ANTI-PD-1 MONOCLONAL ANTIBODY AND OBTAINING METHOD THEREFOR

20170240644 · 2017-08-24

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention provides human monoclonal antibodies that specifically bind to PD-1 with high affinity. The anti-PD-1 monoclonal antibodies were screened from a synthetic antibody library, and affinity maturation was performed. The synthetic antibody libraries used to select for the high affinity anti-PD-1 monoclonal antibodies were made by replacing the light chain CDR1, CDR2 and CDR3 and heavy chain CDR1, CDR 2 and CDR 3 of phage libraries from the preliminary screening, and the high affinity anti-PD-1 monoclonal antibodies were selected. The human anti-PD-1 monoclonal antibodies have high affinity and inhibit the binding of PD-1 to its ligand PD-L1. The antibodies can be used for treating tumor, inflammation and autoimmune diseases.

    Claims

    1. An anti-PD-1 monoclonal antibody comprises light chains and heavy chains, wherein the light chain contains three complementarity determining regions (CDRs) which are named as LCDR1, LCDR2 and LCDR3; the LCDR1 comprises one of peptides whose amino acid sequences are shown as of SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22, SEQ ID NO. 23 or SEQ ID NO. 24; the LCDR2 comprises one of the peptide whose amino acid sequences are shown as SEQ ID NO. 25, SEQ ID NO. 26, SEQ ID NO. 27, SEQ ID NO. 28, SEQ ID NO. 29 or SEQ ID NO. 30; the LCDR3 comprises one of the peptides whose amino acid sequences shown as SEQ ID NO. 31, SEQ ID NO. 32, SEQ ID NO. 33, SEQ ID NO. 34, SEQ ID NO. 35, SEQ ID NO. 36 or SEQ ID NO. 37.

    2. The anti-PD-1 monoclonal antibody according to claim 1, wherein the light chain contains a light chain variable region that is selected from one of the peptides having amino acid sequences shown as SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO. 8, SEQ ID NO.9, SEQ ID NO.10 or SEQ ID NO.11.

    3. An anti-PD-1 monoclonal antibody comprises light chains and heavy chains, wherein the heavy chain contains three complementarity determining regions which are named as HCDR1, HCDR2 and HCDR3; the HCDR1 comprises one of peptides whose amino acid sequences were shown as SEQ ID NO. 38 or SEQ ID NO. 39; the HCDR2 comprises one of peptides whose amino acid sequences were shown as SEQ ID NO. 40, SEQ ID NO. 41 or SEQ ID NO. 42; the HCDR3 comprises one of peptides whose amino acid sequences were shown as SEQ ID NO. 43 or SEQ ID NO. 44.

    4. The anti-PD-1 monoclonal antibody according to claim 3, wherein the heavy chain contains a heavy chain variable region that is selected from one of the peptides having amino acid sequences shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO. 4.

    5. An antibody, a polypeptide or a protein thereof, wherein the antibody, the polypeptide or the protein contains one or more complementarity determining regions of claims 1 and 3.

    6. A polynucleotide or combination of polynucleotides thereof, wherein the polynucleotide sequence or the combination encodes one or more complementarity determining regions of claims 1 and 3.

    7. A recombinant DNA expression vector, wherein the recombinant DNA expression vector contains a polynucleotide sequence or combination encoding one or more complementarity determining regions of claims 1 and 3.

    8. The recombinant DNA expression vector according to claim 7, wherein the recombinant DNA expression vector is transfected into a host cell, the host cell is selected from prokaryotic cells, yeasts, insects or mammalian cells.

    9. The anti-PD-1 monoclonal antibody according to claims 1 and 3, wherein the anti-PD-1 monoclonal antibody is a human antibody; the heavy chain having a constant region selected from IgG1, IgG2, IgG3 or IgG4; the light chain having a constant region that is C.sub.κ or C.sub.λ.

    10. A monoclonal antibody, a single-chain antibody, a single domain antibody, a bi-specific antibody or a drug-conjugated antibody, contains one or more complementarity determining regions of claims 1 and 3.

