; b) if a) is positive, assaying the methylation status of at least two genes selected from the group consisting of KCNIP4, GATA4, GFRA1, ST6GALNAC5, CDH6, ZSCAN1, ANKRD18CP and LHX8.; c) if the at least two genes of b) are methylated, refer the woman for colposcopy; d) if the at least two genes of b) are unmethylated, refer the woman to cytology testing on a more regular basis.

21. A method for cervical cancer detection or screening comprising the steps of: a) assaying the methylation status of at least two genes selected from the group consisting of KCNIP4, GATA4, GFRA1, ST6GALNAC5, CDH6, ZSCAN1, ANKRD18CP and LHX8.; b) if the at least two genes of a) are methylated, perform cytology testing; c) if b) is tested positive, refer the woman for colposcopy; d) if b) is negative, refer the woman to follow-up after 6 month for HPV-testing.

Description

LEGENDS TO THE FIGURES

[0048] FIG. 1: Flow scheme of the strategy used for the identification of new CIN2+ methylation markers.

[0049] FIG. 2: Methylation ratio of 9 genes tested with QMSP in scrapings from normal (Nl) and cancer (Ca) patients. Relative levels of methylation is significantly higher in the cancer scrapings (all genes, except PAX2, p<0.001).

[0050] FIG. 3: ROC curve analyses of methylation ratio's per gene.

[0051] FIG. 4: Methylation ratio of each of 8 novel marker genes tested with QMSP in scrapings from patients with CIN0, CIN1, CIN2, CIN3 and (mi)Ca. Relative levels of methylation significantly increase with more severe histological abnormality (all p<0.001).

EXPERIMENTAL SECTION

Patients and Methods

General Strategy

[0052] To characterize the DNA methylome of CIN2/3 lesions and to identify new CIN2 or higher (CIN2+) methylation markers, we applied the following strategy (see FIG. 1): First, methylated DNA was enriched using MBD of human MECP2 with subsequent paired-end sequencing (MethylCap-seq) on DNA isolated from fresh-frozen macro-dissected epithelial tissue of 18 CIN2/3 lesions (6 CIN2 and 12 CIN3), 20 normal cervices and two pools of leukocyte DNA of healthy volunteers. In order to identify differential methylated regions (DMRs), we retrieved the reads of promoter and exon regions. We selected methylation markers that showed significant differences between the normal and CIN2/3 cervices, while also the leukocyte count had to be low, to prevent false-positive results. Markers were ranked on high specificity (no methylation in the normal cervices) and high sensitivity (methylation in CIN2/3 lesions). For the highest ranking top15 genes, methylation specific PCR (MSP) primers were designed and methylation patterns were verified on the same DNA, which originally was used for MethylCap-seq. This first validation step enabled verification of MethylCap-seq data by correlating MSP band intensity with the number of reads from the MethylCap-seq. In the second validation step high prevalence of methylation in the CIN2/3 lesions and no methylation in the normal cervices was analyzed by MSP analysis on DNA isolated from a completely independent cohort of patients (cervical cancer (n=13), CIN2/3 lesions (n=19) and normal cervices (n=17)). DNA was isolated from macro-dissected formalin fixed paraffin embedded (FFPE) epithelial tissue.

[0053] Finally, diagnostic evaluation of the newly discovered methylation markers was performed by QMSP on cervical scrapings. First, we tested the methylation ratios of new biomarkers on a large series of randomly selected scrapings from cervical cancer patients (n=100) and a similar age group of healthy controls (n=89). Secondly, the potential of the new methylation markers as a diagnostic tool was evaluated in a large series of scrapings (n=215) of randomly selected patients, referred with an abnormal Pap smear at population-based screening. Histology was used as the reference standard.

Patient Samples

[0054] All patients referred to the outpatient clinic of the University Medical Center Groningen (UMCG) with cervical cancer or an abnormal Pap smear at population-based screening are routinely asked to participate in our ongoing ‘Methylation study’ which has been approved by the Institutional Review Board (IRB) of the UMCG. Cervical tissue, scrapings and clinicopathologic data are prospectively collected and stored in our tissue bank. Within our Methylation study tissue samples, scrapings and clinicopathologic data from normal cervices are also collected from patients planned to undergo a hysterectomy for non-malignant reasons. All cervical tissue that was used for the normal control group was judged as histopathological normal. Patients referred with cervical cancer are staged according to the FIGO criteria with pelvic examination and biopsies under general anaesthesia. Cervical scrapings from both groups (cervical cancer staging and benign gynecologic surgery) were collected before surgery under general anaesthesia. All patients referred with an abnormal Pap smear at population-based screening underwent an additional Pap smear prior to colposcopy specifically for this study. At colposcopy, biopsies and/or Large Loop Excision of the Transformation Zone (LLETZ) were performed. The tissue samples were scored by an experienced gynaecologic pathologist and the histological classification was used as the reference standard. If no interference with routine diagnostic evaluation was anticipated, specimens from the CIN lesions were retrieved and stored at −80° C. Clinicopathological data were retrieved from patient files and stored in our large anonymous password-protected institutional Gynecologic Oncology database. All patients gave written informed consent.

