Nitrile hydratase

09738885 · 2017-08-22

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is an improved nitrile hydratase with improved catalytic activity. Also provided are DNA for coding the improved nitrile hydratase, a recombinant vector that contains the DNA, a transformant that contains the recombinant vector, nitrile hydratase acquired from a culture of the transformant, and a method for producing the nitrile hydratase. Also provided is a method for producing an amide compound that uses the culture or a processed product of the culture. The improved nitrile hydratase contains an amino acid sequence represented by SEQ ID NO: 50 (GX.sub.1X.sub.2X.sub.3X.sub.4DX.sub.5X.sub.6R) in a beta subunit, and is characterized in that X.sub.4 is an amino acid selected from a group comprising cysteine, aspartic acid, glutamic acid, histidine, isoleucine, lysine, methionine, asparagine, proline, glutamine, serine and threonine.

Claims

1. A modified Rhodococcus bacterial or Nocardia bacterial nitrile hydratase, comprising in the β subunit, an amino-acid sequence as shown in SEQ ID NO: 81: WEX.sub.1X.sub.2X.sub.3X.sub.4X.sub.5X.sub.6X.sub.7X.sub.8X.sub.9X.sub.10X.sub.11X.sub.12X.sub.13X.sub.14X.sub.15X.sub.16X.sub.17X.sub.18D (SEQ ID NO: 81), wherein W is tryptophan, E is glutamic acid, D is aspartic acid, X.sub.1˜X.sub.6, X.sub.8˜X.sub.13 and X.sub.15˜X.sub.18 each independently indicate any amino-acid residue, X.sub.7 is an amino acid selected from the group consisting of alanine, valine, aspartic acid, threonine, phenylalanine, isoleucine and methionine, and X.sub.14 is glycine.

2. The modified Rhodococcus bacterial or Nocardia bacterial nitrile hydratase according to claim 1, wherein X.sub.1 is G (glycine), X.sub.2 is R (arginine), X.sub.3 is T (threonine), X.sub.4 is L (leucine), X.sub.5 is S (serine), X.sub.6 is I (isoleucine), X.sub.8 is T (threonine), X.sub.9 is W (tryptophan), X.sub.10 is M (methionine), X.sub.11 is H (histidine), X.sub.12 is L (leucine), X.sub.13 is K (lysine), and X.sub.14 is G (glycine) in SEQ ID NO: 81.

3. The modified Rhodococcus bacterial or Nocardia bacterial nitrile hydratase according to claim 1, further comprising an amino-acid sequence in SEQ ID NO: 82 comprising the amino-acid sequence in SEQ ID NO: 81.

4. A DNA encoding the modified Rhodococcus bacterial or Nocardia bacterial nitrile hydratase according to claim 1.

5. A recombinant vector, comprising the DNA according to claim 4.

6. A transformant, comprising the recombinant vector according to claim 5.

7. A nitrile hydratase collected from a culture obtained by incubating the transformant according to claim 6.

8. A method for producing a nitrile hydratase, the method comprising: incubating the transformant according to claim 6; and collecting the nitrile hydratase from the obtained culture.

9. A method for producing an amide compound, the method comprising contacting a nitrile compound with a culture, or a processed product of the culture, obtained by incubating the nitrile hydratase according to claim 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a view showing the structure of plasmid pSJ034;

(2) FIG. 2-1 is a list showing the alignment results in β subunits of known nitrile hydratases;

(3) FIG. 2-2 is a list showing the alignment results in β subunits of known nitrile hydratases;

(4) FIG. 3 shows the amino-acid sequence of the β subunit identified as SEQ ID NO: 51 related to the present invention;

(5) FIG. 4 is a photograph showing results of SDS-PAGE;

(6) FIG. 5 is a view showing the structure of plasmid pER855A;

(7) FIG. 6-1 is a list showing amino-acid sequences (part of N-terminal side) of β subunits in wild-type nitrile hydratases derived from various microorganisms;

(8) FIG. 6-2 is a list showing amino-acid sequences (part of C-terminal side) subsequent to the amino-acid sequences in FIG. 6-1;

(9) FIG. 7 shows the amino-acid sequence in the β subunit identified as SEQ ID NO: 82 related to the present invention;

(10) FIG. 8-1 is a list showing amino-acid sequences (part of N-terminal side) in α subunits of nitrile hydratases derived from various microorganisms;

(11) FIG. 8-2 is a list showing amino-acid sequences subsequent to the amino-acid sequences in FIG. 8-1;

(12) FIG. 9 shows the amino-acid sequence in the α subunit identified as SEQ ID NO: 121 related to the present invention;

(13) FIG. 10-1 is a list showing amino-acid sequences (part of N-terminal side) in α subunits of nitrile hydratases derived from various microorganisms;

(14) FIG. 10-2 is a list showing amino-acid sequences the same as in FIG. 2-1, and shows the sequences subsequent to the amino-acid sequences in FIG. 10-1;

(15) FIG. 11 shows the amino-acid sequence in the α subunit identified as SEQ ID NO: 131 related the present invention;

(16) FIG. 12-1 is a list showing amino-acid sequences (part of N-terminal side) in α subunits of nitrile hydratases derived from various microorganisms;

(17) FIG. 12-2 is a list showing amino-acid sequences subsequent to the amino-acid sequences in FIG. 12-1; and

(18) FIG. 13 shows the amino-acid sequence in the α subunit identified as SEQ ID NO: 135 related to the present invention.

MODE TO CARRY OUT THE INVENTION

(19) In the following, the present invention is described in detail.

(20) 1. Nitrile Hydratase

(21) (a) Known Nitrile Hydratase

(22) The improved nitrile hydratase of the present invention is obtained by modifying a known nitrile hydratase and is not limited to being derived from any specific type. For example, those registered as nitrile hydratases in the GenBank database provided by the U.S. National Center for Biotechnology Information (NCBI), or those described as nitrile hydratases in publications, may be referred to for a use. Examples of such nitrile hydratases are those described in patent publications 5˜9 (which are incorporated by reference in the present application). Nitrile hydratases in patent publications 5˜9 have heat resistance and acrylamide resistance, and by employing amino-acid substitutions according to the present invention, enhanced catalytic activity is further added to their properties. In particular, nitrile hydratases having amino-acid sequences shown in SEQ ID NOs: 53˜57 are listed as reference.

(23) Furthermore, by introducing a mutation from the gene encoding the amino-acid sequences described above using a well-known method, and by evaluating and screening mutant enzymes which have desired properties, improved enzymes with further enhanced activity are achieved. In particular, nitrile hydratases with amino-acid sequences shown in SEQ ID NOs: 58˜61 are listed.

(24) A “nitrile hydratase” has a conformation formed with α and β subunit domains, and contains a non-heme iron atom or a non-corrin cobalt atom as a prosthetic molecule. Such a nitrile hydratase is identified and referred to as an iron-containing nitrile hydratase or a cobalt-containing nitrile hydratase.

(25) An example of an iron-containing nitrile hydratase is such derived from Rhodococcus N-771 strain. The tertiary structure of such an iron-containing nitrile hydratase has been identified by X-ray crystal structural analysis. The enzyme is bonded with non-heme iron via four amino-acid residues in a cysteine cluster (Cys-Ser-Leu-Cys-Ser-Cys) (SEQ ID NO: 48) forming the active site of the α subunit.

(26) As for a cobalt-containing nitrile hydratase, examples are those derived from Rhodococcus rhodochrous J1 strain (hereinafter may be referred to as “J1 strain”) or derived from Pseudonocardia thermophila.