    11. A monoclonal antibody, an artificial vector, a drug or a combination of drugs thereof, wherein the monoclonal antibody, the artificial vector, the drug or the combinations of drugs contains one or more complementarity determining regions of claims 1 and 3.

    12. A detection reagent or a kit thereof, wherein the detection reagent or the kit contains one or more complementarity determining regions of claims 1 and 3.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0033] FIG. 1 shows the plasmid atlas of pScFvDisb-s.

    [0034] FIG. 2 shows the electrophoresis atlas of the PCR product of the heavy chain and the linker region by using DFPD1-1 as the template in building the mutant light chain variable region library.

    [0035] FIG. 3 shows the electrophoresis atlas of the PCR product obtained by using the synthetic mutant light chain library as template in building the mutant light chain variable region library.

    [0036] FIG. 4 shows the electrophoresis atlas of the PCR product in building the mutant light chain variable region library VLCDR123M-DFPD1-1.

    [0037] FIG. 5 shows the electrophoresis atlas of the double digested product of plasmid pScFvDisb-s in building the mutant light chain variable region library. and heavy chain variable region library by NcoI-HF and NotI.

    [0038] FIG. 6 shows relative affinity identification of the phage-Abs selected from the mutant light chain variable region library by monoclonal phage-ELISA.

    [0039] FIG. 7 shows relative affinity identification of the phage-Abs selected from the mutant light chain variable region library by gradient diluting phage-ELISA

    [0040] FIG. 8 shows that the electrophoresis atlas of the PCR product by using the synthetic mutant heavy chain variable domain library as template in building the mutant heavy chain variable region library

    [0041] FIG. 9 shows that the electrophoresis atlas of the PCR product of the light chain and the linker by using the plasmid DFPD1-3 and DFPD1-7 as template in building the mutant heavy chain variable region library

    [0042] FIG. 10 shows the electrophoresis atlas of the PCR product in building the mutant heavy chain variable region library VHCDR123M-DFPD1-3

    [0043] FIG. 11 shows the electrophoresis atlas of the PCR product of the mutant library obtained by amplification in building the mutant heavy chain variable region library VHCDR123M-DFPD1-7.

    [0044] FIG. 12 shows relative affinity identification of the phage-Abs selected from the mutant heavy chain variable region library by monoclonal phage-ELISA.

    [0045] FIG. 13 shows the relative affinity identification of phage-Abs selected from the mutant heavy chain variable region library by gradient diluting phage-ELISA

    [0046] FIG. 14 shows the plasmid vector map of pTSE

    [0047] FIG. 15 shows the binding activities of monoclonal antibodies to PD-1 at the protein level.

    [0048] FIG. 16 shows the competitive inhibition of PD-1 binding to PD-L1 by full antibodies.

    [0049] FIG. 17 shows the binding activities of monoclonal antibodies to PD-1 on the cell surface.

    DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS

    [0050] The embodiment mode of this invention is described in the following examples. However, it should be noted that the embodiment is not limited to certain details of these examples.

    [0051] The experimental methods described in the following examples are all common technologies unless otherwise specified; the reagents and biological described are all commercially available unless otherwise specified.

    [0052] The present invention provides a monoclonal antibody, which specifically interacts with PD-1, the heavy chain variable region sequence is selected from the group consisting of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 or SEQ ID NO. 4, the light chain variable region sequence is selected from the group consisting of SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10 or SEQ ID NO. 11.

    [0053] Preferably, the heavy chain variable region sequence is SEQ ID NO. 2, SEQ ID NO. 3 or SEQ ID NO. 4, the light chain variable region sequence is SEQ ID NO. 7 or SEQ ID NO. 11.

    [0054] Through screening the phage library of the light chain, the amino acid sequence of the LCDR1, LCDR2 or LCDR3 of the light chain or its functional fragment of the monoclonal antibody are selected from the following group (as shown in Table 1).