[0055] For the frozen tissue samples used in de MethylCap-seq analysis, the median age of the CIN2/3 patients was 35 years (IQR 30-39) and for the patients with normal cervices 43 years (IQR 41-44). For the independent cohort of patients with FFPE samples, the median age of the CIN2/3 patients was 37 years (IQR 34-41), for the patients with normal cervices 43 years (IQR 40-44) and for the cervical cancer patients 49 years (range 42-54). For the cervical scrapings the median age of cervical cancer patients was 50 years (IQR 39-64) and for the patients with normal cervices 47 years (IQR 43-53). The stage of cervical cancer patients was: 1 (1%) FIGO stage IA1, 31 (31%) FIGO stage IB1, 18 (18%) FIGO stage IB2, 21 (21%) FIGO stage IIA, 17 (17%) FIGO stage IIB, 1 (1%) FIGO stage IIIA, 8 (8%) FIGO stage IIIB and 3 (3%) FIGO stage IV. Histological classification of the cervical cancer patients was: 70 (70%) squamous cell carcinoma (SCC), 21 (21%) adenocarcinoma (AD), 3 (3%) adenosquamous (ASC) and 6 (6%) undifferentiated carcinoma. The median age of the patients referred with an abnormal Pap smear was 37 years (IQR 32-43). The histological classifications of these patients were: 27 without CIN, 38 CIN1, 45 CIN2, 61 CIN3 and 44 miCa (29 SCC, 12 AD, 3 ASC). The Pap smears were classified according to the Papanicolaou system. Table 4 shows per histological subgroup, the Pap classification (and translation to Bethesda).

[0056] From all frozen tissue samples used for MethylCap-seq and the FFPE samples, 10 μm tissue sections were cut and macrodissection was performed to enrich for epithelial cells. Before and after cutting a hematoxylin and eosin slide was made to check presence of epithelial cells. Cervical scrapings were collected in 5 ml ice-cold phosphate buffered saline (PBS: 6.4 mM NA.sub.2HPO.sub.4; 1.5 mM KH.sub.2PO.sub.4; 0.14 M NaCl; 2.7 mM KCl) and kept on ice until further processing. Of these 5 ml cell suspension, 1 ml was used for cytomorphological assessment. The remaining 4 ml was centrifuged and the cell pellet was suspended in 1 ml TRAP wash buffer and divided in 4 fractions. Two fractions were stored as dry pellet at −80° C. for DNA isolation as described previously.sup.21.

DNA Isolation

[0057] Tissue slides from FFPE tissue were deparaffinized using 100% xylene followed by 100% ethanol.sup.17. Genomic DNA from fresh-frozen macro-dissected samples and cervical scrapings was isolated by standard overnight 1% SDS and Proteinase K treatment, salt-chloroform extraction and isopropanol precipitation as described previously.sup.21. DNA pellets were washed with 70% ethanol and dissolved in 150 μl TE.sup.−4 (10 mM Tris/HCL; 0.1 mM EDTA, pH 8.0). Genomic DNA was amplified in a multiplex PCR according to the BIOMED-2 protocol, to check the DNA's structural integrity.sup.27. For the MethylCap-seq samples, DNA quantity was measured using Quant-iT™ PicoGreen® dsDNA Assay Kit according to manufacturer's protocol (Invitrogen, Carlsbad, Calif., USA). For cervical scrapings DNA concentrations and 260/280 ratios were measured using the Nanodrop ND-1000 Spectrophotometer (Thermo Scientific, Waltham, Mass., USA). A 260/280 ratio of >1.8 was required for all samples.

