POLYNUCLEOTIDE AGENTS TARGETING SERPINC1 (AT3) AND METHODS OF USE THEREOF
20170240892 · 2017-08-24
Inventors
Cpc classification
C12N15/113
CHEMISTRY; METALLURGY
C12N2310/3231
CHEMISTRY; METALLURGY
C12N2320/35
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The invention relates to polynucleotide agents targeting the Serpinc1 (AT3) gene, and methods of using such polynucleotide agents to inhibit expression of Serpinc1 and to treat subjects having a bleeding disorder, e.g., a hemophilia.
Claims
1. An antisense polynucleotide agent for inhibiting expression of Serpinc1 (AT3), wherein the agent comprises about 4 to about 50 contiguous nucleotides, wherein at least one of the contiguous nucleotides is a modified nucleotide, and wherein the nucleotide sequence of the agent is about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of any one of SEQ ID NOs:1-4.
2. The agent of claim 1, wherein the equivalent region is one of the target regions of SEQ ID NO:1 provided in Tables 3 and 4.
3. An antisense polynucleotide agent for inhibiting expression of Serpinc1, wherein the agent comprises at least 8 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences listed in Tables 3 and 4.
4. The agent of claim 1, wherein substantially all of the nucleotides of the antisense polynucleotide agent are modified nucleotides.
5. The agent of claim 1, which is 10 to 40 nucleotides in length; 10 to 30 nucleotides in length; 18 to 30 nucleotides in length; 10 to 24 nucleotides in length; 18 to 24 nucleotides in length; or 20 to 24 nucleotides in length.
6. The agent of claim 1, wherein the modified nucleotide comprises a modified sugar moiety selected from the group consisting of: a 2′-O-methoxyethyl modified sugar moiety, a 2′-methoxy modified sugar moiety, a 2′-O-alkyl modified sugar moiety, and a bicyclic sugar moiety.
7. The agent of claim 1, wherein the modified nucleotide is a 5-methylcytosine.
8. The agent of claim 1, wherein the modified nucleotide comprises a modified internucleoside linkage.
9. The agent of claim 1, comprising a plurality of 2′-deoxynucleotides flanked on each side by at least one nucleotide having a modified sugar moiety.
10. The agent of claim 9, wherein the agent is a gapmer comprising a gap segment comprised of linked 2′-deoxynucleotides positioned between a 5′ and a 3′ wing segment.
11. An antisense polynucleotide agent for inhibiting Serpinc1 (AT3), comprising a gap segment consisting of linked deoxynucleotides; a 5′-wing segment consisting of linked nucleotides; a 3′-wing segment consisting of linked nucleotides; wherein the gap segment is positioned between the 5′-wing segment and the 3′-wing segment and wherein each nucleotide of each wing segment comprises a modified sugar.
12. The agent of claim 11, wherein the gap segment is ten 2′-deoxynucleotides in length and each of the wing segments is five nucleotides in length.
13. The agent of claim 1, wherein the agent further comprises a ligand at the 3′-terminus of the agent.
14. The agent of claim 13, wherein the ligand is an N-acetylgalactosamine (GalNAc) derivative.
15. A pharmaceutical composition for inhibiting expression of a Serpinc1 (AT3) gene comprising the agent of claim 1.
16. A pharmaceutical composition comprising the agent of claim 1, and a lipid formulation.
17. A method of inhibiting Serpinc1 (AT3) expression in a cell, the method comprising: (a) contacting the cell with the agent of claim 1 or a pharmaceutical composition of claim 15; and (b) maintaining the cell produced in step (a) for a time sufficient to obtain antisense inhibition of a Serpinc1 gene, thereby inhibiting expression of Serpinc1 gene in the cell.
18. The method of claim 17, wherein the cell is within a subject.
19. The method of claim 18, wherein the subject is a human.
20. A method of treating a subject having a disease or disorder that would benefit from reduction in Serpinc1 (AT3) expression, the method comprising administering to the subject a therapeutically effective amount of the agent of claim 1 or a pharmaceutical composition of claim 15, thereby treating the subject.
21. A method of preventing at least one symptom in a subject having a disease or disorder that would benefit from reduction in Serpinc1 (AT3) expression, the method comprising administering to the subject a prophylactically effective amount of the agent of claim 1 or a pharmaceutical composition of claim 15, thereby preventing at least one symptom in the subject having a disorder that would benefit from reduction in Serpinc1 expression.
22. The method of claim 20 or 21, wherein the administration of the antisense polynucleotide agent to the subject causes a decrease in intravascular hemolysis, a stabilization of hemoglobin levels and/or a decrease in Serpinc1 protein levels.
23. The method of claim 20 or 21, wherein the disorder is a bleeding disorder.
24. The method of claim 23, wherein the bleeding disorder is one of the inherited disorders hemophilia and von Willebrand's disease.
25. The method of claim 23, wherein the bleeding disorder is an acquired disorder associated with a disease or condition selected from the group consisting of disseminated intravascular coagulation, pregnancy-associated eclampsia, vitamin K deficiency, an autoimmune disorder, inflammatory bowel disease, ulcerative colitis, a dermatologic disorder, a respiratory disease, an allergic drug reaction, diabetes, acute hepatitis B infection, acute hepatitis C infection, and a malignancy or solid tumor.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0084]
[0085]
DETAILED DESCRIPTION OF THE INVENTION
[0086] The present invention provides polynucleotide agents and compositions comprising such agents which target nucleic acids encoding Serpinc1 or antithrombin III (AT3) (e.g., mRNA encoding Serpinc1 as provided in, for example, any one of SEQ ID NOs:1-4). The Serpinc1 gene may be within a cell, e.g., a cell within a subject, such as a human. The present invention also provides methods of using the polynucleotide agents and compositions of the invention for inhibiting the expression of a Serpinc1 gene and/or for treating a subject having a disorder that would benefit from inhibiting or reducing the expression of a Serpinc1 gene, e.g., a bleeding disorder, such as hemophilia. The present invention further provides methods for preventing at least one symptom, e.g., bleeding, in a subject having a disorder that would benefit from inhibiting or reducing the expression of a Serpinc1 gene, e.g., a bleeding disorder, such as hemophilia.
[0087] The polynucleotide agents of the invention include a nucleotide sequence which is about 4 to about 50 nucleotides or less in length and which is about 80% complementary to at least part of an mRNA transcript of a Serpinc1 gene. The use of these polynucleotide agents enables the targeted inhibition of RNA expression and/or activity of a Serpinc1 gene in mammals.
[0088] The present inventors have demonstrated that polynucleotide agents targeting Serpinc1 can mediate antisense inhibition in vitro resulting in significant inhibition of expression of a Serpinc1 gene. Thus, methods and compositions including these polynucleotide agents are useful for treating a subject who would benefit by a reduction in the levels and/or activity of a Serpinc1 protein, such as a subject having a bleeding disorder, e.g. hemophilia.
[0089] The present invention also provides methods and combination therapies for treating a subject having a disorder that would benefit from inhibiting or reducing the expression of a Serpinc1 gene, e.g., an inherited or acquired bleeding disorder, by using the polynucleotide agents and compositions of the invention. Such combination therapies include one or more agents which function by a non-antisense polynucleotide mechanism and which are useful in treating a bleeding disorder. Examples of such agents include, but are not limited to an anti-inflammatory agent, anti-steatosis agent, anti-viral, and/or anti-fibrosis agent. In addition, other substances commonly used to protect the liver, such as silymarin, can also be used in conjunction with the polynucleotide agents described herein. Other agents useful for treating liver diseases include telbivudine, entecavir, and protease inhibitors such as telaprevir and other disclosed, for example, in Tung et al., U.S. Application Publication Nos. 2005/0148548, 2004/0167116, and 2003/0144217; and in Hale et al., U.S. Application Publication No. 2004/0127488.
[0090] The present invention also provides methods for preventing at least one symptom, e.g., a bleed, in a subject having a disorder that would benefit from inhibiting or reducing the expression of a Serpinc1 gene, e.g., Hemophilia A, Hemophilia B, or Hemophilia C. The present invention further provides compositions comprising polynucleotide agents which effect antisense inhibition of a Serpinc1 gene. The Serpinc1 gene may be within a cell, e.g., a cell within a subject, such as a human.
[0091] The combination therapies of the present invention include administering to a subject having a bleeding disorder, a polynucleotide agent of the invention and an additional therapeutic agent useful in treating a bleeding disorder, such as fresh-frozen plasma (FFP), recombinant FVIIa, or recombinant FIX; FXI concentrates. The combination therapies of the invention reduce Serpinc1 levels in the subject (e.g., by about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 99%) by targeting Serpinc1 mRNA with a polynucleotide agent of the invention and, accordingly, allow the therapeutically (or prophylactically) effective amount of the additional therapeutic agent required to treat the subject to be reduced, thereby decreasing the costs of treatment and permitting easier and more convenient ways of administering the agent, such as subcutaneous administration.
[0092] The following detailed description discloses how to make and use polynucleotide agents to inhibit the mRNA and/or protein expression of a Serpinc1 gene, as well as compositions, uses, and methods for treating subjects having diseases and disorders that would benefit from inhibition and/or reduction of the expression of this gene.
I. Definitions
[0093] In order that the present invention may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention.
[0094] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements.
[0095] The term “including” is used herein to mean, and is used interchangeably with, the phrase “including but not limited to”.
[0096] The term “or” is used herein to mean, and is used interchangeably with, the term “and/or,” unless context clearly indicates otherwise.
[0097] As used herein, “Serpinc1” refers to a particular polypeptide expressed in a cell. Serpinc1 is also known as serpin peptidase inhibitor, clade C (antithrombin), member 1; antithrombin III; AT3; antithrombin; and heparin cofactor 1. The sequence of a human Serpinc1 mRNA transcript can be found at, for example, GenBank Accession No. GI:254588059 (NM_000488; SEQ ID NO:1). The sequence of rhesus Serpinc1 mRNA can be found at, for example, GenBank Accession No. GI:157167169 (NM_001104583; SEQ ID NO:2). The sequence of mouse Serpinc1 mRNA can be found at, for example, GenBank Accession No. GI:237874216 (NM_080844; SEQ ID NO:3). The sequence of rat Serpinc1 mRNA can be found at, for example, GenBank Accession No. GI:58865629 (NM_001012027; SEQ ID NO:4).
[0098] Additional examples of Serpinc1 mRNA sequences are readily available using publicly available databases, e.g., GenBank, Prosite, OMIM.
[0099] The term“Serpinc1” as used herein also refers to a particular polypeptide expressed in a cell by naturally occurring DNA sequence variations of the Serpinc1 gene, such as a single nucleotide polymorphism in the Serpinc1 gene. Numerous SNPs within the Serpinc1 gene have been identified and may be found at, for example, NCBI dbSNP (see, e.g., www.ncbi.nlm.nih.gov/snp). Non-limiting examples of SNPs within the Serpinc1 gene may be found at, NCBI dbSNP Accession Nos. rs677; rs5877; rs5878; rs5879; rs941988; rs941989; rs1799876; rs19637711; rs2008946; and rs2227586.
[0100] The terms “antisense polynucleotide agent” “antisense compound”, and “agent” as used interchangeably herein, refer to an agent comprising a single-stranded oligonucleotide that contains RNA as that term is defined herein, and which targets nucleic acid molecules encoding Serpinc1 (e.g., mRNA encoding Serpinc1 as provided in, for example, any one of SEQ ID NOs:1-4). The antisense polynucleotide agents specifically bind to the target nucleic acid molecules via hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) and interfere with the normal function of the targeted nucleic acid (e.g., by an antisense mechanism of action). This interference with or modulation of the function of a target nucleic acid by the polynucleotide agents of the present invention is referred to as “antisense inhibition.”
[0101] The functions of the target nucleic acid molecule to be interfered with may include functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA.
[0102] In some embodiments, antisense inhibition refers to “inhibiting the expression” of target nucleic acid levels and/or target protein levels in a cell, e.g., a cell within a subject, such as a mammalian subject, in the presence of the antisense polynucleotide agent complementary to a target nucleic acid as compared to target nucleic acid levels and/or target protein levels in the absence of the antisense polynucleotide agent. For example, the antisense polynucleotide agents of the invention can inhibit translation in a stoichiometric manner by base pairing to the mRNA and physically obstructing the translation machinery, see Dias, N. et al., (2002) Mol Cancer Ther 1:347-355.
[0103] As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a Serpinc1 gene, including mRNA that is a product of RNA processing of a primary transcription product
[0104] As used herein, “target nucleic acid” refers to a nucleic acid molecule to which an antisense polynucleotide agent specifically hybridizes.
[0105] As used herein, the term “specifically hybridizes” refers to an antisense polynucleotide agent having a sufficient degree of complementarity between the antisense polynucleotide agent and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, e.g., under physiological conditions in the case of in vivo assays and therapeutic treatments.
[0106] A target sequence may be from about 4-50 nucleotides in length, e.g., 8-45, 10-45, 10-40, 10-35, 10-30, 10-20, 11-45, 11-40, 11-35, 11-30, 11-20, 12-45, 12-40, 12-35, 12-30, 12-25, 12-20, 13-45, 13-40, 13-35, 13-30, 13-25, 13-20, 14-45, 14-40, 14-35, 14-30, 14-25, 14-20, 15-45, 15-40, 15-35, 15-30, 15-25, 15-20, 16-45, 16-40, 16-35, 16-30, 16-25, 16-20, 17-45, 17-40, 17-35, 17-30, 17-25, 17-20, 18-45, 18-40, 18-35, 18-30, 18-25, 18-20, 19-45, 19-40, 19-35, 19-30, 19-25, 19-20, e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 contiguous nucleotides of the nucleotide sequence of an mRNA molecule formed during the transcription of a Serpinc1 gene. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.
[0107] The terms “complementary,” “fully complementary” and “substantially complementary” are used herein with respect to the base matching between an antisense polynucleotide agent and a target sequence. The term“complementarity” refers to the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
[0108] As used herein, an antisense polynucleotide agent that is “substantially complementary to at least part of” a messenger RNA (mRNA) refers to an antisense polynucleotide agent that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding Serpinc1). For example, a polynucleotide is complementary to at least a part of a Serpinc1 mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding Serpinc1.
[0109] As used herein, the term “region of complementarity” refers to the region of the antisense polynucleotide agent that is substantially complementary to a sequence, for example a target sequence, e.g., a Serpinc1 nucleotide sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5′- and/or 3′-terminus of the antisense polynucleotide.
[0110] As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of a polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. for 12-16 hours followed by washing (see, e.g., “Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the nucleotides.
[0111] Complementary sequences include those nucleotide sequences of an antisense polynucleotide agent of the invention that base-pair to a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., antisense inhibition of target gene expression.
[0112] “Complementary” sequences, as used herein, can also include, or be formed entirely from, non-Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing.
[0113] As used herein, the term “strand comprising a sequence” refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.
[0114] “G,” “C,” “A,” “T” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as a base, respectively. However, it will be understood that the terms “deoxyribonucleotide”, “ribonucleotide” and “nucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety (see, e.g., Table 2). The skilled person is well aware that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of the agents featured in the invention by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the invention.
[0115] A “nucleoside” is a base-sugar combination. The “nucleobase” (also known as “base”) portion of the nucleoside is normally a heterocyclic base moiety. “Nucleotides” are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2′, 3′ or 5′ hydroxyl moiety of the sugar.
[0116] “Polynucleotides,” also referred to as “oligonucleotides,” are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the polynucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the polynucleotide.
[0117] In general, the majority of nucleotides of the antisense polynucleotide agents are ribonucleotides, but as described in detail herein, the agents may also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide. In addition, as used in this specification, an “antisense polynucleotide agent” may include nucleotides (e.g., ribonucleotides or deoxyribonucleotides) with chemical modifications; an antisense polynucleotide agent may include substantial modifications at multiple nucleotides.
[0118] As used herein, the term “modified nucleotide” refers to a nucleotide having, independently, a modified sugar moiety, a modified internucleotide linkage, and/or modified nucleobase. Thus, the term modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases. The modifications suitable for use in the antisense polynucleotide agents of the invention include all types of modifications disclosed herein or known in the art. Any such modifications, as used in nucleotides, are encompassed by “antisense polynucleotide agent” for the purposes of this specification and claims.
[0119] As used herein, a “subject” is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), a non-primate (such as a cow, a pig, a camel, a llama, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, a mouse, a horse, and a whale), or a bird (e.g., a duck or a goose). In an embodiment, the subject is a human, such as a human being treated or assessed for a disease, disorder or condition that would benefit from reduction in Serpinc1 expression; a human at risk for a disease, disorder or condition that would benefit from reduction in Serpinc1 expression; a human having a disease, disorder or condition that would benefit from reduction in Serpinc1 expression; and/or human being treated for a disease, disorder or condition that would benefit from reduction in Serpinc1 expression as described herein.
[0120] As used herein, the terms “treating” or “treatment” refer to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more symptoms, diminishing the extent of bleeding, stabilized (i.e., not worsening) state of bleeding, amelioration or palliation of the bleeding, whether detectable or undetectable. “Treatment” can also mean prolonging survival as compared to expected survival in the absence of treatment.
[0121] The term “lower” in the context of the level of Serpinc1 in a subject or a disease marker or symptom refers to a statistically significant decrease in such level. The decrease can be, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more and is preferably down to a level accepted as within the range of normal for an individual without such disorder.
[0122] As used herein, “prevention” or “preventing,” when used in reference to a disease, disorder or condition thereof, that would benefit from a reduction in expression of a Sertpinc1 gene, refers to a reduction in the likelihood that a subject will develop a symptom associated with a such a disease, disorder, or condition, e.g., a symptom such as a bleed. The likelihood of developing a bleed is reduced, for example, when an individual having one or more risk factors for a bleed either fails to develop a bleed or develops a bleed with less severity relative to a population having the same risk factors and not receiving treatment as described herein. The failure to develop a disease, disorder or condition, or the reduction in the development of a symptom associated with such a disease, disorder or condition (e.g., by at least about 10% on a clinically accepted scale for that disease or disorder), or the exhibition of delayed symptoms delayed (e.g., by days, weeks, months or years) is considered effective prevention.
[0123] As used herein, the term “bleeding disorder” is a disease or disorder that results in poor blood clotting and/or excessive bleeding. A bleeding disorder may be an inherited disorder, such as a hemophilia or von Willebrand's disease, or an acquired disorder, associated with, for example, disseminated intravascular coagulation, pregnancy-associated eclampsia, vitamin K deficiency, an autoimmune disorder, inflammatory bowel disease, ulcerative colitis, a dermatologic disorder (e.g., psoriasis, pemphigus), a respiratory disease (e.g., asthma, chronic obstructive pulmonary disease), an allergic drug reaction, e.g., the result of medications, such as aspirin, heparin, and warfarin, diabetes, acute hepatitis B infection, acute hepatitis C infection, a malignancy or solid tumor (e.g., prostate, lung, colon, pancreas, stomach, bile duct, head and neck, cervix, breast, melanoma, kidney, and/or a hematologic malignancy). In one embodiment, an inherited bleeding disorder is a hemophilia, e.g., hemophilia A, B, or C. In one embodiment, a subject having an inherited bleeding disorder, e.g., a hemophilia, has developed inhibitors, e.g., alloantibody inhibitors, to replacement coagulation therapies and is referred to herein as an “inhibitor subject.” In one embodiment, the inhibitor subject has hemophilia A. In another embodiment, the inhibitor subject has hemophilia B. In yet another embodiment, the inhibitor subject has hemophilia C.
II. Polynucleotide Agents of the Invention
[0124] The present invention provides polynucleotide agents, e.g., antisense polynucleotide agents, and compositions comprising such agents, which target a Serpinc1 gene and inhibit the expression of the Serpinc1 gene. In one embodiment, the antisense polynucleotide agents inhibit the expression of a Serpinc1 gene in a cell, such as a cell within a subject, e.g., a mammal, such as a human having a bleeding disorder e.g., hemophilia.
[0125] The antisense polynucleotide agents of the invention include a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of a Serpinc1 gene. The region of complementarity may be about 50 nucleotides or less in length (e.g., about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, or 4 nucleotides or less in length). Upon contact with a cell expressing the Serpinc1 gene, the antisense polynucleotide agent inhibits the expression of the Serpinc1 gene (e.g., a human, a primate, a non-primate, or a bird Serpinc1 gene) by at least about 10% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by immunofluorescence analysis, using, for example, Western Blotting or flow cytometric techniques.
[0126] The region of complementarity between an antisense polynucleotide agent and a target sequence may be substantially complementary (e.g., there is a sufficient degree of complementarity between the antisense polynucleotide agent and a target nucleic acid to so that they specifically hybridize and induce a desired effect), but is generally fully complementary to the target sequence. The target sequence can be derived from the sequence of an mRNA formed during the expression of a Serpinc1 gene.
[0127] Accordingly, in one aspect, an antisense polynucleotide agent of the invention specifically hybridizes to a target nucleic acid molecule, such as the mRNA encoding Serpinc1, and comprises a contiguous nucleotide sequence which corresponds to the reverse complement of a nucleotide sequence of any one of SEQ ID NOs:1-4, or a fragment of any one of SEQ ID NOs:1-4.
[0128] In some embodiments, the antisense polynucleotide agents of the invention may be substantially complementary to the target sequence. For example, an antisense polynucleotide agent that is substantially complementary to the target sequence may include a contiguous nucleotide sequence comprising no more than 5 mismatches (e.g., no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches) when hybridizing to a target sequence, such as to the corresponding region of a nucleic acid which encodes a mammalian Serpinc1 mRNA. In some embodiments, the contiguous nucleotide sequence comprises no more than a single mismatch when hybridizing to the target sequence, such as the corresponding region of a nucleic acid which encodes a mammalian Serpinc1 mRNA.
[0129] In some embodiments, the antisense polynucleotide agents of the invention that are substantially complementary to the target sequence comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of any one of SEQ ID NOs:1-4, or a fragment of any one of SEQ ID NOs:1-4, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.
[0130] In some embodiments, an antisense polynucleotide agent comprises a contiguous nucleotide sequence which is fully complementary over its entire length to the equivalent region of the nucleotide sequence of any one of SEQ ID NOs:1-4 (or a fragment of any one of SEQ ID NOs:1-4).
[0131] An antisense polynucleotide agent may comprise a contiguous nucleotide sequence of about 4 to about 50 nucleotides in length, e.g., 8-49, 8-48, 8-47, 8-46, 8-45, 8-44, 8-43, 8-42, 8-41, 8-40, 8-39, 8-38, 8-37, 8-36, 8-35, 8-34, 8-33, 8-32, 8-31, 8-30, 8-29, 8-28, 8-27, 8-26, 8-25, 8-24, 8-23, 8-22, 8-21, 8-20, 8-19, 8-18, 8-17, 8-16, 8-15, 8-14, 8-13, 8-12, 8-11, 8-10, 8-9, 10-49, 10-48, 10-47, 10-46, 10-45, 10-44, 10-43, 10-42, 10-41, 10-40, 10-39, 10-38, 10-37, 10-36, 10-35, 10-34, 10-33, 10-32, 10-31, 10-30, 10-29, 10-28, 10-27, 10-26, 10-25, 10-24, 10-23, 10-22, 10-21, 10-20, 10-19, 10-18, 10-17, 10-16, 10-15, 10-14, 10-13, 10-12, 10-11, 11-49, 11-48, 11-47, 11-46, 11-45, 11-44, 11-43, 11-42, 11-41, 11-40, 11-39, 11-38, 11-37, 11-36, 11-35, 11-34, 11-33, 11-32, 11-31, 11-30, 11-29, 11-28, 11-27, 11-26, 11-25, 11-24, 11-23, 11-22, 11-21, 11-20, 11-19, 11-18, 11-17, 11-16, 11-15, 11-14, 11-13, 11-12, 12-49, 12-48, 12-47, 12-46, 12-45, 12-44, 12-43, 12-42, 12-41, 12-40, 12-39, 12-38, 12-37, 12-36, 12-35, 12-34, 12-33, 12-32, 12-31, 12-30, 12-29, 12-28, 12-27, 12-26, 12-25, 12-24, 12-23, 12-22, 12-21, 12-20, 12-19, 12-18, 12-17, 12-16, 12-15, 12-14, 12-13, 13-49, 13-48, 13-47, 13-46, 13-45, 13-44, 13-43, 13-42, 13-41, 13-40, 13-39, 13-38, 13-37, 13-36, 13-35, 13-34, 13-33, 13-32, 13-31, 13-30, 13-29, 13-28, 13-27, 13-26, 13-25, 13-24, 13-23, 13-22, 13-21, 13-20, 13-19, 13-18, 13-17, 13-16, 13-15, 13-14, 14-49, 14-48, 14-47, 14-46, 14-45, 14-44, 14-43, 14-42, 14-41, 14-40, 14-39, 14-38, 14-37, 14-36, 14-35, 14-34, 14-33, 14-32, 14-31, 14-30, 14-29, 14-28, 14-27, 14-26, 14-25, 14-24, 14-23, 14-22, 14-21, 14-20, 14-19, 14-18, 14-17, 14-16, 14-15, 15-49, 15-48, 15-47, 15-46, 15-45, 15-44, 15-43, 15-42, 15-41, 15-40, 15-39, 15-38, 15-37, 15-36, 15-35, 15-34, 15-33, 15-32, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 15-16, 16-49, 16-48, 16-47, 16-46, 16-45, 16-44, 16-43, 16-42, 16-41, 16-40, 16-39, 16-38, 16-37, 16-36, 16-35, 16-34, 16-33, 16-32, 16-31, 16-30, 16-29, 16-28, 16-27, 16-26, 16-25, 16-24, 16-23, 16-22, 16-21, 16-20, 16-19, 16-18, 16-17, 17-49, 17-48, 17-47, 17-46, 17-45, 17-44, 17-43, 17-42, 17-41, 17-40, 17-39, 17-38, 17-37, 17-36, 17-35, 17-34, 17-33, 17-32, 17-31, 17-30, 17-29, 17-28, 17-27, 17-26, 17-25, 17-24, 17-23, 17-22, 17-21, 17-20, 17-19, 17-18, 18-49, 18-48, 18-47, 18-46, 18-45, 18-44, 18-43, 18-42, 18-41, 18-40, 18-39, 18-38, 18-37, 18-36, 18-35, 18-34, 18-33, 18-32, 18-31, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-49, 19-48, 19-47, 19-46, 19-45, 19-44, 19-43, 19-42, 19-41, 19-40, 19-39, 19-38, 19-37, 19-36, 19-35, 19-34, 19-33, 19-32, 19-31, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-49, 20-48, 20-47, 20-46, 20-45, 20-44, 20-43, 20-42, 20-41, 20-40, 20-39, 20-38, 20-37, 20-36, 20-35, 20-34, 20-33, 20-32, 20-31, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-49, 21-48, 21-47, 21-46, 21-45, 21-44, 21-43, 21-42, 21-41, 21-40, 21-39, 21-38, 21-37, 21-36, 21-35, 21-34, 21-33, 21-32, 21-31, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, 21-22, 22-49, 22-48, 22-47, 22-46, 22-45, 22-44, 22-43, 22-42, 22-41, 22-40, 22-39, 22-38, 22-37, 22-36, 22-35, 22-34, 22-33, 22-32, 22-31, 22-30, 22-29, 22-28, 22-27, 22-26, 22-25, 22-24, 22-23, 23-49, 23-48, 23-47, 23-46, 23-45, 23-44, 23-43, 23-42, 23-41, 23-40, 23-39, 23-38, 23-37, 23-36, 23-35, 23-34, 23-33, 23-32, 23-31, 23-30, 23-29, 23-28, 23-27, 23-26, 23-25, 23-24, 24-49, 24-48, 24-47, 24-46, 24-45, 24-44, 24-43, 24-42, 24-41, 24-40, 24-39, 24-38, 24-37, 24-36, 24-35, 24-34, 24-33, 24-32, 24-31, 24-30, 24-29, 24-28, 24-27, 24-26, 24-25, 25-49, 25-48, 25-47, 25-46, 25-45, 25-44, 25-43, 25-42, 25-41, 25-40, 25-39, 25-38, 25-37, 25-36, 25-35, 25-34, 25-33, 25-32, 25-31, 25-30, 25-29, 25-28, 25-27, 25-26, 26-49, 26-48, 26-47, 26-46, 26-45, 26-44, 26-43, 26-42, 26-41, 26-40, 26-39, 26-38, 26-37, 26-36, 26-35, 26-34, 26-33, 26-32, 26-31, 26-30, 26-29, 26-28, 26-27, 27-49, 27-48, 27-47, 27-46, 27-45, 27-44, 27-43, 27-42, 27-41, 27-40, 27-39, 27-38, 27-37, 27-36, 27-35, 27-34, 27-33, 27-32, 27-31, 27-30, 27-29, 27-28, 28-49, 28-48, 28-47, 28-46, 28-45, 28-44, 28-43, 28-42, 28-41, 28-40, 28-39, 28-38, 28-37, 28-36, 28-35, 28-34, 28-33, 28-32, 28-31, 28-30, 28-29, 29-49, 29-48, 29-47, 29-46, 29-45, 29-44, 29-43, 29-42, 29-41, 29-40, 29-39, 29-38, 29-37, 29-36, 29-35, 29-34, 29-33, 29-32, 29-31, 29-30, 30-49, 30-48, 30-47, 30-46, 30-45, 30-44, 30-43, 30-42, 30-41, 30-40, 30-39, 30-38, 30-37, 30-36, 30-35, 30-34, 30-33, 30-32, or 30-31 nucleotides in length, e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length.
[0132] In some embodiments, an antisense polynucleotide agent may comprise a contiguous nucleotide sequence of no more than 22 nucleotides, such as no more than 21 nucleotides, 20 nucleotides, 19 nucleotides, or no more than 18 nucleotides. In some embodiments the antisense polynucleotide agents of the invention comprises less than 20 nucleotides. In other embodiments, the antisense polynucleotide agents of the invention comprise 20 nucleotides.
[0133] In one aspect, an antisense polynucleotide agent of the invention includes a sequence selected from the group of the sequences provided in Tables 3 and 4. It will be understood that, although some of the sequences in Tables 3 and 4 are described as modified and/or conjugated sequences, an antisense polynucleotide agent of the invention, may also comprise any one of the sequences set forth in Tables 3 and 4 that is un-modified, un-conjugated, and/or modified and/or conjugated differently than described therein.
[0134] By virtue of the nature of the nucleotide sequences provided in Tables 3 and 4, antisense polynucleotide agents of the invention may include one of the sequences of Tables 3 and 4 minus only a few nucleotides on one or both ends and yet remain similarly effective as compared to the antisense polynucleotide agents described above. Hence, antisense polynucleotide agents having a sequence of at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more contiguous nucleotides derived from one of the sequences of Tables 3 and 4 and differing in their ability to inhibit the expression of a Serpinc1 gene by not more than about 5, 10, 15, 20, 25, or 30% inhibition from an antisense polynucleotide agent comprising the full sequence, are contemplated to be within the scope of the present invention.
[0135] In addition, the antisense polynucleotide agents provided in Tables 3 and 4 identify a region(s) in a Serpinc1 transcript that is susceptible to antisense inhibition (e.g., the regions encompassed by the start and end positions relative to NM_000488.3 in Table 4). As such, the present invention further features antisense polynucleotide agents that target within one of these sites. As used herein, an antisense polynucleotide agent is said to target within a particular site of an RNA transcript if the antisense polynucleotide agent promotes antisense inhibition of the target at that site. Such an antisense polynucleotide agent will generally include at least about 15 contiguous nucleotides from one of the sequences provided in Tables 3 or 4 coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in a Serpinc1 (AT3) gene.
[0136] While a target sequence is generally about 4-50 nucleotides in length, there is wide variation in the suitability of particular sequences in this range for directing antisense inhibition of any given target RNA. Various software packages and the guidelines set out herein provide guidance for the identification of optimal target sequences for any given gene target, but an empirical approach can also be taken in which a “window” or “mask” of a given size (as a non-limiting example, 20 nucleotides) is literally or figuratively (including, e.g., in silico) placed on the target RNA sequence to identify sequences in the size range that can serve as target sequences. By moving the sequence “window” progressively one nucleotide upstream or downstream of an initial target sequence location, the next potential target sequence can be identified, until the complete set of possible sequences is identified for any given target size selected. This process, coupled with systematic synthesis and testing of the identified sequences (using assays as described herein or as known in the art) to identify those sequences that perform optimally can identify those RNA sequences that, when targeted with an antisense polynucleotide agent, mediate the best inhibition of target gene expression. Thus, while the sequences identified, for example, in Tables 3 or 4 represent effective target sequences, it is contemplated that further optimization of antisense inhibition efficiency can be achieved by progressively “walking the window” one nucleotide upstream or downstream of the given sequences to identify sequences with equal or better inhibition characteristics.