    TABLE-US-00001 TABLE 1 The Amino Acid Sequence Of Each CDR In The Light Chain No. LCDR1 LCDR2 LCDR3 A RASQNIHSYLD EASTRAS QQALKLPIT (SEQ ID NO. 18) (SEQ ID NO. 25) (SEQ ID NO. 31) B RASQNVSNWLD DASNRAT QQSRHIPLT (SEQ ID NO. 19) (SEQ ID NO. 26) (SEQ ID NO. 32) C RASQSIHNYLD NASTRAT QQELHLPLT (SEQ ID NO. 20) (SEQ ID NO. 27) (SEQ ID NO. 33) D RASQDINNWLD DASTLAT QQNVNLPLT (SEQ ID NO. 21) (SEQ ID NO. 28) (SEQ ID NO. 34) E RASQDVRTYLD GASTRAT QQDIDLPLT (SEQ ID NO. 22) (SEQ ID NO. 29) (SEQ ID NO. 35) F RASQGINSWLD DASTRAT QQSYRLPLT (SEQ ID NO. 23) (SEQ ID NO. 30) (SEQ ID NO. 36) G RASQSVSNYLD DASTRAT QQNMQLPLT (SEQ ID NO. 24) (SEQ ID NO. 30) (SEQ ID NO. 37)

    [0055] Through screening the phage library of the heavy chain, the CDR1, CDR2 or CDR3 of the heavy chain or its functional fragment of the monoclonal antibodies are represented by HCDR1, HCDR2 or HCDR3, HCDR1 contains SNNGMH (SEQ ID NO. 38) or SNYGMH (SEQ ID NO.39), HCDR2 contains VIWYDGSKK (SEQ ID NO. 40), VIWYDSSRK (SEQ ID NO. 41) or VIWYDSTKK (SEQ ID NO. 42), HCDR3 contains TAVYYCATNNDYW (SEQ ID NO. 43) or TAVYYCATNTDYW (SEQ ID NO. 44).

    [0056] Preferably, through screening the phage library of the heavy chain, the heavy chain variable region of the monoclonal antibody specifically interacted with PD-1 contains HCDR1, HCDR2 and HCDR3 sequence, and the light chain variable region contains LCDR1, LCDR2 and LCDR3 sequence. Wherein, HCDR1 sequence of the heavy chain variable region is selected from the amino acid sequence of SNNGMH (SEQ ID NO. 38) or SNYGMH (SEQ ID NO. 39), LCDR1 sequence of the light chain variable region is selected from the amino acid sequence of RASQSIHNYLD (SEQ ID NO. 20) or RASQSVSNYLD (SEQ ID NO. 24), HCDR2 sequence of the heavy chain variable region is selected from the amino acid sequence of VIWYDGSKK (SEQ ID NO. 40) or VIWYDSSRK (SEQ ID NO. 41), LCDR2 sequence of the light chain variable region is selected from the amino acid sequence of NASTRAT (SEQ ID NO.27) or DASTRAT (SEQ ID NO. 30), HCDR3 sequence of the heavy chain variable region is selected from the amino acid sequence of TAVYYCATNNDYW (SEQ ID NO. 43) or TAVYYCATNTDYW (SEQ ID NO. 44), LCDR3 sequence of the light chain variable region is selected from the amino acid sequence of QQELHLPLT (SEQ ID NO. 33) or QQNMQLPLT (SEQ ID NO. 37).

    [0057] In the present invention, the antibody, which specifically interacts with PD-1, is obtained from the synthetic ScFv phage library, the process for preparing the anti-PD-1 monoclonal antibodies including:

    [0058] First of all, anti-PD-1 single-chain antibody library was bio-panned through three rounds of enriching and screening of the antibody library, and a high affinity antibody DFPD1-1 was obtained

    [0059] Secondly, a light chain CDR1, CDR2 or CDR3 mutant library was designed by computer aided design based on DFPD1-1. Six different light chain antibodies (DFPD1-2, DFPD1-3, DFPD1-4, DFPD1-5, DFPD1-6 or DFPD1-7) were identified as positive clones by bio-panning and comparing the affinities of the ScFvs on the level of phage.

    [0060] Thirdly, a heavy chain CDR1, CDR2 and CDR3 mutant library was built on basis of two higher affinity strains of clones DFPD1-3 and DFPD1-7. Five different single-chain antibodies which are DFPD1-9, DFPD1-10, DFPD1-11, DFPD1-12, DFPD1-13 were selected by bio-panning and comparing affinities of the ScFvs on the level of phage.

