RESISTANCE TO ARTHROPOD PEST IN TOMATOES
20170240910 · 2017-08-24
Assignee
Inventors
- Tjeerd Adrianus Lambertus Snoeren (St Utrecht, NL)
- Einat Sitbon (Ness Ziona, IL)
- David Levy (Lapid, IL)
Cpc classification
A01H1/1245
HUMAN NECESSITIES
A01H1/04
HUMAN NECESSITIES
International classification
C12N15/82
CHEMISTRY; METALLURGY
A01H1/04
HUMAN NECESSITIES
Abstract
The present invention is directed to a commercial tomato, namely S. lycopersicum plant, which is resistant to an arthropod pest comprising in its genome introgressed sequences from S. galapagense conferring resistance to said arthropod pest, wherein the introgressed sequences are chosen from those present in the genome of a plant of the line TUT115 NCIMB accession number 42109. The commercial tomato of the invention is preferably resistant to ToMV (Tomato Mosaic Virus). The introgressed sequences are preferably found at one or more of the loci defined by the following SNP markers: SNP solcap_snp_sl_18619 on chromosome 1 and SNP solcap_snp_sl_12348 on chromosome 1.
Claims
1. A S. lycopersicum plant, which is resistant to an arthropod pest and resistant to ToMV (Tomato Mosaic Virus), comprising in its genome introgressed sequences from S. galapagense conferring resistance to said arthropod pest, wherein the introgressed sequences are chosen from those present in the genome of a plant of the line TUT115 (NCIMB accession number 42109), and wherein the introgressed sequences are present on chromosome 1 at one or more of the following loci, locus encompassing SNP solcap_snp_sl_18619 at position 68232900 of chromosome 1, on the tomato genome version 2.40, and locus encompassing SNP solcap_snp_sl_12348 at position 72528600 of chromosome 1, on the tomato genome version 2.40.
2. A S. lycopersicum plant according to claim 1, wherein introgressed sequences are also to be found at the locus encompassing SNP SLC2.31_1_72272308, at position 72271870 of chromosome 1, on the tomato genome version 2.40.
3. A S. lycopersicum plant according to claim 1, wherein said introgressed sequences include the fragment corresponding to that comprised between and including SNPs SNP solcap_snp_sl_18619 at position 68232900 of chromosome 1, on the tomato genome version 2.40 and SNP solcap_snp_sl_12348 at position 72528600 of chromosome 1, on the tomato genome version 2.40, in chromosome 1 of a plant of the line TUT115 NCIMB accession number 42109.
4. A S. lycopersicum plant according to claim 1, wherein said introgressed sequences include the fragment corresponding to that comprised between and including SNPs solcap_snp_sl_59890 at position 4597950 of chromosome 1, on the tomato genome version 2.40 and solcap_snp_sl_15339 at position 77112400 of chromosome 1, on the tomato genome version 2.40, in chromosome 1 of a plant of the line TUT115 NCIMB accession number 42109.
5. A S. lycopersicum plant according to claim 1, wherein further introgressed sequences are also to be found at one or more of the following loci: a) Locus encompassing SNP EE_0301 on chromosome 5, b) Locus encompassing SNP CL016475-0340 on chromosome 9, c) Locus encompassing SNP EP_0502 on chromosome 9, d) Locus encompassing SNP EE_4969_LC7529 on chromosome 9, e) Locus encompassing SNP EE_2332 on chromosome 9, and wherein the introgressed sequences are chosen from those present in the genome of a plant of the line TUT115 NCIMB accession number 42109.
6. A S. lycopersicum plant according to claim 1, wherein the introgressed sequences from S. galapagense are homozygously present in the genome of the plant.
7. A S. lycopersicum plant according to claim 1, characterized by the presence in the genome of said S. lycopersicum plant the following alleles: allele G of SNP solcap_snp_sl_18619, allele C of SNP solcap_snp_sl_12348; allele T of SNP EE_0301, allele A of SNP CL016475-0340; allele C of SNP EP_0502, allele A of SNP EE_4969 LC7529 and allele T of SNP EE_2332.
8. A S. lycopersicum plant according to claim 1, wherein the introgressed sequences from S. galapagense comprise at least 5 kb.
9. The plant according to claim 1, wherein said introgressed sequences are less than 25 cM each in length, preferably less than 10 cM, most preferably less than 5 cM.
10. The plant according to claim 1, wherein said introgressed sequences constitute Quantitative Trait Loci (QTL) underlying the trait corresponding to resistance to arthropod pest.
11. The plant according to claim 5 comprising introgressed sequences at 2 loci or more, preferably at 3 or 5 of said loci.
12. The plant according to claim 1 further comprising, introgressed in its genome: a sequence corresponding to that comprised between SNPs EP_0489_LC7684 and EE_1452 in chromosome 9 of a plant of the line TUT115 NCIMB accession number 42109.
13. The plant according to claim 12 further comprising, introgressed in its genome: a sequence corresponding to that comprised between SNPs solcap_snp_sl_40154 and EP_1592_LC7762 in chromosome 1 of a plant of the line TUT115 NCIMB accession number 42109, and/or a sequence corresponding to that comprised between SNPs EE_4363_LC7656 and SL10539_786_LC7260 in chromosome 6 of a plant of the line TUT115 NCIMB accession number 42109, and/or a sequence corresponding to that comprised between SNPs SL10204_1269 and EE_0924 in chromosome 12 of a plant of the line TUT115 NCIMB accession number 42109.
14. The plant according to claim 1, wherein said plant is a progeny of a plant of line TUT115 (NCIMB accession number 42109).
15. The plant according to claim 1, wherein said arthropods are insects.
16. The plant according to claim 1, wherein the arthropod is the South American pinworm T. absoluta.
17. The plant according to claim 1, wherein the arthropods are chosen from the group comprising whiteflies, thrips and spider mites.
18. The plant according to claim 1, wherein said resistance is measured by Percent Leaflet Attacked, preferably at 8 days post infestation.
19. A cell of a S. lycopersicum plant according to claim 1, comprising in its genome introgressed sequences from S. galapagense conferring resistance to said arthropod pest, at one or more of said loci, wherein the introgressed sequences are chosen from those present in the genome of a plant of the line TUT115 (NCIMB accession number 42109).
20. Plant part of a S. lycopersicum plant according to claim 1, in particular seeds, reproductive material, roots, flowers, fruits, rootstock or scion, said plant part comprising cells according to claim 17.
21. Seed of a S. lycopersicum plant, which develops into a plant according to claim 1.
22. A method for detecting and/or selecting S. lycopersicum plants having introgressed sequences from S. galapagense as found in the genome of a plant of the line TUT115 (NCIMB accession number 42109), said introgressed sequences conferring resistance to arthropods, comprising detection of at least one of the following markers: allele G of SNP solcap_snp_sl_18619, allele C of SNP solcap_snp_sl_12348; allele T of SNP SLC2.31_1_72272308, in a genetic material sample of the plant to be selected.
23. Hybrid plant of S. lycopersicum, obtainable by crossing a plant of S. lycopersicum with a resistant plant according to claim 1.
24. Method for the production of S. lycopersicum plants resistant to arthropod pest comprising the steps of: a) Making a cross between a plant of the line TUT115 (NCIMB accession number 42109), or resistant progeny thereof, and a susceptible or less resistant S. lycopersicum plant, in which the resistance to arthropod pest is to be imported or improved; b) Selecting one resistant plant to arthropod pest in the progeny thus obtained, or one plant bearing sequences linked to said resistance; c) Optionally self-pollinating one or several times the resistant plant obtained at step b) and selecting a plant resistant to arthropod pest in the progeny thus obtained; d) Backcrossing the resistant plant selected in step b) or c) with a susceptible S. lycopersicum plant; and e) Selecting a plant resistant to arthropod pest.
25. Method for the production of S. lycopersicum plants resistant to arthropod pest comprising the steps of a1) Making a cross between a plant of the line TUT115 (NCIMB accession number 42109), or resistant progeny thereof, and a susceptible or less resistant S. lycopersicum plant, in which the resistance to arthropod pest is to be imported or improved, thus generating the F1 population. a2) Increasing the F1 population to create F2 population; b) Selecting resistant individuals in the progeny thus obtained; c) Optionally self-pollinating one or several times the resistant plant obtained at step b) and selecting a resistant plant in the progeny thus obtained; d) Backcrossing the resistant plant selected in step c) or d) with a susceptible S. lycopersicum plant; and e) Selecting a plant resistant to arthropod pest.
26. The method according to claim 22 or 23, wherein SNPs markers are used in steps b), c) and/or e) for selecting plants resistant to arthropod pest or bearing sequences linked to said resistance.
27. The method according to claim 22 or 23, wherein the selection in step b), c) and/or e) is carried out by detection of at least one of the following alleles: allele G of SNP solcap_snp_sl_18619, allele C of SNP solcap_snp_sl_12348 and allele T of SNP SLC2.31_1_72272308.
28. A method for detecting and/or selecting S. lycopersicum plants having introgressed sequences from S. galapagense as found in the genome of a plant of the line TUT115 (NCIMB accession number 42109), said introgressed sequences conferring resistance to arthropods, comprising detection of at least one of the following markers: allele G of SNP solcap_snp_sl_18619, allele C of SNP solcap_snp_sl_12348 and allele T of SNP SLC2.31_1_72272308, in a genetic material sample of the plant to be selected.
Description
LEGEND OF FIGURES
[0208]
[0209]
[0210]
[0211]
[0212]
[0213]
[0214]
[0215]
[0216]
[0217]
EXPERIMENTAL SECTION
Example 1: Test of a Possible Source of Resistance to T. absoluta
[0218] As a starting point of the realization of the invention, the present inventors have conducted several experiments to screen for tomato pinworm resistance amongst several tomato species. As of today, S. galapagense has not been identified as a possible source of resistance to T. absoluta.
[0219] Materials and Methods:
[0220] Tomato Germplasm Rearing
[0221] Tomato germ plasm was sown and reared in nursery trays (187 holes of 1.5″/tray). Seedlings having 3-4 true leaves were transplanted into 1 L pots containing soil mixture of peat and volcano soil (2:1). Plants were transferred to an insect free greenhouse for further development. Plants were regularly watered and fertilizer was added (6:6:6 NPK+micro elements). Temperatures varied between day and night and over seasons: namely 26° C. at day and 17° C. at night in winter, and 27° C. at day and 23° C. at night in summer. No insecticides were applied, and after three weeks plants were treated with the fungicide PROPAMOCARB-HCL. Plants having at least 6 true leaves were used for experiments, these plants were approximately 6 weeks old and 30-45 cm of height.