Methylated-CpG Island DNA Capturing Followed by Next-Generation Sequencing (MethylCap-Seq)

[0058] Methylated DNA fragments were captured with methyl-binding domains using the MethylCap kit according to manufacturers instructions (Diagenode, Liege, Belgium). The kit consists of the methyl binding domain (MBD) of human MeCP2, as a C-terminal fusion with Glutathione-S-transferase (GST) containing an N-terminal His6-tag. Before capturing, DNA samples (500 ng) were sheared to a size range of 300-1000 bps using a Bioruptor™ UCD-200 (Diagenode, Liege, Belgium) and fragments of ˜300 bp were isolated. Leukocyte DNA of 4 healthy controls were included in 2 sets of 2 samples. Captured DNA was paired-end-sequenced on the Illumina Genome Analyzer II platform according to protocol (Illumina, San Diego, Calif., USA). Results were mapped on the nucleotide sequence using Bowtie software.sup.28, visualized using BioBix' 112G2 browser (http://h2g2.ugent.be/) and processed using the human reference genome (NCBI build 37). The paired-end fragments were unique and located within 400 bp of each other.sup.29.

MethylCap-Sequencing Analysis

[0059] For statistical analysis, reads of promoter (−2000 bp—to +500 bp of transcription start site) and exon regions were retrieved. In order to identify differences between normal cervices and CIN2/3 lesions, we dichotomised the read data into methylation positive or negative. Samples were considered negative if a sample showed either 0 or 1 read. Samples were considered methylation positive if a sample showed ≧3 reads. Subsequently, regions were ranked based on highest specificity and highest sensitivity for CIN2/3. The candidate markers should fulfil the following criteria: 1) Low/negative reads in the leukocytes to prevent false positive results. The region was excluded if both leukocyte samples showed >1 read or if 1 leukocyte sample showed >2 reads. 2) Unmethylated (0 or 1 read) in at least 75% (15/20) of the normal cervix group. 3) Methylated (>3 reads) in at least 28% (5/18) of the CIN2/3 lesion group.

Verification and Validation of MethylCap-Sequencing Data by Methylation Specific PCR (MSP)

[0060] MSP primers were designed for the highest ranking top 15 genes (16 DMRs). Sodium bisulfite treatment of isolated genomic DNA (1 μg/sample) was performed according to the recommendations of the EZ DNA methylation kit (Zymo, BaseClear, Leiden, the Netherlands). MSP design and analysis was performed using sequences derived from the H2G2 browser. Each reaction was performed in 30 μl total reaction volume, containing: 600 nM of each MSP primer, 1.5 μl of bisulphite treated DNA (approximately 15 ng), standard PCR components (Applied Biosystems) and 0.5 U AmpliTaq Gold DNA polymerase (Applied Biosystems). Condition of the MSP was: 10 min hot-start at 95° C.; 95° C. for 60 sec, 60° C. for 60 sec, 72° C. 60 sec for a total of 40 cycles, with a final elongation step of 7 min at 72° C. Leukocyte DNA from healthy women was used as negative control and in vitro methylated (by SssI enzyme) leukocyte DNA was used as positive control for each MSP.

Quantitative Methylation Specific PCR (QMSP)

[0061] QMSP was performed as described previously by our group with an internal (FAM-ZEN/IBFQ)-labelled hybridisation probe for quantitative analyses.sup.21. Primer and probe sequences are summarized in Table 1. β-actin was used as a methylation independent internal reference gene.

TABLE-US-00001 TABLE 1A Primer and probe sequences used in Quantitative Methylation Specific PCR (QMSP) Gene Forward primer 5′.fwdarw.3′ Reverse primer 5′.fwdarw.3′ ZSCAN1 TTGTTGGTATTCGTTTGTTC (entry 1) ACGCGACCGAACGATATT (entry 2) ST6GALNAC5 GTAGTTGCGGATGGAGGTTC (entry 3) CTAACTACGCTCACCCTCCG (entry 4) ANKRD18CP CGATGTGGTATTTTCGATTC (entry 5) ACGTCTAAAAAATCGCCAC (entry 6) CDH6 GGGCGGCGTTGTTGTC (entry 7) CCAACCCCACGACGAATC (entry 8) GFRA1 TAGGGGGAATCGATGTTTC (entry 9) GAATCCTAAACACCGAACGA (entry 10) GATA4 GGTCGGGTTAATTCGGTC (entry 11) CCTCGACAAAACTCAAAACG (entry 12) KCNIP4 GGGACGTAGGGTGTAGAAGC (entry 13) AAACTCTCGCTCCCAACG (entry 14) LHX8 TATTTTTTTCGTAGCGGATC (entry 15) ACGAAAAACCAAATTCTACG (entry 16)