    [0061] Finally, the variable region genes of the heavy chain and the light chain of the monoclonal antibody which are described above and their corresponding constant region genes were cloned into the eukaryotic expression vector and transfected into the host cells, obtained the monoclonal antibody, and then compared their affinity and other biological functions.

    Example 1

    The Biopanning of Anti-PD-1 Single-Chain Antibody Library

    [0062] pComb3 vector (Purchased from Biovector Science Lab, Inc.) was modified by a series of cloning technology for constructing and expressing of a single-chain antibody phage library. The modified vector is named as pScFvDisb-s shown in FIG. 1 and was used to make a fully-synthetic phage antibody library.

    [0063] The immune tubes were coated with the antigen PD-1-His, the amount of antigen-coated is 5 μg/500 μI/tube at 4° C. overnight. The 4% skim milk/PBST was used to block the immune tubes and the full synthetic phage antibody library at room temperature for one hour. The blocked phage antibody library was added into the immune tubes for Ab-Ag interactions at room temperature for one hour, the amount of phage inputs was about 10.sup.9-10.sup.12. PBST-PBS was used to wash the unbound phages, 0.1M Glycine-HCl (pH 2.2) was used to elute, 1.5M Tris-HCl (pH8.8) was used to neutralize the eluted phage antibody solution to about pH7.0.

    [0064] The above neutralized phages infected 10 ml TG1 bacteria were grown to the logarithmic period, and set for 30 minutes at in 37° C. incubator. A partial of the bacteria culture was used for gradient diluting, coated on a 2YTAG plate to calculate the amount of phage outputs. The remaining bacteria culture was centrifuged, then the supernatant was discarded. The thallus precipitation was suspended in a few of liquid culture media which was used to coat on a large 2YTAG plate for the next round of screening.

    [0065] The thallus was scraped from the large plate, inoculated to 2YTAG liquid culture media, adding M13K07 for the helper phage super-infection after shaking to logarithmic period, culturing at 28° C. overnight to amplify the phages, PEG/NaCl is used to settle and purify the phage for the next round of screening. Three rounds of enrichment and screening the phage library are carried out in total.

    Example 2

    The Screening of Positive Clones for the Anti-PD-1 Phage Single-Chain Antibody

    [0066] After three rounds of screening, the monoclonal bacterial colonies were selected to inoculate in a 96-well deep-well plates contained 2YTAG liquid culture medium, and were cultured at 37° C. at 220 rpm to logarithmic growth period, then about 10.sup.10 helper phage M13K07 were added into each well for infection for 30 minutes at 37° C. Then the culture was centrifuged at 4000 rpm for 15 minutes, the supernatant was discarded, the thallus was suspended with 2YTAKA. After culturing at 220 rpm 28° C. overnight, the culture was centrifuged at 4000 rpm for 15 minutes at 4° C., the phage supernatant was taken out for ELISA. The higher affinity single-chain antibody, DFPD1-1, was obtained by screening, the heavy chain variable region was named as DFPD1-H1 that has an amino acid sequence as shown in SEQ ID NO. 1, the light chain variable region was named DFPD1-L1 that has an amino acid sequence as shown in SEQ ID NO. 5.

    Example 3

    The Affinity Maturation Test In Vitro of the Anti-PD-1 Single-Chain Antibody DFPD1-1

    1. The Construction of the Mutant Library for DFPD1-1 Light Chain CDR1, CDR2 and CDR3

    [0067] The primers PVLF1 and PVLR1 were designed, using a DNA having a nucleic acid sequence shown as SEQ ID NO. 12 as a template, the light chain gene library (as shown in FIG. 3) were amplified by PCR; the primers PVHF1 and PVHR1, plasmid DFPD1-1 as the template were used to amplify its heavy chain and its linker (as shown in FIG. 2). Reaction condition: 95° C. for 30 seconds, 1 cycle, 95° C. for 15 seconds, 60° C. for 10 seconds, 72° C. for 30 seconds, 3 cycles, 95° C. for 15 second, 72° C. for 40 seconds, 25 cycles, 72° C. for 5 minutes, storing at 4° C. The PCR products were recovered with a universal recovery kit.