[0222] Germplasms tested are mentioned in table 1:
TABLE-US-00001 TABLE 1 Name Species LYCO3 S. lycopersicum LYCO4 S. lycopersicum LYCO5 S. lycopersicum LYCO1 S. lycopersicum LYCO6 S. lycopersicum LYCO2 (Rehovot-13) S. lycopersicum HABRO1 S. habrochaites PENN1 S. pennellii PERU1 S. peruvianum HABRO2 S. habrochaites PIMP1 S. pimpinellifolium NEORI S. neorickii PENN2 S. pennellii PERU2 S. peruvianum CHMIE1 S. chmielewskii GALA1 S. cheesmaniae or S. galapagense HABRO3 S. habrochaites HABRO4 S. habrochaites glabratum ARCA1 S. arcanum PERU3 S. peruvianum CHMIE2 S. chmielewskii
[0223] South American Tomato Pinworm Rearing
[0224] The South American tomato pinworm population is reared on LYCO2 tomato plants. Plants having at least 6 true leaves were placed in an insect cage (45*45*90 cm; 150 mesh gauze), to which adult pinworms were added. Pinworm adults were collected from infested commercial greenhouse tomato plants. Insects were reared at approximately 25° C. and under 16 hr:8 hr (L:D) (TLD 840 36W Philips) light conditions. Under these growing conditions the pest life cycle lasts approximately 28 days. For transferring adult tomato pinworms an insect vacuum collector was used.
[0225] Tomato Pinworm Oviposition Experiment: Multiple Choice Experiment
[0226] A selection of 15 different genotypes (see also table 1) were tested for differences in oviposition attractiveness for pinworm females. One plant originating from one genotype was randomly placed in an insect cage (45*45*90 cm; 150 mesh gauze). Experimental plants were exposed to 100 adult moths. Two days post infestation (2 dpi) the total number of eggs per leaves present per genotype were scored (24-26° C., 50-70% RH; 8 hr darkness and 16 hr light (Philips reflex TLD 840 36W)).
[0227] Tomato Pinworm Oviposition Experiment: Three Choice Experiment
[0228] Differences in pinworm oviposition behavior between three genotypes, i.e. LYCO2, LYCO1, and GALA1 (see table 1), were studied. Plants were positioned in an insect cage (45*45*90 cm; 150 mesh gauze), and were exposed to 50 adult moths. Three days post infestation (3 dpi) the number of eggs laid on the first fully developed leaf per genotype were counted (24-26° C., 50-70% RH; 8 hr darkness and 16 hr light (Philips reflex TLD 840 36W)).
[0229] Pinworm Feeding Behavior Experiment
[0230] Pinworm larval feeding behavior was studied by exposing a selection of tomato genotypes to adult moths in a choice set-up. Plants were positioned in an insect cage (45*45*90 cm; 150 mesh gauze). One cage contained 15 randomly placed individual plants from different germ plasm, the experiment consisted out of two replicates. Per replicate the genotypes under testing (see also table 1) were exposed to 100 adult moths. Seven days post infestation the exact number of mines per leaf were counted, since number of mines are indicative for feeding attractiveness by the pinworm larvae. A mine is the space created in leaf tissue between the epidermal layers by herbivore feeding (24-26° C., 50-70% RH; 8 hr darkness and 16 hr light (Philips reflex TLD 840 36W)).
[0231] Identification of the Resistant Recombinant Inbred Lines Developed from GALA1 and LYCO1
[0232] Greenhouse
[0233] Experiments were conducted in a plastic greenhouse of approximately 300 m.sup.2. Inside the greenhouse LYCO2 tomato plants were used for building up a tomato pinworm population, for this end on regular basis new LYCO2 plants obtained from the nursery were transplanted in the greenhouse in 15 L pots filled with clean volcano soil. LYCO2 tomato plants were grown on both long outer rows of the greenhouse.
[0234] The internal rows were divided into 14 different sections (plots) with 16 pots each (15 L), in between plots also some LYCO2 tomato plants were positioned.
[0235] Plant Preparation Used for Identification Experiments:
[0236] All plants that were used in the choice experiment were sown and reared in the nursery in trays (187 holes of 1.5″/tray), without the application of insecticides. Seedlings having 3-4 true leaves were transplanted into 1 L pots containing soil mixture of peat and volcano soil (2:1). Plants were transferred to an insect free greenhouse for further development until they reached at least 6 true leaves up to 10 true leaves. This variation in number of true leaves was caused by differences in plant growth between tomato germ plasm. Plants were supported by bamboo sticks using plastic clips.
[0237] Set-Up of the Greenhouse Experiments:
[0238] When tomato pinworms reared on LYCO2 plants were abundantly present in the greenhouse, tomato germplasm ready for testing were transferred into the greenhouse. Selected plants for testing were roughly one meter of height (+/−BBCH-18: 8 true leaves: 7 weeks after sowing) (Zadoks et al., 1974). Plants were directly positioned with their 1 L plastic pots into the 15 L pots, and a drip irrigation dropper was positioned in the 1 L pot. The tomato plants were placed in the greenhouse in a plot design with 7 experimental repetitions. Within each plot plants were positioned randomly. Temperatures varied between 17° C. at night and 40° C. during the day. The total RIL population screen experiment was divided in sub-experiments by plantation date.
[0239] From each plant in BBCH-18, 3 consecutive fully developed leaves positioned in the upper third part of the plant were tagged. Three days after positioning in the greenhouse, eggs were counted on all tagged leaves. Approximately 8 and 13 days after exposure to the pinworm population in the greenhouse, the Leaflet Lesion Type (LLT), the Percent Leaflet Attacked (PLA) were scored per prior tagged leaflets, and Overall Plant Damage (OPD) was noticed (see: Maluf et al., 1997, table 1). Analysis of means using a Dunnett's method. For this, the susceptible recurrent parent of the RIL population, LYCO1, was used as a control.
TABLE-US-00002 TABLE 2 Indexing system used to score the parameters Leaflet Lesion Type (LLT), Overall Plant Damage (OPD) and Percent Leaflets Attacked (PLA) in plants infested by the pinworm. LLT (= Leaflet Lesion Type) Scores: 0 = no lesion. 1 = lesions small, rare. 2 = small to medium-size lesions, usually towards the leaflet borders. 3 = medium to large-size lesions, coalescent; foliar borders deformed. 4 = large-size lesions, coalescent; leaflets deformed. 5 = whole leaflet surface lesioned. OPD (= Overall Plant Damage) Scores: 0 = no leaf damage. 1 = up to 5% total leaf area damaged; small, non-coalescent lesions. 2 = >5% up to 20% total leaf area damaged; small, non-coalescent lesions. 3 = >20% to 50% total leaf area damaged; medium to large-size lesions. 4 = >50% up to 80% total leaf area damaged; lesions numerous, large, coalescent. 5 = >80% to 100% total leaf area damaged. PLA (= Percent Leaflets Attacked) Scores: 0 = no leaflets attacked. 1 = 0% to 5% leaflets attacked. 2 = 5% to 20% leaflets attacked. 3 = 20% to 50% leaflets attacked. 4 = 50% to 80% leaflets attacked. 5 = 80% to 100% leaflets attacked.
[0240] Results
[0241] 1/ Pinworm Oviposition Behaviour
[0242] 1.1/ Multiple-Choice Experiment
[0243] Pinworm oviposition preferences were studied under climatized lab-conditions. For each tested genotype one plant was positioned in an experimental cage. Plants were approximately of the same height, while number of leaves ranged between 6 and 11. Plants were exposed to 100 adult moths for 2 days, after which number of eggs per leaf per plant were scored. Per tested genotype the average number of eggs per leaf were calculated.
[0244] Results are presented in
[0245] 1.2/ Three-Choice Experiment:
[0246] Different tomato genotypes were tested in a choice experiment for oviposition preferences by the pinworm. Plants were positioned in an experimental cage (one plant per genotype) under controlled lab-conditions. Plants were approximately of the same height, while number of leaves ranged between 7 and 11. Plants were exposed to 50 adult moths for 3 days. Three days post infestation the exact number of eggs on the first fully developed leaf per plant was counted.
[0247] Results are presented in
[0248] 2/ Pinworm Feeding Behaviour
[0249] Pinworm larval feeding behaviour was studied by exposing tomato genotypes to 100 adult moths in a choice experiment. Tested tomato genotypes were positioned in a cage under climatized lab-conditions (two replicates with one plant per genotype).
[0250] Plants were approximately of the same height, while number of leaves ranged between 6 and 11. At 7 dpi the exact numbers of mines per leaf were counted.
[0251] Results are presented in
[0252] Conclusion:
[0253] In the conducted tests, the present inventors demonstrated a level of resistance for several genotypes against the pinworm. Based on these results, the inventors selected GALA1 as the most suitable candidate for further experiments.
[0254] 3/ Identification of the Resistant R/L-Varieties Developed from GALA1 and LYCO1
[0255] Aim:
[0256] In this experiment the inventors studied direct and indirect life cycle parameters like oviposition and feeding of the pinworm on donor GALA1 (L. galapagense), recurrent parent LYCO1 (L. esculentum), the rearing variety for the pinworm, i.e. LYCO2, and the individual RIL lines.
[0257] Results: The RIL population created with donor GALA1 and recurrent parent LYCO1, was screened for resistance against the tomato pinworm.
[0258] More specifically, the used RIL population was an interspecific population derived from a cross between S. lycorpersicum (inbred cultivar LYCO1) and S. galapagense GALA1. LYCO1 was verified as susceptible to South American Pinworm. This population consisted of F8 Recombinant Inbred Lines (RILs) developed by Single Seed Descent.
[0259] RIL lines per sub-experiment with significant higher levels of resistance than their recurrent parent, LYCO1, are listed below in table 3. Means for distinct parameters from RIL's were statistically compared with the mean of the recurrent parent per plantation date. A ranking of only the significantly different resistant RIL-lines per parameter was performed by normalization using the recurrent parent as the denominator (if the normalized mean is <1, the plant is resistant; if the normalized mean is 1, the plant is susceptible). Within this invention the inventors characterized as most robust resistance RIL lines TUT101, TUT103, TUT110 and TUT117. RIL-lines TUT115, TUT110 and TUT111 demonstrated strongest immediate, at PLA1, resistance against oviposition.