TABLE-US-00002 TABLE 1B Probe sequences used in Quantitative Methylation Specific PCR (QMSP) Gene 6FAM/ZEN/IBFQ probe 5′.fwdarw.3′ ZSCAN1 AGGTCGAAGTTTTTTTACGTATTTTTATTGTTCGT  TTA (entry 17) ST6GALNAC5 TTGAAGTTTCGGGTTTGGTCGTCGAGTC  (entry 18) ANKRD18CP AGGAGCGTTTGGTTTAGGCGTTTTTCG  (entry 19) CDH6 CGTTTTTCGGGGAGTTTGGGTATCGTTTTTTCG  (entry 20) GFRA1 TTTATTCGTCGCGCGTTTTCGG  (entry 21) GATA4 ATTTCGGTGAGTAGGAGCGCGAG  (entry 22) KCNIP4 TCGGTTAGGGGCGTTTGTTTACGGGTTTGTACGG  (entry 23) LHX8 ATTGGCGTTTTGCGAATCGG  (entry 24)

[0062] QMSP reactions were performed in 10 μl final volume, containing: 300 nM of forward and reverse primers, 250 nM of hybridisation probe, 5 μl of 2*QuantiTech Probe PCR Master Mix (Qiagen Hilden, Germany) and 2.5 μl bisulfite modified DNA (approximately 25 ng). Each sample was analyzed in triplicate by ABI PRISM® 7900HT Sequence Detection System (Applied Biosystems). Negative and positive controls were the same as used for MSP. Standard curve analysis was performed on each plate and by each primers-probe set on serial dilutions of in vitro methylated leukocyte DNA. A DNA sample was considered methylated if at least 2 out of the 3 wells were methylation positive with a Ct-value below 50 and DNA input of at least 225 pg β-actin. The relative level of methylation of the region of interest was determined by the following calculation: the average quantity of the methylated region of interest divided by the average quantity of the reference β-Actin gene and multiplied by 10000.sup.30. In our analysis we also included 4 genes previously described by our group (C13ORF18, JAM3, EPB41L3 and TERT) to compare sensitivity and specificity of these known genes with the newly identified methylation markers. QMSP for these markers was performed as previously described.sup.21.

HPV Testing

[0063] HrHPV testing was performed using general primer-mediated PCR (GP5+/6+) as reported previously.sup.30. For HPV-typing as well as detection of the clinical relevant HPV infections, GP5+/6+ positive cases were tested by COBAS® 4800 HPV test. The COBAS HPV test individually detects HPV 16 and 18, while at the same time identifying 12 additional hrHPV types .sup.31. The COBAS HPV test is routinely used in our iso-15189-certified laboratory of molecular pathology on scrapings from the national population-based screening program. For the COBAS® HPV testing in this study, the PCR only workflow was used, since no liquid-based scrapings in Preservcyt® were available but only already isolated DNA. This workflow was first validated with DNA isolated from clinical samples that were tested previously in the diagnostic routine and this showed comparable results to the liquid-based samples.

Statistical Analysis

[0064] Statistical analysis was performed using SPSS software package (SPSS 20, Chicago, Ill., USA). Spearman's rank correlation coefficient was used to compare the MethylCap-seq reads with the MSP band intensity. Categorical methylation data were analyzed using the Pearson χ.sup.2 test. Receiver operating characteristic (ROC) curves were generated and the area under the ROC curve (AUC) was used as a measure of test performance. The Mann-Whitney U test and Kruskall-Wallis test was used to determine differences in methylation ratio in 2 groups or more, respectively. The student T test was used to compare positive methylation and age. To compare sensitivity and specificity of the patient group referred with abnormal cytology by DNA methylation markers versus hrHPV, the extended McNemar test, described by Hawass was executed.sup.32. P-values lower than 0.05 were considered statistically significant.

Results

Identification of Differential Methylated Genes by MethylCap Sequencing

[0065] Genome-wide MethylCap-seq was used to compare the DNA methylation profiles of CIN2/3 dysplastic cervical cells with normal cervical cells to identify CIN2/3 specific DMRs. After applying our criteria, 176 DMRs comprising 163 genes remained (data not shown).

Verification and Validation of the Top 15 Differentially Methylated Genes

[0066] To verify the MethylCap-seq data, the top 15, out of the 163 identified genes were selected. MSP primers were designed and could be optimized for 14 out of the 15 genes. Verification of the selected 14 genes showed for 11 genes a significant correlation between the MSP band intensity and the amount of reads from the MethylCap-seq data. One gene (PCDH17) showed high methylation levels in leukocytes and was therefore excluded for further validation. The remaining 10 genes passed verification and continued to the subsequent validation step. Table 2 shows an overview of which genes continued through the different stages of validation.