(27) A cobalt-containing nitrile hydratase derived from the J1 strain is bound with a cobalt atom via a site identified as a cysteine cluster (Cys-Thr-Leu-Cys-Ser-Cys) (SEQ ID NO: 49) that forms the active site of the α subunit. In the cysteine cluster of a cobalt-containing nitrile hydratase derived from Pseudonocardia thermophila, cysteine (Cys) at position 4 from the upstream side (N-terminal side) of the cysteine cluster derived from the J1 strain is cysteine sulfinic acid (Csi), and cysteine (Cys) at position 6 from the furthermost downstream side (C-terminal side) of the cysteine cluster derived from the J1 strain is cysteine sulfenic acid (Cse).

(28) As described above, a prosthetic molecule is bonded with a site identified as cysteine clusters “C(S/T)LCSC” (SEQ ID NO: 48, 49) in the α subunit. Examples of a nitrile hydratase containing a binding site with such a prosthetic molecule are those that have amino-acid sequences and are encoded by gene sequences derived from the following: Rhodococcus rhodochrous J1 (FERM BP-1478), Rhodococcus rhodochrous M8 (SU 1731814), Rhodococcus rhodochrous M33 (VKM Ac-1515D), Rhodococcus rhodochrous ATCC 39484 (JP 2001-292772), Bacillus smithii (JP H9-248188), Pseudonocardia thermophila (JP H9-275978), or Geobacillus thermoglucosidasius.

(29) On the other hand, the β-subunit is thought to be attributed to structural stability.

(30) For example, in the α subunit derived from Rhodococcus rhodochrous J1 strain (FERM BP-1478), its amino-acid sequence is shown as SEQ ID NO: 4, and its base sequence is shown as SEQ ID NO: 3. Also, in the β subunit, its amino-acid sequence is shown as SEQ ID NO: 2, its base sequence is shown as SEQ ID NO: 1 and its accession number is “P21220.” In addition, in Rhodococcus rhodochrous M8 (SU 1731814), the accession number of the α subunit is “ATT 79340” and the accession number of the β subunit is “AAT 79339.”

(31) The accession number of the nitrile hydratase gene derived from Rhodococcus pyridinivorans MW3 is “AJ582605,” and the accession number of the nitrile hydratase gene derived from Rhodococcus pyridinivorans S85-2 is “AJ582605.” The nitrile hydratase gene of Rhodococcus ruber RH (CGMCC No. 2380) is described in CN 101463358. Moreover, the accession number of the nitrile hydratase gene derived from Nocardia YS-2002 is “X86737,” and the accession number of the nitrile hydratase gene derived from Nocardia sp. JBRs is “AY141130.”

(32) (b-1) Improved Nitrile Hydratase 0348)

(33) FIGS. 2-1 and 2-2 show the alignments of amino-acid sequences (in one-letter code) in β-subunits of known nitrile hydratases derived from various microorganisms. FIGS. 2-1 and 2-2 each show amino-acid sequences in sequence ID numbers 2, 5˜12, and 42˜47 of amino-acid sequences from the top.

(34) Furthermore, the improved nitrile hydratase of the present invention includes examples in which one or more (for example, 1˜10, preferred to be approximately 1˜5) amino-acid residues are deleted, substituted and/or added in the amino-acid sequences of known nitrile hydratases, excluding the amino-acid sequence identified as SEQ ID NO: 50.

(35) An example of the improved nitrile hydratase of the present invention has an amino-acid sequence identified as SEQ ID NO: 51 in the β subunit as shown in FIG. 3. Here, the amino-acid sequence shown as SEQ ID NO: 50 is located at positions 44˜52 counted from the N-terminal.

(36) According to an embodiment of the example above, in the improved nitrile hydratase that has the amino-acid sequence as shown in SEQ ID NO: 51, X.sub.1, X.sub.2, X.sub.3, X.sub.5, and X.sub.6 each independently indicate any amino-acid residue, and X.sub.4 is an amino acid selected from among cysteine, aspartic acid, glutamic acid, histidine, isoleucine, lysine, methionine, asparagine, proline, glutamine, serine and threonine.

(37) In addition, according to another embodiment, in the improved nitrile hydratase that has the amino-acid sequence as shown in SEQ ID NO: 51, X.sub.1, X.sub.3, X.sub.5, and X.sub.6 each independently indicate any amino-acid residue, X.sub.2 is S (serine), and X.sub.4 is an amino acid selected from among cysteine, aspartic acid, glutamic acid, histidine, isoleucine, lysine, methionine, asparagine, proline, glutamine, serine and threonine.

(38) Moreover, according to yet another embodiment, in the improved nitrile hydratase that has the amino-acid sequence as shown in SEQ ID NO: 51, X.sub.1 is I (isoleucine), X.sub.2 is S (serine), X.sub.3 is W (tryptophan), and X.sub.5 is K (lysine), X.sub.6 is S (serine), and X.sub.4 is an amino acid selected from among cysteine, aspartic acid, glutamic acid, histidine, isoleucine, lysine, methionine, asparagine, proline, glutamine, serine and threonine.

(39) Another example of the improved nitrile hydratase of the present invention is as follows: in the amino-acid sequence of a known nitrile hydratase identified as SEQ ID NO: 2, the amino-acid residue (tryptophan) at position 48 of the β subunit is substituted with cysteine, aspartic acid, glutamic acid, histidine, isoleucine, lysine, methionine, asparagine, proline, glutamine, serine or threonine.

(40) Modes of such amino-acid substitutions are denoted, for example, as Wβ48C, Wβ48D, Wβ48E, Wβ48H, Wβ48I, Wβ48K, Wβ48M, Wβ48N, Wβ48P, Wβ48Q, Wβ48S or Wβ48T. Amino acids are identified by a single-letter alphabetic code. The letter to the left of the numeral showing the number of amino-acid residues counted from the terminal to the substituted position (for example, “48”) represents the amino acid in a one-letter code before substitution, and the letter to the right represents the amino acid in a one-letter code after substitution.

(41) In particular, when the amino-acid sequence of the β subunit as shown in SEQ ID NO: 2 is denoted as “Wβ48C” in the improved nitrile hydratase, the abbreviation means that, in the amino-acid sequence of the β subunit (SEQ ID NO: 2), tryptophan (W) at position 48 counted from the N-terminal amino-acid residue (including the N-terminal amino-acid residue itself) is substituted with cysteine (C).

(42) Modes of amino acid substitutions in more preferred embodiments of the improved nitrile hydratase according to the present invention are shown as the following 1˜12:

(43) 1. Wβ48C,

(44) 2. Wβ48D,

(45) 3. Wβ48E,

(46) 4. Wβ48H,

(47) 5. Wβ48I,

(48) 6. Wβ48K,

(49) 7. Wβ48M,

(50) 8. Wβ48N,

(51) 9. Wβ48P,

(52) 10. Wβ48Q,

(53) 11. Wβ48S, and

(54) 12. Wβ48T.

(55) Preferred embodiments of base substitutions to cause the above amino-acid substitutions are shown below.

(56) Wβ48C: a base sequence TGG (at positions 142˜144 in SEQ ID NO: 1) is preferred to be substituted with TGC (TGG.fwdarw.TGC).

(57) Wβ48D: a base sequence TGG (at positions 142˜144 in SEQ ID NO: 1) is preferred to be substituted with GAC (TGG.fwdarw.GAC).

(58) Wβ48E: a base sequence TGG (at positions 142˜144 in SEQ ID NO: 1) is preferred to be substituted with GAG (TGG.fwdarw.GAG).

(59) Wβ48F: a base sequence TGG (at positions 142˜144 in SEQ ID NO: 1) is preferred to be substituted with TTC (TGG.fwdarw.TTC).

(60) Wβ48H: a base sequence TGG (at positions 142˜144 in SEQ ID NO: 1) is preferred to be substituted with CAC (TGG.fwdarw.CAC).

(61) Wβ48I: a base sequence TGG (at positions 142˜144 in SEQ ID NO: 1) is preferred to be substituted with ATC (TGG.fwdarw.ATC).

(62) Wβ48K: a base sequence TGG (at positions 142˜144 in SEQ ID NO: 1) is preferred to be substituted with AAG (TGG.fwdarw.AAG).