    [0068] The sequences of primers are as following:

    TABLE-US-00002 PVLF1: (SEQ ID NO. 45) 5′-GATATCCAGATGACCCAGAGC-3′ PVLR1: (SEQ ID NO. 46) 5′-CTAAGCGGCCGCTTTGATCTCCACTTTGGTGC-3′ PVHF1: (SEQ ID NO. 47) 5′-CATACCATGGCCCAGGTGCAGCTGGTGGAGTCTG-3′ PVHR1: (SEQ ID NO. 48) 5′-GCTCTGGGTCATCTGGATATCGGATCCACCACC-3′

    [0069] The light chain mutation variable region library of DFPD1-1 was obtained by overlap PCR via amplifying two PCR products mentioned above. Reaction condition: 95° C. for 30 seconds, 1 cycle, 95° C. for 15 seconds, 72° C. for 30 seconds, 4 cycle (added the primers PVHF1 and PVLR1), 95° C. for 15 seconds, 72° C. for 40 seconds, 25 cycles, 72° C. for 5 minutes, store at 4° C. The PCR products were recovered with universal recovery kit, the corresponding PCR product is named as VLCDR123M-DFPD1-1 (as shown in FIG. 4).

    [0070] The plasmid pScFvDisb-s and VLCDR123M-DFPD1-1 were digested with NcoI-HF and NotI, and the enzyme-digested products were run on 0.8% agarose gel electrophoresis (as shown in FIG. 5). After gel extraction, DNA was purified using a commercial available DNA purification kit. The purified digested VLCDR123M-DFPD1-1 and pScFvDisb-s was ligated at a molar ratio of 4:1 with T4 DNA Ligase for 4 hours at 16° C. The ligation product was transformed into TG1 competent cells by the electroporation. After recovering cells for one hour at 37° C. in SOC medium, a partial of the bacteria was plated on a culture dish to estimate the capacity of library. The remaining bacteria culture was centrifuged at room temperature at 4000 rpm for 15 minutes and the supernatant was removed. The precipitation was plated on 2 YTAG large plate, and cultured at 37° C. overnight.

    [0071] The capacity of the antibody library is about 10.sup.8. Twenty clones were picked from the antibody library randomly for sequencing, the sequences showed 95% accuracy, and the capacity of the antibody library is of high diversity.

    2. The Bio-Panning of the Phage Antibody Library and Screening of Positive Clones

    [0072] The screening is in accordance with the method of the example 1, all clones which have high affinity were sequenced, then six different clones were obtained and named DFPD1-2, DFPD1-3, DFPD1-4, DFPD1-5, DFPD1-6 and DFPD1-7, respectively, the corresponding light chain variable region is named DFPD1-L2, DFPD1-L3, DFPD1-L4, DFPD1-L5, DFPD1-L6 and DFPD1-L7, the corresponding amino acid sequence is as shown in SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10 and SEQ ID NO.11, respectively. The relative affinity of the monoclonal phage was determined with ELISA as shown in FIG. 6.

    3. Determining the Affinity of the Anti-PD-1 Antibody's ScFv by Gradient Diluting Phage-ELISA

    [0073] Displaying and purifying the phage of clones obtained by example 2, the affinity of the phage-Abs was determined by a gradient diluting phage-ELISA test.

    [0074] The PD1-His in pH9.6 carbonate buffer solution was used for coating at 4° C. overnight. PBST was used for washing for three times, 4% skim milk-PBST was used for blocking at 37° C. for one hour. The purified phages were diluted for three times with 4% milk-PBST, then 100 μL diluted sample was added into each well. After setting at room temperature for one hour, the ELISA plate was washed with PBST, then the anti-M13-HRP monoclonal antibody diluted in 4% skim milk was added into the ELISA plate. After placing for one hour at room temperature, the wells were stained with TMB stain solution kit for five minutes at room temperature. The reaction was stopped with 50 μL of 2 mol/L H.sub.2SO.sub.4 per well, and the optical density was determined with the microplate reader by reading at 450 nm and 630 nm wavelength. The result shows a number of different phage antibodies selected can be combined with PD-1, further the affinity of DFPD1-3 and DFPD1-7 are significantly higher than other clones (as shown in FIG. 7). DFPD1-3 and DFPD1-7 were selected for further experiments.