TABLE-US-00003 TABLE 2 Verification, validation and diagnostic evaluation of the highest ranking top 15 genes. Op- Veri- Vali- 1.sup.st 2.sup.nd ti- fica- da- diagnostic diagnostic Rank Gene mized tion tion evaluation evaluation 1 ZSCAN1 Yes Yes Yes Yes Yes 2 PCDH17 Yes No* 3 ST6GALNAC5 Yes Yes Yes Yes Yes 4 CLIC6 Yes No 5 AC01234.1 Yes No 6 ANKRD18CP Yes Yes Yes Yes Yes 7 PAX2** Yes Yes Yes No 8 CDH6 Yes Yes Yes Yes Yes 9 GFRA1 Yes Yes Yes Yes Yes 10 IRX1 Yes No 11 POU4F3 Yes Yes No* 12 GATA4 Yes Yes Yes Yes Yes 13 MKX No 14 PAX2** Yes No 15 KCNIP4 Yes Yes Yes Yes Yes 16 LHX8 Yes Yes Yes Yes Yes *Excluded due to high methylation in leukocytes **Same gene, different region

[0067] The second validation step was performed by MSP on DNA from FFPE tissue of an independent, randomly selected new patient cohort that consisted of 13 cervical cancers, 19 HSIL lesions (8 CIN2, 8 CIN3 and 3 adCIS) and 17 normal cervices. Out of the 10 genes analyzed, 9 showed low methylation levels in the normal samples, significant differential methylation between normal versus HSIL lesions and again little to no methylation in the leukocytes (p<0.05) (Table 3). These 9 genes (ZSCAN1, ST6GALNAC5, ANKRD18CP, PAX2, CDH6, GFRA1, GATA4, KCNIP4 and LHX8) were selected for further diagnostic evaluation in cervical scrapings (Table 3).

TABLE-US-00004 TABLE 3 Methylation positivity in an external cohort of FFPE samples to validate results of high methylation in CIN2+ lesions and no methylation in normal cervices of the newly found methylation markers. Gene Normal CIN2 CIN3 adCIS carcinoma ZSCAN1 4/16 8/8 7/8 3/3 12/10 ST6GALNAC5 0/16 1/6 4/8 2/3  9/12 ANKRD18CP 0/16 1/8 1/7 2/3  6/12 PAX2 1/14 6/8 7/8 3/3  5/13 CDH6 1/15 3/8 4/8 3/3  7/13 GFRA1 0/12 2/8 3/8 2/3 10/12 POU4F3* 2/14 6/7 3/7 3/3 11/12 GATA4 0/17 3/8 2/7 3/3 10/13 KCNIP4 0/17 6/8 5/8 3/3 10/12 LHX8 1/16 3/8 4/8 3/3  7/13 *Excluded due to high methylation in leukocytes

Diagnostic Evaluation by QMSP for Normal Versus Cancer Scrapings

[0068] To evaluate the diagnostic value of the new methylation markers, cervical scrapings from two cohorts of patients were used: 1) normal versus carcinoma scrapings and 2) scrapings from patients referred from population-based screening with an abnormal Pap smear (≧Pap2). In cohort 1, scrapings of 100 randomly selected cervical carcinoma patients and 89 patients with histologically confirmed normal cervices were used. QMSP analysis showed that the relative levels of DNA methylation were higher in the carcinoma scrapings compared to the normal scrapings for 8 out of the 9 selected genes (p<0.001) (FIG. 2). The area under the curve (AUC) for methylation ratio in cervical carcinoma showed for 8 genes an AUC>0.91, and for one gene (PAX2) an AUC of 0.59. Therefore PAX2 was excluded from further analysis (FIG. 3). In women with a normal cervix, methylation positivity for all 9 genes was not related to age (data not shown).

Diagnostic Evaluation by QMSP for Normal/LSIL Versus HSIL Scrapings

[0069] In cohort 2, scrapings of 215 consecutive patients referred from population-based screening with an abnormal Pap smear were used. The 8 genes that showed differential methylation in the normal versus the cancer scrapings were subsequently tested in cohort 2. Methylation levels and frequencies for all 8 genes analyzed (ZSCAN1, ST6GALNAC5, ANKRD18CP, CDH6, GFRA1, GATA4, KCNIP4 and LHX8), increased with the severity of the underlying histological lesion (p<0.001) (FIG. 4 and Table 4).