(63) Wβ48M: a base sequence TGG (at positions 142˜144 in SEQ ID NO: 1) is preferred to be substituted with ATG (TGG.fwdarw.ATG).

(64) Wβ48N: a base sequence TGG (at positions 142˜144 in SEQ ID NO: 1) is preferred to be substituted with AAC (TGG.fwdarw.AAC).

(65) Wβ48P: a base sequence TGG (at positions 142˜144 in SEQ ID NO: 1) is preferred to be substituted with CCG (TGG.fwdarw.CCG).

(66) Wβ48Q: a base sequence TGG (at positions 142˜144 in SEQ ID NO: 1) is preferred to be substituted with CAG (TGG.fwdarw.CAG).

(67) Wβ48S: a base sequence TGG (at positions 142˜144 in SEQ ID NO: 1) is preferred to be substituted with TCC (TGG.fwdarw.TCC).

(68) Wβ48T: a base sequence TGG (at positions 142˜144 in SEQ ID NO: 1) is preferred to be substituted with ACC (TGG.fwdarw.ACC).

(69) (b-2) Improved Nitrile Hydratase (β37)

(70) FIGS. 6-1 and 6-2 show the alignments of amino-acid sequences (in the one-letter code) in β-subunits of known nitrile hydratases derived from various microorganisms. FIGS. 6-1 and 6-2 each show amino-acid sequences in sequence ID numbers 2, 5˜12, and 42˜49 of amino-acid sequences from the top.

(71) Furthermore, the improved nitrile hydratase of the present invention includes examples in which one or more (for example, 1˜10, preferred to be approximately 1˜5) amino-acid residues are deleted, substituted and/or added in the amino-acid sequences of known nitrile hydratases, excluding the amino-acid sequence identified as SEQ ID NO: 81.

(72) An example of the improved nitrile hydratase of the present invention has an amino-acid sequence identified as SEQ ID NO: 82 in the β subunit as shown in FIG. 7. Here, the amino-acid sequence shown in SEQ ID NO: 81 is located at positions 29˜49 counted from the N-terminal.

(73) According to an embodiment, in the improved nitrile hydratase that has the amino-acid sequence shown in SEQ ID NO: 82, X.sub.1˜X.sub.6 and X.sub.8˜X.sub.18 each independently indicate any amino-acid residue, and X.sub.7 is an amino acid selected from among alanine, aspartic acid, threonine, phenylalanine, isoleucine and methionine.

(74) According to another embodiment, in the improved nitrile hydratase that has the amino-acid sequence shown in SEQ ID NO: 82, X.sub.1˜X.sub.6, X.sub.8˜X.sub.13 and X.sub.15˜X.sub.18, each independently indicate any amino-acid residue, X.sub.4 is G (glycine), and X.sub.7 is an amino acid selected from among alanine, valine, aspartic acid, threonine, phenylalanine, isoleucine and methionine.

(75) According to yet another embodiment, in the improved nitrile hydratase that has the amino-acid sequence as shown in SEQ ID NO: 82, X.sub.15˜X.sub.18 each independently indicate any amino-acid residue, X.sub.1 is G (glycine), X.sub.2 is R (arginine), X.sub.3 is T (threonine), X.sub.4 is L (leucine), X.sub.5 is S (serine), X.sub.6 is I (isoleucine), X.sub.8 is T (threonine), X.sub.9 is W (tryptophan), X.sub.10 is M (methionine), X.sub.11 is H (histidine), X.sub.12 is L (leucine), X.sub.13 is K (lysine), X.sub.14 is G (glycine), X.sub.7 is an amino acid selected from among alanine, valine, aspartic acid, threonine, phenylalanine, isoleucine and methionine.

(76) Another example of the improved nitrile hydratase of the present invention is as follows: in the amino-acid sequence of a known nitrile hydratase identified as SEQ ID NO: 2, the amino-acid residue (leucine) at position 37 of the β subunit is substituted with alanine, valine, aspartic acid, threonine, phenylalanine, isoleucine or methionine.

(77) Modes of such amino-acid substitutions are denoted, for example, as Lβ37A, Lβ37D, Lβ37F, Lβ37I, Lβ37M, Lβ37T or Lβ37V. Amino acids are identified by a single-letter alphabetic code. The letter to the left of the numeral showing the number of amino-acid residues counted from the terminal to the substituted position (for example, “37”) is the amino acid in the one-letter code before substitution, and the letter to the right represents the amino acid in the one-letter code after substitution.

(78) In particular, when the amino-acid sequence of the β subunit (SEQ ID NO: 2) identified as SEQ ID NO: 2 is denoted as “Lβ37A” in the improved nitrile hydratase, the abbreviation means that, in the amino-acid sequence of the β subunit (SEQ ID NO: 2), leucine (L) at position 37 counted from the N-terminal amino-acid residue (including the N-terminal amino-acid residue itself) is substituted with alanine (A).

(79) Modes of amino acid substitutions in more preferred embodiments of the improved nitrile hydratase according to the present invention are shown as the following 1˜7:

(80) 1. Lβ37A,

(81) 2. Lβ37D,

(82) 3. Lβ37F,

(83) 4. Lβ37I,

(84) 5. Lβ37M,

(85) 6. Lβ37T and

(86) 7. Lβ37V.

(87) Preferred embodiments of base substitutions to cause the above amino-acid substitutions are shown in Table 1 below.

(88) TABLE-US-00001 TABLE 1 amino-acid substitution base substitution Lβ37A Base sequence CTG (positions at 109~111 in SEQ ID NO: 1) is preferred to be substituted with GCA, GCC, GCG or GCT. Especially preferred to be substituted is C at position 109 with G, T at position 110 with C, and G at position 111 with C (CTG.fwdarw.GCC). Lβ37D Base sequence CTG (positions at 109~111 in SEQ ID NO: 1) is preferred to be substituted with GAC or GAT. Especially preferred to be substituted is C at position 109 with G, T at position 110 with A, and G at position 111 with C (CTG.fwdarw.GAC). Lβ37F Base sequence CTG (positions at 109~111 in SEQ ID NO: 1) is preferred to be substituted with TTC or TTT. Especially preferred to be substituted is C at position 109 with T and G at position 111 with C (CTG.fwdarw.TTC). Lβ37I Base sequence CTG (positions at 109~111 in SEQ ID NO: 1) is preferred to be substituted with ATT, ATC or ATA. Especially preferred to be substituted is C at position 109 with A and G at position 111 with C (CTG.fwdarw.ATC). Lβ37M Base sequence CTG (positions at 109~111 in SEQ ID NO: 1) is preferred to be substituted with ATG. Especially preferred to be substituted is C at position 109 with A (CTG.fwdarw.ATG). Lβ37T Base sequence CTG (positions at 109~111 in SEQ ID NO: 1) is preferred to be substituted with ACA, ACC, ACG or ACT. Especially preferred to be substituted is C at position 109 with A, T at position 110 with C and G at position 111 with C (CTG.fwdarw.ACC). Lβ37V Base sequence CTG (positions at 109~111 in SEQ ID NO: 1) is preferred to be substituted with GTA, GTC, GTG or GTT. Especially preferred to be substituted is C at position 109 with G and G at position 111 with C (CTG.fwdarw.GTC).
(b-3) Improved Nitrile Hydratase (α83)

(89) FIGS. 8-1 and 8-2 show amino-acid sequence alignments (in one-letter code) in α-subunits of known nitrile hydratases derived from various microorganisms. FIGS. 8-1 and 8-2 each show amino-acid sequences in sequence ID numbers 4, 105˜108, 121, 109, 110, 112, 111, 122˜124, 113, 114, 125 from the top.