[0137] Further, it is contemplated that for any sequence identified, e.g., in Tables 3 or 4, further optimization could be achieved by systematically either adding or removing nucleotides to generate longer or shorter sequences and testing those sequences generated by walking a window of the longer or shorter size up or down the target RNA from that point. Again, coupling this approach to generating new candidate targets with testing for effectiveness of antisense polynucleotide agents based on those target sequences in an inhibition assay as known in the art and/or as described herein can lead to further improvements in the efficiency of inhibition. Further still, such optimized sequences can be adjusted by, e.g., the introduction of modified nucleotides as described herein or as known in the art, addition or changes in length, or other modifications as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes) as an expression inhibitor.
III. Modified Polynucleotide Agents of the Invention
[0138] In one embodiment, the nucleotides of a polynucleotide agent of the invention, e.g., an antisense polynucleotide agent of the invention, are un-modified, and do not comprise, e.g., chemical modifications and/or conjugations known in the art and described herein. In another embodiment, at least one of the nucleotides of a polynucleotide agent of the invention, e.g., an antisense polynucleotide agent of the invention, is chemically modified to enhance stability or other beneficial characteristics. In certain embodiments of the invention, substantially all of the nucleotides of a polynucleotide agent of the invention, e.g., an antisense polynucleotide agent of the invention, are modified. In other embodiments of the invention, all of the nucleotides of a polynucleotide agent of the invention, e.g., an antisense polynucleotide agent of the invention, are modified. Antisense polynucleotide agents of the invention in which “substantially all of the nucleotides are modified” are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides.
[0139] The nucleic acids featured in the invention can be synthesized and/or modified by standard methods known in the art as further discussed below, e.g., solution-phase or solid-phase organic synthesis or both, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc. Well-established methods for the synthesis and/or modification of the nucleic acids featured in the invention are described in, for example, “Current protocols in nucleic acid chemistry,” Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, N.Y., USA, which is hereby incorporated herein by reference. Modifications include, for example, end modifications, e.g., 5′-end modifications (phosphorylation, conjugation, inverted linkages) or 3′-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2′-position or 4′-position) or replacement of the sugar; and/or backbone modifications, including modification or replacement of the phosphodiester linkages.
[0140] Specific examples of modified nucleotides useful in the embodiments described herein include, but are not limited to nucleotides containing modified backbones or no natural internucleoside linkages. Nucleotides having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified nucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, a modified antisense polynucleotide agent will have a phosphorus atom in its internucleoside backbone.
[0141] Modified nucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3′-5′ linkages, 2′-5′-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′. Various salts, mixed salts and free acid forms are also included.
[0142] Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6,239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Pat. RE39464, the entire contents of each of which are hereby incorporated herein by reference.
[0143] Modified nucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH.sub.2 component parts.
[0144] Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.
[0145] In other embodiments, suitable nucleotide mimetics are contemplated for use in antisense polynucleotide agents, in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the antisense polynucleotide agents of the invention are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.
[0146] Some embodiments featured in the invention include polynucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular —CH.sub.2—NH—CH.sub.2—, —CH.sub.2—N(CH.sub.3)—O—CH.sub.2— [known as a methylene (methylimino) or MMI backbone], —CH.sub.2—O—N(CH.sub.3)—CH.sub.2—, —CH.sub.2—N(CH.sub.3)—N(CH.sub.3)—CH.sub.2— and —N(CH.sub.3)—CH.sub.2—CH.sub.2— [wherein the native phosphodiester backbone is represented as —O—P—O—CH.sub.2—] of the above-referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above-referenced U.S. Pat. No. 5,602,240. In some embodiments, the antisense polynucleotide agents featured herein have morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.
[0147] Modified nucleotides can also contain one or more modified or substituted sugar moieties. The antisense polynucleotide agents featured herein can include one of the following at the 2′-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and alkynyl. Exemplary suitable modifications include O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2)..sub.nOCH.sub.3, O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2)—ONH.sub.2, and O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3].sub.2, where n and m are from 1 to about 10.
[0148] In other embodiments, antisense polynucleotide agents include one of the following at the 2′ position: C.sub.1 to C.sub.10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an antisense polynucleotide, or a group for improving the pharmacodynamic properties of an antisense polynucleotide agent, and other substituents having similar properties. In some embodiments, the modification includes a 2′-methoxyethoxy (2′-O—CH.sub.2CH.sub.2OCH.sub.3, also known as 2′-O-(2-methoxyethyl) or 2′-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2′-dimethylaminooxyethoxy, i.e., a O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2′-DMAOE, as described in examples herein below, and 2′-dimethylaminoethoxyethoxy (also known in the art as 2′-O-dimethylaminoethoxyethyl or 2′-DMAEOE), i.e., 2′-O—CH.sub.2—O—CH.sub.2—N(CH.sub.2).sub.2.
[0149] Other modifications include 2′-methoxy (2′-OCH.sub.3), 2′-aminopropoxy (2′-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and 2′-fluoro (2′-F). Similar modifications can also be made at other positions on a nucleotide of an antisense polynucleotide agent, particularly the 3′ position of the sugar on the 3′ terminal nucleotide. Antisense polynucleotide agents can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application. The entire contents of each of the foregoing are hereby incorporated herein by reference.
[0150] Additional nucleotides having modified or substituted sugar moieties for use in the polynucleotide agents of the invention include nucleotides comprising a bicyclic sugar. A “bicyclic sugar” is a furanosyl ring modified by the bridging of two atoms. A “bicyclic nucleoside” (“BNA”) is a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4′-carbon and the 2′-carbon of the sugar ring. Thus, in some embodiments an antisense polynucleotide agent may include one or more locked nucleic acids. A “locked nucleic acid” (“LNA”) is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2′ and 4′ carbons. In other words, an LNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4′-CH.sub.2—O-2′ bridge. This structure effectively “locks” the ribose in the 3′-endo structural conformation. The addition of locked nucleic acids to santisense polynucleotide agents has been shown to increase santisense polynucleotide agent stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).
[0151] Examples of bicyclic nucleosides for use in the polynucleotides of the invention include without limitation nucleosides comprising a bridge between the 4′ and the 2′ ribosyl ring atoms. In certain embodiments, the antisense polynucleotide agents of the invention include one or more bicyclic nucleosides comprising a 4′ to 2′ bridge. Examples of such 4′ to 2′ bridged bicyclic nucleosides, include but are not limited to 4′-(CH2)-O-2′ (LNA); 4′-(CH2)-S-2′; 4′-(CH2)2-O-2′ (ENA); 4′-CH(CH3)-O-2′ (also referred to as “constrained ethyl” or “cEt”) and 4′-CH(CH2OCH3)-O-2′ (and analogs thereof; see, e.g., U.S. Pat. No. 7,399,845); 4′-C(CH3)(CH3)-O-2′ (and analogs thereof; see e.g., U.S. Pat. No. 8,278,283); 4′-CH2-N(OCH3)-2′ (and analogs thereof; see e.g., U.S. Pat. No. 8,278,425); 4′-CH2-O—N(CH3)-2′ (see, e.g., U.S. Patent Publication No. 2004/0171570); 4′-CH2-N(R)—O-2′, wherein R is H, C1-C12 alkyl, or a protecting group (see, e.g., U.S. Pat. No. 7,427,672); 4′-CH2-C(H)(CH3)-2′ (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4′-CH2-C(═CH2)-2′ (and analogs thereof; see, e.g., U.S. Pat. No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference.
[0152] Additional representative U.S. Patents and US Patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Pat. Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008/0039618; and US 2009/0012281, the entire contents of each of which are hereby incorporated herein by reference.
[0153] Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and β-D-ribofuranose (see WO 99/14226).
[0154] In one particular embodiment of the invention, an antisense polynucleotide agent can include one or more constrained ethyl nucleotides. As used herein, a “constrained ethyl nucleotide” or “cEt” is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4′-CH(CH.sub.3)—O-2′ bridge. In one embodiment, a constrained ethyl nucleotide is in an S conformation and is referred to as an “S-constrained ethyl nucleotide” or “S-cEt.”
[0155] Modified nucleotides included in the antisense polynucleotide agents of the invention can also contain one or more sugar mimetics. For example, the antisense polynucleotide agent may include a “modified tetrahydropyran nucleotide” or “modified THP nucleotide.” A “modified tetrahydropyran nucleotide” has a six-membered tetrahydropyran “sugar” substituted in for the pentofuranosyl residue in normal nucleotides (a sugar surrogate). Modified THP nucleotides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see, e.g., Leumann, Bioorg. Med. Chem., 2002, 10, 841-854), or fluoro HNA (F-HNA).
[0156] In some embodiments of the invention, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example nucleotides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Pat. Nos. 5,698,685; 5,166,315; 5,185,444; and 5,034,506). Morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.”
[0157] Combinations of modifications are also provided without limitation, such as 2′-F-5′-methyl substituted nucleosides (see PCT International Application WO 2008/101157 published on Aug. 21, 2008 for other disclosed 5′, 2′-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2′-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) or alternatively 5′-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007/134181, published on Nov. 22, 2007 wherein a 4′-CH2-0-2′ bicyclic nucleoside is further substituted at the 5′ position with a 5′-methyl or a 5′-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).
[0158] In certain embodiments, antisense compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides. Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on Apr. 10, 2010, Robeyns et al., J. Am. Chem. Soc., 2008, 130(6), 1979-1984; Horvath et al., Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al., J. Am. Chem. Soc., 2007, 129(30), 9340-9348; Gu et al., Nucleosides, Nucleotides & Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al., Nucleic Acids Research, 2005, 33(8), 2452-2463; Robeyns et al., Acta Crystallographica, Section F: Structural Biology and Crystallization Communications, 2005, F61(6), 585-586; Gu et al., Tetrahedron, 2004, 60(9), 2111-2123; Gu et al., Oligonucleotides, 2003, 13(6), 479-489; Wang et al., J. Org. Chem., 2003, 68, 4499-4505; Verbeure et al., Nucleic Acids Research, 2001, 29(24), 4941-4947; Wang et al., J. Org. Chem., 2001, 66, 8478-82; Wang et al., Nucleosides, Nucleotides & Nucleic Acids, 2001, 20(4-7), 785-788; Wang et al., J. Am. Chem., 2000, 122, 8595-8602; Published PCT application, WO 06/047842; and Published PCT Application WO 01/049687; the text of each is incorporated by reference herein, in their entirety).
[0159] An antisense polynucleotide agent can also include nucleobase modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as deoxy-thymine (dT), 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in “Modified Nucleosides in Biochemistry,” Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y S., Chapter 15, antisense polynucleotide agent Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the agents featured in the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., antisense polynucleotide agent Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2′-O-methoxyethyl sugar modifications.
[0160] Representative U.S. patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.
[0161] One or more of the nucleotides of an agent of the invention may also include a hydroxymethyl substituted nucleotide. A “hydroxymethyl substituted nucleotide” is an acyclic 2′-3′-seco-nucleotide, also referred to as an “unlocked nucleic acid” (“UNA”) modification. Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Pat. No. 8,314,227; and US Patent Publication Nos. 2013/0096289; 2013/0011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference.
[0162] Additional modifications which may potentially stabilize the ends of antisense polynucleotide agents can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2′-0-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3″-phosphate, inverted base dT (idT) and others. Disclosure of this modification can be found in US Patent Publication No. 2012/0142101.
[0163] Any of the antisense polynucleotide agents of the invention may be optionally conjugated with a GalNAc derivative ligand, as described in Section IV, below.
[0164] As described in more detail below, an agent that contains conjugations of one or more carbohydrate moieties to an antisense polynucleotide agent can optimize one or more properties of the agent. In many cases, the carbohydrate moiety will be attached to a modified subunit of the antisense polynucleotide agent. For example, the ribose sugar of one or more ribonucleotide subunits of an agent can be replaced with another moiety, e.g., a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS). A cyclic carrier may be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulfur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.
[0165] The ligand may be attached to the polynucleotide via a carrier. The carriers include (i) at least one “backbone attachment point,” preferably two “backbone attachment points” and (ii) at least one “tethering attachment point.” A “backbone attachment point” as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g., the phosphate, or modified phosphate, e.g., sulfur containing, backbone, of a ribonucleic acid. A “tethering attachment point” (TAP) in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety. The moiety can be, e.g., a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide. Optionally, the selected moiety is connected by an intervening tether to the cyclic carrier. Thus, the cyclic carrier will often include a functional group, e.g., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g., a ligand to the constituent ring.
[0166] The antisense polynucleotide agents may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and decalin; preferably, the acyclic group is selected from serinol backbone or diethanolamine backbone.
[0167] In certain specific embodiments, the antisense polynucleotide agent for use in the methods of the invention is an agent selected from the group of agents listed in Tables 3 and 4. These agents may further comprise a ligand, as described in Section IV, below.
[0168] A. Polynucleotide Agents Comprising Motifs
[0169] In certain embodiments of the invention, at least one of the contiguous nucleotides of the polynucleotide agent of the invention, e.g., the antisense polynucleotide agents of the invention, may be a modified nucleotide. In one embodiment, the modified nucleotide comprises one or more modified sugars. In other embodiments, the modified nucleotide comprises one or more modified nucleobases. In yet other embodiments, the modified nucleotide comprises one or more modified internucleoside linkages. In some embodiments, the modifications (sugar modifications, nucleobase modifications, and/or linkage modifications) define a pattern or motif. In one embodiment, the patterns of modifications of sugar moieties, internucleoside linkages, and nucleobases are each independent of one another.
[0170] Antisense polynucleotide agents having modified oligonucleotides arranged in patterns, or motifs may, for example, confer to the agents properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases. For example, such agents may contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of such agents may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.
[0171] An exemplary antisense polynucleotide agent having modified oligonucleotides arranged in patterns, or motifs is a gapmer. In a “gapmer”, an internal region or “gap” having a plurality of linked nucleotides that supports RNaseH cleavage is positioned between two external flanking regions or “wings” having a plurality of linked nucleotides that are chemically distinct from the linked nucleotides of the internal region. The gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleotides.
[0172] The three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleotides and may be described as “X-Y-Z”, wherein “X” represents the length of the 5-wing, “Y” represents the length of the gap, and “Z” represents the length of the 3′-wing. In one embodiment, a gapmer described as “X-Y-Z” has a configuration such that the gap segment is positioned immediately adjacent to each of the 5′ wing segment and the 3′ wing segment. Thus, no intervening nucleotides exist between the 5′ wing segment and gap segment, or the gap segment and the 3′ wing segment. Any of the antisense compounds described herein can have a gapmer motif. In some embodiments, X and Z are the same, in other embodiments they are different.
[0173] In certain embodiments, the regions of a gapmer are differentiated by the types of modified nucleotides in the region. The types of modified nucleotides that may be used to differentiate the regions of a gapmer, in some embodiments, include β-D-ribonucleotides, β-D-deoxyribonucleotides, 2′-modified nucleotides, e.g., 2′-modified nucleotides (e.g., 2′-MOE, and 2′-O—CH3), and bicyclic sugar modified nucleotides (e.g., those having a 4′-(CH2)n-O-2′ bridge, where n=1 or n=2).
[0174] In one embodiment, at least some of the modified nucleotides of each of the wings may differ from at least some of the modified nucleotides of the gap. For example, at least some of the modified nucleotides of each wing that are closest to the gap (the 3′-most nucleotide of the 5′-wing and the 5′-most nucleotide of the 3-wing) differ from the modified nucleotides of the neighboring gap nucleotides, thus defining the boundary between the wings and the gap. In certain embodiments, the modified nucleotides within the gap are the same as one another. In certain embodiments, the gap includes one or more modified nucleotides that differ from the modified nucleotides of one or more other nucleotides of the gap.
[0175] The length of the 5′-wing (X) of a gapmer may be 1 to 6 nucleotides in length, e.g., 2 to 6, 2 to 5, 3 to 6, 3 to 5, 1 to 5, 1 to 4, 1 to 3, 2 to 4 nucleotides in length, e.g., 1, 2, 3, 4, 5, or 6 nucleotides in length.
[0176] The length of the 3′-wing (Z) of a gapmer may be 1 to 6 nucleotides in length, e.g., 2 to 6, 2-5, 3 to 6, 3 to 5, 1 to 5, 1 to 4, 1 to 3, 2 to 4 nucleotides in length, e.g., 1, 2, 3, 4, 5, or 6 nucleotides in length.
[0177] The length of the gap (Y) of a gapmer may be 5 to 14 nucleotides in length, e.g., 5 to 13, 5 to 12, 5 to 11, 5 to 10, 5 to 9, 5 to 8, 5 to 7, 5 to 6, 6 to 14, 6 to 13, 6 to 12, 6 to 11, 6 to 10, 6 to 9, 6 to 8, 6 to 7, 7 to 14, 7 to 13, 7 to 12, 7 to 11, 7 to 10, 7 to 9, 7 to 8, 8 to 14, 8 to 13, 8 to 12, 8 to 11, 8 to 10, 8 to 9, 9 to 14, 9 to 13, 9 to 12, 9 to 11, 9 to 10, 10 to 14, 10 to 13, 10 to 12, 10 to 11, 11 to 14, 11 to 13, 11 to 12, 12 to 14, 12 to 13, or 13 to 14 nucleotides in length, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 nucleotides in length.
[0178] In some embodiments of the invention X consists of 2, 3, 4, 5 or 6 nucleotides, Y consists of 7, 8, 9, 10, 11, or 12 nucleotides, and Z consists of 2, 3, 4, 5 or 6 nucleotides. Such gapmers include (X-Y-Z) 2-7-2, 2-7-3, 2-7-4, 2-7-5, 2-7-6, 3-7-2, 3-7-3, 3-7-4, 3-7-5, 3-7-6, 4-7-3, 4-7-4, 4-7-5, 4-7-6, 5-7-3, 5-7-4, 5-7-5, 5-7-6, 6-7-3, 6-7-4, 6-7-5, 6-7-6, 3-7-3, 3-7-4, 3-7-5, 3-7-6, 4-7-3, 4-7-4, 4-7-5, 4-7-6, 5-7-3, 5-7-4, 5-7-5, 5-7-6, 6-7-3, 6-7-4, 6-7-5, 6-7-6, 2-8-2, 2-8-3, 2-8-4, 2-8-5, 2-8-6, 3-8-2, 3-8-3, 3-8-4, 3-8-5, 3-8-6, 4-8-3, 4-8-4, 4-8-5, 4-8-6, 5-8-3, 5-8-4, 5-8-5, 5-8-6, 6-8-3, 6-8-4, 6-8-5, 6-8-6, 2-9-2, 2-9-3, 2-9-4, 2-9-5, 2-9-6, 3-9-2, 3-9-3, 3-9-4, 3-9-5, 3-9-6, 4-9-3, 4-9-4, 4-9-5, 4-9-6, 5-9-3, 5-9-4, 5-9-5, 5-9-6, 6-9-3, 6-9-4, 6-9-5, 6-9-6, 2-10-2, 2-10-3, 2-10-4, 2-10-5, 2-10-6, 3-10-2, 3-10-3, 3-10-4, 3-10-5, 3-10-6, 4-10-3, 4-10-4, 4-10-5, 4-10-6, 5-10-3, 5-10-4, 5-10-5, 5-10-6, 6-10-3, 6-10-4, 6-10-5, 6-10-6, 2-11-2, 2-11-3, 2-11-4, 2-11-5, 2-11-6, 3-11-2, 3-11-3, 3-11-4, 3-11-5, 3-11-6, 4-11-3, 4-11-4, 4-11-5, 4-11-6, 5-11-3, 5-11-4, 5-11-5, 5-11-6, 6-11-3, 6-11-4, 6-11-5, 6-11-6, 2-12-2, 2-12-3, 2-12-4, 2-12-5, 2-12-6, 3-12-2, 3-12-3, 3-12-4, 3-12-5, 3-12-6, 4-12-3, 4-12-4, 4-12-5, 4-12-6, 5-12-3, 5-12-4, 5-12-5, 5-12-6, 6-12-3, 6-12-4, 6-12-5, or 6-12-6.
[0179] In some embodiments of the invention, antisense polynucleotide agents targeting Serpinc1 include a 5-10-5 gapmer motif. In other embodiments of the invention, antisense polynucleotide agents targeting Serpinc1 include a 4-10-4 gapmer motif. In another embodiment of the invention, antisense polynucleotide agents targeting Serpinc1 include a 3-10-3 gapmer motif. In yet other embodiments of the invention, antisense polynucleotide agents targeting Serpinc1 include a 2-10-2 gapmer motif.
[0180] The 5′-wing and/or 3′-wing of a gapmer may independently include 1-6 modified nucleotides, e.g., 1, 2, 3, 4, 5, or 6 modified nucleotides.
[0181] In some embodiment, the 5′-wing of a gapmer includes at least one modified nucleotide. In one embodiment, the 5′-wing of a gapmer comprises at least two modified nucleotides. In another embodiment, the 5′-wing of a gapmer comprises at least three modified nucleotides. In yet another embodiment, the 5′-wing of a gapmer comprises at least four modified nucleotides. In another embodiment, the 5′-wing of a gapmer comprises at least five modified nucleotides. In certain embodiments, each nucleotide of the 5′-wing of a gapmer is a modified nucleotide.
[0182] In some embodiments, the 3′-wing of a gapmer includes at least one modified nucleotide. In one embodiment, the 3′-wing of a gapmer comprises at least two modified nucleotides. In another embodiment, the 3′-wing of a gapmer comprises at least three modified nucleotides. In yet another embodiment, the 3′-wing of a gapmer comprises at least four modified nucleotides. In another embodiment, the 3′-wing of a gapmer comprises at least five modified nucleotides. In certain embodiments, each nucleotide of the 3′-wing of a gapmer is a modified nucleotide.
[0183] In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties of the nucleotides. In one embodiment, the nucleotides of each distinct region comprise uniform sugar moieties. In other embodiments, the nucleotides of each distinct region comprise different sugar moieties. In certain embodiments, the sugar nucleotide modification motifs of the two wings are the same as one another. In certain embodiments, the sugar nucleotide modification motifs of the 5′-wing differs from the sugar nucleotide modification motif of the 3′-wing.
[0184] The 5′-wing of a gapmer may include 1-6 modified nucleotides, e.g., 1, 2, 3, 4, 5, or 6 modified nucleotides.
[0185] In one embodiment, at least one modified nucleotide of the 5′-wing of a gapmer is a bicyclic nucleotide, such as a constrained ethyl nucleotide, or an LNA. In another embodiment, the 5′-wing of a gapmer includes 2, 3, 4, or 5 bicyclic nucleotides. In some embodiments, each nucleotide of the 5′-wing of a gapmer is a bicyclic nucleotide.
[0186] In one embodiment, the 5′-wing of a gapmer includes at least 1, 2, 3, 4, or 5 constrained ethyl nucleotides. In some embodiments, each nucleotide of the 5′-wing of a gapmer is a constrained ethyl nucleotide.
[0187] In one embodiment, the 5′-wing of a gapmer comprises at least one LNA nucleotide. In another embodiment, the 5′-wing of a gapmer includes 2, 3, 4, or 5 LNA nucleotides. In other embodiments, each nucleotide of the 5′-wing of a gapmer is an LNA nucleotide.
[0188] In certain embodiments, at least one modified nucleotide of the 5′-wing of a gapmer is a non-bicyclic modified nucleotide, e.g., a 2′-substituted nucleotide. A “2′-substituted nucleotide” is a nucleotide comprising a modification at the 2′-position which is other than H or OH, such as a 2′-OMe nucleotide, or a 2′-MOE nucleotide. In one embodiment, the 5′-wing of a gapmer comprises 2, 3, 4, or 5 2′-substituted nucleotides. In one embodiment, each nucleotide of the 5′-wing of a gapmer is a 2′-substituted nucleotide.
[0189] In one embodiment, the 5′-wing of a gapmer comprises at least one 2′-OMe nucleotide. In one embodiment, the 5′-wing of a gapmer comprises at least 2, 3, 4, or 5 2′-OMe nucleotides. In one embodiment, each of the nucleotides of the 5′-wing of a gapmer comprises a 2′-OMe nucleotide.
[0190] In one embodiment, the 5′-wing of a gapmer comprises at least one 2′-MOE nucleotide. In one embodiment, the 5′-wing of a gapmer comprises at least 2, 3, 4, or 5 2′-MOE nucleotides. In one embodiment, each of the nucleotides of the 5′-wing of a gapmer comprises a 2′-MOE nucleotide.
[0191] In certain embodiments, the 5′-wing of a gapmer comprises at least one 2′-deoxynucleotide. In certain embodiments, each nucleotide of the 5′-wing of a gapmer is a 2′-deoxynucleotide. In a certain embodiments, the 5′-wing of a gapmer comprises at least one ribonucleotide. In certain embodiments, each nucleotide of the 5′-wing of a gapmer is a ribonucleotide.
[0192] The 3′-wing of a gapmer may include 1-6 modified nucleotides, e.g., 1, 2, 3, 4, 5, or 6 modified nucleotides.
[0193] In one embodiment, at least one modified nucleotide of the 3′-wing of a gapmer is a bicyclic nucleotide, such as a constrained ethyl nucleotide, or an LNA. In another embodiment, the 3′-wing of a gapmer includes 2, 3, 4, or 5 bicyclic nucleotides. In some embodiments, each nucleotide of the 3′-wing of a gapmer is a bicyclic nucleotide.
[0194] In one embodiment, the 3′-wing of a gapmer includes at least one constrained ethyl nucleotide. In another embodiment, the 3′-wing of a gapmer includes 2, 3, 4, or 5 constrained ethyl nucleotides. In some embodiments, each nucleotide of the 3′-wing of a gapmer is a constrained ethyl nucleotide.
[0195] In one embodiment, the 3′-wing of a gapmer comprises at least one LNA nucleotide. In another embodiment, the 3′-wing of a gapmer includes 2, 3, 4, or 5 LNA nucleotides. In other embodiments, each nucleotide of the 3′-wing of a gapmer is an LNA nucleotide.
[0196] In certain embodiments, at least one modified nucleotide of the 3′-wing of a gapmer is a non-bicyclic modified nucleotide, e.g., a 2′-substituted nucleotide. In one embodiment, the 3′-wing of a gapmer comprises 2, 3, 4, or 5 2′-substituted nucleotides. In one embodiment, each nucleotide of the 3′-wing of a gapmer is a 2′-substituted nucleotide.
[0197] In one embodiment, the 3′-wing of a gapmer comprises at least one 2′-OMe nucleotide. In one embodiment, the 3′-wing of a gapmer comprises at least 2, 3, 4, or 5 2′-OMe nucleotides. In one embodiment, each of the nucleotides of the 3′-wing of a gapmer comprises a 2′-OMe nucleotide.
[0198] In one embodiment, the 3′-wing of a gapmer comprises at least one 2′-MOE nucleotide. In one embodiment, the 3′-wing of a gapmer comprises at least 2, 3, 4, or 5 2′-MOE nucleotides. In one embodiment, each of the nucleotides of the 3′-wing of a gapmer comprises a 2′-MOE nucleotide.
[0199] In certain embodiments, the 3′-wing of a gapmer comprises at least one 2′-deoxynucleotide. In certain embodiments, each nucleotide of the 3′-wing of a gapmer is a 2′-deoxynucleotide. In a certain embodiments, the 3′-wing of a gapmer comprises at least one ribonucleotide. In certain embodiments, each nucleotide of the 3′-wing of a gapmer is a ribonucleotide.
[0200] The gap of a gapmer may include 5-14 modified nucleotides, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 modified nucleotides.
[0201] In one embodiment, the gap of a gapmer comprises at least one 5-methylcytosine. In one embodiment, the gap of a gapmer comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 5-methylcytosines. In one embodiment, all of the nucleotides of the gap of a gapmer are 5-methylcytosines.
[0202] In one embodiment, the gap of a gapmer comprises at least one 2′-deoxynucleotide. In one embodiment, the gap of a gapmer comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 2′-deoxynucleotides. In one embodiment, all of the nucleotides of the gap of a gapmer are 2′-deoxynucleotides.
[0203] A gapmer may include one or more modified internucleotide linkages. In some embodiments, a gapmer includes one or more phosphodiester internucleotide linkages. In other embodiments, a gapmer includes one or more phosphorothioate internucleotide linkages.
[0204] In one embodiment, each nucleotide of a 5′-wing of a gapmer are linked via a phosphorothioate internucleotide linkage. In another embodiment, each nucleotide of a 3′-wing of a gapmer are linked via a phosphorothioate internucleotide linkage. In yet another embodiment, each nucleotide of a gap segment of a gapmer is linked via a phosphorothioate internucleotide linkage. In one embodiment, all of the nucleotides in a gapmer are linked via phosphorothioate internucleotide linkages.
[0205] In one embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising five nucleotides and a 3′-wing segment comprising 5 nucleotides.
[0206] In another embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising four nucleotides and a 3′-wing segment comprising four nucleotides.
[0207] In another embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising three nucleotides and a 3′-wing segment comprising three nucleotides.
[0208] In another embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising two nucleotides and a 3′-wing segment comprising two nucleotides.
[0209] In one embodiment, each nucleotide of a 5-wing flanking a gap segment of 10 2′-deoxyribonucleotides comprises a modified nucleotide. In another embodiment, each nucleotide of a 3-wing flanking a gap segment of 10 2′-deoxyribonucleotides comprises a modified nucleotide. In one embodiment, each of the modified 5′-wing nucleotides and each of the modified 3′-wing nucleotides comprise a 2′-sugar modification. In one embodiment, the 2′-sugar modification is a 2′-OMe modification. In another embodiment, the 2′-sugar modification is a 2′-MOE modification. In one embodiment, each of the modified 5′-wing nucleotides and each of the modified 3′-wing nucleotides comprise a bicyclic nucleotide. In one embodiment, the bicyclic nucleotide is a constrained ethyl nucleotide. In another embodiment, the bicyclic nucleotide is an LNA nucleotide. In one embodiment, each cytosine in an antisense polynucleotide agent targeting a Serpinc1 gene is a 5-methylcytosine.
[0210] In one embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising five nucleotides comprising a 2′OMe modification and a 3′-wing segment comprising five nucleotides comprising a 2′OMe modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine. In one embodiment, the agent further comprises a ligand.
[0211] In one embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising five nucleotides comprising a 2′MOE modification and a 3′-wing segment comprising five nucleotides comprising a 2′MOE modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine. In one embodiment, the agent further comprises a ligand.
[0212] In one embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising five constrained ethyl nucleotides and a 3′-wing segment comprising five constrained ethyl nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.
[0213] In one embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising five LNA nucleotides and a 3′-wing segment comprising five LNA nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.
[0214] In one embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising four nucleotides comprising a 2′OMe modification and a 3′-wing segment comprising four nucleotides comprising a 2′OMe modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.
[0215] In one embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising four nucleotides comprising a 2′MOE modification and a 3′-wing segment comprising four nucleotides comprising a 2′MOE modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.
[0216] In one embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising four constrained ethyl nucleotides and a 3′-wing segment comprising four constrained ethyl nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.
[0217] In one embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising four LNA nucleotides and a 3′-wing segment comprising four LNA nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.
[0218] In one embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising three nucleotides comprising a 2′OMe modification and a 3′-wing segment comprising three nucleotides comprising a 2′OMe modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.
[0219] In one embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising three nucleotides comprising a 2′MOE modification and a 3′-wing segment comprising three nucleotides comprising a 2′MOE modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.
[0220] In one embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising three constrained ethyl nucleotides and a 3′-wing segment comprising three constrained ethyl nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.
[0221] In one embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising three LNA nucleotides and a 3′-wing segment comprising three LNA nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.
[0222] In one embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising two nucleotides comprising a 2′OMe modification and a 3′-wing segment comprising two nucleotides comprising a 2′OMe modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.
[0223] In one embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising two nucleotides comprising a 2′MOE modification and a 3′-wing segment comprising two nucleotides comprising a 2′MOE modification, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.
[0224] In one embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising two constrained ethyl nucleotides and a 3′-wing segment comprising two constrained ethyl nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.
[0225] In one embodiment, an antisense polynucleotide agent targeting a Serpinc1 gene comprises a gap segment of ten 2′-deoxyribonucleotides positioned immediately adjacent to and between a 5′-wing segment comprising two LNA nucleotides and a 3′-wing segment comprising two LNA nucleotides, wherein each internucleotide linkage of the agent is a phosphorothioate linkage. In one embodiment, each cytosine of the agent is a 5-methylcytosine.
[0226] Further gapmer designs suitable for use in the agents, compositions, and methods of the invention are disclosed in, for example, U.S. Pat. Nos. 7,687,617 and 8,580,756; U.S. Patent Publication Nos. 20060128646, 20090209748, 20140128586, 20140128591, 20100210712, and 20080015162A1; and International Publication No. WO 2013/159108, the entire content of each of which are incorporated herein by reference.
IV. Polynucleotide Agents Conjugated to Ligands
[0227] Another modification of the polynucleotide agents of the invention involves chemically linking to the agent one or more ligands, moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the polynucleotide agent. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).
[0228] In one embodiment, a ligand alters the distribution, targeting or lifetime of an antisense polynucleotide agent into which it is incorporated. In preferred embodiments a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. Preferred ligands will not take part in hybridization of an antisense polynucleotide agent to the targeted mRNA.