[0070] Without setting a cut-off value for achieving higher/lower sensitivity and/or specificity, genes ZSCAN1, ST6GALNAC5 and KCNIP4 reached high sensitivity (≧90%) for detection of CIN2+ lesions, while for CDH6, GATA4 and LHX8 sensitivity for CIN2+ was between 73-84% (Table 5a). For ANKRD18CP and GFRA1 sensitivity for CIN2+ was between 46-61%, and these genes showed especially high specificity (82%-92%). In our analysis, we also included a marker panel of 4 genes, previously described by our group (C13ORF18, JAM3, EPB41L3 and TERT) to compare sensitivity and specificity of these known genes with the newly identified methylation markers. The gene C13ORF18 showed reproducible results as described previously.sup.21 with high specificity (95%) and relatively low sensitivity for CIN2+ of 40%. JAM3 and EPB41L3 showed sensitivities for CIN2+ between 63-69% and specificities between 79-91%. The gene TERT was previously described with high specificity, but this result could not be reproduced since specificity was only 46% in our analysis, while sensitivity for CIN2+ lesions was 82%.

hrHPV Status and Triage Testing

[0071] HrHPV testing was performed on the patients group referred with abnormal cytology at population-based screening. For 6 out of 215 patients insufficient material was available to perform HPV testing. HrHPV was detected in 152/209 (73%) samples by the GP5+/6+ PCR and COBAS HPV test. Table 4 shows HPV status in relation to underlying histological diagnosis. HrHPV was present in 12/26 (46%) patients without CIN lesion, 24/36 (67%) CIN1 patients, 36/45 (80%) CIN2 patients, 49/59 (83%) CIN3 patients and 31/43 (72%) patients with miCa. The sensitivity of hrHPV testing for CIN2+ was 79% with a specificity of 42%.

[0072] For the genes CDH6, GATA4, and LHX8 sensitivity and specificity results were comparable to hrHPV testing with sensitivity for CIN2+ between 73-84% and specificity between 40-60% (Table 5A).

[0073] Table 5B shows sensitivity and specificity for CIN2+ and CIN3+ in scrapings of hrHPV positive women (n=152), which were comparable to the results for the whole group, as shown in Table 5a. The genes ZSCAN1, ST6GALNAC5 and KCNIP4 again showed high sensitivity (≧92%) for the detection of CIN2+, while for CDH6, GATA4, EPB41L3, TERT and ZSCAN16 sensitivity for CIN2+ was between 72-85%. For ANKRD18CP, JAM3, C13ORF18 and GFRA1 sensitivity for CIN2+ was between 43-68%, however these genes showed high specificity between 86-94%. In the current Dutch population based screening program, women with pap2/pap3a (ASCUS/LSIL) scrapings are retested after 6 months with triage testing by hrHPV. Therefore, we also show the results of triage testing by hrHPV and methylation markers in this group (Table 5B). Triage testing by hrHPV shows a sensitivity for CIN2+ of 82% with a specificity of 41%; GATA4, LHX8 and TERT show comparable results.

[0074] Different combinations of genes were analyzed to find the best methylation marker panel with the highest combined sensitivity and specificity. For this analysis a sample was considered positive if either of the genes in the combination tested was positive. By adding more than 3 genes in a combination specificity of the methylation test decreased, with minimal increase in sensitivity. The combinations of genes with the highest combined sensitivity and specificity for CIN2+ was JAM3/ANKRD18CP, C13ORF18/JAM3/ANKRD18CP and JAM3/GFRA1/ANKRD18CP with a sensitivity of 72%, 74% and 73%, which is comparable to hrHPV testing (79%). Specificity of both combinations was 71% and 76%, which is significantly higher than for hrHPV testing (42%) (p≦0.05). Table 6 shows that for all other combinations sensitivities for detecting CIN2+ lesions are between 64-80%, with a combined specificity between 58-88%.

TABLE-US-00005 TABLE 6 Combinations of different methylation markers to create a panel of genes most suited as test in scrapings ranked on highest sensitivity (n = 215). Sensi- Speci- Sensi- Speci- tivity ficity tivity ficity Gene combination CIN2+ CIN2+ CIN3+ CIN3+ JAM3/CDH6 80% 58% 85% 48% ANKRD18CP/CDH6/EPB41L3 80% 55% 87% 48% CDH6/EPB41L3 78% 57% 85% 50% GFRA1/EPB41L3/CDH6 78% 57% 85% 50% ANKRD18CP/CDH6 77% 57% 83% 49% GFRA1/ANKRD18CP/CDH6 77% 57% 83% 49% JAM3/EPB41L3/ANKRD18CP 76% 71% 84% 60% C13ORF18/JAM3/ANKRD18CP 74% 76% 80% 62% ANKRD18CP/EPB41L3 74% 74% 83% 64% GFRA1/EPB41L3/ANKRD18CP 74% 74% 84% 64% C13ORF18/CDH6 74% 58% 80% 51% JAM3/GFRA1/ANKRD18CP 73% 77% 80% 64% C13ORF18/JAM3/EPB41L3 73% 72% 83% 64% GFRA1/CDH6 73% 60% 80% 53% JAM3/ANKRD18CP 72% 79% 79% 65% JAM3/EPB41L3 72% 75% 83% 66% JAM3/EPB41L3/GFRA1 72% 76% 83% 66% GFRA1/EPB41L3 69% 79% 82% 71% C13ORF18/EPB41L3 69% 75% 81% 68% C13ORF18/JAM3/GFRA1 66% 82% 77% 72% JAM3/GFRA1 65% 86% 76% 75% C13ORF18/ANKRD18CP 65% 79% 72% 67% C13ORF18/JAM3 64% 88% 73% 76% GFRA1/ANKRD18CP 64% 81% 72% 69%