(90) Furthermore, the improved nitrile hydratase of the present invention includes examples in which one or more (for example, 1˜10, preferred to be approximately 1˜5) amino-acid residues are deleted, substituted and/or added in amino-acid sequences of known nitrile hydratases, excluding the amino-acid sequence identified as SEQ ID NO: 119. Examples of such a nitrile hydratase are described in patent publications 5˜9 (the contents are incorporated by reference into the present application). Nitrile hydratases in patent publication 5˜9 each exhibit heat resistance and acrylamide resistance. Moreover, as a result of amino-acid substitutions of the present invention, enhanced catalytic activity is further added to their properties.

(91) An example of the improved nitrile hydratase of the present invention has an amino-acid sequence as shown in SEQ ID NO: 120 in the α subunit as shown in FIG. 9. Here, an amino-acid sequence shown in SEQ ID NO: 119 is located at positions 73˜83 counted from the N-terminal.

(92) According to an embodiment, in the improved nitrile hydratase that has the amino-acid sequence shown in SEQ ID NO: 120, X.sub.1˜X.sub.7 each independently indicate any amino-acid residue, and X.sub.8 is an amino acid selected from among alanine, leucine, methionine, asparagine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, histidine, lysine, proline, arginine, serine, threonine, tyrosine and tryptophan.

(93) According to another embodiment, in the improved nitrile hydratase that has the amino-acid sequence shown in SEQ ID NO: 120, X.sub.1 is M (methionine), X.sub.7 is A (alanine), X.sub.3 is S (serine), X.sub.4 is L (leucine), X.sub.5 is Y (tyrosine), X.sub.6 is A (alanine), X.sub.7 is E (glutamic acid), and X.sub.8 is an amino acid selected from among alanine, leucine, methionine, asparagine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, histidine, lysine, proline, arginine, serine, threonine, tyrosine and tryptophan.

(94) Another example of the improved nitrile hydratase of the present invention is as follows: in the amino-acid sequence of a known nitrile hydratase identified as SEQ ID NO: 4, the amino-acid residue at position 83 (glutamine) of the α subunit is substituted with alanine, leucine, methionine, asparagine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, histidine, lysine, proline, arginine, serine, threonine, tyrosine or tryptophan.

(95) Modes of such amino-acid substitutions are denoted, for example, as Qα83A, Qα83C, Qα83D, Qα83E, Qα83F, Qα83G, Qα83H, Qα83K, Qα83L, Qα83M, Qα83N, Qα83P, Qα83R, Qα83S, Qα83T, Qα83Y and Qα83W. Amino acids are identified by a single-letter alphabetic code. The letter to the left of the numeral showing the number of amino-acid residues counted from the terminal to the substituted position (for example, “83”) represents the amino acid in a one-letter code before substitution, and the letter to the right represents the amino acid in a one-letter code after substitution.

(96) In particular, when the amino-acid sequence of the α subunit in SEQ ID NO: 4 is denoted as “Qα83A” in the improved nitrile hydratase, the abbreviated notation means that, in the amino-acid sequence of the α subunit (SEQ ID NO: 4), glutamine (Q) at position 83 counted from the N-terminal amino-acid residue (including the N-terminal amino-acid residue itself) is substituted with alanine (A).

(97) Modes of amino-acid substitutions in more preferred embodiments of the improved nitrile hydratase according to the present invention are shown as the following 1˜17:

(98) 1. Qα83A,

(99) 2. Qα83C,

(100) 3. Qα83D,

(101) 4. Qα83E,

(102) 5. Qα83F,

(103) 6. Qα83G,

(104) 7. Qα83H,

(105) 8. Qα83K,

(106) 9. Qα83L,

(107) 10. Qα83M,

(108) 11. Qα83N,

(109) 12. Qα83P,

(110) 13. Qα83R,

(111) 14. Qα83S,

(112) 15. Qα83T,

(113) 16. Qα83Y and

(114) 17. Qα83W.

(115) Preferred embodiments of base substitutions to cause the above amino-acid substitutions are shown below.

(116) TABLE-US-00002 TABLE 2 amino-acid substitution base substitution Qα83A Base sequence CAG (positions at 247~249 in SEQ ID NO: 3) is preferred to be substituted with GCA, GCC, CCG, or GCT. Especially preferred to be substituted is C at position 247 with G, A at position 248 with C, and G at position 249 with C (CAG.fwdarw.GCC). Qα83C Base sequence CAG (positions at 247~249 in SEQ ID NO: 3) is preferred to be substituted with TGC or TGT. Especially preferred to be substituted is C at position 247 with T, A at position 248 with G, and G at position 249 with C (CAG.fwdarw.TGC). Qα83D Base sequence CAG (positions at 247~249 in SEQ ID NO: 3) is preferred to be substituted with CAC or GAT. Especially preferred to be substituted is C at position 247 with G, and G at position 249 with C (CAG.fwdarw.GAC). Qα83E Base sequence CAG (positions at 247~249 in SEQ ID NO: 3) is preferred to be substituted with GAG or GAA. Especially preferred to be substituted is C at position 247 with G (CAG.fwdarw.GAG). Qα83F Base sequence CAG (positions at 247~249 in SEQ ID NO: 3) is preferred to be substituted with TTC or TTT. Especially preferred to be substituted is C at position 247 with T, A at position 248 with T, and G at position 249 with C (CAG.fwdarw.TTC). Qα83G Base sequence CAG (positions at 247~249 in SEQ ID NO: 3) is preferred to be substituted with GGA, GGC, GGG or GGT. Especially preferred to be substituted is C at position 247 with G, A at position 248 with G, and G at position 249 with C (CAG.fwdarw.GGC). Qα83H Base sequence CAG (positions at 247~249 in SEQ ID NO: 3) is preferred to be substituted with CAC or CAT. Especially preferred to be substituted is G at position 249 with C (CAG.fwdarw.CAC). Qα83K Base sequence CAG (positions at 247~249 in SEQ ID NO: 3) is preferred to be substituted with AAA or AAG. Especially preferred to be substituted is C at position 247 with A (CAG.fwdarw.AAG). Qα83L Base sequence CAG (positions at 247~249 in SEQ ID NO: 3) is preferred to be substituted with CTA, CTC, CTG, CTT, TTA or TTG. Especially preferred to be substituted is A at position 248 with T, and G at position 249 with C (CAG.fwdarw.CTC). Qα83M Base sequence CAG (positions at 247~249 in SEQ ID NO: 3) is preferred to be substituted with ATG. Especially preferred to be substituted is C at position 247 with A, and A at position 248 with T (CAG.fwdarw.ATG). Qα83N Base sequence CAG (positions at 247~249 in SEQ ID NO: 3) is preferred to be substituted with AAC or AAT. Especially preferred to be substituted is C at position 247 with A, and G at position 249 with C (CAG.fwdarw.AAC). Qα83P Base sequence CAG (positions at 247~249 in SEQ ID NO: 3) is preferred to be substituted with CCA, CCC, CCG or CCT. Especially preferred to be substituted is A at position 248 with C (CAG.fwdarw.CCG). Qα83R Base sequence CAG (positions at 247~249 in SEQ ID NO: 3) is preferred to be substituted with CGA, CGC, CGG, CGT, AGA or AGG. Especially preferred to be substituted is A at position 248 with G (CAG.fwdarw.CGG). Qα83S Base sequence CAG (positions at 247~249 in SEQ ID NO: 3) is preferred to be substituted with TCA, TCC, TCG, TCT, AGC or ACT. Especially preferred to be substituted is C at position 247 with T, A at position 248 with C, and G at position 249 with C (CAG.fwdarw.TCC). Qα83T Base sequence CAG (positions at 247~249 in SEQ ID NO: 3) is preferred to be substituted with ACA, ACC, ACG or ACT. Especially preferred to be substituted is C at position 247 with A, A at position 248 with C, and G at position 249 with C (CAG.fwdarw.ACC). Qα83Y Base sequence CAG (positions at 247~249 in SEQ ID NO: 3) is preferred to be substituted with TAC or TAT. Especially preferred to be substituted is C at position 247 with T, and G at position 249 with C (CAG.fwdarw.TAC). Qα83W Base sequence CAG (positions at 247~249 in SEQ ID NO: 3) is preferred to be substituted with TGG. Especially preferred to be substituted is C at position 247 with T, and A at position 248 with G (CAG.fwdarw.TGG).
(b-4) Improved Nitrile Hydratase (α82)

(117) FIGS. 10-1 and 10-2 show amino-acid sequence alignments (in the one-letter code) in α-subunits of known nitrile hydratases derived from various microorganisms. FIGS. 10-1 and 10-2 each show amino-acid sequences in sequence ID numbers 4, 105˜108, 121, 109, 110, 112, 111, 122˜124, 113, 114, 125 from the top.