TABLE-US-00003 TABLE 3 Identified RIL's with a higher resistance level than the recurrent parent (LYCO1). Displayed are only the RIL's with a significant lower mean score for a given parameter at two time points per sub-experiment (n = number of plants). mean mean mean mean (RIL)/ (RIL)/ (RIL)/ (RIL)/ mean mean mean mean PLA1 n (LYCO1) PLA2 n (LYCO1) LLT2 n (LYCO1) OPD2 n (LYCO1) TUT115 7 0.09 TUT101 8 0.75 TUT101 8 0.66 TUT101 8 0.44 TUT110 7 0.42 TUT110 7 0.76 TUT120 7 0.75 TUT103 7 0.54 TUT111 8 0.48 TUT117 7 0.85 TUT111 8 0.75 TUT104 7 0.62 TUT114 7 0.61 TUT119 7 0.92 TUT112 7 0.75 TUT110 6 0.75 TUT108 8 0.61 TUT113 8 0.75 TUT111 8 0.75 TUT101 8 0.61 TUT115 7 0.75 TUT114 7 0.79 TUT118 7 0.81 TUT116 7 0.75 TUT103 7 0.78 TUT109 8 0.78 TUT110 6 0.79
[0260] Observed resistance could be seen as one trait or as a combination of traits that influence the performance of the pest and or the damage caused by the pest. Several underlying plant-characteristics might explain the observed non-feeding-preference.
[0261] Therefore, the inventors conclude that they have identified resistance (comprising inter alia non-feeding-preference) indicated by PLA and to a lower extend also by LLT and OPD.
[0262] TUT115 has been deposited by Hazera Genetics Ltd, Berurim, M. P. Shikmim 79837, Israel, with the NCIMB (NCIMB Ltd, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, United Kingdom), on 11 Feb. 2013, under accession number NCIMB 42109.
[0263] Phenotypic Information Based on PLA:
[0264] Phenotypic information (based on PLA) shows that both line TUT115 and TUT101 display a significant reduction in leaves affected by T. absoluta. Line TUT115 is at the level of the donor and line TUT101 only at ⅕th of the recurrent (=susceptible) parent.
[0265] Genotypic information (see example 2) show no difference between line TUT115 and TUT101.
TABLE-US-00004 PLA adjusted Recurrent parent LYCO1 53% Donor GALA1 2.50% TUT115 0% TUT101 11%
[0266] 4/ Validation Experiments Promising RIL-Leads
[0267] In this experiment, the inventors validated in a growth-chamber the earlier detected resistance levels of promising RIL-leads from the greenhouse screen.
[0268] Promising resistant tomato RIL-lines, the donor and the recurrent parent were reared as described in example 1 (see par. Tomato germplasm rearing from Materials and Methods). In one experimental cage (90 cm*90 cm*130 cm (H*W*L); 150 mesh gauze) 11 plants (6-10 true leaves, 5-8 weeks old, height 30-60 cm) were tested for resistance.
[0269] One experimental cage contained 4 RIL lines for testing (i.e TUT101, TUT110, TUT115 and TUT103) in replica, 2 recurrent parent plants and 1 donor plant. From each plant 3 consecutive fully developed leaves positioned in the upper third part of the plant were tagged. Plants were infested by introducing 100 adult tomato pinworms per experimental cage. One experiment contained 8 experimental cages (24-26° C.; 50-70% RH; 8 hr darkness: 16 hr light (Philips reflex TLD 840 36W).
[0270] Three days after tomato pinworm introduction, eggs were counted on all tagged leaves. Approximately 8 and 13 days after introducing the adult moths, the Leaflet Lesion Type (LLT), the Percent Leaflet Attacked (PLA), and Overall Leaf Damage (OLD) were scored per prior tagged leaflets, and Overall Plant Damage (OPD) was noticed. Test parameters were analyzed for significant differences with an Oneway Analysis of means using a Dunnett's method. For this, the susceptible recurrent parent of the RIL population, LYCO1, was used as a control. (See table 2 for the indexing system).
[0271] Results
[0272] In this choice experiment selected RILs were compared against the recurrent parent LYCO1. Means from individual lines were adjusted by introducing a cage-effect into the linear model. Individual lines were compared using the Tukey Kramer test.
[0273] The analysis confirmed for OPD2, PLA 1 & PLA 2 the earlier obtained observations in the RIL selection experiment (section 3/). Recurrent parent LYCO1 is significantly more susceptible compared to wild type donor GALA1, as well as individual RIL lines TUT101 and TUT115. Regarding parameter OPD1, RIL line TUT110 is not different compared to LYCO1, and for both PLA measurements (i.e. timepoints one and two) TUT103 does not significantly differ from LYCO1.
[0274] For measured parameters OLD1, LLT2 and the actual egg counting numbers, the obtained data for the RIL-lines indicate no significant differences compared with the recurrent parent. Donor GALA1, did also not differ significantly from the validated RIL lines and LYCO1 for the actual egg-counts, but did show more significant resistance for the OLD and LLT measurements. This clearly shows the difficulty one may encounter to identify the appropriate parameter to measure the resistance.
TABLE-US-00005 TABLE 4 Tested parameters that indicate significant differences with LYCO1 (Oneway Analysis of means using a Dunett's method; P < 0.05) Line OPD 2 PLA 1 PLA 2 OLD LTT TUT101 + + + − − TUT110 − + + − − TUT115 + + + − − TUT103 + − − − − GALA1 + + + + +
Example 2: Development of Molecular Markers and Identification of the Underlying Genetic
[0275] Materials and Methods
[0276] Plant Materials and DNA Extraction:
[0277] The discovery population for the experiment was an interspecific population derived from a cross between S. lycorpersicum (inbred cultivar LYCO1) and S. galapagense GALA1. LYCO1 was verified as susceptible to South American Pinworm, and GALA1 was identified as resistant to South American Pinworm (example 1). This population consisted of F8 Recombinant Inbred Lines (RILs) developed by Single Seed Descent.
[0278] Genomic DNA from tomato leaves was extracted using Qiagen DNeasy plant DNA extraction kit.
[0279] SNP Genotyping
[0280] A set of 737-SNPs combination was selected based on their allelic variation and evenly spaced along the genome. High-throughput SNP genotyping was carried out with the GoldenGate assays and the BeadXpress reader from Illumina. The genotypes (of the RILs and of the two parental lines) were screened with 384 markers in a single plate. SNP genotyping data was scored using the Illumina GenomeStudio genotyping software with a no-call threshold of 0.25.
[0281] Illumina GoldenGate Technology Details
[0282] A SNP set was designed for the Illumina GoldenGate assay, which used locus and allele-specific oligos with cy3/cy5 labeling to detect SNP alleles at each locus. These custom Oligo Pool Assay (OPA) sets were then run on the Illumina BeadXpress Reader as 384-plex VeraCode assays. Veracode uses cylinder microbeads with an internal barcode to differentiate bead types which correspond to different SNP loci (384 bead types are used for a 384-plex SNP set), and each microbead was coated with oligos that contain a unique address that hybridizes with the labeled products. During scanning on the BeadXpress Reader, the beads were aligned in a groove plate, and the bead codes and cy3/cy5 signal intensities were measured across replicated sets of beads to assign the SNP alleles. This procedure allowed a rapid, high-quality SNP calling of 96 samples by 384 SNPs without requiring fixed arrays. The GenomeStudio software from Illumine was used for clustering alleles based on the ratio of the cy3/cy5 signal intensities to call the three genotype classes. 310 SNPs were retained as technically valid and polymorphic markers.
[0283] Selection of Polymorphic SNPs
[0284] SNPs with call rate below 70% or with no polymorphism between donor and recurrent parents were removed from the analysis, resulting in 310 SNPs for further analysis.
[0285] Identifying Markers Significantly Linked with Each Phenotypic Trait
[0286] Phenotypic Data
[0287] Phenotypic data was collected as described in example 1. In short, the resistance phenotype was identified by several measurement methods: 1) percent leaflet attacked (PLA), 2) leaflet lesion type (LLT) and 3) overall plant damage (OPD) {Maluf, 1997}. Each was measured in two time points. The first PLA measurement was the only one that distributes normally, and therefore it was used for marker identification. Information from the two other measurement methods was used to reinforce the confidence in the associated markers.
[0288] Heritability
[0289] Broad sense heritability was calculated by dividing the sum of squares of the difference from the mean for all RILs by the total sum of squares.
[0290] Phenotypic Data Normalization
[0291] Since plants were grown and measured in different dates, normalization was required. Phenotypic data was normalized using a mixed linear model {Zar, 2010}, including planting and measurement date as fixed effects. The adjusted means from the model were used as input for the association study described below.
[0292] Association
[0293] The genotyping information described in the SNP genotyping section, and the adjusted mean of the phenotypic measurements were used as input to association mapping via one way ANOVA, using R {Broman 2009}. Each marker was considered independently in order to detect significant markers. The significant markers were then analyzed in the same model in order to retrieve their combined R.sup.2.
[0294] LD Analysis and Haplotype-Blocks Identification
[0295] In order to define the boundaries of the resistant-donor genomic segments that were introduced into the RIL population (i.e. segments that were introduced to the recurrent background as a single continuous segment with almost no recombination in the population) the inventors investigated the LD (Linkage Disequilibrium) patterns in the RIL population. Pairwise LD estimation for all marker combinations in each chromosome was conducted using Haploview software {Barrett, 2005}. Pairwise LD was measured as the D′ statistic {Lewontin, 1964}. Haplotype-blocks were defined using the “solid-spine” option which was defined as a “spine” of strong LD running from one marker to its adjacent markers in the LD chart, meaning that the first and last markers in a block were in strong LD with all intermediate markers although the intermediate markers were not necessarily in LD with each other.
[0296] Results
[0297] Some RILs were phenotyped and genotyped using 310 polymorphic SNPs. The SNPs were physically mapped to the tomato genome version 2.1 {Bombarely, 2011} and then adjusted to the tomato genome version 2.40.