[0075] In the hrHPV positive scrapings, the sensitivities and specificities for CIN2+ of the 3 best-performing combinations (JAM3/ANKRD18CP, C13ORF18/JAM3/ANKRD18CP and JAM3/GFRA1/ANKRD18CP) were comparable (sensitivity: 76-77%; specificity: 81-83%) (Table 7) to the total population.

TABLE-US-00006 TABLE 7 Combinations of different methylation markers to create a panel of genes most suited as triage test in HPV positive scrapings ranked on highest sensitivity (n = 152). Sensi- Speci- Sensi- Speci- tivity ficity tivity ficity Gene combination CIN2+ CIN2+ CIN3+ CIN3+ JAM3/CDH6 80% 64% 88% 50% ANKRD18CP/CDH6/EPB41L3 79% 61% 89% 51% CDH6/EPB41L3 77% 61% 88% 53% GFRA1/EPB41L3/CDH6 78% 61% 88% 53% ANKRD18CP/CDH6 77% 61% 85% 51% GFRA1/ANKRD18CP/CDH6 77% 61% 85% 51% JAM3/EPB41L3/ANKRD18CP 78% 72% 88% 58% C13ORF18/JAM3/ANKRD18CP 77% 81% 85% 61% ANKRD18CP/EPB41L3 75% 75% 86% 63% GFRA1/EPB41L3/ANKRD18CP 75% 75% 86% 63% C13ORF18/CDH6 73% 61% 83% 54% JAM3/GFRA1/ANKRD18CP 76% 81% 85% 63% C13ORF18/JAM3/EPB41L3 76% 72% 86% 60% GFRA1/CDH6 72% 64% 83% 57% JAM3/ANKRD18CP 76% 83% 85% 64% JAM3/EPB41L3 75% 75% 86% 63% JAM3/EPB41L3/GFRA1 75% 75% 86% 63% GFRA1/EPB41L3 72% 78% 85% 68% C13ORF18/EPB41L3 72% 75% 85% 65% C13ORF18/JAM3/GFRA1 70% 86% 81% 71% JAM3/GFRA1 69% 89% 81% 74% C13ORF18/ANKRD18CP 68% 83% 76% 67% C13ORF18/JAM3 69% 92% 80% 74% GFRA1/ANKRD18CP 67% 83% 76% 68%

REFERENCES

[0076] 1. Peto J, Gilham C, Fletcher O, Matthews F E. Lancet. 2004; 364(9430):249-256.

[0077] 2. Arbyn M, Raifu A O, Weiderpass E, Bray F, Anttila A. Eur J Cancer. 2009; 45(15):2640-2648.

[0078] 3. Cuzick J, Clavel C, Petry K U, et al. Int J Cancer. 2006; 119(5):1095-1101.

[0079] 4. Mayrand M H, Duarte-Franco E, Rodrigues I, et al. N Engl J Med. 2007; 357(16):1579-1588.

[0080] 5. Cox J T, Castle P E, Behrens C M, et al. Am J Obstet Gynecol. 2013; 208(3):184.e1-184.e11.

[0081] 6. Walboomers J M, Jacobs M V, Manos M M, et al. J Pathol. 1999; 189(1):12-19.

[0082] 7. Ronco G, Dillner J, Elfstrom K M, et al. Lancet. 2013.

[0083] 8. Ronco G, Giorgi-Rossi P, Carozzi F, et al. Lancet Oncol. 2010; 11(3):249-257.

[0084] 9. Bulkmans N W, Berkhof J, Rozendaal L, et al. Lancet. 2007; 370(9601):1764-1772.

[0085] 10. Rijkaart D C, Berkhof J, Rozendaal L, et al. Lancet Oncol. 2012; 13(1):78-88.