[0229] Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylgalactosamine, or hyaluronic acid); or a lipid. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.
[0230] Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucoseamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.
[0231] Other examples of ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG].sub.2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.
[0232] Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a hepatic cell. Ligands can also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, or multivalent fucose. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-κB.
[0233] The ligand can be a substance, e.g., a drug, which can increase the uptake of the antisense polynucleotide agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and/or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, jasplakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.
[0234] In some embodiments, a ligand attached to an antisense polynucleotide agent as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.
[0235] Ligand-conjugated polynucleotides of the invention may be synthesized by the use of a polynucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below). This reactive polynucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.
[0236] The polynucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other polynucleotides, such as the phosphorothioates and alkylated derivatives.
[0237] In the ligand-conjugated polynucleotides and ligand-molecule bearing sequence-specific linked nucleosides of the present invention, the polynucleotides and polynucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks.
[0238] When using nucleotide-conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the polynucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.
[0239] A. Lipid Conjugates
[0240] In one embodiment, the ligand or conjugate is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule preferably binds a serum protein, e.g., human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For example, naproxen or aspirin can be used. A lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a serum protein, e.g., HSA.
[0241] A lipid based ligand can be used to inhibit, e.g., control the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.
[0242] In a preferred embodiment, the lipid based ligand binds HSA. Preferably, it binds HSA with a sufficient affinity such that the conjugate will be preferably distributed to a non-kidney tissue. However, it is preferred that the affinity not be so strong that the HSA-ligand binding cannot be reversed.
[0243] In another preferred embodiment, the lipid based ligand binds HSA weakly or not at all, such that the conjugate will be preferably distributed to the kidney. Other moieties that target to kidney cells can also be used in place of or in addition to the lipid based ligand.
[0244] In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., of the malignant or non-malignant type, e.g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include are B vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by target cells such as liver cells. Also included are HSA and low density lipoprotein (LDL).
[0245] B. Cell Permeation Agents
[0246] In another aspect, the ligand is a cell-permeation agent, preferably a helical cell-permeation agent. Preferably, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent is preferably an alpha-helical agent, which preferably has a lipophilic and a lipophobic phase.
[0247] The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide. The attachment of peptide and peptidomimetics to antisense polynucleotide agents can affect pharmacokinetic distribution of the agent, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.
[0248] A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Trp or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 9). An RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO: 10) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety can be a “delivery” peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 11) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 12) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Examples of a peptide or peptidomimetic tethered to an antisense polynucleotide agent via an incorporated monomer unit for cell targeting purposes is an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.
[0249] An RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s). RGD-containing peptides and peptidiomimemtics may include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand. Preferred conjugates of this ligand target PECAM-1 or VEGF.
[0250] A “cell permeation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell-permeating peptide can be, for example, an α-helical linear peptide (e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide (e.g., α-defensin, β-defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin). A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).
[0251] C. Carbohydrate Conjugates
[0252] In some embodiments of the compositions and methods of the invention, an antisense polynucleotide agent further comprises a carbohydrate. The carbohydrate conjugated agents are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein (see, e.g., Prakash, et al. (2014) Nuc Acid Res doi 10.1093/nar/gku531). As used herein, “carbohydrate” refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).
[0253] In one embodiment, a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide. In one embodiment, the monosaccharide is an N-acetylgalactosamine, such as
##STR00002##
[0254] In another embodiment, a carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of:
##STR00003## ##STR00004## ##STR00005## ##STR00006## ##STR00007## ##STR00008##
[0255] Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to
##STR00009##
when one of X or Y is an oligonucleotide, the other is a hydrogen.
[0256] In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator and/or a cell permeation peptide.
[0257] D. Linkers
[0258] In some embodiments, the conjugate or ligand described herein can be attached to an antisense polynucleotide agent with various linkers that can be cleavable or non-cleavable.
[0259] The term “linker” or “linking group” means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO.sub.2, SO.sub.2NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), SO.sub.2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-16, or 8-16 atoms.
[0260] A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In a preferred embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).
[0261] Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.
[0262] A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.
[0263] A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.
[0264] Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.
[0265] In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).
[0266] i. Redox Cleavable Linking Groups
[0267] In one embodiment, a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of reductively cleavable linking group is a disulphide linking group (—S—S—). To determine if a candidate cleavable linking group is a suitable “reductively cleavable linking group,” or for example is suitable for use with a particular antisense polynucleotide agent moiety and particular targeting agent one can look to methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. In one, candidate compounds are cleaved by at most about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.
[0268] ii. Phosphate-Based Cleavable Linking Groups
[0269] In another embodiment, a cleavable linker comprises a phosphate-based cleavable linking group. A phosphate-based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are —O—P(O)(ORk)-O—, —O—P(S)(ORk)-O—, —O—P(S)(SRk)-O—, —S—P(O)(ORk)-O—, —O—P(O)(ORk)-S—, —S—P(O)(ORk)-S—, —O—P(S)(ORk)-S—, —S—P(S)(ORk)-O—, —O—P(O)(Rk)-O—, —O—P(S)(Rk)-O—, —S—P(O)(Rk)-O—, —S—P(S)(Rk)-O—, —S—P(O)(Rk)-S—, —O—P(S)(Rk)-S—. Preferred embodiments are —O—P(O)(OH)—O—, —O—P(S)(OH)—O—, —O—P(S)(SH)—O—, —S—P(O)(OH)—O—, —O—P(O)(OH)—S—, —S—P(O)(OH)—S—, —O—P(S)(OH)—S—, —S—P(S)(OH)—O—, —O—P(O)(H)—O—, —O—P(S)(H)—O—, —S—P(O)(H)—O, —S—P(S)(H)—O—, —S—P(O)(H)—S—, —O—P(S)(H)—S—. A preferred embodiment is —O—P(O)(OH)—O—. These candidates can be evaluated using methods analogous to those described above.
[0270] iii. Acid Cleavable Linking Groups
[0271] In another embodiment, a cleavable linker comprises an acid cleavable linking group. An acid cleavable linking group is a linking group that is cleaved under acidic conditions. In preferred embodiments acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups. Examples of acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavable groups can have the general formula —C═NN—, C(O)O, or —OC(O). A preferred embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above.
[0272] iv. Ester-Based Linking Groups
[0273] In another embodiment, a cleavable linker comprises an ester-based cleavable linking group. An ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linking groups include but are not limited to esters of alkylene, alkenylene and alkynylene groups. Ester cleavable linking groups have the general formula —C(O)O—, or —OC(O)—. These candidates can be evaluated using methods analogous to those described above.
[0274] v. Peptide-Based Cleaving Groups
[0275] In yet another embodiment, a cleavable linker comprises a peptide-based cleavable linking group. A peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (—C(O)NH—). The amide group can be formed between any alkylene, alkenylene or alkynelene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide-based cleavable linking groups have the general formula —NHCHRAC(O)NHCHRBC(O)—, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.
[0276] In one embodiment, an antisense polynucleotide agent of the invention is conjugated to a carbohydrate through a linker. Non-limiting examples of antisense polynucleotide agent carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to,
##STR00010## ##STR00011## ##STR00012## ##STR00013##
[0277] when one of X or Y is an oligonucleotide, the other is a hydrogen.
[0278] In certain embodiments of the compositions and methods of the invention, a ligand is one or more “GalNAc” (N-acetylgalactosamine) derivatives attached through a bivalent or trivalent branched linker.
[0279] In one embodiment, a antisense polynucleotide agent of the invention is conjugated to a bivalent or trivalent branched linker selected from the group of structures shown in any of formula (XXXII)-(XXXV):
##STR00014##
wherein:
q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent independently for each occurrence 0-20 and wherein the repeating unit can be the same or different;
P.sup.2A, P.sup.2B, P.sup.3A, P.sup.3B, P.sup.4A, P.sup.4B, P.sup.5A, P.sup.5B, P.sup.5C, T.sup.2A, T.sup.2B, T.sup.3A, T.sup.3B, T.sup.4A, T.sup.4B, T.sup.4A, T.sup.5B, T.sup.5C are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH.sub.2, CH.sub.2NH or CH.sub.2O;
Q.sup.2A, Q.sup.2B, Q.sup.3A, Q.sup.3B, Q.sup.4A, Q.sup.4B, Q.sup.5A, Q.sup.5B, Q.sup.5C are independently for each occurrence absent, alkylene, substituted alkylene wherein one or more methylenes can be interrupted or terminated by one or more of O, S, S(O), SO.sub.2, N(R.sup.N), C(R′)═C(R″), C≡C or C(O);
R.sup.2A, R.sup.2B, R.sup.3A, R.sup.3B, R.sup.4A, R.sup.4B, R.sup.5A, R.sup.5B, R.sup.5C are each independently for each occurrence absent, NH, O, S, CH.sub.2, C(O)O, C(O)NH, NHCH(R.sup.a)C(O), —C(O)—CH(R.sup.a)—NH—, CO, CH═N—
##STR00015##
or heterocyclyl;
[0280] L.sup.2A, L.sup.2B, L.sup.3A, L.sup.3B, L.sup.4A, L.sup.4B, L.sup.5A, L.sup.5B and L.sup.5C represent the ligand; i.e. each independently for each occurrence a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; and R.sup.a is H or amino acid side chain. Trivalent conjugating GalNAc derivatives are particularly useful for use with antisense polynucleotide agents for inhibiting the expression of a target gene, such as those of formula (XXXVI):
##STR00016## [0281] wherein L.sup.5A, L.sup.5B and L.sup.5 represent a monosaccharide, such as GalNAc derivative.
[0282] Examples of suitable bivalent and trivalent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the structures recited above as formulas II, VII, XI, X, and XIII.
[0283] Representative U.S. patents that teach the preparation of RNA conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; 8,106,022, the entire contents of each of which are hereby incorporated herein by reference.
[0284] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications can be incorporated in a single compound or even at a single nucleoside within an antisense polynucleotide agent. The present invention also includes antisense polynucleotide agents that are chimeric compounds.
[0285] “Chimeric” antisense polynucleotide agents or “chimeras,” in the context of this invention, are antisense polynucleotide agent compounds, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an antisense polynucleotide agent. These antisense polynucleotide agents typically contain at least one region wherein the RNA is modified so as to confer upon the antisense polynucleotide agent increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the antisense polynucleotide agent can serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of antisense polynucleotide agent inhibition of gene expression. Consequently, comparable results can often be obtained with shorter antisense polynucleotide agents when chimeric antisense polynucleotide agents are used, compared to phosphorothioate deoxy antisense polynucleotide agents hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
[0286] In certain instances, the nucleotide of an antisense polynucleotide agent can be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to antisense polynucleotide agents in order to enhance the activity, cellular distribution or cellular uptake of the antisense polynucleotide agent, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such RNA conjugates have been listed above. Typical conjugation protocols involve the synthesis of an RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate.
V. Delivery of a Polynucleotide Agent of the Invention
[0287] The delivery of a polynucleotide agent of the invention, e.g., an antisense polynucleotide agent of the invention, to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having a bleeding disorder) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an antisense polynucleotide agent of the invention either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising an antisense polynucleotide agent to a subject.
[0288] In general, any method of delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with an antisense polynucleotide agent of the invention (see e.g., Akhtar S. and Julian R L. (1992) Trends Cell. Biol. 2(5):139-144 and WO94/02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider in order to deliver an antisense polynucleotide agent include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue. The non-specific effects of an antisense polynucleotide agent can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the antisense polynucleotide agent to be administered. Several studies have shown successful knockdown of gene products when an antisense polynucleotide agent is administered locally. For example, intraocular delivery of a VEGF antisense polynucleotide agent by intravitreal injection in cynomolgus monkeys (Tolentino, M J., et al (2004) Retina 24:132-138) and subretinal injections in mice (Reich, S J., et al (2003) Mol. Vis. 9:210-216) were both shown to prevent neovascularization in an experimental model of age-related macular degeneration. In addition, direct intratumoral injection of a antisense polynucleotide agent in mice reduces tumor volume (Pille, J., et al (2005) Mol. Ther. 11:267-274) and can prolong survival of tumor-bearing mice (Kim, W J., et al (2006) Mol. Ther. 14:343-350; Li, S., et al (2007) Mol. Ther. 15:515-523). RNA interference has also shown success with local delivery to the CNS by direct injection (Dorn, G., et al. (2004) Nucleic Acids 32:e49; Tan, P H., et al (2005) Gene Ther. 12:59-66; Makimura, H., et al (2002) BMC Neurosci. 3:18; Shishkina, G T., et al (2004) Neuroscience 129:521-528; Thakker, E R., et al (2004) Proc. Natl. Acad. Sci. U.S.A. 101:17270-17275; Akaneya, Y., et al (2005) J. Neurophysiol. 93:594-602) and to the lungs by intranasal administration (Howard, K A., et al (2006) Mol. Ther. 14:476-484; Zhang, X., et al (2004) J. Biol. Chem. 279:10677-10684; Bitko, V., et al (2005) Nat. Med. 11:50-55). For administering an antisense polynucleotide agent systemically for the treatment of a disease, the agent can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the antisense polynucleotide agent by endo- and exo-nucleases in vivo. Modification of the agent or the pharmaceutical carrier can also permit targeting of the antisense polynucleotide agent composition to the target tissue and avoid undesirable off-target effects. Antisense polynucleotide agent can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. In an alternative embodiment, the antisense polynucleotide agent can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of an antisense polynucleotide agent molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an antisense polynucleotide agent by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an antisense polynucleotide agent, or induced to form a vesicle or micelle (see e.g., Kim S H., et al (2008) Journal of Controlled Release 129(2):107-116) that encases an antisense polynucleotide agent. The formation of vesicles or micelles further prevents degradation of the antisense polynucleotide agent when administered systemically. Methods for making and administering cationic-antisense polynucleotide agent complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, D R., et al (2003) J. Mol. Biol 327:761-766; Verma, U N, et al (2003) Clin. Cancer Res. 9:1291-1300; Arnold, A S et al (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of antisense polynucleotide agents include DOTAP (Sorensen, D R., et al (2003), supra; Verma, U N., et al (2003), supra), Oligofectamine, “solid nucleic acid lipid particles” (Zimmermann, T S., et al (2006) Nature 441:111-114), cardiolipin (Chien, P Y., et al (2005) Cancer Gene Ther. 12:321-328; Pal, A., et al (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet M E., et al (2008) Pharm. Res. August 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A., et al (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H., et al (1999) Pharm. Res. 16:1799-1804). In some embodiments, an antisense polynucleotide agent forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of antisense polynucleotide agents and cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is herein incorporated by reference in its entirety.
VI. Pharmaceutical Compositions of the Invention
[0289] The present invention also includes pharmaceutical compositions and formulations which include the polynucleotide agents of the invention, e.g., the antisense polynucleotide agents of the invention. In one embodiment, provided herein are pharmaceutical compositions containing an antisense polynucleotide agent, as described herein, and a pharmaceutically acceptable carrier.
[0290] The phrase “pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
[0291] The phrase “pharmaceutically-acceptable carrier” as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium state, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and/or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum components, such as serum albumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceutical formulations.
[0292] The pharmaceutical compositions containing the antisense polynucleotide agents are useful for treating a bleeding disorder that would benefit from inhibiting or reducing the expression of Serpinc1. Such pharmaceutical compositions are formulated based on the mode of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by subcutaneous (SC) or intravenous (IV) delivery. Another example is compositions that are formulated for direct delivery into the brain parenchyma, e.g., by infusion into the brain, such as by continuous pump infusion. The pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of a Serpinc1 gene. In general, a suitable dose of an antisense polynucleotide agent of the invention will be in the range of about 0.001 to about 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of about 1 to 50 mg per kilogram body weight per day. For example, the antisense polynucleotide agent can be administered at about 0.01 mg/kg, about 0.05 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 1.5 mg/kg, about 2 mg/kg, about 3 mg/kg, about 10 mg/kg, about 20 mg/kg, about 30 mg/kg, about 40 mg/kg, or about 50 mg/kg per single dose.
[0293] For example, the antisense polynucleotide agent may be administered at a dose of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.
[0294] In another embodiment, the antisense polynucleotide agent is administered at a dose of about 0.1 to about 50 mg/kg, about 0.25 to about 50 mg/kg, about 0.5 to about 50 mg/kg, about 0.75 to about 50 mg/kg, about 1 to about 50 mg/mg, about 1.5 to about 50 mg/kb, about 2 to about 50 mg/kg, about 2.5 to about 50 mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg, about 4 to about 50 mg/kg, about 4.5 to about 50 mg/kg, about 5 to about 50 mg/kg, about 7.5 to about 50 mg/kg, about 10 to about 50 mg/kg, about 15 to about 50 mg/kg, about 20 to about 50 mg/kg, about 20 to about 50 mg/kg, about 25 to about 50 mg/kg, about 25 to about 50 mg/kg, about 30 to about 50 mg/kg, about 35 to about 50 mg/kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg, about 0.1 to about 45 mg/kg, about 0.25 to about 45 mg/kg, about 0.5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/mg, about 1.5 to about 45 mg/kb, about 2 to about 45 mg/kg, about 2.5 to about 45 mg/kg, about 3 to about 45 mg/kg, about 3.5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5 to about 45 mg/kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg, about 10 to about 45 mg/kg, about 15 to about 45 mg/kg, about 20 to about 45 mg/kg, about 20 to about 45 mg/kg, about 25 to about 45 mg/kg, about 25 to about 45 mg/kg, about 30 to about 45 mg/kg, about 35 to about 45 mg/kg, about 40 to about 45 mg/kg, about 0.1 to about 40 mg/kg, about 0.25 to about 40 mg/kg, about 0.5 to about 40 mg/kg, about 0.75 to about 40 mg/kg, about 1 to about 40 mg/mg, about 1.5 to about 40 mg/kb, about 2 to about 40 mg/kg, about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, about 3.5 to about 40 mg/kg, about 4 to about 40 mg/kg, about 4.5 to about 40 mg/kg, about 5 to about 40 mg/kg, about 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about 40 mg/kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40 mg/kg, about 35 to about 40 mg/kg, about 0.1 to about 30 mg/kg, about 0.25 to about 30 mg/kg, about 0.5 to about 30 mg/kg, about 0.75 to about 30 mg/kg, about 1 to about 30 mg/mg, about 1.5 to about 30 mg/kb, about 2 to about 30 mg/kg, about 2.5 to about 30 mg/kg, about 3 to about 30 mg/kg, about 3.5 to about 30 mg/kg, about 4 to about 30 mg/kg, about 4.5 to about 30 mg/kg, about 5 to about 30 mg/kg, about 7.5 to about 30 mg/kg, about 10 to about 30 mg/kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, about 20 to about 30 mg/kg, about 25 to about 30 mg/kg, about 0.1 to about 20 mg/kg, about 0.25 to about 20 mg/kg, about 0.5 to about 20 mg/kg, about 0.75 to about 20 mg/kg, about 1 to about 20 mg/mg, about 1.5 to about 20 mg/kb, about 2 to about 20 mg/kg, about 2.5 to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg, about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg, about 10 to about 20 mg/kg, or about 15 to about 20 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.
[0295] For example, the antisense polynucleotide agent may be administered at a dose of about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.
[0296] In another embodiment, the antisense polynucleotide agent is administered at a dose of about 0.5 to about 50 mg/kg, about 0.75 to about 50 mg/kg, about 1 to about 50 mg/mg, about 1.5 to about 50 mg/kgb, about 2 to about 50 mg/kg, about 2.5 to about 50 mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg, about 4 to about 50 mg/kg, about 4.5 to about 50 mg/kg, about 5 to about 50 mg/kg, about 7.5 to about 50 mg/kg, about 10 to about 50 mg/kg, about 15 to about 50 mg/kg, about 20 to about 50 mg/kg, about 20 to about 50 mg/kg, about 25 to about 50 mg/kg, about 25 to about 50 mg/kg, about 30 to about 50 mg/kg, about 35 to about 50 mg/kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg, about 0.5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/mg, about 1.5 to about 45 mg/kb, about 2 to about 45 mg/kg, about 2.5 to about 45 mg/kg, about 3 to about 45 mg/kg, about 3.5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5 to about 45 mg/kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg, about 10 to about 45 mg/kg, about 15 to about 45 mg/kg, about 20 to about 45 mg/kg, about 20 to about 45 mg/kg, about 25 to about 45 mg/kg, about 25 to about 45 mg/kg, about 30 to about 45 mg/kg, about 35 to about 45 mg/kg, about 40 to about 45 mg/kg, about 0.5 to about 40 mg/kg, about 0.75 to about 40 mg/kg, about 1 to about 40 mg/mg, about 1.5 to about 40 mg/kb, about 2 to about 40 mg/kg, about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, about 3.5 to about 40 mg/kg, about 4 to about 40 mg/kg, about 4.5 to about 40 mg/kg, about 5 to about 40 mg/kg, about 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about 40 mg/kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40 mg/kg, about 35 to about 40 mg/kg, about 0.5 to about 30 mg/kg, about 0.75 to about 30 mg/kg, about 1 to about 30 mg/mg, about 1.5 to about 30 mg/kb, about 2 to about 30 mg/kg, about 2.5 to about 30 mg/kg, about 3 to about 30 mg/kg, about 3.5 to about 30 mg/kg, about 4 to about 30 mg/kg, about 4.5 to about 30 mg/kg, about 5 to about 30 mg/kg, about 7.5 to about 30 mg/kg, about 10 to about 30 mg/kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, about 20 to about 30 mg/kg, about 25 to about 30 mg/kg, about 0.5 to about 20 mg/kg, about 0.75 to about 20 mg/kg, about 1 to about 20 mg/mg, about 1.5 to about 20 mg/kb, about 2 to about 20 mg/kg, about 2.5 to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg, about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg, about 10 to about 20 mg/kg, or about 15 to about 20 mg/kg. In one embodiment, the antisense polynucleotide agent is administered at a dose of about 10 mg/kg to about 30 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.
[0297] For example, subjects can be administered, e.g., subcutaneously or intravenously, a single therapeutic amount of antisense polynucleotide agent, such as about 0.1, 0.125, 0.15, 0.175, 0.2, 0.225, 0.25, 0.275, 0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475, 0.5, 0.525, 0.55, 0.575, 0.6, 0.625, 0.65, 0.675, 0.7, 0.725, 0.75, 0.775, 0.8, 0.825, 0.85, 0.875, 0.9, 0.925, 0.95, 0.975, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.
[0298] In some embodiments, subjects are administered, e.g., subcutaneously or intravenously, multiple doses of a therapeutic amount of antisense polynucleotide agent, such as a dose about 0.1, 0.125, 0.15, 0.175, 0.2, 0.225, 0.25, 0.275, 0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475, 0.5, 0.525, 0.55, 0.575, 0.6, 0.625, 0.65, 0.675, 0.7, 0.725, 0.75, 0.775, 0.8, 0.825, 0.85, 0.875, 0.9, 0.925, 0.95, 0.975, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg/kg. A multi-dose regimen may include administration of a therapeutic amount of antisense polynucleotide agent daily, such as for two days, three days, four days, five days, six days, seven days, or longer.
[0299] In other embodiments, subjects are administered, e.g., subcutaneously or intravenously, a repeat dose of a therapeutic amount of antisense polynucleotide agent, such as a dose about 0.1, 0.125, 0.15, 0.175, 0.2, 0.225, 0.25, 0.275, 0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475, 0.5, 0.525, 0.55, 0.575, 0.6, 0.625, 0.65, 0.675, 0.7, 0.725, 0.75, 0.775, 0.8, 0.825, 0.85, 0.875, 0.9, 0.925, 0.95, 0.975, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg/kg. A repeat-dose regimen may include administration of a therapeutic amount of antisense polynucleotide agent on a regular basis, such as every other day, every third day, every fourth day, twice a week, once a week, every other week, or once a month.
[0300] The pharmaceutical composition can be administered by intravenous infusion over a period of time, such as over a 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21, 22, 23, 24, or about a 25 minute period. The administration may be repeated, for example, on a regular basis, such as weekly, biweekly (i.e., every two weeks) for one month, two months, three months, four months or longer. After an initial treatment regimen, the treatments can be administered on a less frequent basis. For example, after administration weekly or biweekly for three months, administration can be repeated once per month, for six months or a year or longer.
[0301] The pharmaceutical composition can be administered once daily, or the antisense polynucleotide agent can be administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In that case, the antisense polynucleotide agent contained in each sub-dose must be correspondingly smaller in order to achieve the total daily dosage. The dosage unit can also be compounded for delivery over several days, e.g., using a conventional sustained release formulation which provides sustained release of the antisense polynucleotide agent over a several day period. Sustained release formulations are well known in the art and are particularly useful for delivery of agents at a particular site, such as could be used with the agents of the present invention. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.
[0302] In other embodiments, a single dose of the pharmaceutical compositions can be long lasting, such that subsequent doses are administered at not more than 3, 4, or 5 day intervals, or at not more than 1, 2, 3, or 4 week intervals. In some embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered once per week. In other embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered bi-monthly.
[0303] The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the individual antisense polynucleotide agents encompassed by the invention can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as described elsewhere herein.
[0304] Advances in mouse genetics have generated a number of mouse models for the study of various human diseases, such as a disorder that would benefit from reduction in the expression of Serpinc1. Such models can be used for in vivo testing of an antisense polynucleotide agent, as well as for determining a therapeutically effective dose. Suitable mouse models are known in the art and include, for example, Hemophilia A mouse models and Hemohphilia B mouse models, e.g., mice containing a knock-out of a clotting factor gene, such as those described in Bolliger, et al. (2010) Thromb Haemost 103:1233-1238, Bi L, et al. (1995) Nat Genet 10: 119-21, Lin et al. (1997) Blood 90: 3962-6, Kundu et al. (1998) Blood 92: 168-74, Wang et al. (1997) Proc Natl Acad Sci USA 94: 11563-6, and Jin, et al. (2004) Blood 104:1733.
[0305] The pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration.
[0306] The antisense polynucleotide agent can be delivered in a manner to target a particular tissue, such as the liver (e.g., the hepatocytes of the liver).
[0307] Pharmaceutical compositions and formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like can be necessary or desirable. Coated condoms, gloves and the like can also be useful. Suitable topical formulations include those in which the antisense polynucleotide agents featured in the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g., dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). Antisense polynucleotide agents featured in the invention can be encapsulated within liposomes or can form complexes thereto, in particular to cationic liposomes. Alternatively, antisense polynucleotide agents can be complexed to lipids, in particular to cationic lipids. Suitable fatty acids and esters include but are not limited to arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a C.sub.1-20 alkyl ester (e.g., isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically acceptable salt thereof). Topical formulations are described in detail in U.S. Pat. No. 6,747,014, which is incorporated herein by reference.
[0308] A. Antisense Polynucleotide Agent Formulations Comprising Membranous Molecular Assemblies
[0309] An antisense polynucleotide agent for use in the compositions and methods of the invention can be formulated for delivery in a membranous molecular assembly, e.g., a liposome or a micelle. As used herein, the term “liposome” refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, e.g., one bilayer or a plurality of bilayers. Liposomes include unilamellar and multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the antisense polynucleotide agent composition. The lipophilic material isolates the aqueous interior from an aqueous exterior, which typically does not include the antisense polynucleotide agent composition, although in some examples, it may. Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the liposome and cell progresses, the internal aqueous contents that include the antisense polynucleotide agent are delivered into the cell where the antisense polynucleotide agent can specifically bind to a target RNA and can mediate antisense inhibition. In some cases the liposomes are also specifically targeted, e.g., to direct the antisense polynucleotide agent to particular cell types.
[0310] A liposome containing an antisense polynucleotide agent can be prepared by a variety of methods. In one example, the lipid component of a liposome is dissolved in a detergent so that micelles are formed with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or lipid conjugate. The detergent can have a high critical micelle concentration and may be nonionic. Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine. The antisense polynucleotide agent preparation is then added to the micelles that include the lipid component. The cationic groups on the lipid interact with the antisense polynucleotide agent and condense around the antisense polynucleotide agent to form a liposome. After condensation, the detergent is removed, e.g., by dialysis, to yield a liposomal preparation of antisense polynucleotide agent.
[0311] If necessary a carrier compound that assists in condensation can be added during the condensation reaction, e.g., by controlled addition. For example, the carrier compound can be a polymer other than a nucleic acid (e.g., spermine or spermidine). pH can also be adjusted to favor condensation.
[0312] Methods for producing stable polynucleotide delivery vehicles, which incorporate a polynucleotide/cationic lipid complex as structural components of the delivery vehicle, are further described in, e.g., WO 96/37194, the entire contents of which are incorporated herein by reference. Liposome formation can also include one or more aspects of exemplary methods described in Felgner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413-7417, 1987; U.S. Pat. No. 4,897,355; U.S. Pat. No. 5,171,678; Bangham, et al. M. Mol. Biol. 23:238, 1965; Olson, et al. Biochim. Biophys. Acta 557:9, 1979; Szoka, et al. Proc. Natl. Acad. Sci. 75: 4194, 1978; Mayhew, et al. Biochim. Biophys. Acta 775:169, 1984; Kim, et al. Biochim. Biophys. Acta 728:339, 1983; and Fukunaga, et al. Endocrinol. 115:757, 1984. Commonly used techniques for preparing lipid aggregates of appropriate size for use as delivery vehicles include sonication and freeze-thaw plus extrusion (see, e.g., Mayer, et al. Biochim. Biophys. Acta 858:161, 1986). Microfluidization can be used when consistently small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew, et al. Biochim. Biophys. Acta 775:169, 1984). These methods are readily adapted to packaging antisense polynucleotide agent preparations into liposomes.
[0313] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged nucleic acid molecules to form a stable complex. The positively charged nucleic acid/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).
[0314] Liposomes which are pH-sensitive or negatively-charged, entrap nucleic acids rather than complex with it. Since both the nucleic acid and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some nucleic acid is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).
[0315] One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.
[0316] Examples of other methods to introduce liposomes into cells in vitro and in vivo include U.S. Pat. No. 5,283,185; U.S. Pat. No. 5,171,678; WO 94/00569; WO 93/24640; WO 91/16024; Felgner, J. Biol. Chem. 269:2550, 1994; Nabel, Proc. Natl. Acad. Sci. 90:11307, 1993; Nabel, Human Gene Ther. 3:649, 1992; Gershon, Biochem. 32:7143, 1993; and Strauss EMBO J. 11:417, 1992.
[0317] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome™ I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome™ II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporine A into different layers of the skin (Hu et al. S.T.P. Pharma. Sci., 1994, 4(6) 466).
[0318] Liposomes also include “sterically stabilized” liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside G.sub.M1, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).
[0319] Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., 1987, 507, 64) reported the ability of monosialoganglioside G.sub.M1, galactocerebroside sulfate and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., 1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside G.sub.M1 or a galactocerebroside sulfate ester. U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al).
[0320] In one embodiment, cationic liposomes are used. Cationic liposomes possess the advantage of being able to fuse to the cell membrane. Non-cationic liposomes, although not able to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver antisense polynucleotide agents to macrophages.
[0321] Further advantages of liposomes include: liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated antisense polynucleotide agents in their internal compartments from metabolism and degradation (Rosoff, in “Pharmaceutical Dosage Forms,” Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.
[0322] A positively charged synthetic cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) can be used to form small liposomes that interact spontaneously with nucleic acid to form lipid-nucleic acid complexes which are capable of fusing with the negatively charged lipids of the cell membranes of tissue culture cells, resulting in delivery of Antisense polynucleotide agent (see, e.g., Felgner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413-7417, 1987 and U.S. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA).
[0323] A DOTMA analogue, 1,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP) can be used in combination with a phospholipid to form DNA-complexing vesicles. Lipofectin™ Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for the delivery of highly anionic nucleic acids into living tissue culture cells that comprise positively charged DOTMA liposomes which interact spontaneously with negatively charged polynucleotides to form complexes. When enough positively charged liposomes are used, the net charge on the resulting complexes is also positive. Positively charged complexes prepared in this way spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids into, for example, tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleoyloxy)-3,3-(trimethylammonia)propane (“DOTAP”) (Boehringer Mannheim, Indianapolis, Ind.) differs from DOTMA in that the oleoyl moieties are linked by ester, rather than ether linkages.
[0324] Other reported cationic lipid compounds include those that have been conjugated to a variety of moieties including, for example, carboxyspermine which has been conjugated to one of two types of lipids and includes compounds such as 5-carboxyspermylglycine dioctaoleoylamide (“DOGS”) (Transfectam™, Promega, Madison, Wis.) and dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide (“DPPES”) (see, e.g., U.S. Pat. No. 5,171,678).
[0325] Another cationic lipid conjugate includes derivatization of the lipid with cholesterol (“DC-Choi”) which has been formulated into liposomes in combination with DOPE (See, Gao, X. and Huang, L., Biochim. Biophys. Res. Commun. 179:280, 1991). Lipopolylysine, made by conjugating polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., Biochim. Biophys. Acta 1065:8, 1991). For certain cell lines, these liposomes containing conjugated cationic lipids, are said to exhibit lower toxicity and provide more efficient transfection than the DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, Calif.) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Md.). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.