[0298] The broad sense heritability of the resistance to South America tomato pinworm as defined by the first PLA measurement is 0.6. This means 60% of the trait as observed by this experiment can be explained by genetic factors, either additive or dominant.
[0299] Association analysis identified a set of markers significantly linked to resistance to South America tomato pinworm as defined by the first PLA measurement. The list of associated markers and their significance are summarized in table 5. This table comprises all significant markers resulting from the analysis of the phenotypic data, associated to SNP markers by an ANOVA model. The combined R.sup.2 of the listed markers amounts to 0.55, meaning all markers together explain 55% of observed phenotypic variance. The allelic state of the significant markers is identical in the resistant parent and the most resistant RIL, namely TUT115, as described in example 1.
TABLE-US-00006 TABLE 5 significant in position additional (genome P measurements Haplotype Chromosome version 2.40) SNP value.sup.a (with p-value) block.sup.b 1 68 232 900 solcap_snp_sl_18619 0.02 1 72 528 600 solcap_snp_sl_12348 0.01 LLT (0.01) 1 83 766 400 EP_1592_LC7762 0.001 5 3 636 270 EE_0301 0.02 LLT (0.01) 6 166 755 EE_4363_LC7656 0.03 9 22 094 800 CL016475-0340 0.04 LLT2 (0.01), 1 PLA2 (0.01) 9 41 847 000 EP_0502 0.04 LLT2 (0.01), 1 PLA2 (0.01) 9 49 173 600 EE_4969_LC7529 0.04 LLT2 (0.01), 1 PLA2 (0.01) 9 54 692 600 EE_2332 0.04 LLT2 (0.01), 1 PLA2 (0.01) 12 124 598 SL10204_1269 0.05 LLT2 (0.05), PLA2 (0.006) 12 155 493 SGN- 0.05 LLT2 (0.05), U573565_snp665 PLA2 (0.006) 12 1 166 000 EE_0924 0.01 OPD (0.03), LLT2 (0.015), OPD2 (0.03), PLA2 (0.006) .sup.aP-value The probability to obtain the result by chance. P value below 0.05 is considered significant. .sup.bHaplotype Block - Adjacent markers with a low recombination rate between them belong to the same haplotype block. Markers from the same chromosome and haplotype block are marked by a gray background.
[0300] In addition, the occurrence of several markers in one haplotype was investigated. Several markers were found adjacent to each other on the same chromosome, suggesting a low recombination rate between them. Therefore they were inherited as a single haplotype block. In table 5, the relevant haplotype block (if available) is listed for each SNP.
[0301] In table 6 is given the allele of the 12 markers, for different resistant lines, as identified in example 1.
TABLE-US-00007 TABLE 6 Chromosome Marker TUT101 TUT110 TUT115 TUT103 T3 T6 1 solcap_snp_sl_18619 G/G G/G G/G T/T T/T G/G 1 solcap_snp_sl_12348 C/C T/T C/C C/C T/T C/C 1 EP_1592_LC7762 * * C/C * T/T C/C 5 EE_0301 T/T G/G T/T G/G G/G T/T 6 EE_4363_LC7656 G/G G/G G/G T/T T/T G/G 9 CL016475-0340 A/A G/G A/A G/G G/G A/A 9 EP_0502 C/C A/A C/C A/A A/A C/C 9 EE_4969_LC7529 A/A G/G A/A G/G G/G A/A 9 EE_2332 T/T C/C T/T C/C C/C T/T 12 SL10204_1269 C/C C/C C/C T/T T/T C/C 12 SGN- A/A A/A A/A T/T T/T A/A U573565_snp665 12 EE_0924 T/T T/T T/T C/C C/C T/T * neither T, nor C was detected by the assay.
[0302] The genotype of all the 310 SNP markers used in this study is given for TUT115 in table 7.
[0303] In the last column of table 6, “1” means that the allele of the SNP marker corresponds to the resistant donor parent, wherein “2” means that the allele of the SNP marker corresponds to the recurrent susceptible parent. The SNPs with an asterisk (*) and in italics are the 12 SNP markers mentioned in tables 5 and 6.
[0304] The SNP in bold with the symbol “Δ” indicate the edge
, in terms of SNPs, of the introgression fragment, start (“Δs”) or end (“Δe”).
[0305] The chromosome position is by reference to the tomato genome version 2.40.
TABLE-US-00008 TABLE 7 Donor/ SNP TUT115 LYCO1 GALA1 CHROMOSOME POSITION recurrent EE_4663_LC7672 T/T T/T C/C 1 1558580 2 EE_2169_LC7254 A/A A/A G/G 1 2204620 2 IL3_1821 T/T T/T C/C 1 2349120 2 solcap_snp_sl_59890 Δs A/A G/G A/A 1 4597950 1 solcap_snp_sl_19066 C/C T/T C/C 1 38118500 1 solcap_snp_sl_14042 T/T C/C T/T 1 38274900 1
1 68232900
1 72528600
EP_0180_LC7488 A/A C/C A/A 1 74360500 1 EE_2741_LC7681 C/C A/A C/C 1 75365100 1 EP_0350_LC6805 A/A G/G A/A 1 76649200 1 solcap_snp_sl_15339 Δe C/C T/T C/C 1 77112400 1 EE_4184_LC7793 A/A A/A A/G 1 77540500 2 SL10357_122_LC6821 A/A G/G A/A 1 77950400 1 EE_2138_LC7257 C/C G/G C/C 1 78104200 1 IL3_1952_LC7796 G/G A/A G/G 1 78158000 1 SL10693_51_LC7809 C/C T/T C/C 1 78236200 1 EE_3245_LC6799 T/T A/A T/T 1 78602500 1 SL10489_373_LC7781 G/G A/A G/G 1 79286800 1 SL10018_198 A/A G/G A/A 1 80408100 1 SL10259_474_LC7727 T/T T/T C/C 1 81000900 2 solcap_snp_sl_40154 Δs NA T/T NA 1 83517400 1
1 83766400
EP_1027_LC7889 NA NA T/T 1 84256600 2 EE_4621_LC7272 G/G G/G A/A 1 86580700 2 solcap_snp_sl_14323 T/T T/T C/C 1 86675700 2 EE_2225_LC7481 C/C C/C T/T 1 89810700 2 solcap_snp_sl_15058 A/A A/A G/G 1 2 SL20284_556_LC7915 A/A A/A G/G 2 7194740 2 solcap_snp_sl_12647 T/T T/T C/C 2 21285100 2 EE_1649_LC6737 G/G G/G A/A 2 29006800 2 solcap_snp_sl_26072 C/C C/C T/T 2 29095800 2 solcap_snp_sl_12372 T/T T/T G/G 2 29750900 2 SL10173_770_LC6727 C/C C/C T/T 2 29820500 2 solcap_snp_sl_15698 A/A A/A G/G 2 31368100 2 EP_1969_LC7960 A/A A/A C/C 2 33261500 2 solcap_snp_sl_10557 C/C C/C A/A 2 34683500 2 SL10153_153_LC7506 A/A A/A C/C 2 36959600 2 SL10360_663 G/G G/G C/C 2 37860200 2 SL10735_869_LC7741 A/A A/A NA 2 40095800 2 IL2_5828_LC5919 A/A A/A G/G 2 43801800 2 solcap_snp_sl_12841 T/T T/T C/C 2 43801800 2 SL10040_1076_LC7739 T/T T/T G/G 2 47239000 2 CL017436-0294 C/C T/T C/C 2 48687200 1 EE_3579_LC7227 C/C C/C T/T 2 2 solcap_snp_sl_19040 NA NA C/C 2 2 EE_4397_LC7630 T/T T/T C/C 3 77115 2 solcap_snp_sl_9690 G/G G/G A/A 3 2073090 2 solcap_snp_sl_14355 C/C C/C T/T 3 7085130 2 IL2_3177_LC6317 T/T T/T A/A 3 7669140 2 solcap_snp_sl_12718 T/T T/T C/C 3 8904650 2 solcap_snp_sl_12722 G/G G/G A/A 3 8943250 2 solcap_snp_sl_4937 T/T A/A T/T 3 12866900 1 solcap_snp_sl_4932 A/A G/G A/A 3 15380400 1 EP_0398_LC7890 G/G A/A G/G 3 38800900 1 EE_2302 G/G T/T G/G 3 43641500 1 solcap_snp_sl_1779 G/G T/T G/G 3 43641500 1 EE_2301_LC7799 C/C T/T C/C 3 43641700 1 EE_3215_LC7337 A/A G/G A/A 3 45613700 1 EE_2132_LC7726 G/G A/A G/G 3 46645300 1 EE_4940_LC7305 G/G T/T G/G 3 57629400 1 SL10019_376_LC7274 G/G A/A G/G 3 58095800 1 IL2_3047_LC7278 G/G A/A G/G 3 58127400 1 IL2_3855_LC6626 C/C A/A C/C 3 58199700 1 EE_3777_LC7270 G/G A/A G/G 3 58210300 1 EE_0718_LC7273 G/G A/A G/G 3 58226900 1 SL10385_861_LC7255 C/C T/T C/C 3 58365800 1 SL20269_959 C/C T/T C/C 3 58405600 1 EE_3736_LC7608 T/T C/C T/T 3 58640000 1 EE_2254 T/T C/C T/T 3 58746500 1 SGN-U565536_snp46769 P/P G/G P/P 3 59935400 1 solcap_snp_sl_15173 T/T T/T A/A 3 60806800 2 EE_0928_LC7606 T/T T/T C/C 3 60856300 2 EE_0775_LC7309 G/G G/G A/A 3 60862400 2 IL3_0122 T/T T/T C/C 3 60934800 2 EE_5812 T/T T/T C/C 3 61275100 2 SL10976_673_LC7290 G/G G/G A/A 3 62094000 2 SL10772_850_LC6617 G/G G/G A/A 3 62815100 2 EE_2571_LC8007 T/T T/T C/C 3 63616800 2 EE_3501_LC8061 A/A A/A C/C 3 63766900 2 EE_2924_LC7831 G/G G/G C/C 3 64397100 2 EP_1717_LC8068 A/A A/A G/G 3 64800700 2 solcap_snp_sl_55187 T/T T/T C/C 3 2 CL016669-0383 C/C T/T C/C 3 1 SL10428_501 C/C C/C T/T 4 2146360 2 EE_3260 NA NA C/C 4 9492130 2 CL017721-0135 A/A A/A G/G 4 9603600 2 EE_4973_LC7241 C/C C/C A/A 4 51709700 2 EE_4974_LC7242 G/G G/G A/A 4 51709900 2 EE_2179 G/G G/G P/P 4 54197200 2 solcap_snp_sl_58921 G/G G/G T/T 4 54409600 2 EE_1504 T/T T/T C/C 4 54754300 2 EE_1675_LC7556 A/A A/A G/G 4 54846200 2 solcap_snp_sl_13133 A/A A/A G/G 4 55086600 2 EE_0519_LC7259 G/G G/G A/A 4 55717100 2 SL10207_600_LC7235 C/C C/C T/T 4 56139200 2 SL10101_673_LC6864 G/G G/G A/A 4 57223700 2 EP_0368 A/A A/A G/G 4 57402600 2 solcap_snp_sl_11515 A/A A/A G/G 4 57896200 2 EE_4324_LC7699 C/C C/C A/A 4 58075600 2 EE_4325_LC7718 G/G G/G A/A 4 58075700 2 EE_6012_LC7239 NA C/C NA 4 58790800 1 SGN-U594049_snp94598 A/A G/G A/A 4 60551900 1 IL2_0224_LC7658 A/A A/A G/G 4 62610300 2 SL20205_697_LC7245 G/G G/G T/T 4 63672200 2 solcap_snp_sl_2011 A/A A/A T/T 4 2 EE_1982 A/A G/G A/A 4 1