(118) Furthermore, the improved nitrile hydratase of the present invention includes examples in which one or more (for example, 1˜10, preferred to be approximately 1˜5) amino-acid residues are deleted, substituted and/or added in the amino-acid sequences of known nitrile hydratases, excluding the amino-acid sequence identified as SEQ ID NO: 131. Examples of the improved nitrile hydratase are described in patent publications 5˜9 (the contents are incorporated by reference into the present application). Nitrile hydratases in patent publication 5˜9 each exhibit heat resistance and acrylamide resistance. Moreover, as a result of amino-acid substitutions of the present invention, enhanced catalytic activity is further added to their properties.

(119) An example of the improved nitrile hydratase of the present invention has an amino-acid sequence as shown in SEQ ID NO: 131 in the α subunit as shown in FIG. 11. Here, an amino-acid sequence shown in SEQ ID NO: 132 is located at positions 73˜83 counted from the N-terminal.

(120) According to an embodiment of the present invention, in the improved nitrile hydratase that has the amino-acid sequence shown in SEQ ID NO: 131, X.sub.1˜X.sub.6 each independently indicate any amino-acid residue, and X.sub.7 is an amino acid selected from among cysteine, phenylalanine, histidine, isoleucine, lysine, methionine, glutamine, arginine, threonine and tyrosine.

(121) According to another embodiment, in the improved nitrile hydratase that has the amino-acid sequence shown in SEQ ID NO: 131, X.sub.1 is M (methionine), X.sub.2 is A (alanine), X.sub.3 is S (serine), X.sub.4 is L (leucine), X.sub.5 is Y (tyrosine), X.sub.6 is A (alanine), and X.sub.7 is an amino acid selected from among cysteine, phenylalanine, histidine, isoleucine, lysine, methionine, glutamine, arginine, threonine and tyrosine.

(122) Another example of the improved nitrile hydratase of the present invention is as follows: in the amino-acid sequence of a known nitrile hydratase shown in SEQ ID NO: 4, the amino-acid residue at position 82 (glutamic acid) of the α subunit is substituted with cysteine, phenylalanine, histidine, isoleucine, lysine, methionine, glutamine, arginine, threonine or tyrosine.

(123) Modes of such amino-acid substitutions are denoted, for example, as Eα82C, Eα82F, Eα82H, Eα82I, Eα82K, Eα82M, Eα82Q, Eα82R, Eα82T and Eα82Y. Amino acids are identified by a single-letter alphabetic code. The letter to the left of the numeral showing the number of amino-acid residues counted from the terminal to the substituted position (for example, “82”) is the amino acid in a one-letter code before substitution, and the letter to the right represents the amino acid in a one-letter code after substitution.

(124) In particular, when the amino-acid sequence of the α subunit in SEQ ID NO: 4 is denoted as “Eα82C” in the improved nitrile hydratase, the abbreviated notation means among the amino-acid sequence of the α subunit, glutamic acid (E) at position 82 counted from the N-terminal amino-acid residue (including the N-terminal amino-acid residue itself) is substituted with cysteine (C).

(125) Modes of amino acid substitutions in more preferred embodiments of the improved nitrile hydratase according to the present invention are shown as the following 1˜10:

(126) 1. Eα82C,

(127) 2. Eα82F,

(128) 3. Eα82H,

(129) 4. Eα82I,

(130) 5. Eα82K,

(131) 6. Eα82M,

(132) 7. Eα82Q,

(133) 8. Eα82R,

(134) 9. Eα82T and

(135) 10. Eα82Y.

(136) Preferred embodiments of base substitutions to cause above amino-acid substitutions are shown below.

(137) TABLE-US-00003 TABLE 3 amino-acid substitution base substitution Eα82C Base sequence GAG (positions at 244~246 in SEQ ID NO: 3) is preferred to be substituted with TGC or TGT. Especially preferred to be substituted is G at position 244 with T, A at position 245 with G, and G at position 246 with C (GAG.fwdarw.TGC). Eα82F Base sequence GAG (positions at 244~246 in SEQ ID NO: 3) is preferred to be substituted with TTC or TTT. Especially preferred to be substituted is G at position 244 with T, A at position 245 with T, and G at position 246 with C (GAG.fwdarw.TTC). Eα82H Base sequence GAG (positions at 244~246 in SEQ ID NO: 3) is preferred to be substituted with CAT or CAC. Especially preferred to be substituted is G at position 244 with C, and G at position 246 with C (GAG.fwdarw.CAC). Eα82I Base sequence GAG (positions at 244~246 in SEQ ID NO: 3) is preferred to be substituted with ATT, ATC or ATA. Especially preferred to be substituted is G at position 244 with A, A at position 245 with T, and G at position 246 with C (GAG.fwdarw.ATC). Eα82K Base sequence GAG (positions at 244~246 in SEQ ID NO: 3) is preferred to be substituted with AAA or AAG. Especially preferred to be substituted is G at position 244 with A (GAG.fwdarw.AAG). Eα82M Base sequence GAG (positions at 244~246 in SEQ ID NO: 3) is preferred to be substituted with ATG. Especially preferred to be substituted is G at position 244 with A, and A at position 245 with T (GAG.fwdarw.ATG). Eα82Q Base sequence GAG (positions at 244~246 in SEQ ID NO: 3) is preferred to be substituted with CAA or CAG. Especially preferred to be substituted is G at position 244 with C (GAG.fwdarw.CAG). Eα82R Base sequence GAG (positions at 244~246 in SEQ ID NO: 3) is preferred to be substituted with CGA, CGC, CGG, CGT, AGA or AGG. Especially preferred to be substituted is G at position 244 with C, and A at position 245 with G (GAG.fwdarw.CGG). Eα82T Base sequence GAG (positions at 244~246 in SEQ ID NO: 3) is preferred to be substituted with ACA, ACC, ACG or ACT. Especially preferred to be substituted is G at position 244 with A, A at position 245 with C, and G at position 246 with C (GAG.fwdarw.ACC). Eα82Y Base sequence GAG (positions at 244~246 in SEQ ID NO: 3) is preferred to be substituted with TAT or TAC. Especially preferred to be substituted is G at position 244 with T, and G at position 246 with G (GAG.fwdarw.TAC).
(b-5) Improved Nitrile Hydratase (α85)

(138) FIGS. 12-1 and 12-2 show the alignments of amino-acid sequences (in the one-letter code) in α-subunits of known nitrile hydratases derived from various microorganisms. FIGS. 12-1 and 12-2 each show amino-acid sequences in sequence ID numbers 4, 105˜108, 121, 109, 110, 112, 111, 122˜124, 113, 114, 125 from the top.

(139) Furthermore, the improved nitrile hydratase of the present invention includes examples in which one or more (for example, 1˜10, preferred to be approximately 1˜5) amino-acid residues are deleted, substituted and/or added in the amino-acid sequences of known nitrile hydratases, excluding the amino-acid sequence identified as SEQ ID NO: 135. Examples of such a nitrile hydratase are described in patent publications 5˜9 (the contents are incorporated by reference into the present application). Nitrile hydratases in patent publication 5˜9 each exhibit heat resistance and acrylamide resistance. Moreover, as a result of amino-acid substitutions of the present invention, enhanced catalytic activity is further added to their properties.