[0326] Liposomal formulations are particularly suited for topical administration; liposomes present several advantages over other formulations. Such advantages include reduced side effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer an antisense polynucleotide agent into the skin. In some implementations, liposomes are used for delivering antisense polynucleotide agents to epidermal cells and also to enhance the penetration of antisense polynucleotide agents into dermal tissues, e.g., into skin. For example, the liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been documented (see, e.g., Weiner et al., Journal of Drug Targeting, 1992, vol. 2, 405-410 and du Plessis et al., Antiviral Research, 18, 1992, 259-265; Mannino, R. J. and Fould-Fogerite, S., Biotechniques 6:682-690, 1988; Itani, T. et al. Gene 56:267-276. 1987; Nicolau, C. et al. Meth. Enz. 149:157-176, 1987; Straubinger, R. M. and Papahadjopoulos, D. Meth. Enz. 101:512-527, 1983; Wang, C. Y. and Huang, L., Proc. Natl. Acad. Sci. USA 84:7851-7855, 1987).
[0327] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver a drug into the dermis of mouse skin. Such formulations with antisense polynucleotide agents are useful for treating a dermatological disorder.
[0328] Liposomes that include antisense polynucleotide agent can be made highly deformable. Such deformability can enable the liposomes to penetrate through pore that are smaller than the average radius of the liposome. For example, transfersomes are a type of deformable liposomes. Transfersomes can be made by adding surface edge activators, usually surfactants, to a standard liposomal composition. Transfersomes that include antisense polynucleotide agents can be delivered, for example, subcutaneously by infection in order to deliver antisense polynucleotide agents to keratinocytes in the skin. In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. In addition, due to the lipid properties, these transfersomes can be self-optimizing (adaptive to the shape of pores, e.g., in the skin), self-repairing, and can frequently reach their targets without fragmenting, and often self-loading.
[0329] Other formulations amenable to the present invention are described in U.S. provisional application Ser. No. 61/018,616, filed Jan. 2, 2008; 61/018,611, filed Jan. 2, 2008; 61/039,748, filed Mar. 26, 2008; 61/047,087, filed Apr. 22, 2008 and 61/051,528, filed May 8, 2008. PCT application no PCT/US2007/080331, filed Oct. 3, 2007 also describes formulations that are amenable to the present invention.
[0330] Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g., they are self-optimizing (adaptive to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge-activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.
[0331] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the “head”) provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in “Pharmaceutical Dosage Forms”, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
[0332] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.
[0333] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.
[0334] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.
[0335] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.
[0336] The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in “Pharmaceutical Dosage Forms”, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
[0337] The antisense polynucleotide agent for use in the compositions and methods of the invention can also be provided as micellar formulations. “Micelles” are defined herein as a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.
[0338] A mixed micellar formulation suitable for delivery through transdermal membranes may be prepared by mixing an aqueous solution of the antisense polynucleotide agent composition, an alkali metal C.sub.8 to C.sub.22 alkyl sulphate, and a micelle forming compounds. Exemplary micelle forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleates, monolaurates, borage oil, evening of primrose oil, menthol, trihydroxy oxo cholanyl glycine and pharmaceutically acceptable salts thereof, glycerin, polyglycerin, lysine, polylysine, triolein, polyoxyethylene ethers and analogues thereof, polidocanol alkyl ethers and analogues thereof, chenodeoxycholate, deoxycholate, and mixtures thereof. The micelle forming compounds may be added at the same time or after addition of the alkali metal alkyl sulphate. Mixed micelles will form with substantially any kind of mixing of the ingredients but vigorous mixing in order to provide smaller size micelles.
[0339] In one method a first micellar composition is prepared which contains the antisense polynucleotide agent composition and at least the alkali metal alkyl sulphate. The first micellar composition is then mixed with at least three micelle forming compounds to form a mixed micellar composition. In another method, the micellar composition is prepared by mixing the antisense polynucleotide agent composition, the alkali metal alkyl sulphate and at least one of the micelle forming compounds, followed by addition of the remaining micelle forming compounds, with vigorous mixing.
[0340] Phenol and/or m-cresol may be added to the mixed micellar composition to stabilize the formulation and protect against bacterial growth. Alternatively, phenol and/or m-cresol may be added with the micelle forming ingredients. An isotonic agent such as glycerin may also be added after formation of the mixed micellar composition.
[0341] For delivery of the micellar formulation as a spray, the formulation can be put into an aerosol dispenser and the dispenser is charged with a propellant. The propellant, which is under pressure, is in liquid form in the dispenser. The ratios of the ingredients are adjusted so that the aqueous and propellant phases become one, i.e., there is one phase. If there are two phases, it is necessary to shake the dispenser prior to dispensing a portion of the contents, e.g., through a metered valve. The dispensed dose of pharmaceutical agent is propelled from the metered valve in a fine spray.
[0342] Propellants may include hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ether and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2 tetrafluoroethane) may be used.
[0343] The specific concentrations of the essential ingredients can be determined by relatively straightforward experimentation. For absorption through the oral cavities, it is often desirable to increase, e.g., at least double or triple, the dosage for through injection or administration through the gastrointestinal tract.
[0344] B. Lipid Particles
[0345] Antisense polynucleotide agents of in the invention may be fully encapsulated in a lipid formulation, e.g., a LNP, or other nucleic acid-lipid particle.
[0346] As used herein, the term “LNP” refers to a stable nucleic acid-lipid particle comprising a lipid layer encapsulating a pharmaceutically active molecule. LNPs typically contain a cationic lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG-lipid conjugate). LNPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the administration site). LNPs include “pSPLP,” which include an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00/03683. The particles of the present invention typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when present in the nucleic acid-lipid particles of the present invention are resistant in aqueous solution to degradation with a nuclease. Nucleic acid-lipid particles and their method of preparation are disclosed in, e.g., U.S. Pat. Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; 6,858,225; 8,158,601; and 8,058,069; U.S. Publication No. 2010/0324120 and PCT Publication No. WO 96/40964.
[0347] In one embodiment, the lipid to drug ratio (mass/mass ratio) (e.g., lipid to antisense polynucleotide agent ratio) will be in the range of from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the above recited ranges are also contemplated to be part of the invention.
[0348] The cationic lipid can be, for example, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N—(I-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N—(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-Dioleylamino)-1,2-propanedio (DOAP), 1,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)—N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (MC3), 1,1′-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1), or a mixture thereof. The cationic lipid can comprise from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid present in the particle.
[0349] In another embodiment, the compound 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane can be used to prepare lipid-santisense polynucleotide agent nanoparticles. Synthesis of 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane is described in U.S. provisional patent application No. 61/107,998 filed on Oct. 23, 2008, which is herein incorporated by reference.
[0350] In one embodiment, the lipid-antisense polynucleotide agent particle includes 40% 2, 2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane: 10% DSPC: 40% Cholesterol: 10% PEG-C-DOMG (mole percent) with a particle size of 63.0±20 nm and a 0.027 antisense polynucleotide agent/Lipid Ratio.
[0351] The ionizable/non-cationic lipid can be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), cholesterol, or a mixture thereof. The non-cationic lipid can be from about 5 mol % to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol is included, of the total lipid present in the particle.
[0352] The conjugated lipid that inhibits aggregation of particles can be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof. The PEG-DAA conjugate can be, for example, a PEG-dilauryloxypropyl (Ci.sub.2), a PEG-dimyristyloxypropyl (Ci.sub.4), a PEG-dipalmityloxypropyl (Ci.sub.6), or a PEG-distearyloxypropyl (C].sub.8). The conjugated lipid that prevents aggregation of particles can be from 0 mol % to about 20 mol % or about 2 mol % of the total lipid present in the particle.
[0353] In some embodiments, the nucleic acid-lipid particle further includes cholesterol at, e.g., about 10 mol % to about 60 mol % or about 48 mol % of the total lipid present in the particle.
[0354] In one embodiment, the lipidoid ND98.4HCl (MW 1487) (see U.S. patent application Ser. No. 12/056,230, filed Mar. 26, 2008, which is incorporated herein by reference), Cholesterol (Sigma-Aldrich), and PEG-Ceramide C16 (Avanti Polar Lipids) can be used to prepare lipid-antisense polynucleotide agent nanoparticles (i.e., LNP01 particles). Stock solutions of each in ethanol can be prepared as follows: ND98, 133 mg/ml; Cholesterol, 25 mg/ml, PEG-Ceramide C16, 100 mg/ml. The ND98, Cholesterol, and PEG-Ceramide C16 stock solutions can then be combined in a, e.g., 42:48:10 molar ratio. The combined lipid solution can be mixed with aqueous antisense polynucleotide agent (e.g., in sodium acetate pH 5) such that the final ethanol concentration is about 35-45% and the final sodium acetate concentration is about 100-300 mM. Lipid-antisense polynucleotide agent nanoparticles typically form spontaneously upon mixing. Depending on the desired particle size distribution, the resultant nanoparticle mixture can be extruded through a polycarbonate membrane (e.g., 100 nm cut-off) using, for example, a thermobarrel extruder, such as Lipex Extruder (Northern Lipids, Inc). In some cases, the extrusion step can be omitted. Ethanol removal and simultaneous buffer exchange can be accomplished by, for example, dialysis or tangential flow filtration. Buffer can be exchanged with, for example, phosphate buffered saline (PBS) at about pH 7, e.g., about pH 6.9, about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3, or about pH 7.4.
##STR00017##
[0355] LNP01 formulations are described, e.g., in International Application Publication No. WO 2008/042973, which is hereby incorporated by reference.
[0356] Additional exemplary lipid-antisense polynucleotide agent formulations are described in Table 1.
TABLE-US-00001 TABLE 1 cationic lipid/non-cationic lipid/cholesterol/PEG-lipid conjugate Ionizable/Cationic Lipid Lipid:santisense polynucleotide agent ratio SNALP- 1,2-Dilinolenyloxy-N,N-dimethylaminopropane DLinDMA/DPPC/Cholesterol/PEG-cDMA 1 (DLinDMA) (57.1/7.1/34.4/1.4) lipid:santisense polynucleotide agent ~7:1 2-XTC 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DPPC/Cholesterol/PEG-cDMA dioxolane (XTC) 57.1/7.1/34.4/1.4 lipid:santisense polynucleotide agent ~7:1 LNP05 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 57.5/7.5/31.5/3.5 lipid:santisense polynucleotide agent ~6:1 LNP06 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 57.5/7.5/31.5/3.5 lipid:santisense polynucleotide agent ~11:1 LNP07 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 60/7.5/31/1.5, lipid:santisense polynucleotide agent ~6:1 LNP08 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 60/7.5/31/1.5, lipid:santisense polynucleotide agent ~11:1 LNP09 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 50/10/38.5/1.5 Lipid:santisense polynucleotide agent 10:1 LNP10 (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)- ALN100/DSPC/Cholesterol/PEG-DMG octadeca-9,12-dienyl)tetrahydro-3aH- 50/10/38.5/1.5 cyclopenta[d][1,3]dioxol-5-amine (ALN100) Lipid:santisense polynucleotide agent 10:1 LNP11 (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31- MC-3/DSPC/Cholesterol/PEG-DMG tetraen-19-yl 4-(dimethylamino)butanoate 50/10/38.5/1.5 (MC3) Lipid:santisense polynucleotide agent 10:1 LNP12 1,1′-(2-(4-(2-((2-(bis(2- Tech G1/DSPC/Cholesterol/PEG-DMG hydroxydodecyl)amino)ethyl)(2- 50/10/38.5/1.5 hydroxydodecyl)amino)ethyl)piperazin-1- Lipid:santisense polynucleotide agent 10:1 yl)ethylazanediyl)didodecan-2-ol (Tech G1) LNP13 XTC XTC/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:santisense polynucleotide agent: 33:1 LNP14 MC3 MC3/DSPC/Chol/PEG-DMG 40/15/40/5 Lipid:santisense polynucleotide agent: 11:1 LNP15 MC3 MC3/DSPC/Chol/PEG-DSG/GalNAc-PEG-DSG 50/10/35/4.5/0.5 Lipid:santisense polynucleotide agent: 11:1 LNP16 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:santisense polynucleotide agent: 7:1 LNP17 MC3 MC3/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:santisense polynucleotide agent: 10:1 LNP18 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:santisense polynucleotide agent: 12:1 LNP19 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/35/5 Lipid:santisense polynucleotide agent: 8:1 LNP20 MC3 MC3/DSPC/Chol/PEG-DPG 50/10/38.5/1.5 Lipid:santisense polynucleotide agent: 10:1 LNP21 C12-200 C12-200/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:santisense polynucleotide agent: 7:1 LNP22 XTC XTC/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:santisense polynucleotide agent: 10:1 DSPC: distearoylphosphatidylcholine DPPC: dipalmitoylphosphatidylcholine PEG-DMG: PEG-didimyristoyl glycerol (C14-PEG, or PEG-C14) (PEG with avg mol wt of 2000) PEG-DSG: PEG-distyryl glycerol (C18-PEG, or PEG-C18) (PEG with avg mol wt of 2000) PEG-cDMA: PEG-carbamoyl-1,2-dimyristyloxypropylamine (PEG with avg mol wt of 2000) SNALP (1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA)) comprising formulations are described in International Publication No. WO2009/127060, filed Apr. 15, 2009, which is hereby incorporated by reference.
[0357] XTC comprising formulations are described, e.g., in U.S. Provisional Ser. No. 61/148,366, filed Jan. 29, 2009; U.S. Provisional Ser. No. 61/156,851, filed Mar. 2, 2009; U.S. Provisional Serial No. filed Jun. 10, 2009; U.S. Provisional Ser. No. 61/228,373, filed Jul. 24, 2009; U.S. Provisional Ser. No. 61/239,686, filed Sep. 3, 2009, and International Application No. PCT/US2010/022614, filed Jan. 29, 2010, which are hereby incorporated by reference.
[0358] MC3 comprising formulations are described, e.g., in U.S. Publication No. 2010/0324120, filed Jun. 10, 2010, the entire contents of which are hereby incorporated by reference.
[0359] ALNY-100 comprising formulations are described, e.g., International patent application number PCT/US09/63933, filed on Nov. 10, 2009, which is hereby incorporated by reference.
[0360] C12-200 comprising formulations are described in U.S. Provisional Ser. No. 61/175,770, filed May 5, 2009 and International Application No. PCT/US10/33777, filed May 5, 2010, which are hereby incorporated by reference.
[0361] Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders can be desirable. In some embodiments, oral formulations are those in which the antisense polynucleotide agents featured in the invention are administered in conjunction with one or more penetration enhancer surfactants and chelators. Suitable surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Suitable bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g., sodium). In some embodiments, combinations of penetration enhancers are used, for example, fatty acids/salts in combination with bile acids/salts. One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. Antisense polynucleotide agents featured in the invention can be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Antisense polynucleotide agent complexing agents include poly-amino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans, celluloses and starches. Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g., p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co-glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG). Oral formulations for antisense polynucleotide agents and their preparation are described in detail in U.S. Pat. No. 6,887,906, US Publn. No. 20030027780, and U.S. Pat. No. 6,747,014, each of which is incorporated herein by reference.
[0362] Compositions and formulations for parenteral, intraparenchymal (into the brain), intrathecal, intraventricular or intrahepatic administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
[0363] Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids. Particularly preferred are formulations that target the liver, e.g., when treating hepatic disorders, e.g., hepatic carcinoma.
[0364] The pharmaceutical formulations of the present invention, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
[0365] The compositions of the present invention can be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention can also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions can further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension can also contain stabilizers.
[0366] C. Additional Formulations
[0367] i. Emulsions
[0368] The compositions of the present invention can be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 μm in diameter (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions can be of either the water-in-oil (w/o) or the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions can contain additional components in addition to the dispersed phases, and the active drug which can be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and antioxidants can also be present in emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion.
[0369] Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion can be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that can be incorporated into either phase of the emulsion. Emulsifiers can broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
[0370] Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants can be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y. Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).
[0371] Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.
[0372] A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
[0373] Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.
[0374] Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that can readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used can be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.
[0375] The application of emulsion formulations via dermatological, oral and parenteral routes and methods for their manufacture have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery have been very widely used because of ease of formulation, as well as efficacy from an absorption and bioavailability standpoint (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions.
[0376] ii. Microemulsions
[0377] In one embodiment of the present invention, the compositions of antisense polynucleotide agents are formulated as microemulsions. A microemulsion can be defined as a system of water, oil and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).
[0378] The phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.
[0379] Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions can, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase can typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase can include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
[0380] Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions can form spontaneously when their components are brought together at ambient temperature. This can be particularly advantageous when formulating thermolabile drugs, peptides or antisense polynucleotide agents. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of antisense polynucleotide agents from the gastrointestinal tract, as well as improve the local cellular uptake of antisense polynucleotide agents and nucleic acids.
[0381] Microemulsions of the present invention can also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the antisense polynucleotide agents of the present invention. Penetration enhancers used in the microemulsions of the present invention can be classified as belonging to one of five broad categories—surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.
[0382] iii. Microparticles
[0383] An antisense polynucleotide agent of the invention may be incorporated into a particle, e.g., a microparticle. Microparticles can be produced by spray-drying, but may also be produced by other methods including lyophilization, evaporation, fluid bed drying, vacuum drying, or a combination of these techniques.
[0384] iv. Penetration Enhancers
[0385] In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly antisense polynucleotide agents, to the skin of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs can cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.
[0386] Penetration enhancers can be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.
[0387] Surfactants (or “surface-active agents”) are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of antisense polynucleotide agents through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).
[0388] Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C.sub.1-20 alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (see e.g., Touitou, E., et al. Enhancement in Drug Delivery, CRC Press, Danvers, Mass., 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).
[0389] The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term “bile salts” includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).
[0390] Chelating agents, as used in connection with the present invention, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of antisense polynucleotide agents through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Suitable chelating agents include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines)(see e.g., Katdare, A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, Mass., 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).
[0391] As used herein, non-chelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of antisense polynucleotide agents through the alimentary mucosa (see e.g., Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers includes, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).
[0392] Agents that enhance uptake of antisense polynucleotide agents at the cellular level can also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of antisense polynucleotide agents. Examples of commercially available transfection reagents include, for example Lipofectamine™ (Invitrogen; Carlsbad, Calif.), Lipofectamine 2000™ (Invitrogen; Carlsbad, Calif.), 293Fectin™ (Invitrogen; Carlsbad, Calif.), Cellfectin™ (Invitrogen; Carlsbad, Calif.), DMRIE-C™ (Invitrogen; Carlsbad, Calif.), FreeStyle™ MAX (Invitrogen; Carlsbad, Calif.), Lipofectamine™ 2000 CD (Invitrogen; Carlsbad, Calif.), Lipofectamine™ (Invitrogen; Carlsbad, Calif.), RNAiMAX (Invitrogen; Carlsbad, Calif.), Oligofectamine™ (Invitrogen; Carlsbad, Calif.), Optifect™ (Invitrogen; Carlsbad, Calif.), X-tremeGENE Q2 Transfection Reagent (Roche; Grenzacherstrasse, Switzerland), DOTAP Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), DOSPER Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), or Fugene (Grenzacherstrasse, Switzerland), Transfectam® Reagent (Promega; Madison, Wis.), TransFast™ Transfection Reagent (Promega; Madison, Wis.), Tfx™-20 Reagent (Promega; Madison, Wis.), Tfx™-50 Reagent (Promega; Madison, Wis.), DreamFect™ (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPass.sup.a D1 Transfection Reagent (New England Biolabs; Ipswich, Mass., USA), LyoVec™/LipoGen™ (Invitrogen; San Diego, Calif., USA), PerFectin Transfection Reagent (Genlantis; San Diego, Calif., USA), NeuroPORTER Transfection Reagent (Genlantis; San Diego, Calif., USA), GenePORTER Transfection reagent (Genlantis; San Diego, Calif., USA), GenePORTER 2 Transfection reagent (Genlantis; San Diego, Calif., USA), Cytofectin Transfection Reagent (Genlantis; San Diego, Calif., USA), BaculoPORTER Transfection Reagent (Genlantis; San Diego, Calif., USA), TroganPORTER™ transfection Reagent (Genlantis; San Diego, Calif., USA), RiboFect (Bioline; Taunton, Mass., USA), PlasFect (Bioline; Taunton, Mass., USA), UniFECTOR (B-Bridge International; Mountain View, Calif., USA), SureFECTOR (B-Bridge International; Mountain View, Calif., USA), or HiFect™ (B-Bridge International, Mountain View, Calif., USA), among others.
[0393] Other agents can be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.
[0394] v. Carriers
[0395] Certain compositions of the present invention also incorporate carrier compounds in the formulation. As used herein, “carrier compound” or “carrier” can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioated antisense polynucleotide agent in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4′isothiocyano-stilbene-2,2′-disulfonic acid (Miyao et al., Antisense polynucleotide agent Res. Dev., 1995, 5, 115-121; Takakura et al., Antisense polynucleotide agent & Nucl. Acid Drug Dev., 1996, 6, 177-183.
[0396] vi. Excipients
[0397] In contrast to a carrier compound, a “pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient can be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc).
[0398] Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
[0399] Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions can also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.
[0400] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
[0401] vii. Other Components
[0402] The compositions of the present invention can additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions can contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or can contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
[0403] Aqueous suspensions can contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension can also contain stabilizers.
[0404] In some embodiments, pharmaceutical compositions featured in the invention include (a) one or more antisense polynucleotide agents and (b) one or more agents which function by a non-antisense inhibition mechanism and which are useful in treating a hemolytic disorder. Examples of such agents include, but are not limited to an anti-inflammatory agent, anti-steatosis agent, anti-viral, and/or anti-fibrosis agent. In addition, other substances commonly used to protect the liver, such as silymarin, can also be used in conjunction with the antisense polynucleotide agents described herein. Other agents useful for treating liver diseases include telbivudine, entecavir, and protease inhibitors such as telaprevir and other disclosed, for example, in Tung et al., U.S. Application Publication Nos. 2005/0148548, 2004/0167116, and 2003/0144217; and in Hale et al., U.S. Application Publication No. 2004/0127488.
[0405] Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD.sub.50 (the dose lethal to 50% of the population) and the ED.sub.50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD.sub.50/ED.sub.50. Compounds that exhibit high therapeutic indices are preferred.
[0406] The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of compositions featured herein in the invention lies generally within a range of circulating concentrations that include the ED.sub.50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods featured in the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC.sub.50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography.
[0407] In addition to their administration, as discussed above, the antisense polynucleotide agents featured in the invention can be administered in combination with other known agents effective in treatment of a bleeding disorder. In any event, the administering physician can adjust the amount and timing of antisense polynucleotide agent administration on the basis of results observed using standard measures of efficacy known in the art or described herein.
VII. Methods for Inhibiting Serpinc1 Expression
[0408] The present invention provides methods of inhibiting expression of Serpinc1 in a cell. The methods include contacting a cell with a polynucleotide agent of the invention, e.g., an antisense polynucleotide agent of the invention, in an amount effective to inhibit expression of the Serpinc1 in the cell, thereby inhibiting expression of the Serpinc1 in the cell.
[0409] Contacting of a cell with an antisense polynucleotide agent may be done in vitro or in vivo. Contacting a cell in vivo with the antisense polynucleotide agent includes contacting a cell or group of cells within a subject, e.g., a human subject, with the antisense polynucleotide agent. Combinations of in vitro and in vivo methods of contacting are also possible. Contacting may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In preferred embodiments, the targeting ligand is a carbohydrate moiety, e.g., a GalNAc.sub.3 ligand, or any other ligand that directs the antisense polynucleotide agent to a site of interest, e.g., the liver of a subject.
[0410] The term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating” and other similar terms, and includes any level of inhibition.
[0411] The phrase “inhibiting expression of a Serpinc1” is intended to refer to inhibition of expression of any Serpinc1 gene (such as, e.g., a mouse Serpinc1 gene, a rat Serpinc1 gene, a monkey Serpinc1 gene, or a human Serpinc1 gene) as well as variants or mutants of a Serpinc1 gene. Thus, the Serpinc1 gene may be a wild-type Serpinc1 gene, a mutant Serpinc1 gene, or a transgenic Serpinc1 gene in the context of a genetically manipulated cell, group of cells, or organism.
[0412] “Inhibiting expression of a Serpinc1 gene” includes any level of inhibition of a Serpinc1 gene, e.g., at least partial suppression of the expression of a Serpinc1 gene. The expression of the Serpinc1 gene may be assessed based on the level, or the change in the level, of any variable associated with Serpinc1 gene expression, e.g., Serpinc1 mRNA level, Serpinc1 protein level. This level may be assessed in an individual cell or in a group of cells, including, for example, a sample derived from a subject.
[0413] Inhibition may be assessed by a decrease in an absolute or relative level of one or more variables that are associated with Serpinc1 expression compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).
[0414] In some embodiments of the methods of the invention, expression of a Serpinc1 gene is inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%. at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.
[0415] Inhibition of the expression of a Serpinc1 gene may be manifested by a reduction of the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a Serpinc1 gene is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an antisense polynucleotide agent of the invention, or by administering an antisense polynucleotide agent of the invention to a subject in which the cells are or were present) such that the expression of a Serpinc1 gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s)). In preferred embodiments, the inhibition is assessed by expressing the level of mRNA in treated cells as a percentage of the level of mRNA in control cells, using the following formula:
[0416] Alternatively, inhibition of the expression of a Serpinc1 gene may be assessed in terms of a reduction of a parameter that is functionally linked to Serpinc1 gene expression, e.g., Serpinc1 protein expression.
[0417] Inhibition of the expression of a Serpinc1 protein may be manifested by a reduction in the level of the Serpinc1 protein that is expressed by a cell or group of cells (e.g., the level of protein expressed in a sample derived from a subject). As explained above for the assessment of mRNA suppression, the inhibition of protein expression levels in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells.
[0418] A control cell or group of cells that may be used to assess the inhibition of the expression of a Serpinc1 gene includes a cell or group of cells that has not yet been contacted with an antisense polynucleotide agent of the invention. For example, the control cell or group of cells may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an antisense polynucleotide agent.
[0419] The level of Serpinc1 mRNA that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of Serpinc1 in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the Serpinc1 gene. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy RNA preparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays (Melton et al., Nuc. Acids Res. 12:7035), Northern blotting, in situ hybridization, and microarray analysis.
[0420] In one embodiment, the level of expression of Serpinc1 is determined using a nucleic acid probe. The term “probe”, as used herein, refers to any molecule that is capable of selectively binding to a specific Serpinc1. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.
[0421] Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or Northern analyses, polymerase chain reaction (PCR) analyses and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to Serpinc1 mRNA. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an Affymetrix gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of Serpinc1 mRNA.
[0422] An alternative method for determining the level of expression of Serpinc1 in a sample involves the process of nucleic acid amplification and/or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio/Technology 6:1197), rolling circle replication (Lizardi et al., U.S. Pat. No. 5,854,033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In particular aspects of the invention, the level of expression of Serpinc1 is determined by quantitative fluorogenic RT-PCR (i.e., the TaqMan™ System).
[0423] The expression levels of Serpinc1 mRNA may be monitored using a membrane blot (such as used in hybridization analysis such as Northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See U.S. Pat. Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195 and 5,445,934, which are incorporated herein by reference. The determination of Serpinc1 expression level may also comprise using nucleic acid probes in solution.
[0424] In preferred embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR). The use of these methods is described and exemplified in the Examples presented herein.
[0425] The level of Serpinc1 protein expression may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, Western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like.
[0426] The term “sample” as used herein refers to a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, lymph, urine, cerebrospinal fluid, saliva, ocular fluids, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hepatocytes). In preferred embodiments, a “sample derived from a subject” refers to blood or plasma drawn from the subject. In further embodiments, a “sample derived from a subject” refers to liver tissue derived from the subject.
[0427] In some embodiments of the methods of the invention, the antisense polynucleotide agent is administered to a subject such that the antisense polynucleotide agent is delivered to a specific site within the subject. The inhibition of expression of Serpinc1 may be assessed using measurements of the level or change in the level of Serpinc1 mRNA or Serpinc1 protein in a sample derived from fluid or tissue from the specific site within the subject. In preferred embodiments, the site is the liver. The site may also be a subsection or subgroup of cells from any one of the aforementioned sites. The site may also include cells that express a particular type of receptor.
[0428] The phrase “contacting a cell with an antisense polynucleotide agent,” as used herein, includes contacting a cell by any possible means. Contacting a cell with an antisense polynucleotide agent includes contacting a cell in vitro with the antisense polynucleotide agent or contacting a cell in vivo with the antisense polynucleotide agent. The contacting may be done directly or indirectly. Thus, for example, the antisense polynucleotide agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the antisense polynucleotide agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell.
[0429] Contacting a cell in vitro may be done, for example, by incubating the cell with the antisense polynucleotide agent. Contacting a cell in vivo may be done, for example, by injecting the antisense polynucleotide agent into or near the tissue where the cell is located, or by injecting the antisense polynucleotide agent into another area, e.g., the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the antisense polynucleotide agent may contain and/or be coupled to a ligand, e.g., GalNAc3, that directs the antisense polynucleotide agent to a site of interest, e.g., the liver. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an antisense polynucleotide agent and subsequently transplanted into a subject.
[0430] In one embodiment, contacting a cell with an antisense polynucleotide agent includes “introducing” or “delivering the antisense polynucleotide agent into the cell” by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of an antisense polynucleotide agent can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. Introducing an antisense polynucleotide agent into a cell may be in vitro and/or in vivo. For example, for in vivo introduction, antisense polynucleotide agent can be injected into a tissue site or administered systemically. In vivo delivery can also be done by a beta-glucan delivery system, such as those described in U.S. Pat. Nos. 5,032,401 and 5,607,677, and U.S. Publication No. 2005/0281781, the entire contents of which are hereby incorporated herein by reference. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below and/or are known in the art.
VIII. Methods for Treating or Preventing a Serpinc1-Associated Disorder
[0431] The present invention also provides therapeutic and prophylactic methods which include administering to a subject having a Serpinc1-associated disorder, such as a bleeding disorder, e.g., a hemophilia, an antisense polynucleotide agent or pharmaceutical compositions comprising an antisense polynucleotide agent of the invention. In some aspects of the invention, the methods further include administering to the subject an additional therapeutic agent, e.g., recombinant FVIIa, or recombinant FIX.
[0432] In one aspect, the present invention provides methods of treating a subject having a disorder that would benefit from reduction in Serpinc1 expression, e.g., a bleeding disorder e.g., hemophilia. The treatment methods (and uses) of the invention include administering to the subject, e.g., a human, a therapeutically effective amount of an antisense polynucleotide agent targeting a Serpinc1 gene or a pharmaceutical composition comprising an antisense polynucleotide agent targeting a Serpinc1 gene, thereby treating the subject having a disorder that would benefit from reduction in Serpinc1 expression.
[0433] In another aspect, the present invention provides methods of treating a subject having a disorder that would benefit from reduction in Serpinc1 expression, e.g., a bleeding disorder, e.g., a hemophilia, which include administering to the subject, e.g., a human, a therapeutically effective amount of an antisense polynucleotide agent targeting a Serpinc1 gene or a pharmaceutical composition comprising an antisense polynucleotide agent targeting a Serpinc1 gene, and an additional therapeutic agent, such as recombinant FVIIa, recombinant FIX, or a FXI concentrate, thereby treating the subject having a disorder that would benefit from reduction in Serpinc1 expression.
[0434] In one aspect, the invention provides methods of preventing at least one symptom in a subject having a disorder that would benefit from reduction in Serpinc1 expression, e.g., a bleeding disorder, e.g., a hemophilia. The methods include administering to the subject a prophylactically effective amount of an antisense polynucleotide agent targeting a Serpinc1 gene or a pharmaceutical composition comprising an antisense polynucleotide agent targeting a Serpinc1 gene, thereby preventing at least one symptom in the subject having a disorder that would benefit from reduction in Serpinc1 expression. For example, the invention provides methods for preventing or decreasing the frequency of bleeding in a subject suffering from a bleeding disorder that would benefit from reduction in Serpinc1 expression, e.g., a hemophilia, ulcerative colitis, or an allergic drug reaction.
[0435] In another aspect, the invention provides methods of preventing at least one symptom in a subject having a disorder that would benefit from reduction in Serpinc1 expression, e.g., a bleeding disorder, e.g., disseminated intravascular coagulation, pregnancy-associated eclampsia, or a dermatologic disorder. The methods include administering to the subject a prophylactically effective amount of an antisense polynucleotide agent targeting a Serpinc1 gene or a pharmaceutical composition comprising an antisense polynucleotide agent targeting a Serpinc1 gene, and an additional therapeutic agent, such as an antifibrinolytic, thereby preventing at least one symptom in the subject having a disorder that would benefit from reduction in Serpinc1 expression.