5 3636270
EE_3810_LC7374 G/G G/G A/A 5 4146540 2 EE_4099_LC6860 C/C C/C T/T 5 5887820 2 IL2_1979_LC8095 T/T T/T C/C 5 5971710 2 EE_2637_LC7698 A/A A/A G/G 5 6160880 2 EE_0853_LC6863 A/A A/A T/T 5 6226660 2 IL2_4587_LC7087 G/G G/G NA 5 6388250 2 EE_0954_LC7212 C/C C/C T/T 5 6457710 2 EE_4155_LC6841 C/C C/C T/T 5 6979790 2 EE_3256 A/A A/A G/G 5 7492620 2 solcap_snp_sl_13798 C/C C/C T/T 5 8156640 2 SL10639_108 G/G G/G A/A 5 8215150 2 IL3_2338 T/T T/T C/C 5 8967100 2 EE_4380 G/G G/G A/A 5 10095100 2 IL2_4686_LC5993 G/G G/G T/T 5 10702300 2 SL10469_816_LC7368 T/T T/T C/C 5 13142000 2 SL10469_202_LC7365 A/A A/A C/C 5 13142700 2 EP_0159 C/C C/C T/T 5 16804800 2 SL10526_459_LC7321 A/A A/A T/T 5 18738900 2 SL10526_144_LC7578 T/T T/T A/A 5 18738900 2 IL3_1559_LC7546 C/C C/C A/A 5 19274800 2 SL10100_95_LC7314 T/T T/T C/C 5 20574100 2 SL10100_757 G/G G/G A/A 5 20574700 2 EE_1486_LC7518 G/G G/G A/A 5 23877100 2 IL1_6687_LC7317 T/T T/T C/C 5 23878300 2 CL015854-0378 T/T T/T C/C 5 25878300 2 IL2_4983 T/T T/T C/C 5 25878300 2 KGe1103_LC7548 G/G G/G T/T 5 39648500 2 EE_2817 A/A A/A G/G 5 43177000 2 KGe2770_LC7361 T/T T/T C/C 5 45414700 2 KGe1882 G/G G/G A/A 5 49402500 2 SL10373_526 T/T T/T C/C 5 50849700 2 Le001857_68 C/C C/C T/T 5 59037000 2 KGe1995 T/T T/T C/C 5 59037100 2 SL10724_1217_LC7835 C/C C/C T/T 5 59655900 2 solcap_snp_sl_12181 T/T T/T C/C 5 60197900 2 Le006551_63 G/G G/G C/C 5 62103800 2 EE_5750 C/C C/C T/T 5 62495900 2
6 166755
IL3_2569_LC7566 G/G T/T G/G 6 1649290 1 EE_1008_LC7515 T/T C/C T/T 6 1674080 1 solcap_snp_sl_65595 A/A C/C A/A 6 3299310 1 solcap_snp_sl_32320 C/C T/T C/C 6 5388530 1 solcap_snp_sl_30498 G/G T/T G/G 6 6794900 1 solcap_snp_sl_30511 G/G A/A G/G 6 8159800 1 solcap_snp_sl_31156 G/G T/T G/G 6 12040400 1 SL10187_425 A/A G/G A/A 6 12751900 1 Le004790_246 T/T C/C T/T 6 20347900 1 EP_0572_LC7445 T/T C/C T/T 6 21806900 1 EE_2362 C/C T/T C/C 6 29418200 1 SL10768_133 C/C T/T C/C 6 33808800 1 EE_2996 C/C T/T C/C 6 34459100 1 solcap_snp_sl_14452 A/A G/G A/A 6 35101900 1 SL10539_786_LC7260 Δe T/T G/G T/T 6 35194800 1 solcap_snp_sl_12646 T/T T/T C/C 6 35677700 2 solcap_snp_sl_12638 G/G T/T G/G 6 36179000 1 solcap_snp_sl_12746 C/C T/T C/C 6 36927900 1 EE_0212_LC7755 G/G A/A G/G 6 41542800 1 EE_5803_LC7716 T/T T/T C/C 6 44134700 2 EP_1913_LC7870 A/A A/A G/G 6 44542800 2 SL20164_562_LC7140 C/C C/C T/T 6 44857700 2 EE_0497_LC7340 T/T T/T C/C 6 2 solcap_snp_sl_11233 C/C T/T C/C 7 670304 1 EE_3711_LC10116 T/T C/C T/T 7 994270 1 solcap_snp_sl_11205 C/C A/A C/C 7 1375140 1 EE_1788_LC7194 T/T C/C T/T 7 2240720 1 EE_2398_LC7918 G/G T/T G/G 7 2893460 1 IL2_1573_LC6628 T/T C/C T/T 7 3147390 1 EE_4619_LC7594 G/G A/A G/G 7 3835460 1 solcap_snp_sl_26437 T/T C/C T/T 7 54697000 1 EE_0993_LC7772 C/C T/T C/C 7 55130300 1 solcap_snp_sl_14172 C/C A/A C/C 7 58092200 1 CL016778-0295 T/T A/A T/T 7 59114500 1 3081_1_53 C/C A/A C/C 7 60325200 1 SL10719_49_LC7694 A/A A/A C/C 7 61079400 2 SL10041_719_LC7675 A/A A/A G/G 7 61094800 2 EP_0109_LC7882 A/A A/A G/G 7 61194700 2 EE_4765_LC7703 A/A A/A G/G 7 62265100 2 EE_2310_LC7448 A/A A/A G/G 7 62465700 2 EE_5773_LC7638 T/T T/T NA 7 62473000 2 EE_5366 G/G G/G A/A 7 2 EE_6087_LC7761 T/T T/T C/C 8 602770 2 solcap_snp_sl_4431 G/G C/C G/G 8 50440200 1 solcap_snp_sl_21394 G/G A/A G/G 8 55659500 1 EE_1326_LC6848 T/T C/C T/T 8 55997400 1 EP_0889_LC6813 T/T C/C T/T 8 56053100 1 solcap_snp_sl_21401 C/C G/G C/C 8 56202000 1 EE_3574_LC7825 T/T T/T C/C 8 58036300 2 IL3_0456 T/T T/T G/G 8 59248400 2 solcap_snp_sl_15432 A/A T/T A/A 8 60016900 1 EE_1024 A/A G/G A/A 8 60035000 1 solcap_snp_sl_10181 T/T A/A T/T 8 61303500 1 solcap_snp_sl_29404 G/G T/T G/G 8 1 CL015323-0211 A/A C/C A/A 8 1 EP_0489_LC7684 Δs C/C T/T C/C 9 3897960 1 SL10004_409_LC7341 A/A G/G A/A 9 4063240 1 IL2_5178 NA T/T NA 9 7854930 1 EE_1577_LC7366 G/G A/A G/G 9 11226500 1 EE_1758_LC7427 NA A/A NA 9 18614700 1
9 22094800
*
9 41847000
9 49173600
9 54692600
IL2_1262 T/T C/C T/T 9 62444900 1 EE_1817_LC6849 A/A G/G A/A 9 62491400 1 EE_3482_LC7808 C/C A/A C/C 9 63350800 1 EE_5152_LC7199 A/A G/G A/A 9 63473800 1 EE_1452 Δe T/T C/C T/T 9 63642500 1 EE_1806_LC7215 C/C C/C T/T 10 274856 2 CL015614-0412 G/G C/C G/G 10 468922 1 solcap_snp_sl_13200 C/C G/G C/C 10 1058430 1 EE_0324 T/T T/T C/C 10 2746430 2 SGN-U603133_snp167 T/T T/T C/C 10 3092680 2 EE_2689 A/A A/A NA 10 7364210 2 CL017204-0355 A/A A/A NA 10 7364210 2 EP_1264_LC7935 NA NA A/A 10 28869300 2 EE_6135 A/A A/A G/G 10 49992900 2 solcap_snp_sl_5191 G/G G/G C/C 10 51147000 2 solcap_snp_sl_5186 T/T T/T C/C 10 52254300 2 EE_4309 A/A A/A C/C 10 52670500 2 solcap_snp_sl_16501 C/C C/C G/G 10 57997200 2 SL10843_69_LC7861 T/T T/T C/C 10 59085800 2 solcap_snp_sl_13113 G/G G/G T/T 10 59255100 2 EP_0902_LC6716 G/G G/G A/A 10 60698100 2 IL3_2005_LC7733 T/T T/T NA 10 61823700 2 EE_3505_LC7711 A/A A/A G/G 10 61957300 2 IL2_1143_LC7218 G/G G/G A/A 10 62066300 2 EE_0009_LC7600 T/T T/T C/C 10 62724400 2 SL10786_261_LC7236 C/C C/C T/T 10 62802900 2 SL20016_1557_LC7848 T/T T/T C/C 10 64632700 2 EE_3347_LC7683 T/T T/T C/C 10 64633300 2 solcap_snp_sl_15641 C/C G/G C/C 11 436090 1 EE_0570 A/A G/G A/A 11 502389 1 solcap_snp_sl_10611 T/T T/T A/A 11 1988860 2 EP_1258_LC7710 T/T T/T C/C 11 3626710 2 solcap_snp_sl_15269 G/G G/G A/A 11 5389480 2 SL10640_256_LC7686 A/A A/A C/C 11 6410110 2 SL10640_602_LC7666 T/T T/T C/C 11 6410460 2 solcap_snp_sl_14367 A/A A/A C/C 11 7715560 2 solcap_snp_sl_13506 C/C C/C T/T 11 8640020 2 EE_4860_LC7564 G/G G/G C/C 11 8753140 2 EE_1605_LC7308 A/A A/A G/G 11 9837710 2 EE_4181_LC7643 G/G G/G A/A 11 10019300 2 EE_2849_LC7237 A/A A/A NA 11 15654300 2 CL016179-0556 A/A A/A G/G 11 35287700 2 solcap_snp_sl_13126 C/C C/C T/T 11 35863500 2 solcap_snp_sl_13123 T/T T/T C/C 11 36376700 2 solcap_snp_sl_10890 C/C C/C T/T 11 45230400 2 solcap_snp_sl_10899 C/C C/C T/T 11 45816700 2 solcap_snp_sl_10900 C/C C/C T/T 11 45816800 2 solcap_snp_sl_10969 G/G G/G A/A 11 46395700 2 EE_4526 A/A A/A C/C 11 47595400 2 EP_1594_LC6817 C/C C/C A/A 11 49928100 2 IL3_1995_LC6827 G/G G/G A/A 11 50098600 2 EE_3018_LC7246 C/C C/C T/T 11 51502700 2 EE_4777_LC7555 T/T T/T C/C 11 52142200 2 EE_1598_LC6842 G/G G/G A/A 11 52225900 2 EE_1639_LC8071 T/T T/T C/C 11 52645000 2 SL10027_680_LC7770 A/A A/A T/T 11 53186500 2 solcap_snp_sl_15247 A/A A/A G/G 11 2 EE_5199_LC7352 T/T T/T C/C 11 2
12 124598
12 155493
12 1166000