(140) An example of the improved nitrile hydratase of the present invention has an amino-acid sequence as shown in SEQ ID NO: 135 in the α subunit as shown in FIG. 13. Here, an amino-acid sequence shown in SEQ ID NO: 136 is located at positions 73˜85 counted from the N-terminal.

(141) According to an embodiment of the present invention, in the improved nitrile hydratase that has the amino-acid sequence shown in SEQ ID NO: 135, X.sub.1˜X.sub.8 each independently indicate any amino-acid residue, and X.sub.9 is an amino acid selected from among cysteine, glutamic acid, phenylalanine, isoleucine, asparagine, glutamine, serine and tyrosine.

(142) According to another embodiment, in the improved nitrile hydratase that has the amino-acid sequence shown in SEQ ID NO: 135, X.sub.1 is M (methionine), X.sub.2 is A (alanine), X.sub.3 is S (serine), X.sub.4 is L (leucine), X.sub.5 is Y (tyrosine), X.sub.6 is A (alanine), X.sub.7 is E (glutamic acid), X.sub.8 is A (alanine), and X.sub.9 is an amino acid selected from among cysteine, glutamic acid, phenylalanine, isoleucine, asparagine, glutamine, serine and tyrosine.

(143) Another example of the improved nitrile hydratase of the present invention is as follows: in the amino-acid sequence of a known nitrile hydratase shown in SEQ ID NO: 4, the amino-acid residue at position 85 (histidine) of the α subunit is substituted with cysteine, glutamic acid, phenylalanine, isoleucine, asparagine, glutamine, serine or tyrosine.

(144) Modes of such amino-acid substitutions are shown, for example, as Hα85C, Hα85E, Hα85F, Hα85I, Hα85N, Hα85Q, Hα85S and Hα85Y. Amino acids are identified by a single-letter alphabetic code. The letter to the left of the numeral showing the number of amino-acid residues counted from the terminal to the substituted position (for example, “85”) is the amino acid in a one-letter code before substitution, and the letter to the right represents the amino acid in a one-letter code after substitution.

(145) In particular, when the amino-acid sequence of the α subunit in SEQ ID NO: 4 is denoted as “Hα85C” in the improved nitrile hydratase, the abbreviated notation means that, in the amino-acid sequence of the α subunit (SEQ ID NO: 4), histidine (H) at position 85 counted from the N-terminal amino-acid residue (including the N-terminal amino-acid residue itself) is substituted with cysteine (C).

(146) Modes of amino acid substitutions in more preferred embodiments of the improved nitrile hydratase according to the present invention are shown as the following 1˜8:

(147) 1. Hα85C,

(148) 2. Hα85E,

(149) 3. Hα85F,

(150) 4. Hα85I,

(151) 5. Hα85N,

(152) 6. Hα85Q,

(153) 7. Hα85S and

(154) 8. Hα85Y.

(155) Preferred embodiments of base substitutions to cause the above amino-acid substitutions are shown below.

(156) TABLE-US-00004 TABLE 4 amino-acid substitution base substitution Hα85C Base sequence CAC (positions at 253~255 in SEQ ID NO: 3) is preferred to be substituted with TGC or TGT. Especially preferred to be substituted is C at position 253 with T, and A at position 254 with G (CAC.fwdarw.TGC). Hα85E Base sequence CAC (positions at 253~255 in SEQ ID NO: 3) is preferred to be substituted with GAG or GAA. Especially preferred to be substituted is C at position 253 with G, and C at position 255 with G (CAC.fwdarw.GAG). Hα85F Base sequence CAC (positions at 253~255 in SEQ ID NO: 3) is preferred to be substituted with TTC or TTT. Especially preferred to be substituted is C at position 253 with T, and A at position 254 with T (CAC.fwdarw.TTC). Hα85I Base sequence CAC (positions at 253~255 in SEQ ID NO: 3) is preferred to be substituted with ATT, ATC or ATA. Especially preferred to be substituted is C at position 253 with A, and A at position 254 with T (CAC.fwdarw.ATC). Hα85N Base sequence CAC (positions at 253~255 in SEQ ID NO: 3) is preferred to be substituted with AAC or AAT. Especially preferred to be substituted is C at position 253 with A (CAC.fwdarw.AAC). Hα85Q Base sequence CAC (positions at 253~255 in SEQ ID NO: 3) is preferred to be substituted with CAA or CAG. Especially preferred to be substituted is C at position 255 with G (CAC.fwdarw.CAG). Hα85S Base sequence CAC (positions at 253~255 in SEQ ID NO: 3) is preferred to be substituted with TCA, TCC, TCG, TCT, AGC or AGT. Especially preferred to be substituted is C at position 253 with T, and A at position 254 with C (CAC.fwdarw.TCC). Hα85Y Base sequence CAC (positions at 253~255 in SEQ ID NO: 3) is preferred to be substituted with TAT or TAC. Especially preferred to be substituted is C at position 253 with T (CAC.fwdarw.TAC).
(b-6) Nitrile Hydratase Activity

(157) Among the activity properties of the improved nitrile hydratase according to the present invention, catalytic activity is improved relative to that in a nitrile hydratase before a mutation is introduced.

(158) Here, “nitrile hydratase activity” means an enzyme to catalyze the hydration for converting a nitrile compound to a corresponding amide compound (RCN+H.sub.2O.fwdarw.RCONH.sub.2). Determining the activity is conducted by bringing a nitrile compound as a substrate into contact with a nitrile hydratase for conversion to a corresponding amide compound and by determining the resultant amide compound. Any nitrile compound may be used as a substrate as long as nitrile hydratase reacts with such a compound, but acrylonitrile is preferred.

(159) Reaction conditions are a substrate concentration of 2.5%, reaction temperature of 10° C. to 30° C. and duration of 10˜30 minutes. The enzymatic reactions are terminated by adding phosphoric acid. Then, using HPLC (high-performance liquid chromatography) or gas chromatography, the produced acrylamide is analyzed to measure the amount of the amide compound.

(160) “Improved catalytic activity” means that when activity is measured in the culture of a transformant containing the improved nitrile hydratase or the improved nitrile hydratase isolated from the transformant, the catalytic activity of the improved nitrile hydratase is at least 10% higher than that of the parent strain measured under the same conditions. The parent strain in the present application means a transformant into which a template plasmid for mutation was introduced.

(161) As for an amide compound, an amide compound represented by the general formula (1) below, for example, is preferred.
R—CONH.sub.2  (1)
(Here, R is an optionally substituted linear or branched alkyl or alkenyl group having 1˜10 carbon atoms, an optionally substituted cycloalkyl or allyl group having 3˜48 carbon atoms, or an optionally substituted saturated or unsaturated heterocyclic group.) Especially preferred is an acrylamide in which “R” in the formula is “CH.sub.2═CH—.”

(162) The above improved nitrile hydratase is obtained by performing amino-acid substitution on a nitrile hydratase. For example, such an improved nitrile hydratase is obtained by modifying the amino-acid sequence (SEQ ID NO: 2) of a nitrile hydratase derived from Rhodococcus rhodochrous J1 strain, and by screening a nitrile hydratase with an improved catalytic activity.

(163) Rhodococcus rhodochrous J1 strain is internationally registered under accession number “FERM BP-1478” at the International Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology (Central 6, 1-1-1 Higashi, Tsukuba, Ibaraki), deposited Sep. 18, 1987.