[0436] “Therapeutically effective amount,” as used herein, is intended to include the amount of an antisense polynucleotide agent or an amount of another therapeutic agent, such as an antifibrinolytic, that may be used in combination with the polynucleotide agent, that, when administered to a subject having a bleeding disorder, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease). The “therapeutically effective amount” may vary depending on the antisense polynucleotide agent or the other therapeutic agent, how the polynucleotide agent or the other therapeutic agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated.
[0437] “Prophylactically effective amount,” as used herein, is intended to include the amount of an antisense polynucleotide agent or an amount of another therapeutic agent, such as an antifibrinolytic, that may be used in combination with the polynucleotide agent, that, when administered to a subject having a bleeding disorder but not yet (or currently) experiencing or displaying symptoms of the disorder, and/or a subject at risk of developing a bleeding disorder, e.g., a subject having inflammatory bowel disease or a subject having ulcerative colitis, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The “prophylactically effective amount” may vary depending on the antisense polynucleotide agent or the other therapeutic agent, how the polynucleotide agent or the other therapeutic agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.
[0438] A “therapeutically effective amount” or “prophylactically effective amount” also includes an amount of an antisense polynucleotide agent or an amount of another therapeutic agent, such as an antifibrinolytic, that may be used in combination with the polynucleotide agent, that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment. Antisense polynucleotide agents employed in the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.
[0439] In another aspect, the present invention provides uses of a therapeutically effective amount of an antisense polynucleotide agent of the invention for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of Serpinc1 expression.
[0440] In another aspect, the present invention provides uses of a therapeutically effective amount of an antisense polynucleotide agent of the invention and an additional therapeutic agent, such as recombinant FVIIa for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of Serpinc1 expression.
[0441] In yet another aspect, the present invention provides use of an antisense polynucleotide agent of the invention targeting a Serpinc1 gene or a pharmaceutical composition comprising an antisense polynucleotide agent targeting a Serpinc1 gene in the manufacture of a medicament for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of Serpinc1 expression, such as a subject having a disorder that would benefit from reduction in Serpinc1 expression, e.g., a bleeding disorder, e.g., a hemophilia.
[0442] In another aspect, the present invention provides uses of an antisense polynucleotide agent of the invention targeting a Serpinc1 gene or a pharmaceutical composition comprising an antisense polynucleotide agent targeting a Serpinc1 gene in the manufacture of a medicament for use in combination with an additional therapeutic agent, such as an immunosuppressive agent, for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of Serpinc1 expression, e.g., a bleeding disorder associated with an allergic drug reaction.
[0443] In another aspect, the invention provides uses of an antisense polynucleotide agent of the invention for preventing at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of Serpinc1 expression, such as ulcerative colitis.
[0444] In yet another aspect, the invention provides uses of an antisense polynucleotide agent of the invention, and an additional therapeutic agent, such as an antifibrinolytic agent, for preventing at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of Serpinc1 expression, such as a bleeding disorder, e.g., hemophilia.
[0445] In a further aspect, the present invention provides uses of an antisense polynucleotide agent of the invention in the manufacture of a medicament for preventing at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of Serpinc1 expression, such as a such as a bleeding disorder, e.g., hemophilia.
[0446] In a further aspect, the present invention provides uses of an antisense polynucleotide agent of the invention in the manufacture of a medicament for use in combination with an additional therapeutic agent, such as recombinant FVIIa or recombinant FIX, for preventing at least one symptom in a subject suffering from a disorder that would benefit from a reduction and/or inhibition of Serpinc1 expression, such as a bleeding disorder, e.g., hemophilia.
[0447] In one embodiment, an antisense polynucleotide agent targeting Serpinc1 is administered to a subject having a bleeding disorder such that Serpinc1 levels, e.g., in a cell, tissue, blood, urine or other tissue or fluid of the subject are reduced by at least about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 62%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99% or more and, subsequently, an additional therapeutic (as described below) is administered to the subject.
[0448] The additional therapeutic may be other pharmaceuticals such as, for example, those which are currently employed for treating these disorders. For example, additional therapeutics suitable for treating a subject that would benefit from reduction in Serpinc1 expression, e.g., a subject having a bleeding disorder, include fresh-frozen plasma (FFP); recombinant FVIIa; recombinant FIX; FXI concentrates; virus-inactivated vWF-containing FVIII concentrates; desmopressin acetate [DDAVP]; antifibrinolytics, such as aminocaproic acid and tranexamic acid; activated prothrombin complex concentrate (PCC); antihemophilic agents; corticosteroids; immunosuppressive agents; and estrogens. The polynucleotide agent and an additional therapeutic agent and/or treatment may be administered at the same time and/or in the same combination, e.g., parenterally, or the additional therapeutic agent can be administered as part of a separate composition or at separate times and/or by another method known in the art or described herein. Examples of such another method are desensitization therapy which may include large doses of FVIII or FIX, along with steroids or intravenous immunoglobulin (IVIG) and cyclophosphamide; plasmapheresis in conjunction with immunosuppression and infusion of FVIII or FIX, with or without antifibrinolytic therapy; and immune tolerance induction (ITI), with or without immunosuppressive therapy (e.g., cyclophosphamide, prednisone, and/or anti-CD20).
[0449] Moreover, the additional therapeutic, e.g., recombinant FVIIa may be administered to the subject in the same formulation as the antisense polynucleotide agent targeting Serpinc1 or in a different formulation as the antisense polynucleotide agent targeting Serpinc1.
[0450] The methods and uses of the invention include administering a composition described herein such that expression of the target Serpinc1 gene is decreased, such as for about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24, 28, 32, 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76, or about 80 hours. In one embodiment, expression of the target Serpinc1 gene is decreased for an extended duration, e.g., at least about two, three, four, five, six, seven days or more, e.g., about one week, two weeks, three weeks, or about four weeks or longer.
[0451] Administration of the antisense polynucleotide agent according to the methods and uses of the invention may result in a reduction of the severity, signs, symptoms, and/or markers of such diseases or disorders in a patient with a bleeding. By “reduction” in this context is meant a statistically significant decrease in such level. The reduction can be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%.
[0452] Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. For example, efficacy of treatment of a hemolytic disorder may be assessed, for example, by periodic monitoring of LDH and CH.sub.50 levels. Comparisons of the later readings with the initial readings provide a physician an indication of whether the treatment is effective. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. In connection with the administration of an antisense polynucleotide agent targeting Serpinc1 or pharmaceutical composition thereof, “effective against” a bleeding disorder indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as improvement of symptoms, a cure, a reduction in disease, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating a bleeding disorder.
[0453] A treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease, and preferably at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment. Efficacy for a given antisense polynucleotide agent drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant reduction in a marker or symptom is observed.
[0454] Alternatively, the efficacy can be measured by a reduction in the severity of disease as determined by one skilled in the art of diagnosis based on a clinically accepted disease severity grading scale. Any positive change resulting in e.g., lessening of severity of disease measured using the appropriate scale, represents adequate treatment using an antisense polynucleotide agent or antisense polynucleotide agent formulation as described herein.
[0455] Subjects can be administered a therapeutic amount of antisense polynucleotide agent, such as about 0.01 mg/kg, 0.02 mg/kg, 0.03 mg/kg, 0.04 mg/kg, 0.05 mg/kg, 0.1 mg/kg, 0.15 mg/kg, 0.2 mg/kg, 0.25 mg/kg, 0.3 mg/kg, 0.35 mg/kg, 0.4 mg/kg, 0.45 mg/kg, 0.5 mg/kg, 0.55 mg/kg, 0.6 mg/kg, 0.65 mg/kg, 0.7 mg/kg, 0.75 mg/kg, 0.8 mg/kg, 0.85 mg/kg, 0.9 mg/kg, 0.95 mg/kg, 1.0 mg/kg, 1.1 mg/kg, 1.2 mg/kg, 1.3 mg/kg, 1.4 mg/kg, 1.5 mg/kg, 1.6 mg/kg, 1.7 mg/kg, 1.8 mg/kg, 1.9 mg/kg, 2.0 mg/kg, 2.1 mg/kg, 2.2 mg/kg, 2.3 mg/kg, 2.4 mg/kg, 2.5 mg/kg, 2.6 mg/kg, 2.7 mg/kg, 2.8 mg/kg, 2.9 mg/kg, 3.0 mg/kg, 3.1 mg/kg, 3.2 mg/kg, 3.3 mg/kg, 3.4 mg/kg, 3.5 mg/kg, 3.6 mg/kg, 3.7 mg/kg, 3.8 mg/kg, 3.9 mg/kg, 4.0 mg/kg, 4.1 mg/kg, 4.2 mg/kg, 4.3 mg/kg, 4.4 mg/kg, 4.5 mg/kg, 4.6 mg/kg, 4.7 mg/kg, 4.8 mg/kg, 4.9 mg/kg, 5.0 mg/kg, 5.1 mg/kg, 5.2 mg/kg, 5.3 mg/kg, 5.4 mg/kg, 5.5 mg/kg, 5.6 mg/kg, 5.7 mg/kg, 5.8 mg/kg, 5.9 mg/kg, 6.0 mg/kg, 6.1 mg/kg, 6.2 mg/kg, 6.3 mg/kg, 6.4 mg/kg, 6.5 mg/kg, 6.6 mg/kg, 6.7 mg/kg, 6.8 mg/kg, 6.9 mg/kg, 7.0 mg/kg, 7.1 mg/kg, 7.2 mg/kg, 7.3 mg/kg, 7.4 mg/kg, 7.5 mg/kg, 7.6 mg/kg, 7.7 mg/kg, 7.8 mg/kg, 7.9 mg/kg, 8.0 mg/kg, 8.1 mg/kg, 8.2 mg/kg, 8.3 mg/kg, 8.4 mg/kg, 8.5 mg/kg, 8.6 mg/kg, 8.7 mg/kg, 8.8 mg/kg, 8.9 mg/kg, 9.0 mg/kg, 9.1 mg/kg, 9.2 mg/kg, 9.3 mg/kg, 9.4 mg/kg, 9.5 mg/kg, 9.6 mg/kg, 9.7 mg/kg, 9.8 mg/kg, 9.9 mg/kg, 9.0 mg/kg, 10 mg/kg, 15 mg/kg, 20 mg/kg, 25 mg/kg, 30 mg/kg, 35 mg/kg, 40 mg/kg, 45 mg/kg, or about 50 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.
[0456] In certain embodiments, for example, when a composition of the invention comprises a antisense polynucleotide agent as described herein and a lipid, subjects can be administered a therapeutic amount of antisense polynucleotide agent, such as about 0.01 mg/kg to about 5 mg/kg, about 0.01 mg/kg to about 10 mg/kg, about 0.05 mg/kg to about 5 mg/kg, about 0.05 mg/kg to about 10 mg/kg, about 0.1 mg/kg to about 5 mg/kg, about 0.1 mg/kg to about 10 mg/kg, about 0.2 mg/kg to about 5 mg/kg, about 0.2 mg/kg to about 10 mg/kg, about 0.3 mg/kg to about 5 mg/kg, about 0.3 mg/kg to about 10 mg/kg, about 0.4 mg/kg to about 5 mg/kg, about 0.4 mg/kg to about 10 mg/kg, about 0.5 mg/kg to about 5 mg/kg, about 0.5 mg/kg to about 10 mg/kg, about 1 mg/kg to about 5 mg/kg, about 1 mg/kg to about 10 mg/kg, about 1.5 mg/kg to about 5 mg/kg, about 1.5 mg/kg to about 10 mg/kg, about 2 mg/kg to about 2.5 mg/kg, about 2 mg/kg to about 10 mg/kg, about 3 mg/kg to about 5 mg/kg, about 3 mg/kg to about 10 mg/kg, about 3.5 mg/kg to about 5 mg/kg, about 4 mg/kg to about 5 mg/kg, about 4.5 mg/kg to about 5 mg/kg, about 4 mg/kg to about 10 mg/kg, about 4.5 mg/kg to about 10 mg/kg, about 5 mg/kg to about 10 mg/kg, about 5.5 mg/kg to about 10 mg/kg, about 6 mg/kg to about 10 mg/kg, about 6.5 mg/kg to about 10 mg/kg, about 7 mg/kg to about 10 mg/kg, about 7.5 mg/kg to about 10 mg/kg, about 8 mg/kg to about 10 mg/kg, about 8.5 mg/kg to about 10 mg/kg, about 9 mg/kg to about 10 mg/kg, or about 9.5 mg/kg to about 10 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.
[0457] For example, the antisense polynucleotide agent may be administered at a dose of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.
[0458] In other embodiments, for example, when a composition of the invention comprises a antisense polynucleotide agent as described herein and an N-acetylgalactosamine, subjects can be administered a therapeutic amount of antisense polynucleotide agent, such as a dose of about 0.1 to about 50 mg/kg, about 0.25 to about 50 mg/kg, about 0.5 to about 50 mg/kg, about 0.75 to about 50 mg/kg, about 1 to about 50 mg/mg, about 1.5 to about 50 mg/kb, about 2 to about 50 mg/kg, about 2.5 to about 50 mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg, about 4 to about 50 mg/kg, about 4.5 to about 50 mg/kg, about 5 to about 50 mg/kg, about 7.5 to about 50 mg/kg, about 10 to about 50 mg/kg, about 15 to about 50 mg/kg, about 20 to about 50 mg/kg, about 20 to about 50 mg/kg, about 25 to about 50 mg/kg, about 25 to about 50 mg/kg, about 30 to about 50 mg/kg, about 35 to about 50 mg/kg, about 40 to about 50 mg/kg, about 45 to about 50 mg/kg, about 0.1 to about 45 mg/kg, about 0.25 to about 45 mg/kg, about 0.5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/mg, about 1.5 to about 45 mg/kb, about 2 to about 45 mg/kg, about 2.5 to about 45 mg/kg, about 3 to about 45 mg/kg, about 3.5 to about 45 mg/kg, about 4 to about 45 mg/kg, about 4.5 to about 45 mg/kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg, about 10 to about 45 mg/kg, about 15 to about 45 mg/kg, about 20 to about 45 mg/kg, about 20 to about 45 mg/kg, about 25 to about 45 mg/kg, about 25 to about 45 mg/kg, about 30 to about 45 mg/kg, about 35 to about 45 mg/kg, about 40 to about 45 mg/kg, about 0.1 to about 40 mg/kg, about 0.25 to about 40 mg/kg, about 0.5 to about 40 mg/kg, about 0.75 to about 40 mg/kg, about 1 to about 40 mg/mg, about 1.5 to about 40 mg/kb, about 2 to about 40 mg/kg, about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, about 3.5 to about 40 mg/kg, about 4 to about 40 mg/kg, about 4.5 to about 40 mg/kg, about 5 to about 40 mg/kg, about 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about 40 mg/kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40 mg/kg, about 35 to about 40 mg/kg, about 0.1 to about 30 mg/kg, about 0.25 to about 30 mg/kg, about 0.5 to about 30 mg/kg, about 0.75 to about 30 mg/kg, about 1 to about 30 mg/mg, about 1.5 to about 30 mg/kb, about 2 to about 30 mg/kg, about 2.5 to about 30 mg/kg, about 3 to about 30 mg/kg, about 3.5 to about 30 mg/kg, about 4 to about 30 mg/kg, about 4.5 to about 30 mg/kg, about 5 to about 30 mg/kg, about 7.5 to about 30 mg/kg, about 10 to about 30 mg/kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, about 20 to about 30 mg/kg, about 25 to about 30 mg/kg, about 0.1 to about 20 mg/kg, about 0.25 to about 20 mg/kg, about 0.5 to about 20 mg/kg, about 0.75 to about 20 mg/kg, about 1 to about 20 mg/mg, about 1.5 to about 20 mg/kb, about 2 to about 20 mg/kg, about 2.5 to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg, about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg, about 10 to about 20 mg/kg, or about 15 to about 20 mg/kg. In one embodiment, when a composition of the invention comprises a antisense polynucleotide agent as described herein and an N-acetylgalactosamine, subjects can be administered a therapeutic amount of about 10 to about 30 mg/kg of antisense polynucleotide agent. Values and ranges intermediate to the recited values are also intended to be part of this invention.
[0459] For example, subjects can be administered a therapeutic amount of antisense polynucleotide agent, such as about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg/kg. Values and ranges intermediate to the recited values are also intended to be part of this invention.
[0460] The antisense polynucleotide agent can be administered by intravenous infusion over a period of time, such as over a 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or about a 25 minute period. The administration may be repeated, for example, on a regular basis, such as weekly, biweekly (i.e., every two weeks) for one month, two months, three months, four months or longer. After an initial treatment regimen, the treatments can be administered on a less frequent basis. For example, after administration weekly or biweekly for three months, administration can be repeated once per month, for six months or a year or longer.
[0461] Administration of the antisense polynucleotide agent can reduce Serpinc1 levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99% or more.
[0462] Before administration of a full dose of the antisense polynucleotide agent, patients can be administered a smaller dose, such as a 5% infusion, and monitored for adverse effects, such as an allergic reaction. In another example, the patient can be monitored for unwanted immunostimulatory effects, such as increased cytokine (e.g., TNF-alpha or INF-alpha) levels.
[0463] Owing to the inhibitory effects on Serpinc1 expression, a composition according to the invention or a pharmaceutical composition prepared therefrom can enhance the quality of life.
[0464] An antisense polynucleotide agent of the invention may be administered in “naked” form, or as a “free antisense polynucleotide agent.” A naked antisense polynucleotide agent is administered in the absence of a pharmaceutical composition. The naked antisense polynucleotide agent may be in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the antisense polynucleotide agent can be adjusted such that it is suitable for administering to a subject.
[0465] Alternatively, an antisense polynucleotide agent of the invention may be administered as a pharmaceutical composition, such as an antisense polynucleotide agent liposomal formulation.
[0466] Subjects that would benefit from a reduction and/or inhibition of Serpinc1 gene expression are those having a bleeding disorder as described herein. In one embodiment, a subject having a bleeding disorder has an acquired disorder associated with ulcerative colitis. In another embodiment, a subject having a bleeding disorder has an acquired disorder associated with pregnancy-associated eclampsia. In another embodiment, a subject having a bleeding disorder has an inherited disorder such as von Willebrand's disease. In another embodiment, a subject having a bleeding disorder has an acquired disorder associated with vitamin K deficiency. In yet another embodiment, a subject having a bleeding disorder has an acquired disorder associated with disseminated intravascular coagulation. In one embodiment, a subject having a bleeding disorder has an acquired disorder associated with an autoimmune disorder. In one embodiment, a subject having a bleeding disorder has an acquired disorder associated with inflammatory bowel disease. In another embodiment, a subject having a bleeding disorder has an acquired disorder associated with a dermatologic disorder, e.g., psoriasis or pemphigus. In yet another embodiment, a subject having a bleeding disorder has an acquired disorder associated with a respiratory disease (e.g., asthma or chronic obstructive pulmonary disease). In one embodiment, a subject having a bleeding disorder has an acquired disorder associated with an allergic drug reaction, e.g., the result of medications such as aspirin, heparin, or warfarin. In another embodiment, a subject having a bleeding disorder has an acquired disorder associated with diabetes. In another embodiment, a subject having a bleeding disorder has an acquired disorder associated with acute hepatitis B infection. In another embodiment, a subject having a bleeding disorder has an acquired disorder associated with acute hepatitis C infection. In another embodiment, a subject having a bleeding disorder has an acquired disorder associated with a malignancy or solid tumor, (e.g., prostate, lung, colon, colon, pancreas, stomach, bile duct, head and neck, cervix, breast, melanoma, kidney) or a hematologic malignancy. In another embodiment, a subject has an inherited bleeding disorder, e.g., hemophilia A, B, or C. In one embodiment, the subject having an inherited bleeding disorder, e.g., a hemophilia has developed inhibitors, e.g., alloantibody inhibitors to replacement coagulation therapies. Such a subject is referred to herein as an “inhibitor subject.” In one embodiment, the inhibitor subject has hemophilia A. In another embodiment, the inhibitor subject has hemophilia B. In yet another embodiment, the inhibitor subject has hemophilia C.
[0467] Treatment of a subject that would benefit from a reduction and/or inhibition of Serpinc1 gene expression includes therapeutic and prophylactic (e.g., the subject is to undergo sensitized (or allogenic) transplant surgery) treatment.
[0468] The invention further provides methods and uses of an antisense polynucleotide agent or a pharmaceutical composition thereof for treating a subject that would benefit from reduction and/or inhibition of Serpinc1 expression, e.g., a subject having a bleeding disorder, in combination with other pharmaceuticals and/or other therapeutic methods, e.g., with known pharmaceuticals and/or known therapeutic methods, such as, for example, those which are currently employed for treating these disorders. For example, in certain embodiments, an antisense polynucleotide agent targeting Serpinc1 is administered in combination with, e.g., an agent useful in treating a bleeding disorder as described elsewhere herein.
[0469] For example, additional therapeutics and therapeutic methods suitable for treating a subject that would benefit from reduction in Serpinc1 expression, e.g., a subject having a bleeding disorder, include known pharmaceuticals and/or known therapeutic methods, such as, for example, those which are currently employed for treating these disorders. For example, in certain embodiments, an antisense polynucleotide agent targeting Serpinc1 is administered in combination with, e.g., an agent useful in treating a bleeding disorder as described elsewhere herein. For example, additional therapeutics and therapeutic methods suitable for treating a subject that would benefit from reduction in Serpinc1 expression, e.g., a subject having a bleeding disorder, include fresh-frozen plasma (FFP); recombinant FVIIa; recombinant FIX; FXI concentrates; virus-inactivated, vWF-containing FVIII concentrates; desensitization therapy which may include large doses of FVIII or FIX, along with steroids or intravenous immunoglobulin (IVIG) and cyclophosphamide; plasmapheresis in conjunction with immunosuppression and infusion of FVIII or FIX, with or without antifibrinolytic therapy; immune tolerance induction (ITI), with or without immunosuppressive therapy (e.g., cyclophosphamide, prednisone, and/or anti-CD20); desmopressin acetate [DDAVP]; antifibrinolytics, such as aminocaproic acid and tranexamic acid; activated prothrombin complex concentrate (PCC); antihemophilic agents; corticosteroids; immunosuppressive agents; and estrogens.
[0470] The antisense polynucleotide agent and an additional therapeutic agent and/or treatment may be administered at the same time and/or in the same combination, e.g., parenterally, or the additional therapeutic agent can be administered as part of a separate composition or at separate times and/or by another method known in the art or described herein.
[0471] The present invention also provides methods of using an antisense polynucleotide agent of the invention and/or a composition containing an antisense polynucleotide agent of the invention to reduce and/or inhibit Serpinc1 expression in a cell. In other aspects, the present invention provides an antisense polynucleotide agent of the invention and/or a composition comprising an antisense polynucleotide agent of the invention for use in reducing and/or inhibiting Serpinc1 expression in a cell. In yet other aspects, use of an antisense polynucleotide agent of the invention and/or a composition comprising an antisense polynucleotide agent of the invention for the manufacture of a medicament for reducing and/or inhibiting Serpinc1 expression in a cell are provided.
[0472] The methods and uses include contacting the cell with an antisense polynucleotide agent, e.g., a antisense polynucleotide agent, of the invention and maintaining the cell for a time sufficient to obtain antisense inhibition of a Serpinc1 gene, thereby inhibiting expression of the Serpinc1 gene in the cell.
[0473] Reduction in gene expression can be assessed by any methods known in the art. For example, a reduction in the expression of Serpinc1 may be determined by determining the mRNA expression level of Serpinc1 using methods routine to one of ordinary skill in the art, e.g., Northern blotting, qRT-PCR, by determining the protein level of Serpinc1 using methods routine to one of ordinary skill in the art, such as Western blotting, immunological techniques, flow cytometry methods, ELISA, and/or by determining a biological activity of Serpinc1 and/or by determining the biological activity of one or more molecules associated with Serpinc1 in the coagulation pathway.
[0474] In the methods and uses of the invention the cell may be contacted in vitro or in vivo, i.e., the cell may be within a subject. In embodiments of the invention in which the cell is within a subject.
[0475] A cell suitable for treatment using the methods of the invention may be any cell that expresses a Serpinc1 gene. A cell suitable for use in the methods and uses of the invention may be a mammalian cell, e.g., a primate cell (such as a human cell or a non-human primate cell, e.g., a monkey cell or a chimpanzee cell), a non-primate cell (such as a cow cell, a pig cell, a camel cell, a llama cell, a horse cell, a goat cell, a rabbit cell, a sheep cell, a hamster, a guinea pig cell, a cat cell, a dog cell, a rat cell, a mouse cell, a lion cell, a tiger cell, a bear cell, or a buffalo cell), a bird cell (e.g., a duck cell or a goose cell), or a whale cell. In one embodiment, the cell is a human cell, e.g., a human liver cell.
[0476] Serpinc1 expression may be inhibited in the cell by at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or about 100%.
[0477] The in vivo methods and uses of the invention may include administering to a subject a composition containing an antisense polynucleotide agent, where the antisense polynucleotide agent includes a nucleotide sequence that is complementary to at least a part of an RNA transcript of the Serpinc1 gene of the mammal to be treated. When the organism to be treated is a mammal such as a human, the composition can be administered by any means known in the art including, but not limited to subcutaneous, intravenous, oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by subcutaneous or intravenous infusion or injection.
[0478] In some embodiments, the administration is via a depot injection. A depot injection may release the antisense polynucleotide agent in a consistent way over a prolonged time period. Thus, a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e.g., a desired inhibition of Serpinc1, or a therapeutic or prophylactic effect. A depot injection may also provide more consistent serum concentrations. Depot injections may include subcutaneous injections or intramuscular injections. In preferred embodiments, the depot injection is a subcutaneous injection.
[0479] In some embodiments, the administration is via a pump. The pump may be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. An infusion pump may be used for intravenous, subcutaneous, arterial, or epidural infusions. In preferred embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the antisense polynucleotide agent to the liver.
[0480] The mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated. The route and site of administration may be chosen to enhance targeting.
[0481] In one aspect, the present invention also provides methods for inhibiting the expression of a Serpinc1 gene in a mammal, e.g., a human. The present invention also provides a composition comprising an antisense polynucleotide agent that targets a Serpinc1 gene in a cell of a mammal for use in inhibiting expression of the Serpinc1 gene in the mammal. In another aspect, the present invention provides use of an antisense polynucleotide agent that targets a Serpinc1 gene in a cell of a mammal in the manufacture of a medicament for inhibiting expression of the Serpinc1 gene in the mammal.
[0482] The methods and uses include administering to the mammal, e.g., a human, a composition comprising an antisense polynucleotide agent that targets a Serpinc1 gene in a cell of the mammal and maintaining the mammal for a time sufficient to obtain antisense inhibition of the mRNA transcript of the Serpinc1 gene, thereby inhibiting expression of the Serpinc1 gene in the mammal.
[0483] Reduction in gene expression can be assessed by any methods known it the art and by methods, e.g. qRT-PCR, described herein. Reduction in protein production can be assessed by any methods known it the art and by methods, e.g., ELISA or Western blotting, described herein. In one embodiment, a puncture liver biopsy sample serves as the tissue material for monitoring the reduction in Serpinc1 gene and/or protein expression. In another embodiment, a blood sample serves as the tissue material for monitoring the reduction in Serpinc1 gene and/or protein expression. In other embodiments, inhibition of the expression of a Serpinc1 gene is monitored indirectly by, for example, determining the expression and/or activity of a gene in a Serpinc1 pathway (see, e.g.,
[0484] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the antisense polynucleotide agents and methods featured in the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
EXAMPLES
Example 1. Antisense Synthesis
[0485] The antisense polynucleotides targeting Serpinc1 were synthesized using standard synthesis methods well known in the art.
[0486] Design of antisense polynucleotides was carried out using the following transcripts from the NCBI RefSeq collection: Human—NM_000488.2, NM_000488.3; Rhesus—NM_001104583.1; Dog—XM_856414.1; Mouse—NM_080844.4; Rat—NM_001012027.1.
[0487] A detailed list of antisense molecules targeting Serpinc1 is shown in Tables 3 and 4 below.