solcap_snp_sl_1495 A/A A/A G/G 12 3252080 2 SL10795_222 A/A A/A G/G 12 3767860 2 solcap_snp_sl_14758 T/T T/T C/C 12 4462020 2 IL3_0004 A/A A/A G/G 12 4462020 2 solcap_snp_sl_9707 A/A A/A C/C 12 5718730 2 solcap_snp_sl_59718 A/A A/A G/G 12 6660010 2 solcap_snp_sl_24755 G/G G/G C/C 12 7801440 2 EE_3447 C/C C/C T/T 12 8948060 2 solcap_snp_sl_40598 G/G G/G A/A 12 8948060 2 solcap_snp_sl_1289 G/G G/G A/A 12 9917930 2 solcap_snp_sl_1295 T/T T/T C/C 12 12758600 2 solcap_snp_sl_40622 T/T T/T G/G 12 12760400 2 SL10352_214_LC7623 T/T T/T C/C 12 12871800 2 EE_4807_LC7624 T/T T/T C/C 12 14337200 2 EE_5237 NA NA G/G 12 14640400 2 EE_5238_LC7619 A/A A/A G/G 12 14640600 2 solcap_snp_sl_53084 T/T T/T C/C 12 17503100 2 solcap_snp_sl_53090 T/T T/T C/C 12 19452500 2 solcap_snp_sl_17184 G/G G/G A/A 12 23240100 2 solcap_snp_sl_42961 A/A A/A T/T 12 24101300 2 EE_0461 T/T T/T C/C 12 37136500 2 solcap_snp_sl_52407 T/T T/T C/C 12 37672700 2 solcap_snp_sl_59087 T/T T/T G/G 12 39221700 2 EP_0926_LC7289 G/G G/G A/A 12 40771200 2 solcap_snp_sl_59093 T/T T/T C/C 12 40776000 2 solcap_snp_sl_52539 G/G G/G A/A 12 42568300 2 EP_0768_LC7607 A/A A/A G/G 12 43619100 2 EE_0865_LC7616 T/T T/T C/C 12 43643700 2 3132_3_136 C/C C/C T/T 12 43645100 2 EE_3443_LC7302 G/G G/G A/A 12 43799100 2 EE_5488 A/A A/A C/C 12 44347200 2 EE_4018_LC7618 A/A A/A G/G 12 44634400 2 solcap_snp_sl_12389 T/T T/T C/C 12 44709600 2 EP_1486_LC7832 A/A A/A G/G 12 63255200 2 SL10823_84_LC7816 A/A A/A G/G 12 63538200 2 SL10329_708_LC6736 C/C C/C A/A 12 63612300 2 EE_3321_LC7974 A/A A/A G/G 12 64623500 2 SL10284_439 A/A A/A G/G 12 65136500 2 EE_5042_LC6684 C/C C/C T/T 12 65148800 2
[0306] Conclusion
[0307] Twelve markers were significantly associated with the PLA measure of resistance to South America tomato pinworm, together explaining 55% of the observed phenotypic variance. Nine of these markers are also significantly associated with other measures of resistance, namely LLT and OPD, which reinforce the confidence of these markers. The significant correlation to different measures of the traits suggests these markers are linked to a general resistance mechanism.
[0308] Marker Validation
[0309] Markers are validated by crossing line TUT115, which displayed the highest resistance relative to all tested RILs, with a susceptible line. The resulting F1 is selfed, and a large population of F2 seeds is collected. Plants are grown and genotyped. A selection of the F2 progeny is selfed to F3. The F3 families are phenotyped as described in example 1. The linkage of each marker to the resistance phenotype is assessed.
[0310] Breeding Plan
[0311] From the above described F2 plants, a set is selected. Each F2 plant carry a subset of the validated markers, where all selected F2 plants together cover all validated markers. Each F2 plant is backcrossed to a breeding line in a marker assisted backcross scheme. Plants having the relevant markers as well as the highest percentage of breeding line markers are selected to a second round of backcrossing. This process is repeated to a third backcross round resulting in a set of lines with a high percentage of breeding line background, each having a homozygous subset of the markers linked to the required resistance. Next the lines are crossed in turn in order to accumulate (“pyramid”) all required markers into one line or commercial variety.
[0312] Discussion
[0313] The resistance to South American Pinworm is a complex trait, probably defined by several genes {Maluf 1997, 2010a}. The inventors describe here the identification of a resistant source, and resistant recombinant inbred lines devised from this source. In addition, they identified a group of markers significantly correlated with the resistance, identifying the resistant line.
[0314] Since this trait is highly affected by environment {Resende 2002}, not all the observed variance is however explained by the genetic markers as shown by the calculated heritability of 0.6.
Example 3: Determine Resistance of Identified RIL's of GALA1 Against Additional Organisms
[0315] Spider Mites (Tetranychus urticae)
[0316] Materials and Methods
[0317] Experimental Design
[0318] In an experimental choice setting, 19 genotypes were tested for their suitability to rear spider mites on. Test plants were grown, as described in section Tomato germplasm rearing (Example 1), until plants reached the stage of having 4 true leaves. A genotype's suitability for spider mite rearing was measured by scoring feeding symptoms in combination with observed mites and webbings constructed by the mite species under testing. The experiment contained two experimental repetitions over time, per experimental repetition there were 3 repeats with each 11 seedlings per genotype (26° C.; 16 hr light: 8 hr dark).
[0319] Infestation Method:
[0320] Test plants were infested three weeks after sowing by placing heavily infested leaves from the spidermite rearing face down on the test plants. The leaves used for infestation were placed close to each other in order to create a surface of leaves above the test plants. After infestation, plants were irrigated using a flooding system. Two days after infestation the leaves that were used for infestation were removed.
[0321] Scoring Method:
[0322] The spidermite population reached a peak after two to three weeks. Three weeks post infestation feeding damage levels were scored. The susceptible or resistant plants were defined by the amount and the distribution of the population and were indexed by a scale from 0-3 (see below):
[0323] 0—A clean leaf without mites or tissue-feeding damage. Note: a number of mites centered on one place on the leaf could still be observed.
[0324] 1—Presence of mites in a defined area that did not cover the entire leaf. In this area feeding symptoms were observed. Leaves continued to develop, but the mite population did not grow.
[0325] 2—A leaf surface was covered with mites and clear feeding damage symptoms were noticed.
[0326] 3—A leaf is covered with mites and webs. Leaves showed clear chlorosis or necrosis symtomps.
[0327] Plant symptoms from 0-1 indicate resistant plants. Plants symptoms from 2-3 indicate susceptible plants (see
[0328] Results:
[0329] Resistance levels for the individual RIL-lines were compared to resistance levels from the recurrent parent, i.e. LYCO1, using an Hsu-Dunnett LSMeans Difference test. The mean score from each tested line was adjusted by entering observation notes as an effect into the linear model. Obtained data indicated that almost all tested RIL lines were significantly more resistant against spider mites when compared to the recurrent parent (see
[0330] Conclusion:
[0331] Tested RIL lines were mostly resistant, but these lines were less resistant compared to donor GALA1. Therefore it is concluded that the donor and also most of the RIL lines contain resistance traits that hamper population build up for the tested spidermite species, which is determined by scoring the population distribution per genotype using feeding symptoms and mite and webbing density as parameters.
[0332] White Fly (Bemicia tabaci)
[0333] Materials and Methods
[0334] Experimental Design
[0335] In a choice assay RIL leads were tested for resistance against the Hemiptera white fly. As a measure of resistance the success of building up a white fly population on a plant was scored by counting numbers of newly developed white fly nymphs. Tested RIL-lines TUT103, TUT112, TUT115, and the donor GALA1, the recurrent parent LYCO1 and pinworm rear line LYCO2, were grown as described in section Tomato germplasm rearing (Example 1). Experimental plants were randomly divided over three experimental cages (0.9 m width*8.0 m length*0.6 m height) in a greenhouse (temperature: +/−30° C. day and +/−20° C. night). Experimental cages hosted at least 6 plants per tested germplasm. Three consecutive fully developed leaves were marked starting at the top of a plant.
[0336] Infestation Method:
[0337] For infestation an on cotton reared white fly colony was used. Infestation was conducted by introducing approximately one hundred 5-10 days old adult white flies per test plant.