    Example 4

    The Affinity Maturation Test In Vitro of the Anti-PD-1 of Single-Chain Antibody DFPD1-3 and DFPD1-7

    1. The Construction of the Heavy Chain CDR1, CDR 2 and CDR 3 Mutant Library for DFPD1-3 And DFPD1-7.

    [0075] Using the synthesized heavy chain mutant library (as shown in SEQ ID NO. 13) as a template and PVHF2 and PVHR2 as PCR primers, the heavy chain gene library (as shown in FIG. 8) were amplified by PCR; The PVLF2 and PVLR2 as PCR primers and plasmid DFPD1-3 and DFPD1-7 were used as the template to amplify its light chain and its linker (as shown in FIG. 9). Wherein, the left is DFPD1-3, the right is DFPD1-7. Reaction conditions: 95° C. for 30 seconds, 1 cycle, 95° C. for 15 seconds, 60° C. for 10 seconds, 72° C. for 30 seconds, 3 cycles, 95° C. for 15 seconds, 72° C. for 40 seconds, 25 cycles, 72° C. for 5 minutes, 4° C. for storing. PCR products were recovered with universal recovery kit.

    [0076] The sequences of primers as following:

    TABLE-US-00003 PVHF2: (SEQ ID NO. 49) ′5CATACCATGGCCCAGGTGCAGCTGGTGGAGTCTG3′ PVHR2: (SEQ ID NO. 50) ′5TGAGGAGACGGTGACCAGGGTGCCCTG3′ PVLF2: (SEQ ID NO. 51) ′5 CTGGTCACCGTCTCCTCAGGTGGTGGTGGTAGC3′ PVLR2: (SEQ ID NO. 52) ′5 CTAAGCGGCCGCTTTGATCTCCACTTTGGTGC3′

    [0077] The above two PCR products were amplified by overlap PCR to obtain the gene of DFPD1-3 and DFPD1-7 heavy chain mutation library. Reaction conditions: 95° C. for 30 seconds, 1 cycle, 95° C. for 15 seconds, 72° C. for 30 seconds, 4 cycle (added the primers PVHF2 and PVLR2), 95° C. for 15 seconds, 72° C. for 40 seconds, 25 cycles, 72° C. for 5 minutes, 4° C. for storing. PCR products were recovered with universal recovery kit, the corresponding products named as VHCDR123M-DFPD1-3 (as shown in FIG. 10) and VHCDR123M-DFPD1-7 (as shown in FIG. 11).

    [0078] VHCDR123M-DFPD1-3, VHCDR123M-DFPD1-7 and plasmid pScFvDisb-s were digested with NcoI-HF and NotI, and the enzyme-digested products were separated by 0.8% agarose gel electrophoresis (as shown in FIG. 5). After gel extraction, the enzyme-digested products were purified with a commercial available DNA purification kit. The digested PCR products and pScFvDisb-s were ligated at the molar ratio of 4:1 with T4 DNA ligase for 16° C. for 4 hours. The ligated products were transformed into TG1 competent cells by the electroporation. After recovering cells in SOC medium at 37° C. for one hour, a small fraction of the bacteria was used to plate on a culture dish to estimate the capacity of the antibody library. The remaining bacteria were centrifuged at room temperature at 4000 rpm for 15 minutes, and then the supernatant was removed. The precipitation was plated on 2 YTAG large culture dish that was culturing at 37° C. overnight.

    [0079] Two different antibody libraries were made; the capacity of each antibody library is about 10.sup.7, the capacity of the antibody library is much higher than the diversity. Twenty clones from the above antibody library randomly were sequenced, the sequences showed 90% accuracy.