(164) Using a nitrile hydratase derived from bacteria other than the J1 strain, catalytic activity is thought to be improved as well when a mutation is introduced by modifying a position, type of amino acid or DNA sequence described above. Preferred strains are: Rhodococcus rhodochrous M8 (SU 1731814) (SEQ ID NO: 5), Rhodococcus ruber TH (SEQ ID NO: 6), Rhodococcus rhodochrous M33 (VKM Ac-1515D), Rhodococcus pyridinivorans MW3 (SEQ ID NO: 7), Rhodococcus pyridinivorans S85-2 (SEQ ID NO: 8), Rhodococcus pyridinivorans MS-38 (SEQ ID NO: 9), Rhodococcus ruber RH (CN 101463358) (SEQ ID NO: 52), Nocardia sp. JBRs (SEQ ID NO: 10), Nocardia sp. YS-2002 (SEQ ID NO: 11), Rhodococcus rhodochrous ATCC 39384 (SEQ ID NO: 12), uncultured bacterium SP1 (SEQ ID NO: 42), uncultured bacterium BD2 (SEQ ID NO: 43), Comamonas testosterone (SEQ ID NO: 44), Geobacillus thermoglucosidasius Q6 (SEQ ID NO: 45), Pseudonocardia thermophila JCM 3095 (SEQ ID NO: 46), Rhodococcus rhodochrous Cr 4 (SEQ ID NO: 47), or the like. Obtained through natural mutation from the M8 strain above (SU 1731814), Rhodococcus rhodochrous M33 (VKM Ac-1515D) was selected because it is capable of constitutive expression of a nitrile hydratase. The amino-acid or gene sequence of the nitrile hydratase itself is not mutated (U.S. Pat. No. 5,827,699). In the β subunit in a bacterium listed above, the amino-acid residue at position 48 from the N-terminal of the improved nitrile hydratase is substituted with cysteine, aspartic acid, glutamic acid, histidine, isoleucine, lysine, methionine, asparagine, proline, glutamine, serine or threonine.

(165) Methods for conducting amino-acid substitution on a wild-type nitrile hydratase are as follows: a bacterium having nitrile hydratase activity is brought into contact for reactions with chemicals such as hydroxyl amine or nitrous acid as a mutation source; UV rays are irradiated to induce mutation; error-prone PCR or site-directed mutagenesis is employed to introduce a mutation at random into the gene that encodes a nitrile hydratase; and the like.

(166) (b-7) Error-Prone PCR

(167) To study functions and characteristics of proteins using a mutant, random mutagenesis is known. Random mutagenesis is a method to introduce a random mutation to the gene encoding a specific protein so that a mutant is produced. In random mutagenesis by PCR, stringency conditions are set low for the DNA amplification period so that a mutant base is introduced (error-prone PCR).

(168) In such an error-prone PCR method, a mutation is introduced randomly into any position of the entire DNA site to be amplified. Then, by examining the function of the obtained mutant, which occurred through the mutation introduced at a random site, information of the amino acid or domain important for a specific function of a protein is obtained.

(169) As a nitrile hydratase used for the template of error-prone PCR, the nitrile hydratase gene derived from a wild-type strain or DNA obtained as an amplified product by error-prone PCR is used.

(170) As reaction conditions for error-prone PCR, for example, a composition ratio of any one, two or three among dNTP (dGTP, dCTP, dATP or dTTP) in the reaction mix is reduced relative to another dNTP. In so setting, during the DNA synthesis, at a position that requires a dNTP whose ratio is reduced, another dNTP is more likely to be used by error and that may lead to mutation. In addition, other preferred reaction conditions are a composition in which the amount of MgCl.sub.2 and/or MnCl.sub.2 in the reaction mix is increased.

(171) (b-8) Improved Nitrile Hydratase Mutagenesis

(172) Based on a known nitrile hydratase gene, DNA that encodes such an improved nitrile hydtratase is produced by site-directed mutagenesis methods described in Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press (1989), Current Protocols in Molecular Biology, John Wiley and Sons (1987-1997) and the like. To introduce a mutation into DNA by well-known methods such as the Kunkel method or Gapped Duplex method, mutagenesis kits applying site-directed mutagenesis methods such as follows are used: QuickChange™ XL Site-Directed Mutagenesis Kit (made by Stratagene), GeneTailor™ Site-Directed Mutagenesis System (made by Invitrogen Corporation), TaKaRa Site-Directed Mutagenesis System (Mutan-K, Mutan-Super Express Km and the like, made by Takara Bio Inc.) and the like.

(173) Furthermore, the DNA related to the present invention includes DNA which is hybridized under stringent conditions with a DNA made up of a base sequence complementary to the base sequence of the DNA of the present invention, and which encodes a protein having nitrile hydratase activity.

(174) Such an improved nitrile hydratase DNA is obtained by introducing a mutation into a wild-type gene as described above. Alternatively, using the DNA sequence or its complementary sequence or a DNA fragment as a probe, improved nitrile hydratase DNA may also be obtained from cDNA libraries and genomic libraries by employing well-known hybridization methods such as colony hybridization, plaque hybridization, Southern blot or the like. Libraries constructed by a well-known method may be used, or commercially available cDNA libraries and genomic libraries may also be used.

(175) “Stringent conditions” are those for washing after hybridization; a salt concentration of 300˜2000 mM and a temperature of 40˜75° C., preferably a salt concentration of 600˜900 mM and a temperature of 65° C. For example, conditions 2×SSC at 50° C. may be employed. In addition to such a salt concentration of the buffer, temperature and the like, a person skilled in the art may set conditions for obtaining DNA that encodes a nitrile hydratase of the present invention by adding various conditions such as probe concentration, probe length and reaction time.

(176) For detailed procedures for hybridization, Molecular Cloning, A Laboratory Manual, 2nd edition (Cold Spring Harbor Laboratory Press (1989)) or the like may be referred to. DNA to be hybridized includes DNA or its fragment, containing a base sequence which is at least 40%, preferably 60%, more preferably 90% or greater, homologous to the genomic DNA of the present invention.

(177) (c) Recombinant Vector, Transformant

(178) It is necessary for a nitrile hydratase gene to be put into a vector so that nitrile hydratase is expressed in the host organism to be transformed. Examples of such vectors are plasmid DNA, bacteriophage DNA, retrotransposon DNA, artificial chromosome DNA and the like.

(179) In addition, a host to be used in the present invention is not limited to any specific type as long as it can express the target nitrile hydratase after the recombinant vector is introduced into the host. Examples are bacteria such as E. coli and Bacillus subtilis, yeasts, animal cells, insect cells, plant cells and the like. When E. coli is used as a host, an expression vector with high expression efficiency, such as expression vector pkk 233-2 with a trc promoter (made by Amersham Biosciences Corp.), pTrc 99A (made by Amersham Biosciences Corp.) or the like, is preferred.

(180) In addition to a nitrile hydratase gene, a vector may be coupled with a promoter, terminator, enhancer, splicing signal, poly A addition signal, selection marker, ribosome binding sequence (SD sequence) or the like. Examples of selection markers are kanamycin resistance gene, dihydrofolate reductase gene, ampicillin resistance gene, neomycin resistance gene and the like.

(181) When a bacterium is used as a host, Escherichia coli may be used, for example, and a Rhodococcus strain such as Rhodococcus rhodochrous ATCC 12674, Rhodococcus rhodochrous ATCC 17895 and Rhodococcus rhodochrous ATCC 19140 may also be used. Those ATCC strains are obtained from the American type culture collection.

(182) When E. coli is used as a host for producing a transformant to express a nitrile hydratase, since most of the expressed nitrile hydratase is formed as an inclusion body and is insoluble, a transformant with low catalytic activity is obtained. On the other hand, if a Rhodococcus strain is used as a host, nitrile hydratase is present in the soluble fraction, and a transformant with high activity is obtained. Those transformants may be selected based on purposes. However, when an improved enzyme is selected under stringent conditions, a transformant with high activity derived from a Rhodococcus strain is preferred.

(183) Introducing a recombinant vector into a bacterium is not limited to any specific method as long as DNA is introduced into the bacterium. For example, a method using calcium ions, electroporation or the like may be employed.