[0338] Introduced adults were allowed to oviposit for seven days after which they were killed with insecticide Talstar (pyrethroid Bifenthrin).
[0339] Scoring Method:
[0340] Fourteen days after infestation nymphs were counted from the bottom side of the prior marked leaves. For this end, five randomly 2 cm.sup.2 areas per leave were screened for nymphs using a magnifying glass (6×).
[0341] Results:
[0342] Number of nymphs per leaf were measured. Mean number of nymphs per genotype were adjusted by using the table and the leaf position as an effect in a linear model. Obtained data was compared using a Tukey Kramer test. All RIL lines were significantly more resistant
TABLE-US-00009 TABLE 8 Tomato resistance against white fly. Mean number of white fly nymphs were analyzed using a Tukey Kramer HSD test: genotypes with the same sign.grouping letter do not differ significantly. Mean number Germplasm of nymphs SE Least Sq mean Sign. grouping GALA1 12.23 1.87 11.76 C TUT112 4.59 1.46 4.79 D TUT115 10.15 1.52 9.95 D C TUT103 19.45 1.36 19.27 B LYCO1 26.05 1.52 25.85 A
[0343] Conclusion
[0344] All tested genotypes were more resistant against white flies compared to recurrent parent LYCO1. Moreover, this bioassay indicate that tested RIL line TUT112 is more resistant against white fly population build (i.e. nymph presence) compared to donor GALA1.
[0345] Western Flower Thrips (Franklienella occidentalis)
[0346] Materials and Methods
[0347] Resistance traits from identified promising RIL leads were tested against the Thysanoptera insect F. occidentalis. Promising resistant tomato RIL-lines, the donor and the recurrent parent were sown and reared in nursery trays (54 holes of 2″/tray) filled with rockwool plugs. Seedlings having 1-2 true leaves were transplanted on rockwool (10*10*6.5 cm). Sixteen plants per germ plasm were transferred to an insect free greenhouse for further development, and divided over two cages. When plants had 5-8 true leaves, they were infested with 20 thrips per plant. Feeding damage was scored by scoring the number of leaflets infested for consecutive true leaves A, B, & C, started counting from the cotyledons.
[0348] Results
[0349] Resistance levels for the individual RIL-lines were compared to resistance levels from the recurrent parent, i.e. LYCO1, using an Hsu-Dunnett LSMeans Difference test (see
[0350] Conclusion:
[0351] RIL-lines TUT101 and TUT115 were significantly more resistant against thrips damage compared to recurrent parent LYCO1. These two RIL-lines showed GALA1 levels of resistance against thrips.
[0352] Tomato Russet Mite (Aculopus lycopersici)
[0353] Materials and Methods
[0354] Experimental Design
[0355] In a non-choice experimental setting, 5 genotypes were tested for its suitability to build up a russet mite population. Test plants were grown, as described in section Tomato germplasm rearing (Example 1), until plants reached the stage of having 6-8 true leaves. A genotype's suitability for population build up was measured by scoring feeding symptoms in combination with observed severeness of the russet mite population.
[0356] Infestation Method:
[0357] Test plants were infested six weeks after sowing by placing heavily infested leaves from a tomato russet mite rearing face down on the test plants. After infestation, plants were regularly irrigated using 20:20:20 NPK. Two days post infestation used leaves for infestation were removed (26° C.; 16 hr light:8 hr dark regime).
[0358] Scoring Method:
[0359] The tomato russet mite population was scored 2 weeks after infestation by determining the severeness of the present russet mite population and the observed feeding symptoms.
[0360] Results:
TABLE-US-00010 TABLE 9 Resistance against the tomato russet mite. genotype Russet mite population Feeding symptoms LYCO2 Abundant severe necrosis + chlorosis TUT103 Abundant severe necrosis + chlorosis TUT110 Abundant severe necrosis + chlorosis TUT115 Poor some necrosis GALA1 Poor some necrosis
[0361] Conclusion:
[0362] Obtained qualitative data suggested that TUT115 contain the resistance characteristics from donor GALA1 that could cause non-preference.
Example 4: Flanking Sequences of the SNPs of the Invention
[0363] The flanking sequences of the 12 SNPs of the invention and of the 12 alternative SNPs of the invention are hereby given in table 10, as well as the sequences of the additional SNPs SLC2.31_1_72272308 (position 72271870 on the tomato genome version SL2.40) and SLC2.31_9_7668450 (position 7667332 on the tomato genome version SL2.40).
TABLE-US-00011 TABLE 10 SNP 5′ flanking sequence 3′ flanking sequence solcap_snp_sl_ CAAAATTTGGGAGAGCTGAAGCA AGCTAGTCAAAAGTATGCCAGTTGT 18619 GAGTTTCCCACTCAAGGTAAATGT GTCCTGTTGCTTGTGTATATAGTTC (SEQ ID N. 49) ATA (SEQ ID N. 1) (SEQ ID N. 2) solcap_snp_sl_ AGTCTCTAACAATCAAGTTGGTGG ACATTCATCTGATTCCGATCAAGAAG 12348 GGATATAGGCTCAGACATTGAGC TTGATGATTACGATGACCTTCCAC (SEQ ID N. 50) TGG (SEQ ID N. 3) (SEQ ID N. 4) EP_1592_LC7762 GAGAAAAAGACCATTAGACAAAGA ATAGAGAAAAAAAGCAAAACAGGGA (SEQ ID N. 51) AAAGGTGTTTTGATAGCTACGGAG GATGAAAGGGGTCTCTAATGGGAGA AAAAAGAGAAAG (SEQ ID N. 5) TCCATTCCCT (SEQ ID N. 6) EE_0301 TAAACTAAAGTCTCCTTTTATTTTT AGGCAATTTTTATCCACACCAAATAT (SEQ ID N. 52) CATCAATAACCTTATAACTAACTTA AAAACTAAACTTAAATCCCCATTTTC ACTAAAAACA (SEQ ID N. 7) CAAGACAT (SEQ ID N. 8) EE_4363_LC7656 CTGAAGGTCCAGACCACCTGTAC CTAAAGCTGAGTCTTTGATGGAAAAA (SEQ ID N. 53) TGCCCTTCTCCACACCTATGTCCA ATGTCTGAATGCGGGGTTCTGAAGT GCATAAGGACACT (SEQ ID N. 9) ACCCTCTTC (SEQ ID N. 10) CL016475-0340 AATAATCTCCCCTCCTTTAAACTT CTTATGTNACCTATTTAATTACCACA (SEQ ID N. 54) GGAGTATTTGAATATCACTGTTTC CAAACCAATTTACCTGATTATGGAGG CGATCCACACAAGGAAATACAAG AACCGATTTCANTGTTCGTAGACGCT CATCCCCCTCAATTGTTCCTGGCA TTAAAGACATTGTTACTTTATC CTAAT (SEQ ID N. 11) (SEQ ID N. 12) EP_0502 GATGATGAAAAGGTGGATTATTCA TCACTGCTGTTGCTGCTCTTTCTCAC (SEQ ID N. 55) CAAGTACTTTCTGCATTGCTTCCT CCTTCAACTTTCACATGGGTTTCTAA TTTGTTGTGGCC (SEQ ID N. 13) AGATTTGT (SEQ ID N. 14) EE_4969_LC7529 GCCGGGGATAGCTAACACACCAA ATGGGAACTCAAATGATGTTCTTCAC (SEQ ID N. 56) TATTATTAATTTAGAGAATCAATTA ATAGTTTTGTTCCCTTTTTTTCGCATT TGGAGATC (SEQ ID N. 15) TGGTCAT (SEQ ID N. 16) EE_2332 AAGTTGCAAGAGTTGCTTTTGCCT GAATGGGTTCCTACCATTGACCAAAT (SEQ ID N. 57) CGCTTCTCTTGTTGATGCTGATGC GCTTCTCATGACCAGCATAGTCCTTA TATAGTAACTTC (SEQ ID N. 17) CATATATA (SEQ ID N. 18) SL10204_1269 GTCTAGTATTGTTGTAAGAATGCT GATATAGGTTATAACACAGCATAAAT (SEQ ID N. 58) GGAAGAGGCATTTGTGATTATAAA CTATATCTAATTCACTTGAACATTAC AGAAACTTGGCA (SEQ ID N. 19) ACAAGAAG (SEQ ID N. 20) SGN- GGCTTCAATATTGACTGTAATGAA GCCTGTCGTGATTTTTAATCCTAAAT U573565_snp665 GGAGATTTCTGATACATTGTACCC GGGGTTTTGATGAAGAGAGTAGTT (SEQ ID N. 59) AA (SEQ ID N. 21) (SEQ ID N. 22) EE_0924 TATTACGGAATCTACTGTAACGTT GAAGGTGGTTCTATATCCCTAGATG (SEQ ID N. 60) ATCAGAAGCTCTGTCTGAACTTCC CCTTGTCTTGCGAGAACCATGAAATA AGGTGAAAGGAC (SEQ ID N. 23) AAGAAGATG (SEQ ID N. 24) EE_1452 GTCGCAAGATGCGTGAGATCATG CCTGAAGTTCATTCCTGAATCAATCG (SEQ ID N. 61) GTTAACCAGGCACAATCGTGTGAT GTAGAGAGATTGAGAAGGCAACTTC TTGAAAGACTTGG (SEQ ID N. 25) AAGCATCTA (SEQ ID N. 26) EE_2996 ATGGGTTGGTTTTGGAGAACATAT AGATAGTCACTCTTTGTTGACTGAGG (SEQ ID N. 62) CGTATGGGCAGCTTCAGGCGCTT AAAGAGGCGGGGAAGGTAGTGGGA TCAGCTGTGCCTG (SEQ ID N. 27) GTGGTTCATA (SEQ ID N. 28) IL2_5178 TTACTCTTCGGTGTTTGAGGATCT CTTTGCGTTGAAACACCGATGGGTT (SEQ ID N. 63) TGTTGCAGAGGGTTTTTTGAGCCC CTGATGTTTTTGCGTTGAGGGAAATT AAATTCAAAAAC (SEQ ID N. 29) GGGGTAGCC (SEQ ID N. 30) EE_2362 AGTTCCAATTCACGAAATCGAAGC CTTGGGGACCGGCGATAATGGTGAC (SEQ ID N. 64) CTTCCAACTCTCATCCACGCTTGG