TABLE-US-00002 TABLE 2 Abbreviations of nucleotide monomers used in nucleic acid sequence representation. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5′-3′-phosphodiester bonds. Abbreviation Nucleotide(s) A Adenosine-3′-phosphate Af 2′-fluoroadenosine-3′-phosphate Afs 2′-fluoroadenosine-3′-phosphorothioate As adenosine-3′-phosphorothioate a 2′-O-methyladenosine-3′-phosphate as 2′-O-methyladenosine-3′-phosphorothioate C cytidine-3′-phosphate dA 2′-deoxyadenosine-3′-phosphate dAs 2′-deoxyadenosine-3′-phosphorothioate Cf 2′-fluorocytidine-3′-phosphate Cfs 2′-fluorocytidine-3′-phosphorothioate Cs cytidine-3′-phosphorothioate c 2′-O-methylcytidine-3′-phosphate cs 2′-O-methylcytidine-3′-phosphorothioate dC 2′-deoxycytidine-3′-phosphate dCs 2′-deoxycytidine-3′-phosphorothioate G guanosine-3′-phosphate Gf 2′-fluoroguanosine-3′-phosphate Gfs 2′-fluoroguanosine-3′-phosphorothioate Gs guanosine-3′-phosphorothioate g 2′-O-methylguanosine-3′-phosphate gs 2′-O-methylguanosine-3′-phosphorothioate dG 2′-deoxyguanosine-3′-phosphate dGs 2′-deoxyguanosine-3′-phosphorothioate T 5′-methyluridine-3′-phosphate Tf 2′-fluoro-5-methyluridine-3′-phosphate Tfs 2′-fluoro-5-methyluridine-3′-phosphorothioate Ts 5-methyluridine-3′-phosphorothioate t 2′-O-methyl-5-methyluridine-3′-phosphate ts 2′-O-methyl-5-methyluridine-3′-phosphorothioate dT 2′-deoxythymidine-3′-phosphate dTs 2′-deoxythymidine-3′-phosphorothioate U Uridine-3′-phosphate Uf 2′-fluorouridine-3′-phosphate Ufs 2′-fluorouridine-3′-phosphorothioate Us uridine-3′-phosphorothioate u 2′-O-methyluridine-3′-phosphate us 2′-O-methyluridine-3′-phosphorothioate dU 2′-deoxyuridine-3′-phosphate dUs 2′-deoxyuridine-3′-phosphorothioate s phosphorothioate linkage N any nucleotide (G, A, C, T or U) L96 N-[tris(GalNAc-alkyl)-amidodecanoyl)]- 4-hydroxyprolinol Hyp-(GalNAc-alkyl)3 (dt) deoxy-thymine (5MdC) or (m5dC) 5′-methyl-deoxycytidine-3′-phosphate (5MdC)s or 5′-methyl-deoxycytidine-3′-phosphorothioate (m5dCs)
TABLE-US-00003 TABLE 3 Antisense polynucleotides targeting Serpinc1(AT3) Alterna- tive SEQ Oligonucleotide SEQ Sequence Sequence ID Sequence ID ID ID Modified Sequence (5′-3′) NO. (5′-3′) NO. A-131024.1 X10631 csusasasasdTs(5MdC)sdTs(5MdC)sdGs(5MdC)sdAsdGsdAsdGsdG 13 CTAAATCTCGCAGAGGGTTC 197 sgsususcsc C A-131025.1 X10632 gsususcsusdTsdTs(5MdC)s(5MdC)sdTs(5MdC)sdTsdAsdAsdAsdT 14 GTTCTTTCCTCTAAATTCTCG 198 suscsuscsg A-131026.1 X10633 csusgsasasdAsdAs(5MdC)sdTsdGsdGsdTsdTs(5MdC)sdTsdTsusu 15 CTGAAAACTGGTTCTTTTCC 199 scscsu T A-131027.1 X10634 gsgscsasasdTs(5MdC)s(5MdC)sdGs(5MdC)s(5MdC)sdTsdGsdAsd 16 GGCAATCCGCCTGAAAAAC 200 AsdAsasascsusg TG A-131028.1 X10635 usgsusgsasdTs(5MdC)sdTsdGsdAsdGsdGs(5MdC)sdAsdAsdTsusc 17 TGTGATCTGAGGCAATTCCG 201 scsgsc C A-131029.1 X10636 gsusgsgsasdGsdAsdTsdAsdGsdTsdGsdTsdGsdAsdTsuscsusgsa 18 GTGGAGATAGTGTGATTCTG 202 A A-131030.1 X10637 gsgscsusgsdGsdGs(5MdC)sdAsdAsdGsdTsdGsdGsdAsdGsgsasusa 19 GGCTGGGCAAGTGGAGGAT 203 sg AG A-131031.1 X10638 uscsususcs(5MdC)sdAs(5MdC)sdAsdGsdGsdGs(5MdC)sdTsdGsdG 20 TCTTCCACAGGGCTGGGGCA 204 sgsgscsasa A A-131032.1 X10639 usgsgscscsdGs(5MdC)sdTsdAsdAsdTs(5MdC)sdTsdTs(5MdC)s 21 TGGCCGCTAATCTTCCCACA 205 (5MdC)scsascsasg G A-131033.1 X10640 ususgsgsasdAsdTsdAs(5MdC)sdAsdTsdGsdGs(5MdC)s(5MdC)sdG 22 TTGGAATACATGGCCGGCTA 206 sgscsusasa A A-131034.1 X10641 uscscsusasdTs(5MdC)sdAs(5MdC)sdAsdTsdTsdGsdGsdAsdAsasu 23 TCCTATCACATTGGAAATAC 207 sascsa A A-131035.1 X10642 asgsgsususdAs(5MdC)sdAsdGsdTsdTs(5MdC)s(5MdC)sdTsdAsdT 24 AGGTTACAGTTCCTATTCAC 208 suscsascsa A A-131036.1 X10643 csususususdTs(5MdC)s(5MdC)sdAsdGsdAsdGsdGsdTsdTsdAsasc 25 CTTTTTCCAGAGGTTAACAG 209 sasgsu T A-131037.1 X10644 asusasasas(5MdC)s(5MdC)sdTsdTs(5MdC)s(5MdC)sdTsdTsdTsd 26 ATAAACCTTCCTTTTTTCCA 210 TsdTsuscscsasg G A-131038.1 X10645 asgsgsascsdAsdAsdAsdAsdGsdAsdTsdAsdAsdAs(5MdC)scscsusu 27 AGGACAAAAGATAAACCCT 211 sc TC A-131039.1 X10646 asusgsasgs(5MdC)sdAsdGs(5MdC)sdAsdAsdGsdGsdAs(5MdC)sdA 28 ATGAGCAGCAAGGACAAAA 212 sasasasasg AG A-131040.1 X10647 cscsasgsasdAsdGs(5MdC)s(5MdC)sdAsdAsdTsdGsdAsdGs(5MdC) 29 CCAGAAGCCAATGAGCCAG 213 scsasgscsa CA A-131041.1 X10648 uscsascsgs(5MdC)sdAsdGsdTs(5MdC)s(5MdC)s(5MdC)sdAsdGsd 30 TCACGCAGTCCCAGAAAGC 214 AsdAsasgscscsa CA A-131042.1 X10649 cscsgsusgsdAs(5MdC)sdAsdGsdGsdTs(5MdC)sdAs(5MdC)sdGs 31 CCGTGACAGGTCACGCCAGT 215 (5MdC)scsasgsusc C A-131043.1 X10650 csascsasgsdGsdGs(5MdC)sdTs(5MdC)s(5MdC)s(5MdC)sdGsdTsd 32 CACAGGGCTCCCGTGAACA 216 GsdAsascsasgsg GG A-131044.1 X10651 usgscsasgsdAsdTsdGsdTs(5MdC)s(5MdC)sdAs(5MdC)sdAsdGsdG 33 TGCAGATGTCCACAGGGGCT 217 sgsgscsusc C A-131045.1 X10652 gsgscsususdGsdGs(5MdC)sdTsdGsdTsdGs(5MdC)sdAsdGsdAsasu 34 GGCTTGGCTGTGCAGAATGT 218 sgsusc C A-131046.1 X10653 asasusgsus(5MdC)s(5MdC)s(5MdC)sdGs(5MdC)sdGsdGs(5MdC)s 35 AATGTCCCGCGGCTTGGGCT 219 dTsdTsdGsgsgscsusg G A-131047.1 X10654 gsasususcsdAsdTsdGsdGsdGsdAsdAsdTsdGsdTs 36 GATTCATGGGAATGTCCCCG 220 (5MdC)scscscsgsc C A-131048.1 X10655 asusgscsas(5MdC)sdAsdTsdGsdGsdGsdAsdTsdTs(5MdC)sdAsasu 37 ATGCACATGGGATTCAATGG 221 sgsgsg G A-131049.1 X10656 gsgsasgscsdGsdGsdTsdAsdAsdAsdTsdGs(5MdC)sdAs(5MdC)scsa 38 GGAGCGGTAAATGCACCAT 222 susgsg GG A-131050.1 X10657 uscsususcsdTs(5MdC)s(5MdC)sdGsdGsdGsdGsdAsdGs(5MdC)sdG 39 TCTTCTCCGGGGAGCGGGTA 223 sgsgsusasa A A-131051.1 X10658 uscsasgsusdTsdGs(5MdC)s(5MdC)sdTsdTs(5MdC)sdTsdTs 40 TCAGTTGCCTTCTTCTTCCG 224 (5MdC)sdTsuscscsgsg G A-131052.1 X10659 gscscscsus(5MdC)sdAsdTs(5MdC)s(5MdC)sdTs(5MdC)sdAsdGsd 41 GCCCTCATCCTCAGTTTGCC 225 TsdTsusgscscsu T A-131053.1 X10660 uscsusgsusdTs(5MdC)sdTsdGsdAsdGs(5MdC)s(5MdC)s(5MdC)sd 42 TCTGTTCTGAGCCCTCCATC 226 Ts(5MdC)scsasuscsc C A-131054.1 X10661 uscscsgsgsdGsdAsdTs(5MdC)sdTsdTs(5MdC)sdTsdGsdTsdTsusc 43 TCCGGGATCTTCTGTTTCTG 227 susgsa A A-131055.1 X10662 gsususgsgsdTsdGsdGs(5MdC)s(5MdC)sdTs(5MdC)s(5MdC)sdGsd 44 GTTGGTGGCCTCCGGGGATC 228 GsdGsgsasuscsu T A-131056.1 X10663 asgsascsas(5MdC)sdGs(5MdC)s(5MdC)sdGsdGsdTsdTsdGsdGsdT 45 AGACACGCCGGTTGGTTGGC 229 susgsgscsc C A-131057.1 X10664 gsascsasgsdTsdTs(5MdC)s(5MdC)s(5MdC)sdAsdGsdAs(5MdC)sd 46 GACAGTTCCCAGACACCGCC 230 As(5MdC)scsgscscsg G A-131058.1 X10665 asususgsgs(5MdC)s(5MdC)sdTsdTsdGsdGsdAs(5MdC)sdAsdGsdT 47 ATTGGCCTTGGACAGTTTCC 231 sususcscsc C A-131059.1 X10666 csasasasgs(5MdC)sdGsdGsdGsdAsdAsdTsdTsdGsdGs(5MdC)scsc 48 CAAAGCGGGAATTGGCCCTT 232 sususg G A-131060.1 X10667 asasasgsusdGsdGsdTsdAsdGs(5MdC)sdAsdAsdAsdGs(5MdC)scsg 49 AAAGTGGTAGCAAAGCCGG 233 sgsgsa GA A-131061.1 X10668 gsusgscsusdGsdAsdTsdAsdGsdAsdAsdAsdGsdTsdGsgsgsusasg 50 GTGCTGATAGAAAGTGGGT 234 AG A-131062.1 X10669 asasuscsusdGs(5MdC)s(5MdC)sdAsdGsdGsdTsdGs(5MdC)sdTsdG 51 AATCTGCCAGGTGCTGGATA 235 sgsasusasg G A-131063.1 X10670 uscsasusus(5MdC)sdTsdTsdGsdGsdAsdAsdTs(5MdC)sdTsdGsgsc 52 TCATTCTTGGAATCTGGCCA 236 scsasg G A-131064.1 X10671 gsususasus(5MdC)sdAsdTsdTsdGsdTs(5MdC)sdAsdTsdTs(5MdC) 53 GTTATCATTGTCATTCCTTG 237 scsususgsg G A-131065.1 X10672 ascsasgsgsdAsdAsdAsdAsdTsdGsdTsdTsdAsdTs(5MdC)scsasusu 54 ACAGGAAAATGTTATCCATT 238 sg G A-131066.1 X10673 csuscsasgsdGsdGsdGsdTsdGsdAs(5MdC)sdAsdGsdGsdAsasasasa 55 CTCAGGGGTGACAGGAAAA 239 su AT A-131067.1 X10674 csgsusgsgsdAsdGsdAsdTsdAs(5MdC)sdTs(5MdC)sdAsdGsdGsgsg 56 CGTGGAGATACTCAGGGGG 240 sgsusg TG A-131068.1 X10675 usasgscsasdAsdAsdAsdGs(5MdC)s(5MdC)sdGsdTsdGsdGsdAsasg 57 TAGCAAAAGCCGTGGAAGA 241 sasusa TA A-131069.1 X10676 asgscsususdGsdGsdTs(5MdC)sdAsdTsdAsdGs(5MdC)sdAsdAsasa 58 AGCTTGGTCATAGCAAAAA 242 sasgsc GC A-131070.1 X10677 ascsasgsgs(5MdC)sdAs(5MdC)s(5MdC)s(5MdC)sdAsdGs(5MdC)s 59 ACAGGCACCCAGCTTGGGTC 243 cTsdTsdGsgsgsuscsa A A-131071.1 X10678 gsgsgsusgsdTs(5MdC)sdAsdTsdTsdAs(5MdC)sdAsdGsdGs(5MdC) 60 GGGTGTCATTACAGGCCACC 244 scsascscsc C A-131072.1 X10679 asgsususgs(5MdC)sdTsdGsdGsdAsdGsdGsdGsdTsdGsdTsuscsasu 61 AGTTGCTGGAGGGTGTTCAT 245 su T A-131073.1 X10680 usascscsus(5MdC)s(5MdC)sdAsdTs(5MdC)sdAsdGsdTsdTsdGs 62 TACCTCCATCAGTTGCCTGG 246 (5MdC)scsusgsgsa A A-131074.1 X10681 csasasascsdTsdTsdAsdAsdAsdTsdAs(5MdC)s(5MdC)sdTs(5MdC) 63 CAAACTTAAATACCTCCCAT 247 scscsasusc C A-131075.1 X10682 gsasusasusdGsdGsdTsdGsdTs(5MdC)sdAsdAsdAs(5MdC)sdTsusu 64 GATATGGTGTCAAACTTTAA 248 sasasa A A-131076.1 X10683 usgsusususdTs(5MdC)sdTs(5MdC)sdAsdGsdAsdTsdAsdTsdGsgsg 65 TGTTTTCTCAGATATGGGTG 249 susgsu T A-131077.1 X10684 uscsusgsasdTs(5MdC)sdAsdGsdAsdTsdGsdTsdTsdTsdTsuscsusc 66 TCTGATCAGATGTTTTTCTC 250 sa A A-131078.1 X10685 asasgsasasdGsdTsdGsdGsdAsdTs(5MdC)sdTsdGsdAsdTsuscsasg 67 AAGAAGTGGATCTGATTCA 251 sa GA A-131079.1 X10686 usususgsgs(5MdC)sdAsdAsdAsdGsdAsdAsdGsdAsdAsdGsgsusgsg 68 TTTGGCAAAGAAGAAGGTG 252 sa GA A-131080.1 X10687 gsgscsasgsdTsdTs(5MdC)sdAsdGsdTsdTsdTsdGsdGs(5MdC)scsa 69 GGCAGTTCAGTTTGGCCAAA 253 sasasg G A-131081.1 X10688 csgsasusasdGsdAsdGsdTs(5MdC)sdGsdGs(5MdC)sdAsdGsdTsusu 70 CGATAGAGTCGGCAGTTTCA 254 scsasg G A-131082.1 X10689 gsususgsgs(5MdC)sdTsdTsdTsdTs(5MdC)sdGsdAsdTsdAsdGsgsa 71 GTTGGCTTTTCGATAGGAGT 255 sgsusc C A-131083.1 X10690 usgsgsasgsdGsdAsdTsdTsdTsdGsdTsdTsdGsdGs(5MdC)scsususu 72 TGGAGGATTTGTTGGCCTTT 256 su T A-131084.1 X10691 gsasusascsdTsdAsdAs(5MdC)sdTsdTsdGsdGsdAsdGsdGsgsasusu 73 GATACTAACTTGGAGGGATT 257 su T A-131085.1 X10692 gscsgsasusdTsdGsdGs(5MdC)sdTsdGsdAsdTsdAs(5MdC)sdTsusa 74 GCGATTGGCTGATACTTAAC 258 sascsu T A-131086.1 X10693 csuscscsasdAsdAsdAsdAsdGsdGs(5MdC)sdGsdAsdTsdTsusgsgsc 75 CTCCAAAAAGGCGATTTGGC 259 su T A-131087.1 X10694 asgsgsgsasdTsdTsdTsdGsdTs(5MdC)sdTs(5MdC)s(5MdC)sdAsdA 76 AGGGATTTGTCTCCAAAAAA 260 sasasasasg G A-131088.1 X10695 asususgsasdAsdGsdGsdTsdAsdAsdGsdGsdGsdAsdTsusususgsu 77 ATTGAAGGTAAGGGATTTTG 261 T A-131089.1 X10696 gsgsusasgsdGsdTs(5MdC)sdTs(5MdC)sdAsdTsdTsdGsdAsdAsasg 78 GGTAGGTCTCATTGAAAGGT 262 sgsusa A A-131090.1 X10697 csusgsasusdGsdTs(5MdC)s(5MdC)sdTsdGsdGsdTsdAsdGsdGsgsu 79 CTGATGTCCTGGTAGGGTCT 263 scsusc C A-131091.1 X10698 usascscsasdAs(5MdC)sdTs(5MdC)sdAs(5MdC)sdTsdGsdAsdTsdG 80 TACCAACTCACTGATGGTCC 264 sgsuscscsu T A-131092.1 X10699 usgsgscsus(5MdC)s(5MdC)sdAsdTsdAsdTsdAs(5MdC)s(5MdC)sd 81 TGGCTCCATATACCAAACTC 265 AsdAsascsuscsa A A-131093.1 X10700 gsgscsusgsdGsdAsdGs(5MdC)sdTsdTsdGsdGs(5MdC)sdTs(5MdC) 82 GGCTGGAGCTTGGCTCCCAT 266 scscsasusa A A-131094.1 X10701 gsasasgsus(5MdC)s(5MdC)sdAsdGsdGsdGsdGs(5MdC)sdTsdGsdG 83 GAAGTCCAGGGGCTGGGAG 267 sgsasgscsu CT A-131095.1 X10702 csasusususdTs(5MdC)s(5MdC)sdTsdTsdGsdAsdAsdGsdTs(5MdC) 84 CATTTTCCTTGAAGTCCCAG 268 scscsasgsg G A-131096.1 X10703 gsasususgs(5MdC)sdTs(5MdC)sdTsdGs(5MdC)sdAsdTsdTsdTsdT 85 GATTGCTCTGCATTTTTCCTT 269 suscscsusu A-131097.1 X10704 gsgscscsgs(5MdC)sdTs(5MdC)sdTsdGsdGsdAsdTsdTsdGs(5MdC) 86 GGCCGCTCTGGATTGCCTCT 270 scsuscsusg G A-131098.1 X10705 asusususgsdTsdTsdGsdAsdTsdGsdGs(5MdC)s(5MdC)sdGs(5MdC) 87 ATTTGTTGATGGCCGCCTCT 271 scsuscsusg G A-131099.1 X10706 ususgsgsas(5MdC)sdAs(5MdC)s(5MdC)s(5MdC)sdAsdTsdTsdTsd 88 TTGGACACCCATTTGTTTGA 272 GsdTsususgsasu T A-131100.1 X10707 ususcsgsgsdTs(5MdC)sdTsdTsdAsdTsdTsdGsdGsdAs(5MdC)scsa 89 TTCGGTCTTATTGGACCACC 273 scscsc C A-131101.1 X10708 usgsasusus(5MdC)sdGsdGs(5MdC)s(5MdC)sdTsdTs(5MdC)sdGsd 90 TGATTCGGCCTTCGGTTCTT 274 GsdTsuscsususa A A-131102.1 X10709 asusgsascsdAsdTs(5MdC)sdGsdGsdTsdGsdAsdTsdTs(5MdC)scsg 91 ATGACATCGGTGATTCCGGC 275 sgscsc C A-131103.1 X10710 ususcscsgsdAsdGsdGsdGsdAsdAsdTsdGsdAs(5MdC)sdAsasuscsg 92 TTCCGAGGGAATGACAATC 276 sg GG A-131104.1 X10711 csasususgsdAsdTsdGsdGs(5MdC)sdTsdTs(5MdC)s(5MdC)sdGsdA 93 CATTGATGGCTTCCGAAGGG 277 sasgsgsgsa A A-131105.1 X10712 ascsasgsusdGsdAsdGs(5MdC)sdTs(5MdC)sdAsdTsdTsdGsdAsasu 94 ACAGTGAGCTCATTGAATGG 278 sgsgsc C A-131106.1 X10713 csasgscsas(5MdC)s(5MdC)sdAsdGsdAsdAs(5MdC)sdAsdGsdTsdG 95 CAGCACCAGAACAGTGGAG 279 sgsasgscsu CT A-131107.1 X10714 asascscsasdGs(5MdC)sdAs(5MdC)s(5MdC)sdAsdGsdAsdAs 96 AACCAGCACCAGAACAAGT 280 (5MdC)sdAsasgsusgsa GA A-131108.1 X10715 usasascscsdAsdGs(5MdC)sdAs(5MdC)s(5MdC)sdAsdGsdAsdAs 97 TAACCAGCACCAGAACCAG 281 (5MdC)scsasgsusg TG A-131109.1 X10716 ususasascs(5MdC)sdAsdGs(5MdC)sdAs(5MdC)s(5MdC)sdAsdGsd 98 TTAACCAGCACCAGAAACA 282 AsdAsascsasgsu GT A-131110.1 X10717 gsususasas(5MdC)s(5MdC)sdAsdGs(5MdC)sdAs(5MdC)s(5MdC)s 99 GTTAACCAGCACCAGAAAC 283 dAsdGsdAsasascsasg AG A-131111.1 X10718 usgsususasdAs(5MdC)s(5MdC)sdAsdGs(5MdC)sdAs(5MdC)s 100 TGTTAACCAGCACCAGGAA 284 (5MdC)sdAsdGsgsasascsa CA A-131112.1 X10719 gsusgsususdAsdAs(5MdC)s(5MdC)sdAsdGs(5MdC)sdAs(5MdC)s 101 GTGTTAACCAGCACCAAGA 285 (5MdC)sdAsasgsasasc AC A-131113.1 X10720 gsgsusgsusdTsdAsdAs(5MdC)s(5MdC)sdAsdGs(5MdC)sdAs 102 GGTGTTAACCAGCACCCAG 286 (5MdC)s(5MdC)scsasgsasa AA A-131114.1 X10721 usgsgsusgsdTsdTsdAsdAs(5MdC)s(5MdC)sdAsdGs(5MdC)sdAs 103 TGGTGTTAACCAGCACCCAG 287 (5MdC)scscsasgsa A A-131115.1 X10722 asusgsgsusdGsdTsdTsdAsdAs(5MdC)s(5MdC)sdAsdGs(5MdC)sdA 104 ATGGTGTTAACCAGCAACCA 288 sascscsasg G A-131116.1 X10723 asasusgsgsdTsdGsdTsdTsdAsdAs(5MdC)s(5MdC)sdAsdGs(5MdC) 105 AATGGTGTTAACCAGCCACC 289 scsascscsa A A-131117.1 X10724 asasasusgsdGsdTsdGsdTsdTsdAsdAs(5MdC)s(5MdC)sdAsdGsgsc 106 AAATGGTGTTAACCAGGCA 290 sascsc CC A-131118.1 X10725 usasasasusdGsdGsdTsdGsdTsdTsdAsdAs(5MdC)s(5MdC)sdAsasg 107 TAAATGGTGTTAACCAAGCA 291 scsasc C A-131119.1 X10726 gsusasasasdTsdGsdGsdTsdGsdTsdTsdAsdAs(5MdC)s(5MdC)scsa 108 GTAAATGGTGTTAACCCAGC 292 sgscsa A A-131120.1 X10727 asgsusasasdAsdTsdGsdGsdTsdGsdTsdTsdAsdAs(5MdC)scscsasg 109 AGTAAATGGTGTTAACCCAG 293 sc C A-131121.1 X10728 asasgsusasdAsdAsdTsdGsdGsdTsdGsdTsdTsdAsdAsascscsasg 110 AAGTAAATGGTGTTAAACC 294 AG A-131122.1 X10729 gsasasgsusdAsdAsdAsdTsdGsdGsdTsdGsdTsdTsdAsasascscsa 111 GAAGTAAATGGTGTTAAAC 295 CA A-131123.1 X10730 usgsasasgsdTsdAsdAsdAsdTsdGsdGsdTsdGsdTsdTsusasascsc 112 TGAAGTAAATGGTGTTTAAC 296 C A-131124.1 X10731 ususgsasasdGsdTsdAsdAsdAsdTsdGsdGsdTsdGsdTsususasasc 113 TTGAAGTAAATGGTGTTTAA 297 C A-131125.1 X10732 csususgsasdAsdGsdTsdAsdAsdAsdTsdGsdGsdTsdGsgsususasa 114 CTTGAAGTAAATGGTGGTTA 298 A A-131126.1 X10733 cscsususgsdAsdAsdGsdTsdAsdAsdAsdTsdGsdGsdTsusgsususa 115 CCTTGAAGTAAATGGTTGTT 299 A A-131127.1 X10734 cscscsususdGsdAsdAsdGsdTsdAsdAsdAsdTsdGsdGsgsusgsusu 116 CCCTTGAAGTAAATGGGTGT 300 T A-131128.1 X10735 gscscscsusdTsdGsdAsdAsdGsdTsdAsdAsdAsdTsdGsgsgsusgsu 117 GCCCTTGAAGTAAATGGGTG 301 T A-131129.1 X10736 gsgscscscsdTsdTsdGsdAsdAsdGsdTsdAsdAsdAsdTsusgsgsusg 118 GGCCCTTGAAGTAAATTGGT 302 G A-131130.1 X10737 asgsgscscs(5MdC)sdTsdTsdGsdAsdAsdGsdTsdAsdAsdAsasusgsg 119 AGGCCCTTGAAGTAAAATG 303 su GT A-131131.1 X10738 csasgsgscs(5MdC)s(5MdC)sdTsdTsdGsdAsdAsdGsdTsdAsdAsasa 120 CAGGCCCTTGAAGTAAAAT 304 susgsg GG A-131132.1 X10739 ascsasgsgs(5MdC)s(5MdC)s(5MdC)sdTsdTsdGsdAsdAsdGsdTsdA 121 ACAGGCCCTTGAAGTAAAA 305 sasasasusg TG A-131133.1 X10740 csascsasgsdGs(5MdC)s(5MdC)s(5MdC)sdTsdTsdGsdAsdAsdGsdT 122 CACAGGCCCTTGAAGTTAAA 306 susasasasu T A-131134.1 X10741 cscsascsasdGsdGs(5MdC)s(5MdC)s(5MdC)sdTsdTsdGsdAsdAsdG 123 CCACAGGCCCTTGAAGGTA 307 sgsusasasa AA A-131135.1 X10742 uscscsascsdAsdGsdGs(5MdC)s(5MdC)s(5MdC)sdTsdTsdGsdAsdA 124 TCCACAGGCCCTTGAAAGTA 308 sasgsusasa A A-131136.1 X10743 ususcscsas(5MdC)sdAsdGsdGs(5MdC)s(5MdC)s(5MdC)sdTsdTsd 125 TTCCACAGGCCCTTGAAAGT 309 GsdAsasasgsusa A A-131137.1 X10744 csususcscsdAs(5MdC)sdAsdGsdGs(5MdC)s(5MdC)s(5MdC)sdTsd 126 CTTCCACAGGCCCTTGGAAG 310 TsdGsgsasasgsu T A-131138.1 X10745 ascsusususdGsdAs(5MdC)sdTsdTs(5MdC)s(5MdC)sdAs(5MdC)sd 127 ACTTTGACTTCCACAGGGCC 311 AsdGsgsgscscsc C A-131139.1 X10746 uscsasgsgsdGs(5MdC)sdTsdGsdAsdAs(5MdC)sdTsdTsdTsdGsgsa 128 TCAGGGCTGAACTTTGGACT 312 scsusu T A-131140.1 X10747 cscsususgsdTsdGsdTsdTs(5MdC)sdTs(5MdC)sdAsdGsdGsdGsgsc 129 CCTTGTGTTCTCAGGGGCTG 313 susgsa A A-131141.1 X10748 ascsasgsusdTs(5MdC)s(5MdC)sdTsdTs(5MdC)s(5MdC)sdTsdTsd 130 ACAGTTCCTTCCTTGTTGTTC 314 GsdTsusgsususc A-131142.1 X10749 gscscsususdGsdTsdAsdGsdAsdAs(5MdC)sdAsdGsdTsdTsuscscsu 131 GCCTTGTAGAACAGTTTCCT 315 su T A-131143.1 X10750 csuscsuscs(5MdC)sdAsdTs(5MdC)sdAsdGs(5MdC)s(5MdC)sdTsd 132 CTCTCCATCAGCCTTGGTAG 316 TsdGsgsusasgsa A A-131144.1 X10751 csusgsasas(5MdC)sdAs(5MdC)sdGsdAs(5MdC)sdTs(5MdC)sdTs 133 CTGAACACGACTCTCCCATC 317 (5MdC)s(5MdC)scsasuscsa A A-131145.1 X10752 asuscsasusdAsdGsdAsdTsdGs(5MdC)sdTsdGsdAsdAs(5MdC)scsa 134 ATCATAGATGCTGAACCACG 318 scsgsa A A-131146.1 X10753 ususcscsusdGsdGsdTsdAs(5MdC)sdAsdTs(5MdC)sdAsdTsdAsasg 135 TTCCTGGTACATCATAAGAT 319 sasusg G A-131147.1 X10754 gsgsasascsdTsdTsdGs(5MdC)s(5MdC)sdTsdTs(5MdC)s(5MdC)sd 136 GGAACTTGCCTTCCTGGGTA 320 TsdGsgsgsusasc C A-131148.1 X10755 csgscscsgsdAsdTsdAsdAs(5MdC)sdGsdGsdAsdAs(5MdC)sdTsusu 137 CGCCGATAACGGAACTTTGC 321 sgscsc C A-131149.1 X10756 ususcsasgs(5MdC)s(5MdC)sdAs(5MdC)sdGs(5MdC)sdGs(5MdC)s 138 TTCAGCCACGCGCCGAATAA 322 (5MdC)sdGsdAsasusasasc C A-131150.1 X10757 cscsusgsgsdGsdTsdGs(5MdC)s(5MdC)sdTsdTs(5MdC)sdAsdGs 139 CCTGGGTGCCTTCAGCCCAC 323 (5MdC)scscsascsg G A-131151.1 X10758 asascsuscsdAsdAsdGs(5MdC)sdAs(5MdC)s(5MdC)sdTsdGsdGsdG 140 AACTCAAGCACCTGGGGTG 324 sgsusgscsc CC A-131152.1 X10759 usususgsasdAsdGsdGsdGs(5MdC)sdAsdAs(5MdC)sdTs(5MdC)sdA 141 TTTGAAGGGCAACTCAAAG 325 sasasgscsa CA A-131153.1 X10760 usgsuscsasdTs(5MdC)sdAs(5MdC)s(5MdC)sdTsdTsdTsdGsdAsdA 142 TGTCATCACCTTTGAAAGGG 326 sasgsgsgsc C A-131154.1 X10761 ascscsasusdGsdGsdTsdGsdAsdTsdGsdTs(5MdC)sdAsdTsuscsasc 143 ACCATGGTGATGTCATTCAC 327 sc C A-131155.1 X10762 csasasgsasdTsdGsdAsdGsdGsdAs(5MdC)s(5MdC)sdAsdTsdGsgsg 144 CAAGATGAGGACCATGGGT 328 susgsa GA A-131156.1 X10763 csasgsgscsdTsdTsdGsdGsdGs(5MdC)sdAsdAsdGsdAsdTsusgsasg 145 CAGGCTTGGGCAAGATTGA 329 sg GG A-131157.1 X10764 asgsgscsus(5MdC)sdTsdTs(5MdC)sdTs(5MdC)sdAsdGsdGs 146 AGGCTCTTCTCAGGCTTTGG 330 (5MdC)sdTsususgsgsg G A-131158.1 X10765 usascscsusdTsdGsdGs(5MdC)s(5MdC)sdAsdGsdGs(5MdC)sdTs 147 TACCTTGGCCAGGCTCCTTC 331 (5MdC)scsususcsu T A-131159.1 X10766 gsususcscsdTsdTs(5MdC)sdTs(5MdC)sdTsdAs(5MdC)s(5MdC)sd 148 GTTCCTTCTCTACCTTTGGCC 332 TsdTsusgsgscsc A-131160.1 X10767 uscsusgsgsdGsdGsdTsdGsdAsdGsdTsdTs(5MdC)s(5MdC)sdTsusu 149 TCTGGGGTGAGTTCCTTTCT 333 scsusc C A-131161.1 X10768 ususgscsasdGs(5MdC)sdAs(5MdC)s(5MdC)sdTs(5MdC)sdTsdGsd 150 TTGCAGCACCTCTGGGGGTG 334 GsdGsgsgsusgsa A A-131162.1 X10769 cscsasgscs(5MdC)sdAs(5MdC)sdTs(5MdC)sdTsdTsdGs(5MdC)sd 151 CCAGCCACTCTTGCAGGCAC 335 AsdGsgscsascsc C A-131163.1 X10770 uscscsasasdTsdTs(5MdC)sdAsdTs(5MdC)s(5MdC)sdAsdGs 152 TCCAATTCATCCAGCCCACT 336 (5MdC)s(5MdC)scsascsusc C A-131164.1 X10771 csasuscsasdTs(5MdC)sdTs(5MdC)s(5MdC)sdTs(5MdC)s(5MdC)s 153 CATCATCTCCTCCAATTTCA 337 cAsdAsdTsususcsasu T A-131165.1 X10772 gsgsascscsdAs(5MdC)s(5MdC)sdAsdGs(5MdC)sdAsdTs(5MdC)sd 154 GGACCACCAGCATCATTCTC 338 AsdTsuscsuscsc C A-131166.1 X10773 csgsgsgsgs(5MdC)sdAsdTsdGsdTsdGsdGsdAs(5MdC)s(5MdC)sdA 155 CGGGGCATGTGGACCAACC 339 sascscsasg AG A-131167.1 X10774 