[0086] 11. Arbyn M, Ronco G, Anttila A, et al. Vaccine. 2012; 30 Suppl 5:F88-99.

[0087] 12. Cuzick J, Arbyn M, Sankaranarayanan R, et al. Vaccine. 2008; 26 Suppl 10:K29-41.

[0088] 13. Kulasingam S L, Hughes J P, Kiviat N B, et al. JAMA. 2002; 288(14):1749-1757.

[0089] 14. Franco E L, Mahmud S M, Tota J, Ferenczy A, Coutlee F. Arch Med Res. 2009; 40(6):478-485.

[0090] 15. Baylin S B, Ohm J E. Nat Rev Cancer. 2006; 6(2):107-116.

[0091] 16. Steenbergen R D, Snijders P J, Heideman D A, Meijer C J. Nat Rev Cancer. 2014; 14(6):395-405.

[0092] 17. Yang N, Nijhuis E R, Volders H H, et al. Cell Oncol. 2010; 32(1-2):131-143.

[0093] 18. Bierkens M, Hesselink A T, Meijer C J, et al. Int J Cancer. 2013; 133(6):1293-1299.

[0094] 19. Hesselink A T, Heideman D A, Steenbergen R D, et al. Clin Cancer Res. 2011; 17(8):2459-2465.

[0095] 20. Lai H C, Lin Y W, Huang R L, et al. Cancer. 2010; 116(18):4266-4274.

[0096] 21. Eijsink J J, Lendvai A, Deregowski V, et al. Int J Cancer. 2012; 130(8):1861-1869.

[0097] 22. Yang N, Eijsink J J, Lendvai A, et al. Cancer Epidemiol Biomarkers Prev. 2009; 18(11):3000-3007.

[0098] 23. Reesink-Peters N, Wisman G B, Jeronimo C, et al. Mol Cancer Res. 2004; 2(5):289-295.

[0099] 24. Laird P W. Nat Rev Genet. 2010; 11(3):191-203.

[0100] 25. Lendvai A, Johannes F, Grimm C, et al. Epigenetics. 2012; 7(11):1268-1278.

[0101] 26. Rauch T A, Pfeifer G P. Methods. 2010; 52(3):213-217.

[0102] 27. van Dongen J J, Langerak A W, Bruggemann M, et al. Leukemia. 2003; 17(12):2257-2317.

[0103] 28. Langmead B, Trapnell C, Pop M, Salzberg S L. Genome Biol. 2009; 10(3):R25-2009-10-3-r25. Epub 2009 Mar. 4.

[0104] 29. De Meyer T, Mampaey E, Vlemmix M, et al. PLoS One. 2013; 8(3):e59068.

[0105] 30. Wisman G B, Nijhuis E R, Hoque M O, et al. Int J Cancer. 2006; 119(8):1908-1914.

[0106] 31. Cui M, Chan N, Liu M, et al. J Clin Microbiol. 2014; 52(6):2210-2211.

[0107] 32. Hawass N E. Br J Radiol. 1997; 70(832):360-366.

[0108] 33. Overmeer R M, Louwers J A, Meijer C J, et al. Int J Cancer. 2011; 7(6).

[0109] 34. Gok M, van Kemenade F J, Heideman D A, et al. Int J Cancer. 2012; 130(5):1128-1135.

[0110] 35. Carozzi F, Confortini M, Dalla Palma P, et al. Lancet Oncol. 2008; 9(10):937-945.

[0111] 36. Carozzi F, Gillio-Tos A, Confortini M, et al. Lancet Oncol. 2013; 14(2):168-176.

[0112] 37. Rijkaart D C, Berkhof J, van Kemenade F J, et al. Int J Cancer. 2012; 130(3):602-610.

[0113] 38. Brentnall A R, Vasiljevic N, Scibior-Bentkowska D, et al. Int J Cancer. 2014.

[0114] 39. Vasiljevic N, Scibior-Bentkowska D, Brentnall A R, Cuzick J, Lorincz A T. Gynecol Oncol. 2014; 132(3):709-714.

[0115] 40. Hansel A, Steinbach D, Greinke C, et al. PLoS One. 2014; 9(3):e91905.

[0116] 41. Verhoef V M, Bosgraaf R P, van Kemenade F J, et al. Lancet Oncol. 2014; 15(3):315-322.

[0117] 42. Sancisi V, Gandolfi G, Ragazzi M, et al. PLoS One. 2013; 8(9):e75489.

[0118] 43. Selamat S A, Chung B S, Girard L, et al. Genome Res. 2012; 22(7):1197-1211.