    2. Biopanning of the Phage Antibody Library and the Screening of Positive Clones

    [0080] The above two antibody libraries were displayed, precipitated and purified on the phage level. Then the anti-PD-1 ScFv form antibodies were bio-panned from these libraries. The method of biopanning the phage antibody libraries is the same as example 1. The method of screening the positive clones of the anti-PD-1 antibody's ScFv is the same as example 2. The result shows five different anti-PD-1 antibodies were screened. They are named as DFPD1-9, DFPD1-10, DFPD1-11, DFPD1-12, DFPD1-13. Wherein the light chain variable region sequence of DFPD1-9, DFPD1-11 and DFPD1-12 is DFPD1-L3; and the light chain variable region sequence of DFPD1-10 and DFPD1-13 is DFPD1-L7; and the heavy chain variable region sequence of DFPD1-9 and DFPD1-10 is DFPD1-H2; the heavy chain variable region sequence of DFPD1-11 and DFPD1-13 is DFPD1-H3; the heavy chain variable region sequence of DFPD1-12 is DFPD1-H4. The relative affinity of the monoclonal phage was determined by ELISA as shown in FIG. 12.

    3. Determining the Affinity of the Anti-PD-1 Antibody's ScFv by a Gradient Diluting Phage-ELISA

    [0081] Displaying and purifying the clones were done as descripted in the second implementation of this example at the level of monoclonal phage; the affinity of the phage-Abs was determined by a gradient diluting phage-ELISA test, and the method is the same as the third implementation of example 3. The result shows a number of different phage antibodies can interact with PD-1. There is no obvious affinity difference among this phage antibodies (as shown in FIG. 13), wherein DFPD1-9, DFPD1-10, DFPD1-11, DFPD1-12 and DFPD1-13 are better, and are used for the further experiments.

    Example 5

    The Determination of the Affinity of the Anti-PD-1 Monoclonal Antibodies, DFPD1-9, DFPD1-10, DFPD1-11, DFPD1-12 and DFPD1-13

    1. The Preparing of Anti-PD-1 Full-Length Antibody

    [0082] The DNAs encoding above antibodies' heavy chain VH and light chain VK were cloned into vector pTSE, respectively, with the DNAs encoding the heavy chain constant region, the light chain constant region (as shown in FIG. 14), the constant region γ4 (as shown in SEQ ID NO. 14) and κ (as shown in SEQ ID NO. 17) of human (the vector atlas of pTSE as shown in FIG. 14, the preparation process as shown in the description page 3 section 0019 of CN103525868A). Transient transfected HEK293E cells with the cloned vector were used to express antibodies. The antibody proteins were purified with protein A affinity column by the AKTA.

    2. The Determination of the Affinity of the Monoclonal Antibody with BIAcore X100

    [0083] The affinities of the antibodies were determined by ligand-capture method. Anti-human IgG was coupled to the surface of CM5 chip, and DFPD1-9, DFPD1-10, DFPD1-11, DFPD1-12 and DFPD1-13 were diluted respectively to ensure the capturing about 300 RU of the antibody by the anti-human IgG. A series of concentration gradient of the PD-1 (1000 nM, 500 nM, 250 nM, 125 nM, 62.5 nM, 31.25 nM, 15.625 nM, 7.8125 nM, 3.9063 nM, 1.9531 nM and 0.9766 nM) flowed through the surface of the stationary phase to determine the affinities of the antibodies. The results show the affinity of the antibodies has no obvious difference (as shown in table 2).

    TABLE-US-00004 TABLE 2 Determination of The Affinity Constants For The Anti-PD 1 Full-length Antibody Sample ka(1/Ms) kd(1/s) KD DFPD1-9 1.626E+4 1.045E−4 6.429E−9 DFPD1-10 3.285E+4 1.300E−4 3.957E−9 DFPD1-11 9.357E+3 1.015E−4 1.085E−8 DFPD1-12 1.327E+4 2.975E−4 2.242E−8 DFPD1-13 1.811E+4 1.079E−4 9.504E−9