asasusgscsdGsdGsdAsdAsdGs(5MdC)sdGsdGsdGsdGs(5MdC)scsa 156 AATGCGGAAGCGGGGCCAT 340 susgsu GT A-131168.1 X10775 asgscscsgsdTs(5MdC)s(5MdC)sdTs(5MdC)sdAsdAsdTsdGs 157 AGCCGTCCTCAATGCGGGA 341 (5MdC)sdGsgsgsasasg AG A-131169.1 X10776 ususcsasasdAs(5MdC)sdTsdGsdAsdAsdGs(5MdC)s(5MdC)sdGsdT 158 TTCAAACTGAAGCCGTTCCT 342 suscscsusc C A-131170.1 X10777 csasgscsusdGs(5MdC)sdTs(5MdC)s(5MdC)sdTsdTs(5MdC)sdAsd 159 CAGCTGCTCCTTCAAAACTG 343 AsdAsascsusgsa A A-131171.1 X10778 cscsasusgsdTs(5MdC)sdTsdTsdGs(5MdC)sdAsdGs(5MdC)sdTsdG 160 CCATGTCTTGCAGCTGGCTC 344 sgscsuscsc C A-131172.1 X10779 uscsgsascsdAsdAsdGsdGs(5MdC)s(5MdC)s(5MdC)sdAsdTsdGsdT 161 TCGACAAGGCCCATGTTCTT 345 suscsususg G A-131173.1 X10780 gscsusgsasdAs(5MdC)sdAsdGsdAsdTs(5MdC)sdGsdAs(5MdC)sdA 162 GCTGAACAGATCGACAAAG 346 sasasgsgsc GC A-131174.1 X10781 ascsusususdTs(5MdC)sdAsdGsdGsdGs(5MdC)sdTsdGsdAsdAsasc 163 ACTTTTCAGGGCTGAAACAG 347 sasgsa A A-131175.1 X10782 gsgsgsasgsdTsdTsdTsdGsdGsdAs(5MdC)sdTsdTsdTsdTsuscsasg 164 GGGAGTTTGGACTTTTTCAG 348 sg G A-131176.1 X10783 asascsasasdTsdAs(5MdC)s(5MdC)sdTsdGsdGsdGsdAsdGsdTsusu 165 AACAATACCTGGGAGTTTTG 349 susgsg G A-131177.1 X10784 gsgscscsusdTs(5MdC)sdTsdGs(5MdC)sdAsdAs(5MdC)sdAsdAsdT 166 GGCCTTCTGCAACAATTACC 350 susascscsu T A-131178.1 X10785 asgsgsuscsdAsdTs(5MdC)sdTs(5MdC)sdGsdGs(5MdC)s(5MdC)sd 167 AGGTCATCTCGGCCTTTCTG 351 TsdTsuscsusgsc C A-131179.1 X10786 usgsasgsas(5MdC)sdAsdTsdAsdGsdAsdGsdGsdTs(5MdC)sdAsasu 168 TGAGACATAGAGGTCAATCT 352 scsusc C A-131180.1 X10787 gsgsasasusdGs(5MdC)sdAsdTs(5MdC)sdTsdGsdAsdGsdAs(5MdC) 169 GGAATGCATCTGAGACCAT 353 scsasusasg AG A-131181.1 X10788 asasusgscs(5MdC)sdTsdTsdAsdTsdGsdGsdAsdAsdTsdGsgscsasu 170 AATGCCTTATGGAATGGCAT 354 sc C A-131182.1 X10789 usascscsus(5MdC)sdAsdAsdGsdAsdAsdAsdTsdGs(5MdC)s(5MdC) 171 TACCTCAAGAAATGCCCTTA 355 scsususasu T A-131183.1 X10790 csususcsusdTs(5MdC)sdAsdTsdTsdTsdAs(5MdC)s(5MdC)sdTs 172 CTTCTTCATTTACCTCCAAG 356 (5MdC)scsasasgsa A A-131184.1 X10791 gscsususcsdAs(5MdC)sdTsdGs(5MdC)s(5MdC)sdTsdTs(5MdC)sd 173 GCTTCACTGCCTTCTTTCATT 357 TsdTsuscsasusu A-131185.1 X10792 ascsususgs(5MdC)sdAsdGs(5MdC)sdTsdGs(5MdC)sdTsdTs 174 ACTTGCAGCTGCTTCAACTG 358 (5MdC)sdAsascsusgsc C A-131186.1 X10793 csasascsasdGs(5MdC)sdGsdGsdTsdAs(5MdC)sdTsdTsdGs(5MdC) 175 CAACAGCGGTACTTGCCAGC 359 scsasgscsu T A-131187.1 X10794 cscsasgscsdAsdAsdTs(5MdC)sdAs(5MdC)sdAsdAs(5MdC)sdAsdG 176 CCAGCAATCACAACAGGCG 360 sgscsgsgsu GT A-131188.1 X10795 usasgscsgsdAsdAs(5MdC)sdGsdGs(5MdC)s(5MdC)sdAsdGs 177 TAGCGAACGGCCAGCAAAT 361 (5MdC)sdAsasasuscsa CA A-131189.1 X10796 usgsususgsdGsdGsdGsdTsdTsdTsdAsdGs(5MdC)sdGsdAsasascsg 178 TGTTGGGGTTTAGCGAAACG 362 sg G A-131190.1 X10797 asasasgsus(5MdC)sdAs(5MdC)s(5MdC)s(5MdC)sdTsdGsdTsdTsd 179 AAAGTCACCCTGTTGGGGGT 363 GsdGsgsgsgsusu T A-131191.1 X10798 gsususgsgs(5MdC)s(5MdC)sdTsdTsdGsdAsdAsdAsdGsdTs(5MdC) 180 GTTGGCCTTGAAAGTCCACC 364 scsascscsc C A-131192.1 X10799 gsgsasasasdGsdGs(5MdC)s(5MdC)sdTsdGsdTsdTsdGsdGs(5MdC) 181 GGAAAGGCCTGTTGGCCCTT 365 scscsususg G A-131193.1 X10800 asusasasasdAsdAs(5MdC)s(5MdC)sdAsdGsdGsdAsdAsdAsdGsgsg 182 ATAAAAACCAGGAAAGGGC 366 scscsu CT A-131194.1 X10801 asascsusus(5MdC)sdTs(5MdC)sdTsdTsdAsdTsdAsdAsdAsdAsasa 183 AACTTCTCTTATAAAAAACC 367 scscsa A A-131195.1 X10802 usgsususcsdAsdGsdAsdGsdGsdAsdAs(5MdC)sdTsdTs(5MdC)scsu 184 TGTTCAGAGGAACTTCCTCT 368 scsusu T A-131196.1 X10803 asasgsasusdAsdAsdTsdAsdGsdTsdGsdTsdTs(5MdC)sdAsasgsasg 185 AAGATAATAGTGTTCAAGA 369 sg GG A-131197.1 X10804 uscsusgscs(5MdC)s(5MdC)sdAsdTsdGsdAsdAsdGsdAsdTsdAsasa 186 TCTGCCCATGAAGATAAATA 370 susasg G A-131198.1 X10805 gsgsususgsdGs(5MdC)sdTsdAs(5MdC)sdTs(5MdC)sdTsdGs 187 GGTTGGCTACTCTGCCCCAT 371 (5MdC)s(5MdC)scscsasusg G A-131199.1 X10806 ususasascsdAs(5MdC)sdAsdAsdGsdGsdGsdTsdTsdGsdGsgscsusa 188 TTAACACAAGGGTTGGGCTA 372 sc C A-131200.1 X10807 asascsasusdTsdTsdTsdAs(5MdC)sdTsdTsdAsdAs(5MdC)sdAsasc 189 AACATTTTACTTAACAACAA 373 sasasg G A-131201.1 X10808 asasasgsasdAsdTsdAsdAsdGsdAsdAs(5MdC)sdAsdTsdTsusususa 190 AAAGAATAAGAACATTTTTA 374 sc C A-131202.1 X10809 gsasasgsasdGsdGsdTsdGs(5MdC)sdAsdAsdAsdGsdAsdAsasusasa 191 GAAGAGGTGCAAAGAAATA 375 sg AG A-131203.1 X10810 cscsasasasdAsdAsdTsdAsdGsdGsdAsdAsdGsdAsdGsgsgsusgsc 192 CCAAAAATAGGAAGAGGGT 376 GC A-131204.1 X10811 usgsususcsdAs(5MdC)sdAsdAsdAs(5MdC)s(5MdC)sdAsdAsdAsd 193 TGTTCACAAACCAAAAAAT 377 Asasasusasg AG A-131205.1 X10812 usususususdAs(5MdC)sdTsdTs(5MdC)sdTsdGsdTsdTs(5MdC)sdA 194 TTTTTACTTCTGTTCAACAA 378 sascsasasa A A-131206.1 X10813 usususgsusdAsdTsdTsdTsdAsdTsdTsdTsdTsdTsdAsascsususc 195 TTTGTATTTATTTTTAACTTC 379 A-131207.1 X10814 asusgsgsasdAsdGsdTsdAsdGsdTsdTsdTsdGsdTsdAsasusususa 196 ATGGAAGTAGTTTGTAATTT 380 A
TABLE-US-00004 TABLE 4 Antisense polynucleotides targeting Serpinc1(AT3) Start Posi- tion in NM_ SEQ Antisense SEQ SEQ 000488. ID Sequence ID Sense Sequence ID Sequence ID 3 Modified Sequence (5′-3′) NO. (5′ to 3′) NO. (5′ to 3′) NO. NM_000488.3_ 20 csusasasasdTs(m5dCs)dTs(m5dCs)dGs(m5dCs) 381 CUAAAUCUCGCAG 565 GGAACCUCUGCGAGA 749 20-39_aso dAsdGsdAsdGsgsususcsc AGGUUCC UUUAG NM_000488.3_ 30 gsususcsusdTsdTs(m5dCs)(m5dCs)dTs(m5dCs) 382 GUUCUUUCCUCUA 566 CGAGAUUUAGAGGAA 750 30-49_aso dTsdAsdAsdAsuscsuscsg AAUCUCG AGAAC NM_000488.3_ 40 csusgsasasdAsdAs(m5dCs)dTsdGsdGsdTsdTs 383 CUGAAAACUGGUU 567 AGGAAAGAACCAGUU 751 40-59_aso (m5dCs)dTsususcscsu CUUUCCU UUCAG NM_000488.3_ 50 gsgscsasasdTs(m5dCs)(m5dCs)dGs(m5dCs) 384 GGCAAUCCGCCUG 568 CAGUUUUCAGGCGGA 752 50-69_aso (m5dCs)dTsdGsdAsdAsasascsusg AAAACUG UUGCC NM_000488.3_ 60 usgsusgsasdTs(m5dCs)dTsdGsdAsdGsdGs 385 UGUGAUCUGAGGC 569 GCGGAUUGCCUCAGA 753 60-79_aso (m5dCs)dAsdAsuscscsgsc AAUCCGC UCACA NM_000488.3_ 70 gsusgsgsasdGsdAsdTsdAsdGsdTsdGsdTsdGsd 386 GUGGAGAUAGUGU 570 UCAGAUCACACUAUC 754 70-89_aso Asuscsusgsa GAUCUGA UCCAC NM_000488.3_ 80 gsgscsusgsdGsdGs(m5dCs)dAsdAsdGsdTsdGsd 387 GGCUGGGCAAGUG 571 CUAUCUCCACUUGCC 755 80-99_aso GsdAsgsasusasg GAGAUAG CAGCC NM_000488.3_ 90 uscsususcs(m5dCs)dAs(m5dCs)dAsdGsdGsdGs 388 UCUUCCACAGGGC 572 UUGCCCAGCCCUGUG 756 90-109_aso (m5dCs)dTsdGsgsgscsasa UGGGCAA GAAGA NM_000488.3_ 100 usgsgscscsdGs(m5dCs)dTsdAsdAsdTs(m5dCs) 389 UGGCCGCUAAUCU 573 CUGUGGAAGAUUAGC 757 100-119_aso dTsdTs(m5dCs)csascsasg UCCACAG GGCCA NM_000488.3_ 110 ususgsgsasdAsdTsdAs(m5dCs)dAsdTsdGsdGs 390 UUGGAAUACAUGG 574 UUAGCGGCCAUGUAU 758 110-129_aso (m5dCs)(m5dCs)gscsusasa CCGCUAA UCCAA NM_000488.3_ 120 uscscsusasdTs(m5dCs)dAs(m5dCs)dAsdTsdTsd 391 UCCUAUCACAUUG 575 UGUAUUCCAAUGUGA 759 120-139_aso GsdGsdAsasusascsa GAAUACA UAGGA NM_000488.3_ 130 asgsgsususdAs(m5dCs)dAsdGsdTsdTs(m5dCs) 392 AGGUUACAGUUCC 576 UGUGAUAGGAACUGU 760 130-149_aso (m5dCs)dTsdAsuscsascsa UAUCACA AACCU NM_000488.3_ 140 csususususdTs(m5dCs)(m5dCs)dAsdGsdAsdGs 393 CUUUUUCCAGAGG 577 ACUGUAACCUCUGGA 761 140-159_aso dGsdTsdTsascsasgsu UUACAGU AAAAG NM_000488.3_ 150 asusasasas(m5dCs)(m5dCs)dTsdTs(m5dCs) 394 AUAAACCUUCCUU 578 CUGGAAAAAGGAAGG 762 150-169_aso (m5dCs)dTsdTsdTsdTsuscscsasg UUUCCAG UUUAU NM_000488.3_ 160 asgsgsascsdAsdAsdAsdAsdGsdAsdTsdAsdAsd 395 AGGACAAAAGAUA 579 GAAGGUUUAUCUUUU 763 160-179_aso Ascscsususc AACCUUC GUCCU NM_000488.3_ 170 asusgsasgs(m5dCs)dAsdGs(m5dCs)dAsdAsdGs 396 AUGAGCAGCAAGG 580 CUUUUGUCCUUGCUG 764 170-189_aso dGsdAs(m5dCs)asasasasg ACAAAAG CUCAU NM_000488.3_ 180 cscsasgsasdAsdGs(m5dCs)(m5dCs)dAsdAsdTs 397 CCAGAAGCCAAUG 581 UGCUGCUCAUUGGCU 765 180-199_aso dGsdAsdGscsasgscsa AGCAGCA UCUGG NM_000488.3_ 190 uscsascsgs(m5dCs)dAsdGsdTs(m5dCs)(m5dCs) 398 UCACGCAGUCCCA 582 UGGCUUCUGGGACUG 766 190-209_aso (m5dCs)dAsdGsdAsasgscscsa GAAGCCA CGUGA NM_000488.3_ 200 cscsgsusgsdAs(m5dCs)dAsdGsdGsdTs(m5dCs) 399 CCGUGACAGGUCA 583 GACUGCGUGACCUGU 767 200-219_aso dAs(m5dCs)dGscsasgsusc CGCAGUC CACGG NM_000488.3_ 210 csascsasgsdGsdGs(m5dCs)dTs(m5dCs)(m5dCs) 400 CACAGGGCUCCCG 584 CCUGUCACGGGAGCC 768 210-229_aso (m5dCs)dGsdTsdGsascsasgsg UGACAGG CUGUG NM_000488.3_ 220 usgscsasgsdAsdTsdGsdTs(m5dCs)(m5dCs)dAs 401 UGCAGAUGUCCAC 585 GAGCCCUGUGGACAU 769 220-239_aso (m5dCs)dAsdGsgsgscsusc AGGGCUC CUGCA NM_000488.3_ 230 gsgscsususdGsdGs(m5dCs)dTsdGsdTsdGs 402 GGCUUGGCUGUGC 586 GACAUCUGCACAGCC 770 230-249_aso (m5dCs)dAsdGsasusgsusc AGAUGUC AAGCC NM_000488.3_ 240 asasusgsus(m5dCs)(m5dCs)(m5dCs)dGs 403 AAUGUCCCGCGGC 587 CAGCCAAGCCGCGGG 771 240-259_aso (m5dCs)dGsdGs(m5dCs)dTsdTsgsgscsusg UUGGCUG ACAUU NM_000488.3_ 250 gsasususcsdAsdTsdGsdGsdGsdAsdAsdTsdGsd 404 GAUUCAUGGGAAU 588 GCGGGACAUUCCCAU 772 250-269_aso Tscscscsgsc GUCCCGC GAAUC NM_000488.3_ 260 asusgscsas(m5dCs)dAsdTsdGsdGsdGsdAsdTsd 405 AUGCACAUGGGAU 589 CCCAUGAAUCCCAUG 773 260-279_aso Ts(m5dCs)asusgsgsg UCAUGGG UGCAU NM_000488.3_ 270 gsgsasgscsdGsdGsdTsdAsdAsdAsdTsdGs 406 GGAGCGGUAAAUG 590 CCAUGUGCAUUUACC 774 270-289_aso (m5dCs)dAscsasusgsg CACAUGG GCUCC NM_000488.3_ 280 uscsususcsdTs(m5dCs)(m5dCs)dGsdGsdGsdGs 407 UCUUCUCCGGGGA 591 UUACCGCUCCCCGGA 775 280-299_aso dAsdGs(m5dCs)gsgsusasa GCGGUAA GAAGA NM_000488.3_ 290 uscsasgsusdTsdGs(m5dCs)(m5dCs)dTsdTs 408 UCAGUUGCCUUCU 592 CCGGAGAAGAAGGCA 776 290-309_aso (m5dCs)dTsdTs(m5dCs)uscscsgsg UCUCCGG ACUGA NM_000488.3_ 300 gscscscsus(m5dCs)dAsdTs(m5dCs)(m5dCs)dTs 409 GCCCUCAUCCUCA 593 AGGCAACUGAGGAUG 777 300-319_aso (m5dCs)dAsdGsdTsusgscscsu GUUGCCU AGGGC NM_000488.3_ 310 uscsusgsusdTs(m5dCs)dTsdGsdAsdGs(m5dCs) 410 UCUGUUCUGAGCC 594 GGAUGAGGGCUCAGA 778 310-329_aso (m5dCs)(m5dCs)dTscsasuscsc CUCAUCC ACAGA NM_000488.3_ 320 uscscsgsgsdGsdAsdTs(m5dCs)dTsdTs(m5dCs)d 411 UCCGGGAUCUUCU 595 UCAGAACAGAAGAUC 779 320-339_aso TsdGsdTsuscsusgsa GUUCUGA CCGGA NM_000488.3_ 330 gsususgsgsdTsdGsdGs(m5dCs)(m5dCs)dTs 412 GUUGGUGGCCUCC 596 AGAUCCCGGAGGCCA 780 330-349_aso (m5dCs)(m5dCs)dGsdGsgsasuscsu GGGAUCU CCAAC NM_000488.3_ 340 asgsascsas(m5dCs)dGs(m5dCs)(m5dCs)dGsdGs 413 AGACACGCCGGUU 597 GGCCACCAACCGGCG 781 340-359_aso dTsdTsdGsdGsusgsgscsc GGUGGCC UGUCU NM_000488.3_ 350 gsascsasgsdTsdTs(m5dCs)(m5dCs)(m5dCs)dAs 414 GACAGUUCCCAGA 598 CGGCGUGUCUGGGAA 782 350-369_aso dGsdAs(m5dCs)dAscsgscscsg CACGCCG CUGUC NM_000488.3_ 360 asususgsgs(m5dCs)(m5dCs)dTsdTsdGsdGsdAs 415 AUUGGCCUUGGAC 599 GGGAACUGUCCAAGG 783 360-379_aso (m5dCs)dAsdGsususcscsc AGUUCCC CCAAU NM_000488.3_ 370 csasasasgs(m5dCs)dGsdGsdGsdAsdAsdTsdTsd 416 CAAAGCGGGAAUU 600 CAAGGCCAAUUCCCG 784 370-389_aso GsdGscscsususg GGCCUUG CUUUG NM_000488.3_ 380 asasasgsusdGsdGsdTsdAsdGs(m5dCs)dAsdAsd 417 AAAGUGGUAGCAA 601 UCCCGCUUUGCUACC 785 380-399_aso AsdGscsgsgsgsa AGCGGGA ACUUU NM_000488.3_ 390 gsusgscsusdGsdAsdTsdAsdGsdAsdAsdAsdGsd 418 GUGCUGAUAGAAA 602 CUACCACUUUCUAUC 786 390-409_aso Tsgsgsusasg GUGGUAG AGCAC NM_000488.3_ 400 asasuscsusdGs(m5dCs)(m5dCs)dAsdGsdGsdTs 419 AAUCUGCCAGGUG 603 CUAUCAGCACCUGGC 787 400-419_aso dGs(m5dCs)dTsgsasusasg CUGAUAG AGAUU NM_000488.3_ 410 uscsasusus(m5dCs)dTsdTsdGsdGsdAsdAsdTs 420 UCAUUCUUGGAAU 604 CUGGCAGAUUCCAAG 788 410-429_aso (m5dCs)dTsgscscsasg CUGCCAG AAUGA NM_000488.3_ 420 gsususasus(m5dCs)dAsdTsdTsdGsdTs(m5dCs)d 421 GUUAUCAUUGUCA 605 CCAAGAAUGACAAUG 789 420-439_aso AsdTsdTscsususgsg UUCUUGG AUAAC NM_000488.3_ 430 ascsasgsgsdAsdAsdAsdAsdTsdGsdTsdTsdAsdT 422 ACAGGAAAAUGUU 606 CAAUGAUAACAUUUU 790 430-449_aso scsasususg AUCAUUG CCUGU NM_000488.3_ 440 csuscsasgsdGsdGsdGsdTsdGsdAs(m5dCs)dAsd 423 CUCAGGGGUGACA 607 AUUUUCCUGUCACCC 791 440-459_aso GsdGsasasasasu GGAAAAU CUGAG NM_000488.3_ 450 csgsusgsgsdAsdGsdAsdTsdAs(m5dCs)dTs 424 CGUGGAGAUACUC 608 CACCCCUGAGUAUCU 792 450-469_aso (m5dCs)dAsdGsgsgsgsusg AGGGGUG CCACG NM_000488.3_ 460 usasgscsasdAsdAsdAsdGs(m5dCs)(m5dCs)dGs 425 UAGCAAAAGCCGU 609 UAUCUCCACGGCUUU 793 460-479_aso dTsdGsdGsasgsasusa GGAGAUA UGCUA NM_000488.3_ 470 asgscsususdGsdGsdTs(m5dCs)dAsdTsdAsdGs 426 AGCUUGGUCAUAG 610 GCUUUUGCUAUGACC 794 470-489_aso (m5dCs)dAsasasasgsc CAAAAGC AAGCU NM_000488.3_ 480 ascsasgsgs(m5dCs)dAs(m5dCs)(m5dCs) 427 ACAGGCACCCAGC 611 UGACCAAGCUGGGUG 795 480-499_aso (m5dCs)dAsdGs(m5dCs)dTsdTsgsgsuscsa UUGGUCA CCUGU NM_000488.3_ 490 gsgsgsusgsdTs(m5dCs)dAsdTsdTsdAs(m5dCs) 428 GGGUGUCAUUACA 612 GGGUGCCUGUAAUGA 796 490-509_aso dAsdGsdGscsascscsc GGCACCC CACCC NM_000488.3_ 500 asgsususgs(m5dCs)dTsdGsdGsdAsdGsdGsdGsd 429 AGUUGCUGGAGGG 613 AAUGACACCCUCCAG 797 500-519_aso TsdGsuscsasusu UGUCAUU CAACU NM_000488.3_ 510 usascscsus(m5dCs)(m5dCs)dAsdTs(m5dCs)dAs 430 UACCUCCAUCAGU 614 UCCAGCAACUGAUGG 798 510-529_aso dGsdTsdTsdGscsusgsgsa UGCUGGA AGGUA NM_000488.3_ 520 csasasascsdTsdTsdAsdAsdAsdTsdAs(m5dCs) 431 CAAACUUAAAUAC 615 GAUGGAGGUAUUUAA 799 520-539_aso (m5dCs)dTscscsasusc CUCCAUC GUUUG NM_000488.3_ 530 gsasusasusdGsdGsdTsdGsdTs(m5dCs)dAsdAsd 432 GAUAUGGUGUCAA 616 UUUAAGUUUGACACC 800 530-549_aso As(m5dCs)ususasasa ACUUAAA AUAUC NM_000488.3_ 540 usgsusususdTs(m5dCs)dTs(m5dCs)dAsdGsdAs 433 UGUUUUCUCAGAU 617 ACACCAUAUCUGAGA 801 540-559_aso dTsdAsdTsgsgsusgsu AUGGUGU AAACA NM_000488.3_ 550 uscsusgsasdTs(m5dCs)dAsdGsdAsdTsdGsdTsd 434 UCUGAUCAGAUGU 618 UGAGAAAACAUCUGA 802 550-569_aso TsdTsuscsuscsa UUUCUCA UCAGA NM_000488.3_ 560 asasgsasasdGsdTsdGsdGsdAsdTs(m5dCs)dTsd 435 AAGAAGUGGAUCU 619 UCUGAUCAGAUCCAC 803 560-579_aso GsdAsuscsasgsa GAUCAGA UUCUU NM_000488.3_ 570 usususgsgs(m5dCs)dAsdAsdAsdGsdAsdAsdGs 436 UUUGGCAAAGAAG 620 UCCACUUCUUCUUUG 804 570-589_aso dAsdAsgsusgsgsa AAGUGGA CCAAA NM_000488.3_ 580 gsgscsasgsdTsdTs(m5dCs)dAsdGsdTsdTsdTsd 437 GGCAGUUCAGUUU 621 CUUUGCCAAACUGAA 805 580-599_aso GsdGscsasasasg GGCAAAG CUGCC NM_000488.3_ 590 csgsasusasdGsdAsdGsdTs(m5dCs)dGsdGs 438 CGAUAGAGUCGGC 622 CUGAACUGCCGACUC 806 590-609_aso (m5dCs)dAsdGsususcsasg AGUUCAG UAUCG NM_000488.3_ 600 gsususgsgs(m5dCs)dTsdTsdTsdTs(m5dCs)dGsd 439 GUUGGCUUUUCGA 623 GACUCUAUCGAAAAG 807 600-619_aso AsdTsdAsgsasgsusc UAGAGUC CCAAC NM_000488.3_ 610 usgsgsasgsdGsdAsdTsdTsdTsdGsdTsdTsdGsdG 440 UGGAGGAUUUGUU 624 AAAAGCCAACAAAUC 808 610-629_aso scsusususu GGCUUUU CUCCA NM_000488.3_ 620 gsasusascsdTsdAsdAs(m5dCs)dTsdTsdGsdGsd 441 GAUACUAACUUGG 625 AAAUCCUCCAAGUUA 809 620-639_aso AsdGsgsasususu AGGAUUU GUAUC NM_000488.3_ 630 gscsgsasusdTsdGsdGs(m5dCs)dTsdGsdAsdTsd 442 GCGAUUGGCUGAU 626 AGUUAGUAUCAGCCA 810 630-649_aso As(m5dCs)usasascsu ACUAACU AUCGC NM_000488.3_ 640 csuscscsasdAsdAsdAsdAsdGsdGs(m5dCs)dGsd 443 CUCCAAAAAGGCG 627 AGCCAAUCGCCUUUU 811 640-659_aso AsdTsusgsgscsu AUUGGCU UGGAG NM_000488.3_ 650 asgsgsgsasdTsdTsdTsdGsdTs(m5dCs)dTs 444 AGGGAUUUGUCUC 628 CUUUUUGGAGACAAA 812 650-669_aso (m5dCs)(m5dCs)dAsasasasasg CAAAAAG UCCCU NM_000488.3_ 660 asususgsasdAsdGsdGsdTsdAsdAsdGsdGsdGsd 445 AUUGAAGGUAAGG 629 ACAAAUCCCUUACCU 813 660-679_aso Asusususgsu GAUUUGU UCAAU NM_000488.3_ 670 gsgsusasgsdGsdTs(m5dCs)dTs(m5dCs)dAsdTsd 446 GGUAGGUCUCAUU 630 UACCUUCAAUGAGAC 814 670-689_aso TsdGsdAsasgsgsusa GAAGGUA CUACC NM_000488.3_ 680 csusgsasusdGsdTs(m5dCs)(m5dCs)dTsdGsdGs 447 CUGAUGUCCUGGU 631 GAGACCUACCAGGAC 815 680-699_aso dTsdAsdGsgsuscsusc AGGUCUC AUCAG NM_000488.3_ 690 usascscsasdAs(m5dCs)dTs(m5dCs)dAs(m5dCs) 448 UACCAACUCACUG 632 AGGACAUCAGUGAGU 816 690-709_aso dTsdGsdAsdTsgsuscscsu AUGUCCU UGGUA NM_000488.3_ 700 usgsgscsus(m5dCs)(m5dCs)dAsdTsdAsdTsdAs 449 UGGCUCCAUAUAC 633 UGAGUUGGUAUAUGG 817 700-719_aso (m5dCs)(m5dCs)dAsascsuscsa CAACUCA AGCCA NM_000488.3_ 710 gsgscsusgsdGsdAsdGs(m5dCs)dTsdTsdGsdGs 450 GGCUGGAGCUUGG 634 UAUGGAGCCAAGCUC 818 710-729_aso (m5dCs)dTscscsasusa CUCCAUA CAGCC NM_000488.3_ 720 gsasasgsus(m5dCs)(m5dCs)dAsdGsdGsdGsdGs 451 GAAGUCCAGGGGC 635 AGCUCCAGCCCCUGG 819 720-739_aso (m5dCs)dTsdGsgsasgscsu UGGAGCU ACUUC NM_000488.3_ 730 csasusususdTs(m5dCs)(m5dCs)dTsdTsdGsdAsd 452 CAUUUUCCUUGAA 636 CCUGGACUUCAAGGA 820 730-749_aso AsdGsdTscscsasgsg GUCCAGG AAAUG NM_000488.3_ 740 gsasususgs(m5dCs)dTs(m5dCs)dTsdGs(m5dCs) 453 GAUUGCUCUGCAU 637 AAGGAAAAUGCAGAG 821 740-759_aso dAsdTsdTsdTsuscscsusu UUUCCUU CAAUC NM_000488.3_ 750 gsgscscsgs(m5dCs)dTs(m5dCs)dTsdGsdGsdAs 454 GGCCGCUCUGGAU 638 CAGAGCAAUCCAGAG 822 750-769_aso dTsdTsdGscsuscsusg UGCUCUG CGGCC NM_000488.3_ 760 asusususgsdTsdTsdGsdAsdTsdGsdGs(m5dCs) 455 AUUUGUUGAUGGC 639 CAGAGCGGCCAUCAA 823 760-779_aso (m5dCs)dGscsuscsusg CGCUCUG CAAAU NM_000488.3_ 770 ususgsgsas(m5dCs)dAs(m5dCs)(m5dCs) 456 UUGGACACCCAUU 640 AUCAACAAAUGGGUG 824 770-789_aso (m5dCs)dAsdTsdTsdTsdGsususgsasu UGUUGAU UCCAA NM_000488.3_ 780 ususcsgsgsdTs(m5dCs)dTsdTsdAsdTsdTsdGsd 457 UUCGGUCUUAUUG 641 GGGUGUCCAAUAAGA 825 780-799_aso GsdAscsascscsc GACACCC CCGAA NM_000488.3_ 790 usgsasusus(m5dCs)dGsdGs(m5dCs)(m5dCs)dTs 458 UGAUUCGGCCUUC 642 UAAGACCGAAGGCCG 826 790-809_aso dTs(m5dCs)dGsdGsuscsususa GGUCUUA AAUCA NM_000488.3_ 800 asusgsascsdAsdTs(m5dCs)dGsdGsdTsdGsdAsd 459 AUGACAUCGGUGA 643 GGCCGAAUCACCGAU 827 800-819_aso TsdTscsgsgscsc UUCGGCC GUCAU NM_000488.3_ 810 ususcscsgsdAsdGsdGsdGsdAsdAsdTsdGsdAs 460 UUCCGAGGGAAUG 644 CCGAUGUCAUUCCCU 828 810-829_aso (m5dCs)asuscsgsg ACAUCGG CGGAA NM_000488.3_ 820 csasususgsdAsdTsdGsdGs(m5dCs)dTsdTs 461 CAUUGAUGGCUUC 645 UCCCUCGGAAGCCAU 829 820-839_aso (m5dCs)(m5dCs)dGsasgsgsgsa CGAGGGA CAAUG NM_000488.3_ 830 ascsasgsusdGsdAsdGs(m5dCs)dTs(m5dCs)dAs 462 ACAGUGAGCUCAU 646 GCCAUCAAUGAGCUC 830 830-849_aso dTsdTsdGsasusgsgsc UGAUGGC ACUGU NM_000488.3_ 840 csasgscsas(m5dCs)(m5dCs)dAsdGsdAsdAs 463 CAGCACCAGAACA 647 AGCUCACUGUUCUGG 831 840-859_aso (m5dCs)dAsdGsdTsgsasgscsu GUGAGCU UGCUG NM_000488.3_ 843 asascscsasdGs(m5dCs)dAs(m5dCs)(m5dCs)dAs 464 AACCAGCACCAGA 648 UCACUGUUCUGGUGC 832 843-862_aso dGsdAsdAs(m5dCs)asgsusgsa ACAGUGA UGGUU NM_000488.3_ 844 usasascscsdAsdGs(m5dCs)dAs(m5dCs)(m5dCs) 465 UAACCAGCACCAG 649 CACUGUUCUGGUGCU 833 844-863_aso dAsdGsdAsdAscsasgsusg AACAGUG GGUUA NM_000488.3_ 845 ususasascs(m5dCs)dAsdGs(m5dCs)dAs(m5dCs) 466 UUAACCAGCACCA 650 ACUGUUCUGGUGCUG 834 845-864_aso (m5dCs)dAsdGsdAsascsasgsu GAACAGU GUUAA NM_000488.3_ 846 gsususasas(m5dCs)(m5dCs)dAsdGs(m5dCs)dA 467 GUUAACCAGCACC 651 CUGUUCUGGUGCUGG 835 846-865_aso s(m5dCs)(m5dCs)dAsdGsasascsasg AGAACAG UUAAC NM_000488.3_ 847 usgsususasdAs(m5dCs)(m5dCs)dAsdGs(m5dCs) 468 UGUUAACCAGCAC 652 UGUUCUGGUGCUGGU 836 847-866_aso dAs(m5dCs)(m5dCs)dAsgsasascsa CAGAACA UAACA NM_000488.3_ 848 gsusgsususdAsdAs(m5dCs)(m5dCs)dAsdGs 469 GUGUUAACCAGCA 653 GUUCUGGUGCUGGUU 837 848-867_aso (m5dCs)dAs(m5dCs)(m5dCs)asgsasasc CCAGAAC AACAC NM_000488.3_ 849 gsgsusgsusdTsdAsdAs(m5dCs)(m5dCs)dAsdGs 470 GGUGUUAACCAGC 654 UUCUGGUGCUGGUUA 838 849-868_aso (m5dCs)dAs(m5dCs)csasgsasa ACCAGAA ACACC NM_000488.3_ 850 usgsgsusgsdTsdTsdAsdAs(m5dCs)(m5dCs)dAs 471 UGGUGUUAACCAG 655 UCUGGUGCUGGUUAA 839 850-869_aso dGs(m5dCs)dAscscsasgsa CACCAGA CACCA NM_000488.3_ 851 asusgsgsusdGsdTsdTsdAsdAs(m5dCs)(m5dCs) 472 AUGGUGUUAACCA 656 CUGGUGCUGGUUAAC 840 851-870_aso dAsdGs(m5dCs)ascscsasg GCACCAG ACCAU NM_000488.3_ 852 asasusgsgsdTsdGsdTsdTsdAsdAs(m5dCs) 473 AAUGGUGUUAACC 657 UGGUGCUGGUUAACA 841 