TTTGAACATTTTACAGCTACACCTAA TGATTGCAAAGG (SEQ ID N. 31) CAAGATTTT (SEQ ID N. 32) SL10187_425 TTTTTACTTTTAAATTTTGCTGTTT TTGGTCCCTTCTTGTACAATAGGAAT (SEQ ID N. 65) GTGAAGTAGGGATATGAATAAAAT GTAAGAACTAGCATATGAGGGATC T (SEQ ID N. 33) (SEQ ID N. 34) solcap_snp_sl_ AAGAGGGCAAAAAATGGCTGTAG CTCCATGCCTTCTATATCTTCCCCTT 15339 CACTCTTGGGGAGTATTTCCTTTT CTCTCCAACACCCTTTCAACTTCA (SEQ ID N. 66) CCT (SEQ ID N. 35) (SEQ ID N. 36) solcap_snp_sl_ AACGCCAGCAATGGAAAAGCAAC GGTTGCTAAATCCAACCAGCCCAAT 32320 TTGAGATCGCGTCCACAGTTGGT GAAGTAGGTGATTTTGGTGGTAGTT (SEQ ID N. 67) GCAT (SEQ ID N. 37) (SEQ ID N. 38) solcap_snp_sl_ GGCGCCTAGAACTGCTTCTTCTTT TCTCATCCAACCACTCACTGCTGGA 40154 TCTTGTGACGCGAACTTCTGTCTC ATCTGTATTACGATCTTCCTTGCTA (SEQ ID N. 68) TT (SEQ ID N. 39) (SEQ ID N. 40) solcap_snp_sl_ ATGTTAACTGAAATTGCATACATC CTTCTAGCAAGAACTTTTTACCCTGT 59890 CACGTTAACAGGAAAACATCGTAG AATTTGAAATCCAACAAACCCAGA (SEQ ID N. 69) TC (SEQ ID N. 41) (SEQ ID N. 42) EP_0489_LC7684 AAACCCCAATTTCTCCGGCCGATC GATCACTTTACAGATCCGATTTCGAG (SEQ ID N. 70) AGTTCTCCTCTTTGTTGATCTCATT TCACTTCCGAATCGGATCCGGGTCA TTTCGATTCTC (SEQ ID N. 43) GATGGCGGC (SEQ ID N. 44) EE_3482_LC7808 CTAGACAGTAGTGACCAAACTCTT AGGACTCGAAAAACATTAGCTCAGA (SEQ ID N. 71) GGTGTTCCGCGTAAGTTTTAGAGT TGATGATGACCTTGTGTAAATTTTCG ATAATAAACCCA (SEQ ID N. 45) TATTGGTAT (SEQ ID N. 46) SL10539_786_ CTCTAGCCCATCCTTTATACACAG AG CATGGAGTCAAGTTTTTGCTGAAT LC7260 AAGGGCGCAGCCACATCGGGAGT CTTCTGTTATTTAAAATTGATAGAGA (SEQ ID N. 72) TCCTGGACGAACA (SEQ ID N. 47) CTTACCAC (SEQ ID N. 48) SLC2.31_1_ TTATATGAGACAGTTACTGTAATT AACTGTAAGGTTTGGATTTAAAAAAA 72272308 (T/C) GATGTTTAACTCAGAATCAAAACA AATCATCCAACTGTATTTACTCAG (SEQ ID N. 73) TC (SEQ ID N. 75) (SEQ ID N. 76) SLC2.31_9_ AATGGCTTTTTGCCTTCATTATTCA GAAAAATAAACAACAAGATAACTAAC 7668450 (T/A) ATGTAGGTAAAGTTTAATAATAAG CAATCACAAAAAAATTAATTTCAA (SEQ ID N. 74) T (SEQ ID N. 77) (SEQ ID N. 78)
Example 5: QTLs Combinations
[0364] A further trial has been conducted by the inventors, in order to demonstrate that some of the QTL previously identified, especially the QTL on chromosome 1, is able to confer the resistance/tolerance even in the absence of the other QTLs, and that the resistance/tolerance to Tuta absoluta is improved when further QTLs are introgressed, preferably at least the QTL on chromosome 9, and even preferably the QTLs on chromosome 9 and 12.
[0365] The trial included 12 F3 lines, originating from a F2 population of TUT115 x line 6858.
[0366] Alternative SNPs were used on chromosomes 1 and 9, namely SLC2.31_1_72272308 (alternative alleles T/C) on chromosome 1, which is associated with the QTL comprising SNPs solcap_snp_sl_18619 and solcap_snp_sl_12348; and SLC2.31_9_7668450 (alternative alleles T/A) on chromosome 9, which is associated with the QTL identified on chromosome 9, especially associated with CL016475-0340.
[0367] Statistical Analysis Results
[0368] One way ANOVA for 160 F2 individuals from TUT115 X 6858 showed a significant effect for chromosome 1, and for chromosomes 1 and 9.
[0369] One Way ANOVA for Chromosome 1 Genotypes
[0370] Means and distribution of PLA results for each genotype from chromosome 1 QTL marker SNP used: SLC2.31_1_72272308 from the 1st QTL region described in example 2, comprising SNP solcap_snp_sl_18619 and SNP solcap_snp_sl_12348. The allele associated with the resistance phenotype and present in TUT115 is T for SLC2.31_1_72272308. The allele associated with susceptibility is C.
[0371] It is to be reminded that for PLA, a lower score represents minimum symptoms, and thus higher resistance. The results are presented in Table 11 and illustrated on figure
TABLE-US-00012 TABLE 11 PLA score depending on the genotype of SLC2.31_1_72272308 on chromosome 1 Upper 95% Lower 95% Std error Mean Number genotype 0.30286 0.21092 0.02327 0.256889 45 C/C 0.25774 0.18604 0.01815 0.221892 74 T/C 0.17976 0.08224 0.02469 0.131000 40 T/T R.sup.2 = 0.085; p-value: 0.0009; Additive effect: −0.063 The lowest mean PLA score corresponds to genotype T/T = 0.13
[0372] One Way ANOVA for Chromosome 9 Genotypes SNP used for chromosome 9: SLC2.31_9_7668450 from the QTL region described in example 2 on chromosome 9, its position is 7667332 on the tomato genome version SL2.40. The allele of SNP SLC2.31_9_7668450 present in TUT115 is T and the allele present in the susceptible parent is A.
[0373] The results are illustrated on figure
[0374] Over Dominant effect: −0.09.
[0375] The lowest mean PLA score corresponds to the heterzygote genotype T/A=0.16
[0376] One Way ANOVA for Combination of Chromosome 1 and Chromosome 9 Genotypes
[0377] SNP used for chr9: SLC2.31_9_7668450 from the QTL region described in the example 2 on chromosome 9.
[0378] The results are presented in Table 12 and illustrated on figure
TABLE-US-00013 TABLE 12 Upper Genotype 95% Lower 95% Std error Mean Number Chr 1, Chr9 0.28544 0.0872 0.05015 0.186333 9 T/T, A/A 0.29174 0.0815 0.05320 0.186625 8 T/T, T/T 0.14874 0.0190 0.03283 0.083857 21 T/T, T/A R.sup.2 = 0.18 The lowest mean PLA score is obtained for the genotype combination (haplotype Chromosome1_chromosome 9): T/T_T/A, value = 0.08.
[0379] One Way ANOVA for Combination of Chromosomes 1, 9 and 5 Genotypes
[0380] SNP used for chromosome 5 is EE_0301, exemplified in example 2 and table 10. The results are presented in Table 13 and illustrated on figure
TABLE-US-00014 TABLE 13 Upper Lower Genotype 95% 95% Std error Mean Number Chr5, chr1, chr 9 0.26230 0.0227 0.05443 0.142500 6 G:G, T/T, T/A 0.29509 −0.0438 0.07698 0.125667 3 G:T, T/T, A/A 0.17024 −0.0922 0.05963 0.039000 5 T:T, T/T, T/A
[0381] The results obtained in this example can be summarized in table 14 below. From these data, it can be confirmed that the QTL on chromosome 1 is determinant for the resistance, and that the presence of an additional QTL on chromosome 9, especially if present heterozygously, and on chromosome 5, improves the mean resistance.
TABLE-US-00015 TABLE 14 QTL chr 1 QTL chr. 9 QTL chr. 5 Nb of Mean PLA SLC2.31_1_72272308 SLC2.31_9_7668450 EE_0301 individuals score T/T 40 0.13* T/A 80 0.16* T/T T/A T/T 21 0.08** T/T T/A T/T 5 0.039*** *corresponds to the phenotype “resistant to T. absoluta, as defined in this invention. **corresponds to a resistance phenotype essentially similar to TUT115 parent, exhibiting a PLA score of 0.09. ***corresponds to a resistance phenotype essentially similar to GAL1 parent, exhibiting a PLA score of 0.025.
REFERENCES
[0382] De Azevedo et al.; Euphytica 134:347-351 (2003) [0383] Barrett et al. Bioinformatics 21(2): 263-265(2005) [0384] Bombarely et al.; Nucleic Acids Res. January; 39: D1149-D1155 (2011) [0385] Broman and Sen; A guide to QTL Mapping with R/qtl. Springer (2009) [0386] Ecole et al.; J. Appl. Ent. 125, 193-200 (2001) [0387] Eigenbrode and Trumble; J. Amer. Soc. Hort. Sci 118(4): 525-530 (1993) [0388] Lewontin. Genetics 49 (1): 49-67, (1964) [0389] Maluf et al. Euphytica 93 (2): 189-194; (1997) [0390] Maluf et al. Euphytica 176:113-123; (2010a) [0391] Maluf et al. Crop Science, vol 50, 439-450; (2010b) [0392] Momotaz et al., J. Amer. Soc. Sci. 135(2):134-142 (2010) [0393] Oliveira et al., Scientia Horticulturae 199; 182-187 (2009) [0394] Resende et al. Genet. Mol. Res. 1 (2): 106-116; (2002) [0395] Resende et al.; Sci. Agric., v. 63, n. 1; 20-25; (2006) [0396] Schoonhoven et al. Insect-Plant Biology. Chapmann & Hall (1998) [0397] Zar, Biostatistical Analysis. Fifth Edition. Prentice Hall, (2010) [0398] Zadoks et al. (1974). Weed Research 14 (6): 415-421