    3. The Binding Assay of the Anti-PD-1 Antibody

    [0084] PD-1-His in pH9.6 carbonate buffer solution, 60 ng/well/100 μl, was used for coating 96 well plate at 4° C. overnight. After washing five times with 300 μl/well PBST, the wells were blocked for two hours with 1% BSA-PBS at 37° C. Different dilution of the antibodies DFPD1-9, DFPD1-10, DFPD1-11, DFPD1-12 and DFPD1-13 were added. The highest concentration of these five kinds of antibodies is 16 μg/mL, diluted for 4 times to 11 gradients, and the last well was used as the negative control which was added PBS diluent only. After incubating at 37° C. for one hour, the wells were washed five times with 300 μL/well of PBST, then adding the anti-human Fc-HRP secondary antibodies diluted at 1:40000 with 1% BSA-PBS, incubating at 37° C. for one hour. After staining with TMB stain solution kit, 100 μL/well, for 8 minutes at room temperature, the reaction was stopped with 504 of 2 mol/L H.sub.2SO.sub.4/well, and the optical density was determined at 450 nm and 630 nm wavelength. The result is shown in FIG. 15, all antibodies can bind with PD-1.

    4. The Antibody Competitive Inhibition Test of PD-L1 Binding with PD-1

    [0085] PDL1-Fc in pH9.6 carbonate buffer solution was used for coating plates at 4° C. overnight. After washing five times with PBST, the wells were blocked for two hours with 1% BSA-PBS at 37° C. The following five antibodies with 4 μg/ml PD1-His, DFPD1-9, DFPD1-10, DFPD1-11, DFPD1-12 and DFPD1-13 were diluted respectively, starting from the molar ratio 10:1 of the antibody and PD1-His, the gradient diluting for five times and 9 dilution gradient of each sample. After incubating at 37° C. for one hour, the wells were washed five times with PBST, and then the mouse anti-His antibody HRP labeled with 1% BSA-PBS diluted were added. After incubating at 37° C. for one hour, the wells were stained with TMB stain solution kit, 100 μI/well, for 8 minutes at room temperature. The reaction was stopped with 50 μl of 10% H.sub.2SO.sub.4/well. The optical density was read at 450 nm and 630 nm wavelength. The result is shown in FIG. 16, DFPD1-9, DFPD1-10, DFPD1-11, DFPD1-12 and DFPD1-13 can inhibit the binding of PD-1 and PD-L1.

    Example 6

    The Binding Assay of Anti-PD-1 Antibody and Cell-Surface PD-1

    [0086] Firstly, the CHO cell line with stable PD-1 overexpression was made and named PD1-CHO. After coating 96-well plates with gelatin, PD1-CHO cells was digested by trypsin and then stopped. After centrifuging and suspending, the cells were diluted to 2×10.sup.5 cells/ml, 100 μL per well in 96-well plates, totally 12 well×6 row, namely 2×10.sup.4 cells/well, and cultured at 5% CO.sub.2, 37° C. overnight. The culture medium were discarded the next day, and the wells were washed one time with 350 μl precooling PBS. Freshly prepared 2% PFA was added to fix 5 minutes, and then PBS was used to wash two times.

    [0087] The full-length anti-PD-1 antibody of double dilution was added into the cell plates, the diluent is PBS with 0.5% BSA. Sample concentration started from 100 μg/mL, diluting for 8 times, totally 12 gradients of dilution. After incubating for 30 minutes at room temperature, supernatant was discarded, and wells were washed wells three times with 350 μL pre-cooled PBS. The anti-human Fc-HRP Secondary antibodies diluted at 1:5000 were added, and incubated for 15 minutes at room temperature. After washing three times with 350 μL PBS, 100 μL TMB stain solution was added into each well, staining for 15 to 30 minutes at room temperature. After adding 50 μL 2 mol/L H2504 per well to stop the staining, the optical density was read at 450 nm and 630 nm wavelength with the microplate reader. The results were processed with Graph pad prism software, and the binding constant was calculated (as shown in FIG. 17).

    [0088] The invention includes all combinations of the recited particular embodiments. Further embodiments and the full scope of applicability of the invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. All publications, patents, and patent applications cited herein, including citations therein, are hereby incorporated by reference in their entirety for all purposes.