852-871_aso (m5dCs)dAsdGscsascscsa AGCACCA CCAUU NM_000488.3_ 853 asasasusgsdGsdTsdGsdTsdTsdAsdAs(m5dCs) 474 AAAUGGUGUUAAC 658 GGUGCUGGUUAACAC 842 853-872_aso (m5dCs)dAsgscsascsc CAGCACC CAUUU NM_000488.3_ 854 usasasasusdGsdGsdTsdGsdTsdTsdAsdAs 475 UAAAUGGUGUUAA 659 GUGCUGGUUAACACC 843 854-873_aso (m5dCs)(m5dCs)asgscsasc CCAGCAC AUUUA NM_000488.3_ 855 gsusasasasdTsdGsdGsdTsdGsdTsdTsdAsdAs 476 GUAAAUGGUGUUA 660 UGCUGGUUAACACCA 844 855-874_aso (m5dCs)csasgscsa ACCAGCA UUUAC NM_000488.3_ 856 asgsusasasdAsdTsdGsdGsdTsdGsdTsdTsdAsdA 477 AGUAAAUGGUGUU 661 GCUGGUUAACACCAU 845 856-875_aso scscsasgsc AACCAGC UUACU NM_000488.3_ 857 asasgsusasdAsdAsdTsdGsdGsdTsdGsdTsdTsdA 478 AAGUAAAUGGUGU 662 CUGGUUAACACCAUU 846 857-876_aso sascscsasg UAACCAG UACUU NM_000488.3_ 858 gsasasgsusdAsdAsdAsdTsdGsdGsdTsdGsdTsdT 479 GAAGUAAAUGGUG 663 UGGUUAACACCAUUU 847 858-877_aso sasascscsa UUAACCA ACUUC NM_000488.3_ 859 usgsasasgsdTsdAsdAsdAsdTsdGsdGsdTsdGsdT 480 UGAAGUAAAUGGU 664 GGUUAACACCAUUUA 848 859-878_aso susasascsc GUUAACC CUUCA NM_000488.3_ 860 ususgsasasdGsdTsdAsdAsdAsdTsdGsdGsdTsd 481 UUGAAGUAAAUGG 665 GUUAACACCAUUUAC 849 860-879_aso Gsususasasc UGUUAAC UUCAA NM_000488.3_ 861 csususgsasdAsdGsdTsdAsdAsdAsdTsdGsdGsd 482 CUUGAAGUAAAUG 666 UUAACACCAUUUACU 850 861-880_aso Tsgsususasa GUGUUAA UCAAG NM_000488.3_ 862 cscsususgsdAsdAsdGsdTsdAsdAsdAsdTsdGsd 483 CCUUGAAGUAAAU 667 UAACACCAUUUACUU 851 862-88 l_aso Gsusgsususa GGUGUUA CAAGG NM_000488.3_ 863 cscscsususdGsdAsdAsdGsdTsdAsdAsdAsdTsd 484 CCCUUGAAGUAAA 668 AACACCAUUUACUUC 852 863-882_aso Gsgsusgsusu UGGUGUU AAGGG NM_000488.3_ 864 gscscscsusdTsdGsdAsdAsdGsdTsdAsdAsdAsd 485 GCCCUUGAAGUAA 669 ACACCAUUUACUUCA 853 864-883_aso Tsgsgsusgsu AUGGUGU AGGGC NM_000488.3_ 865 gsgscscscsdTsdTsdGsdAsdAsdGsdTsdAsdAsd 486 GGCCCUUGAAGUA 670 CACCAUUUACUUCAA 854 865-884_aso Asusgsgsusg AAUGGUG GGGCC NM_000488.3_ 866 asgsgscscs(m5dCs)dTsdTsdGsdAsdAsdGsdTsd 487 AGGCCCUUGAAGU 671 ACCAUUUACUUCAAG 855 866-885_aso AsdAsasusgsgsu AAAUGGU GGCCU NM_000488.3_ 867 csasgsgscs(m5dCs)(m5dCs)dTsdTsdGsdAsdAsd 488 CAGGCCCUUGAAG 672 CCAUUUACUUCAAGG 856 867-886_aso GsdTsdAsasasusgsg UAAAUGG GCCUG NM_000488.3_ 868 ascsasgsgs(m5dCs)(m5dCs)(m5dCs)dTsdTsdGs 489 ACAGGCCCUUGAA 673 CAUUUACUUCAAGGG 857 868-887_aso dAsdAsdGsdTsasasasusg GUAAAUG CCUGU NM_000488.3_ 869 csascsasgsdGs(m5dCs)(m5dCs)(m5dCs)dTsdTs 490 CACAGGCCCUUGA 674 AUUUACUUCAAGGGC 858 869-888_aso dGsdAsdAsdGsusasasasu AGUAAAU CUGUG NM_000488.3_ 870 cscsascsasdGsdGs(m5dCs)(m5dCs)(m5dCs)dTs 491 CCACAGGCCCUUG 675 UUUACUUCAAGGGCC 859 870-889_aso dTsdGsdAsdAsgsusasasa AAGUAAA UGUGG NM_000488.3_ 871 uscscsascsdAsdGsdGs(m5dCs)(m5dCs)(m5dCs) 492 UCCACAGGCCCUU 676 UUACUUCAAGGGCCU 860 871-890_aso dTsdTsdGsdAsasgsusasa GAAGUAA GUGGA NM_000488.3_ 872 ususcscsas(m5dCs)dAsdGsdGs(m5dCs)(m5dCs) 493 UUCCACAGGCCCU 677 UACUUCAAGGGCCUG 861 872-89 l_aso (m5dCs)dTsdTsdGsasasgsusa UGAAGUA UGGAA NM_000488.3_ 873 csususcscsdAs(m5dCs)dAsdGsdGs(m5dCs) 494 CUUCCACAGGCCC 678 ACUUCAAGGGCCUGU 862 873-892_aso (m5dCs)(m5dCs)dTsdTsgsasasgsu UUGAAGU GGAAG NM_000488.3_ 880 ascsusususdGsdAs(m5dCs)dTsdTs(m5dCs) 495 ACUUUGACUUCCA 679 GGGCCUGUGGAAGUC 863 880-899_aso (m5dCs)dAs(m5dCs)dAsgsgscscsc CAGGCCC AAAGU NM_000488.3_ 890 uscsasgsgsdGs(m5dCs)dTsdGsdAsdAs(m5dCs) 496 UCAGGGCUGAACU 680 AAGUCAAAGUUCAGC 864 890-909_aso dTsdTsdTsgsascsusu UUGACUU CCUGA NM_000488.3_ 900 cscsususgsdTsdGsdTsdTs(m5dCs)dTs(m5dCs)d 497 CCUUGUGUUCUCA 681 UCAGCCCUGAGAACA 865 900-919_aso AsdGsdGsgscsusgsa GGGCUGA CAAGG NM_000488.3_ 910 ascsasgsusdTs(m5dCs)(m5dCs)dTsdTs(m5dCs) 498 ACAGUUCCUUCCU 682 GAACACAAGGAAGGA 866 910-929_aso (m5dCs)dTsdTsdGsusgsususc UGUGUUC ACUGU NM_000488.3_ 920 gscscsususdGsdTsdAsdGsdAsdAs(m5dCs)dAsd 499 GCCUUGUAGAACA 683 AAGGAACUGUUCUAC 867 920-939_aso GsdTsuscscsusu GUUCCUU AAGGC NM_000488.3_ 930 csuscsuscs(m5dCs)dAsdTs(m5dCs)dAsdGs 500 CUCUCCAUCAGCC 684 UCUACAAGGCUGAUG 868 930-949_aso (m5dCs)(m5dCs)dTsdTsgsusasgsa UUGUAGA GAGAG NM_000488.3_ 940 csusgsasas(m5dCs)dAs(m5dCs)dGsdAs(m5dCs) 501 CUGAACACGACUC 685 UGAUGGAGAGUCGUG 869 940-959_aso dTs(m5dCs)dTs(m5dCs)csasuscsa UCCAUCA UUCAG NM_000488.3_ 950 asuscsasusdAsdGsdAsdTsdGs(m5dCs)dTsdGsd 502 AUCAUAGAUGCUG 686 UCGUGUUCAGCAUCU 870 950-969_aso AsdAscsascsgsa AACACGA AUGAU NM_000488.3_ 960 ususcscsusdGsdGsdTsdAs(m5dCs)dAsdTs 503 UUCCUGGUACAUC 687 CAUCUAUGAUGUACC 871 960-979_aso (m5dCs)dAsdTsasgsasusg AUAGAUG AGGAA NM_000488.3_ 970 gsgsasascsdTsdTsdGs(m5dCs)(m5dCs)dTsdTs 504 GGAACUUGCCUUC 688 GUACCAGGAAGGCAA 872 970-989_aso (m5dCs)(m5dCs)dTsgsgsusasc CUGGUAC GUUCC NM_000488.3_ 980 csgscscsgsdAsdTsdAsdAs(m5dCs)dGsdGsdAsd 505 CGCCGAUAACGGA 689 GGCAAGUUCCGUUAU 873 980-999_aso As(m5dCs)ususgscsc ACUUGCC CGGCG NM_000488.3_ 990 ususcsasgs(m5dCs)(m5dCs)dAs(m5dCs)dGs 506 UUCAGCCACGCGC 690 GUUAUCGGCGCGUGG 874 990- (m5dCs)dGs(m5dCs)(m5dCs)dGsasusasasc CGAUAAC CUGAA 1009_aso NM_000488.3_ 1000 cscsusgsgsdGsdTsdGs(m5dCs)(m5dCs)dTsdTs 507 CCUGGGUGCCUUC 691 CGUGGCUGAAGGCAC 875 1000- (m5dCs)dAsdGscscsascsg AGCCACG CCAGG 1019_aso NM_000488.3_ 1010 asascsuscsdAsdAsdGs(m5dCs)dAs(m5dCs) 508 AACUCAAGCACCU 692 GGCACCCAGGUGCUU 876 1010- (m5dCs)dTsdGsdGsgsusgscsc GGGUGCC GAGUU 1029 aso NM_000488.3_ 1020 usususgsasdAsdGsdGsdGs(m5dCs)dAsdAs 509 UUUGAAGGGCAAC 693 UGCUUGAGUUGCCCU 877 1020- (m5dCs)dTs(m5dCs)asasgscsa UCAAGCA UCAAA 1039_aso NM_000488.3_ 1030 usgsuscsasdTs(m5dCs)dAs(m5dCs)(m5dCs)dTs 510 UGUCAUCACCUUU 694 GCCCUUCAAAGGUGA 878 1030- dTsdTsdGsdAsasgsgsgsc GAAGGGC UGACA 1049_aso NM_000488.3_ 1040 ascscsasusdGsdGsdTsdGsdAsdTsdGsdTs 511 ACCAUGGUGAUGU 695 GGUGAUGACAUCACC 879 1040- (m5dCs)dAsuscsascsc CAUCACC AUGGU 1059_aso NM_000488.3_ 1050 csasasgsasdTsdGsdAsdGsdGsdAs(m5dCs) 512 CAAGAUGAGGACC 696 UCACCAUGGUCCUCA 880 1050- (m5dCs)dAsdTsgsgsusgsa AUGGUGA UCUUG 1069_aso NM_000488.3_ 1060 csasgsgscsdTsdTsdGsdGsdGs(m5dCs)dAsdAsd 513 CAGGCUUGGGCAA 697 CCUCAUCUUGCCCAA 881 1060- GsdAsusgsasgsg GAUGAGG GCCUG 1079_aso NM_000488.3_ 1070 asgsgscsus(m5dCs)dTsdTs(m5dCs)dTs(m5dCs) 514 AGGCUCUUCUCAG 698 CCCAAGCCUGAGAAG 882 1070- dAsdGsdGs(m5dCs)ususgsgsg GCUUGGG AGCCU 1089_aso NM_000488.3_ 1080 usascscsusdTsdGsdGs(m5dCs)(m5dCs)dAsdGs 515 UACCUUGGCCAGG 699 AGAAGAGCCUGGCCA 883 1080- dGs(m5dCs)dTscsususcsu CUCUUCU AGGUA 1099_aso NM_000488.3_ 1090 gsususcscsdTsdTs(m5dCs)dTs(m5dCs)dTsdAs 516 GUUCCUUCUCUAC 700 GGCCAAGGUAGAGAA 884 1090- (m5dCs)(m5dCs)dTsusgsgscsc CUUGGCC GGAAC 1109 aso NM_000488.3_ 1100 uscsusgsgsdGsdGsdTsdGsdAsdGsdTsdTs(m5dCs) 517 UCUGGGGUGAGUU 701 GAGAAGGAACUCACC 885 1100- (m5dCs)ususcsusc CCUUCUC CCAGA 1119_aso NM_000488.3_ 1110 ususgscsasdGs(m5dCs)dAs(m5dCs)(m5dCs)dTs 518 UUGCAGCACCUCU 702 UCACCCCAGAGGUGC 886 1110- (m5dCs)dTsdGsdGsgsgsusgsa GGGGUGA UGCAA 1129_aso NM_000488.3_ 1120 cscsasgscs(m5dCs)dAs(m5dCs)dTs(m5dCs)dTs 519 CCAGCCACUCUUG 703 GGUGCUGCAAGAGUG 887 1120- dTsdGs(m5dCs)dAsgscsascsc CAGCACC GCUGG 1139_aso NM_000488.3_ 1130 uscscsasasdTsdTs(m5dCs)dAsdTs(m5dCs) 520 UCCAAUUCAUCCA 704 GAGUGGCUGGAUGAA 888 1130- (m5dCs)dAsdGs(m5dCs)csascsusc GCCACUC UUGGA 1149_aso NM_000488.3_ 1140 csasuscsasdTs(m5dCs)dTs(m5dCs)(m5dCs)dTs 521 CAUCAUCUCCUCC 705 AUGAAUUGGAGGAGA 889 1140- (m5dCs)(m5dCs)dAsdAsususcsasu AAUUCAU UGAUG 1159_aso NM_000488.3_ 1150 gsgsascscsdAs(m5dCs)(m5dCs)dAsdGs(m5dCs) 522 GGACCACCAGCAU 706 GGAGAUGAUGCUGGU 890 1150- dAsdTs(m5dCs)dAsuscsuscsc CAUCUCC GGUCC 1169_aso NM_000488.3_ 1160 csgsgsgsgs(m5dCs)dAsdTsdGsdTsdGsdGsdAs 523 CGGGGCAUGUGGA 707 CUGGUGGUCCACAUG 891 1160- (m5dCs)(m5dCs)ascscsasg CCACCAG CCCCG 1179_aso NM_000488.3_ 1170 asasusgscsdGsdGsdAsdAsdGs(m5dCs)dGsdGsd 524 AAUGCGGAAGCGG 708 ACAUGCCCCGCUUCC 892 1170- GsdGscsasusgsu GGCAUGU GCAUU 1189_aso NM_000488.3_ 1180 asgscscsgsdTs(m5dCs)(m5dCs)dTs(m5dCs)dAs 525 AGCCGUCCUCAAU 709 CUUCCGCAUUGAGGA 893 1180- dAsdTsdGs(m5dCs)gsgsasasg GCGGAAG CGGCU 1199_aso NM_000488.3_ 1190 ususcsasasdAs(m5dCs)dTsdGsdAsdAsdGs 526 UUCAAACUGAAGC 710 GAGGACGGCUUCAGU 894 1190- (m5dCs)(m5dCs)dGsuscscsusc CGUCCUC UUGAA 1209_aso NM_000488.3_ 1200 csasgscsusdGs(m5dCs)dTs(m5dCs)(m5dCs)dTs 527 CAGCUGCUCCUUC 711 UCAGUUUGAAGGAGC 895 1200- dTs(m5dCs)dAsdAsascsusgsa AAACUGA AGCUG 1219_aso NM_000488.3_ 1210 cscsasusgsdTs(m5dCs)dTsdTsdGs(m5dCs)dAsd 528 CCAUGUCUUGCAG 712 GGAGCAGCUGCAAGA 896 1210- Gs(m5dCs)dTsgscsuscsc CUGCUCC CAUGG 1229_aso NM_000488.3_ 1220 uscsgsascsdAsdAsdGsdGs(m5dCs)(m5dCs) 529 UCGACAAGGCCCA 713 CAAGACAUGGGCCUU 897 1220- (m5dCs)dAsdTsdGsuscsususg UGUCUUG GUCGA 1239_aso NM_000488.3_ 1230 gscsusgsasdAs(m5dCs)dAsdGsdAsdTs(m5dCs) 530 GCUGAACAGAUCG 714 GCCUUGUCGAUCUGU 898 1230- dGsdAs(m5dCs)asasgsgsc ACAAGGC UCAGC 1249_aso NM_000488.3_ 1240 ascsusususdTs(m5dCs)dAsdGsdGsdGs(m5dCs) 531 ACUUUUCAGGGCU 715 UCUGUUCAGCCCUGA 899 1240- dTsdGsdAsascsasgsa GAACAGA AAAGU 1259_aso NM_000488.3_ 1250 gsgsgsasgsdTsdTsdTsdGsdGsdAs(m5dCs)dTsd 532 GGGAGUUUGGACU 716 CCUGAAAAGUCCAAA 900 1250- TsdTsuscsasgsg UUUCAGG CUCCC 1269_aso NM_000488.3_ 1260 asascsasasdTsdAs(m5dCs)(m5dCs)dTsdGsdGsd 533 AACAAUACCUGGG 717 CCAAACUCCCAGGUA 901 1260- GsdAsdGsusususgsg AGUUUGG UUGUU 1279_aso NM_000488.3_ 1270 gsgscscsusdTs(m5dCs)dTsdGs(m5dCs)dAsdAs 534 GGCCUUCUGCAAC 718 AGGUAUUGUUGCAGA 902 1270- (m5dCs)dAsdAsusascscsu AAUACCU AGGCC 1289_aso NM_000488.3_ 1280 asgsgsuscsdAsdTs(m5dCs)dTs(m5dCs)dGsdGs 535 AGGUCAUCUCGGC 719 GCAGAAGGCCGAGAU 903 1280- (m5dCs)(m5dCs)dTsuscsusgsc CUUCUGC GACCU 1299_aso NM_000488.3_ 1290 usgsasgsas(m5dCs)dAsdTsdAsdGsdAsdGsdGsd 536 UGAGACAUAGAGG 720 GAGAUGACCUCUAUG 904 1290- Ts(m5dCs)asuscsusc UCAUCUC UCUCA 1309_aso NM_000488.3_ 1300 gsgsasasusdGs(m5dCs)dAsdTs(m5dCs)dTsdGs 537 GGAAUGCAUCUGA 721 CUAUGUCUCAGAUGC 905 1300- dAsdGsdAscsasusasg GACAUAG AUUCC 1319_aso NM_000488.3_ 1310 asasusgscs(m5dCs)dTsdTsdAsdTsdGsdGsdAsd 538 AAUGCCUUAUGGA 722 GAUGCAUUCCAUAAG 906 1310- AsdTsgscsasusc AUGCAUC GCAUU 1329_aso NM_000488.3_ 1320 usascscsus(m5dCs)dAsdAsdGsdAsdAsdAsdTsd 539 UACCUCAAGAAAU AUAAGGCAUUUCUUG 907 1320- Gs(m5dCs)csususasu GCCUUAU 723 AGGUA 1339_aso NM_000488.3_ 1330 csususcsusdTs(m5dCs)dAsdTsdTsdTsdAs 540 CUUCUUCAUUUAC 724 UCUUGAGGUAAAUGA 908 1330- (m5dCs)(m5dCs)dTscsasasgsa CUCAAGA AGAAG 1349_aso NM_000488.3_ 1340 gscsususcsdAs(m5dCs)dTsdGs(m5dCs)(m5dCs) 541 GCUUCACUGCCUU 725 AAUGAAGAAGGCAGU 909 1340- dTsdTs(m5dCs)dTsuscsasusu CUUCAUU GAAGC 1359_aso NM_000488.3_ 1350 ascsususgs(m5dCs)dAsdGs(m5dCs)dTsdGs 542 ACUUGCAGCUGCU 726 GCAGUGAAGCAGCUG 910 1350- (m5dCs)dTsdTs(m5dCs)ascsusgsc UCACUGC CAAGU 1369_aso NM_000488.3_ 1360 csasascsasdGs(m5dCs)dGsdGsdTsdAs(m5dCs)d 543 CAACAGCGGUACU 727 AGCUGCAAGUACCGC 911 1360- TsdTsdGscsasgscsu UGCAGCU UGUUG 1379_aso NM_000488.3_ 1370 cscsasgscsdAsdAsdTs(m5dCs)dAs(m5dCs)dAs 544 CCAGCAAUCACAA 728 ACCGCUGUUGUGAUU 912 1370- dAs(m5dCs)dAsgscsgsgsu CAGCGGU GCUGG 1389_aso NM_000488.3_ 1380 usasgscsgsdAsdAs(m5dCs)dGsdGs(m5dCs) 545 UAGCGAACGGCCA 729 UGAUUGCUGGCCGUU 913 1380- (m5dCs)dAsdGs(m5dCs)asasuscsa GCAAUCA CGCUA 1399_aso NM_000488.3_ 1390 usgsususgsdGsdGsdGsdTsdTsdTsdAsdGs 546 UGUUGGGGUUUAG 730 CCGUUCGCUAAACCC 914 1390- (m5dCs)dGsasascsgsg CGAACGG CAACA 1409_aso NM_000488.3_ 1400 asasasgsus(m5dCs)dAs(m5dCs)(m5dCs) 547 AAAGUCACCCUGU 731 AACCCCAACAGGGUG 915 1400- (m5dCs)dTsdGsdTsdTsdGsgsgsgsusu UGGGGUU ACUUU 1419_aso NM_000488.3_ 1410 gsususgsgs(m5dCs)(m5dCs)dTsdTsdGsdAsdAs 548 GUUGGCCUUGAAA 732 GGGUGACUUUCAAGG 916 1410- dAsdGsdTscsascscsc GUCACCC CCAAC 1429_aso NM_000488.3_ 1420 gsgsasasasdGsdGs(m5dCs)(m5dCs)dTsdGsdTsd 549 GGAAAGGCCUGUU 733 CAAGGCCAACAGGCC 917 1420- TsdGsdGscscsususg GGCCUUG UUUCC 1439_aso NM_000488.3_ 1430 asusasasasdAsdAs(m5dCs)(m5dCs)dAsdGsdGs 550 AUAAAAACCAGGA 734 AGGCCUUUCCUGGUU 918 1430- dAsdAsdAsgsgscscsu AAGGCCU UUUAU 1449_aso NM_000488.3_ 1440 asascsusus(m5dCs)dTs(m5dCs)dTsdTsdAsdTs 551 AACUUCUCUUAUA 735 UGGUUUUUAUAAGAG 919 1440- dAsdAsdAsasascscsa AAAACCA AAGUU 1459_aso NM_000488.3_ 1450 usgsususcsdAsdGsdAsdGsdGsdAsdAs(m5dCs) 552 UGUUCAGAGGAAC 736 AAGAGAAGUUCCUCU 920 1450- dTsdTscsuscsusu UUCUCUU GAACA 1469_aso NM_000488.3_ 1460 asasgsasusdAsdAsdTsdAsdGsdTsdGsdTsdTs 553 AAGAUAAUAGUGU 737 CCUCUGAACACUAUU 921 1460- (m5dCs)asgsasgsg UCAGAGG AUCUU 1479_aso NM_000488.3_ 1470 uscsusgscs(m5dCs)(m5dCs)dAsdTsdGsdAsdAs 554 UCUGCCCAUGAAG 738 CUAUUAUCUUCAUGG 922 1470- dGsdAsdTsasasusasg AUAAUAG GCAGA 1489_aso NM_000488.3_ 1480 gsgsususgsdGs(m5dCs)dTsdAs(m5dCs)dTs 555 GGUUGGCUACUCU 739 CAUGGGCAGAGUAGC 923 1480- (m5dCs)dTsdGs(m5dCs)cscsasusg GCCCAUG CAACC 1499_aso NM_000488.3_ 1490 ususasascsdAs(m5dCs)dAsdAsdGsdGsdGsdTsd 556 UUAACACAAGGGU 740 GUAGCCAACCCUUGU 924 1490- TsdGsgscsusasc UGGCUAC GUUAA 1509_aso NM_000488.3_ 1500 asascsasusdTsdTsdTsdAs(m5dCs)dTsdTsdAsd 557 AACAUUUUACUUA 741 CUUGUGUUAAGUAAA 925 1500- As(m5dCs)ascsasasg ACACAAG AUGUU 1519_aso NM_000488.3_ 1510 asasasgsasdAsdTsdAsdAsdGsdAsdAs(m5dCs)d 558 AAAGAAUAAGAAC 742 GUAAAAUGUUCUUAU 926 1510- AsdTsusususasc AUUUUAC UCUUU 1529_aso NM_000488.3_ 1520 gsasasgsasdGsdGsdTsdGs(m5dCs)dAsdAsdAsd 559 GAAGAGGUGCAAA 743 CUUAUUCUUUGCACC 927 1520- GsdAsasusasasg GAAUAAG UCUUC 1539_aso NM_000488.3_ 1530 cscsasasasdAsdAsdTsdAsdGsdGsdAsdAsdGsd 560 CCAAAAAUAGGAA 744 GCACCUCUUCCUAUU 928 1530- Asgsgsusgsc GAGGUGC UUUGG 1549_aso NM_000488.3_ 1540 usgsususcsdAs(m5dCs)dAsdAsdAs(m5dCs) 561 UGUUCACAAACCA 745 CUAUUUUUGGUUUGU 929 1540- (m5dCs)dAsdAsdAsasasusasg AAAAUAG GAACA 1559_aso NM_000488.3_ 1550 usususususdAs(m5dCs)dTsdTs(m5dCs)dTsdGs 562 UUUUUACUUCUGU 746 UUUGUGAACAGAAGU 930 1550- dTsdTs(m5dCs)ascsasasa UCACAAA AAAAA 1569_aso NM_000488.3_ 1560 usususgsusdAsdTsdTsdTsdAsdTsdTsdTsdTsdT 563 UUUGUAUUUAUUU 747 GAAGUAAAAAUAAAU 931 1560- sascsususc UUACUUC ACAAA 1579_aso NM_000488.3_ 1570 asusgsgsasdAsdGsdTsdAsdGsdTsdTsdTsdGsdT 564 AUGGAAGUAGUUU 748 UAAAUACAAACUACU 932 1570- sasusususa GUAUUUA UCCAU 1589_aso
Example 2. In Vitro Screening
[0488] Serpinc1 (AT3) gapmer transfections were done at 5 nM. Single dose screen of 184 Serpinc1 oligos was performed in Huh7 cells, directly after seeding 25,000 cells per well on 96 well plates. Each oligo was transfected in quadruplicate with 0.5 μl Lipofectamine 2000/well. Transfections were harvested 24 h after seeding/transfection. Transfection of an Aha1-LNA gapmer, and mock transfections were performed quadruplicate on each plate as control. Mean values of Serpinc1/GAPDH from Aha1-LNA transfection was set as 100% Serpinc1 expression, which is the reference for all other mean values shown in Table 5. At the same time, the Aha1-LNA also served as a transfection control on each plate.
[0489] The complete screen was performed in two transfection “sessions”. Overall, transfection efficiency with Aha1-oligo was between ˜60-70% at 5 nM. All Serpinc1 oligos were less efficient than the Aha1-LNA at the same concentration.
[0490] Transfection efficiency for each plate was determined, and compared with one another in order to correct the results for the difference in transfection efficiency between the plates.
TABLE-US-00005 TABLE 5 Transfection efficiency of antisense polynucleotides targeting Serpinc1 (AT3) Mean val % Corrected (w/o transfection correction) sd % efficiency X10631K1 85 13 76 X10632K1 92 17 83 X10633K1 85 9 76 X10634K1 81 10 72 X10635K1 71 3 62 X10636K1 91 18 83 X10637K1 90 2 81 X10638K1 82 14 73 X10639K1 72 24 63 X10640K1 71 7 62 X10641K1 86 18 77 X10642K1 105 14 96 X10643K1 99 4 90 X10644K1 90 11 81 X10645K1 113 15 104 X10646K1 87 18 78 X10647K1 100 27 91 X10648K1 96 17 87 X10649K1 105 39 96 X10650K1 105 30 96 X10651K1 103 15 103 X10652K1 76 7 76 X10653K1 90 12 90 X10654K1 95 10 95 X10655K1 84 5 84 X10656K1 89 8 89 X10657K1 104 13 104 X10658K1 89 14 89 X10659K1 69 6 69 X10660K1 80 3 80 X10661K1 95 19 95 X10662K1 88 14 88 X10663K1 106 15 106 X10664K1 91 7 91 X10665K1 79 12 79 X10666K1 96 7 96 X10667K1 101 14 101 X10668K1 96 13 96 X10669K1 74 7 74 X10670K1 69 8 69 X10671K1 79 6 78 X10672K1 117 10 117 X10673K1 86 8 86 X10674K1 96 10 95 X10675K1 100 5 99 X10676K1 96 16 95 X10677K1 103 10 102 X10678K1 118 11 117 X10679K1 95 12 94 X10680K1 90 5 89 X10681K1 99 15 99 X10682K1 93 8 92 X10683K1 105 7 105 X10684K1 99 8 98 X10685K1 97 12 96 X10686K1 102 3 102 X10687K1 77 12 76 X10688K1 81 7 81 X10689K1 69 16 68 X10690K1 78 8 78 X10691K1 126 16 124 X10692K1 105 13 103 X10693K1 107 24 105 X10694K1 91 17 89 X10695K1 138 19 136 X10696K1 110 8 108 X10697K1 103 17 101 X10698K1 101 13 99 X10699K1 106 10 104 X10700K1 86 5 84 X10701K1 82 3 80 X10702K1 95 15 93 X10703K1 96 16 94 X10704K1 85 7 83 X10705K1 102 9 100 X10706K1 111 11 109 X10707K1 100 27 98 X10708K1 122 6 120 X10709K1 85 9 83 X10710K1 82 26 80 X10711K1 102 19 94 X10712K1 105 5 97 X10713K1 97 8 89 X10714K1 107 5 99 X10715K1 104 19 96 X10716K1 103 3 95 X10717K1 107 15 99 X10718K1 115 20 107 X10719K1 96 16 88 X10720K1 96 11 88 X10721K1 75 8 66 X10722K1 76 5 67 X10723K1 85 3 77 X10724K1 84 12 76 X10725K1 93 6 85 X10726K1 92 16 84 X10727K2 99 6 91 X10728K2 101 11 93 X10729K2 96 2 87 X10730K2 98 8 90 X10731K2 168 5 160 X10732K2 160 15 152 X10733K2 155 9 147 X10734K2 139 6 131 X10735K2 123 12 115 X10736K2 133 31 125 X10737K2 115 15 107 X10738K2 116 25 108 X10739K2 96 9 88 X10740K2 96 6 88 X10741K2 109 10 102 X10742K2 109 15 101 X10743K2 147 41 139 X10744K2 192 33 185 X10745K2 163 67 155 X10746K2 145 21 138 X10747K2 148 55 140 X10748K2 139 23 131 X10749K1 117 15 109 X10750K1 93 7 85 X10751K1 114 19 113 X10752K1 139 24 138 X10753K1 133 30 132 X10754K1 87 14 86 X10755K1 91 11 90 X10756K1 98 19 97 X10757K1 105 9 104 X10758K1 97 7 96 X10759K1 99 11 98 X10760K1 82 5 81 X10761K1 118 36 117 X10762K1 135 22 133 X10763K2 129 31 128 X10764K2 111 19 110 X10765 103 9 102 X10766K2 106 15 105 X10767K1 100 6 99 X10768K1 106 16 104 X10769K1 85 11 84 X10770K1 88 12 87 X10771K1 110 10 104 X10772K1 82 27 76 X10773K2 97 18 92 X10774K1 119 14 113 X10775K1 108 12 103 X10776K1 96 5 91 X10777K1 100 10 95 X10778K1 86 5 81 X10779K1 103 14 98 X10780K1 105 12 100 X10781K1 139 5 134 X10782K1 115 9 109 X10783K1 132 35 127 X10784K1 96 10 90 X10785K1 86 5 81 X10786K1 113 8 108 X10787K1 110 3 105 X10788K1 105 10 100 X10789K1 114 7 109 X10790K1 114 8 109 X10791K1 92 4 84 X10792K1 90 8 81 X10793K1 91 11 83 X10794K1 94 5 86 X10795K1 99 14 91 X10796K1 127 9 119 X10797K1 105 6 97 X10798K1 126 13 117 X10799K1 115 13 107 X10800K1 119 7 110 X10801K1 106 21 98 X10802K1 94 11 86 X10803K1 111 23 103 X10804K1 102 9 93 X10805K1 79 16 70 X10806K1 108 12 99 X10807K1 116 11 108 X10808K1 123 14 115 X10809K1 97 16 89 X10810K1 90 12 82 X10811K1 133 20 122 X10812K1 133 20 122 X10813K1 116 9 104 X10814K1 97 13 86
EQUIVALENTS
[0491] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the following claims.