(184) When yeast is used as a host, examples are Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris and the like. As a method for introducing a recombinant vector into yeast, it is not limited specifically as long as DNA is introduced into the yeast. For example, an electroporation method, spheroplast method, lithium acetate method or the like may be employed.

(185) When animal cells are used as a host, monkey cells COS-7, Vero, CHO cells, mouse L cells, rat GH3 cells, human FL cells or the like may be employed. As a method for introducing a recombinant vector into animal cells, for example, an electroporation method, calcium phosphate method, lipofection method or the like may be used.

(186) When insect cells are used as a host, Sf9 cells, Sf21 cells or the like may be used. A method for introducing a recombinant vector into insect cells, for example, a calcium phosphate method, lipofection method, electroporation method or the like may be used.

(187) When plant cells are used as a host, tobacco BY-2 cells or the like may be used. However, that is not the only option. A method for introducing a recombinant vector into plant cells, for example, an Agrobacterium method, particle gun method, PEG method, electroporation method or the like may be used.

(188) (d) Method for Producing Culture and Improved Nitrile Hydratase

(189) An improved nitrile hydratase of the present invention is obtained by incubating the above transformant and by collecting from the obtained culture.

(190) The present invention also relates to a method for producing an improved nitrile hydratase, and the method is characterized by collecting an improved nitrile hydratase from the culture above.

(191) In the present invention, “culture” means any of culture supernatant, cell cultured cell, bacterial-cell culture, and cell homogenates or bacterial-cell homogenates. To incubate a transformant of the present invention, a generally used method for incubating a host is used. The target nitrile hydratase is accumulated in the culture.

(192) As for a culture to incubate a transformant of the present invention, a natural or synthetic culture medium is used as long as it contains a carbon source, a nitrogen source, inorganic salts or the like for the host bacteria to assimilate, and incubation of a transformant is performed efficiently. Examples of a carbon source are carbohydrates such as glucose, galactose, fructose, sucrose, raffinose and starch; organic acids such as acetic acid and propionic acid; alcohols such as ethanol and propanol; and the like. Examples of a nitrogen source are inorganic acids such as ammonia, ammonium chloride, ammonium sulfate, ammonium acetate and ammonium phosphate; ammonium salts of organic acids; and other nitrogen-containing compounds.

(193) In addition, peptone, yeast extract, meat extract, corn steep liquor, various amino acids or the like may also be used. Examples of minerals are monopotassium phosphate, potassium dihydrogenphosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, zinc sulfate, copper sulfate, calcium carbonate and the like. Also, if necessary, a defoaming agent may be used to prevent foaming during the incubation process. Moreover, cobalt ions or iron ions as prosthetic molecules of a nitrile hydratase, or nitriles and amides as an inducer of the enzyme, may also be added to the culture.

(194) Incubation may be conducted by adding selective pressure to prevent the vector and the target gene from being eliminated. Namely, if a selection marker is a drug-resistant gene, a corresponding chemical agent may be added; or if a selection marker is an auxotrophic complementary gene, corresponding nutrition factors may be removed.

(195) Also, if a selection marker has a genetic assimilation trait, an equivalent assimilation factor may be added as a sole factor if necessary. For example, when E. coli transformed by a vector containing an ampicillin-resistant gene is incubated, ampicillin may be added as needed during the incubation process.

(196) When incubating a transformant transformed by an expression vector containing an inducible promoter, such an inducer may be added to the culture if necessary. For example, when incubating a transformant transformed by an expression vector with a promoter inducible with isopropyl-β-D-thiogalactopyranoside (IPTG), IPTG or the like may be added to the culture. Likewise, when incubating a transformant transformed by an expression vector with a trp promoter inducible with indoleacetic acid (IAA), IAA or the like may be added to the culture.

(197) Incubation conditions of a transformant are not limited specifically as long as the productivity of the target nitrile hydratase and growth of the host are not prohibited. Generally, conditions are preferred to be 10° C.˜40° C., more preferably 20° C.˜37° C., for 5˜100 hours. The pH value is adjusted using inorganic or organic acid, alkaline solution or the like. If it is an E. coli, the pH is adjusted to be 6˜9.

(198) As for incubation methods, solid-state culture, static culture, shaking culture, aeration-agitation culture and the like may be used. When an E. coli transformant is incubated, it is especially preferred to use shaking culture or aeration-agitation culture (jar fermentation) under aerobic conditions.

(199) When incubated in culture conditions above, the improved nitrile hydratase of the present invention is accumulated at a high yield in the above culture medium, namely, at least in any of culture supernatant, cell culture, bacterial-cell culture, cell homogenates or bacterial-cell homogenates.

(200) When an improved nitrile hydratase is incubated and produced in a cell or bacterial cell, the target nitrile hydratase is collected by homogenizing the cells or bacterial cells. Cells or bacterial cells are homogenized by high-pressure treatment using a French press or homogenizer, supersonic treatment, grinding treatment using glass beads or the like, enzyme treatment using lysozyme, cellulose, pectinase and the like, freezing and thawing treatment, hypotonic solution treatment, bacteriolysis induction treatment by phage, and so on.

(201) After the homogenization process, residues of cell homogenates or bacterial-cell homogenates (including insoluble fractions of the cell extract) are removed if necessary. To remove residues, centrifugal or filtration methods are employed. To increase the efficiency of removing residues, a coagulant or filter aid may be used. The supernatant obtained after the removal of residues is soluble fractions of the cell extract, which are used as a crudely purified improved nitrile hydratase solution.

(202) Also, when an improved nitrile hydratase is produced in a bacterial cell or in cells, it is an option to collect the bacterial cell or the cells themselves by a centrifuge or membrane filtration and to use without homogenizing them.

(203) When an improved nitrile hydratase is produced outside cells or bacterial cells, the culture may be used as is, or the cells or bacterial cells are removed using a centrifugal or filtration method. Then, the improved nitrile hydratase is collected from the culture by being extracted through ammonium sulfate precipitation, if necessary. Furthermore, dialysis or various chromatography techniques (gel filtration, ion exchange chromatography, affinity chromatography, etc.) may be used to isolate and purify the nitrile hydratase.

(204) To check the production yield of a nitrile hydratase obtained by incubating a transformant is not limited to using any specific method, but SDS-PAGE (polyacrylamide gel electrophoresis), nitrile hydratase activity measurements or the like may be used to determine the yield per culture, per wet or dry weight in a bacterial cell, or per crude enzymatic protein. SDS-PAGE may be conducted by a method well known by a person skilled in the art. Also, the activity described above may be applied to nitrile hydratase activity.

(205) Without using any living cells, an improved nitrile hydratase of the present invention may be produced using a cell-free protein synthesis system.

(206) In a cell-free protein synthesis system, a protein is produced in an artificial vessel such as a test tube using a cell extract. A cell-free protein synthesis system used in the present application includes a cell-free transcription system that synthesizes RNA using DNA as a template.

(207) In such a case, an organism corresponding to the above host is the organism from which the cell extract is derived. Here, for the cell extract, extracts of eukaryotic or prokaryotic origin, such as the extract from wheat germ, E. coli and the like, may be used. Such cell extracts may be concentrated or not.

(208) The cell extract is obtained by ultrafiltration, dialysis, polyethylene glycol (PEG) precipitation or the like. In the present invention, a commercially available kit may also be used for cell-free protein synthesis. Examples of such a kit are a reagent kit PROTEIOS™ (Toyobo), TNT™ system (Promega KK), a synthesizer PG-Mate™ (Toyobo), RTS (Roche Diagnostics) and the like.

(209) An improved nitrile hydratase obtained by cell-free protein synthesis as described above is also purified by properly selecting a chromatography type.

(210) 2. Method for Producing Amide Compound

(211) The improved nitrile hydratase obtained above is used as an enzymatic catalyst for material production. For example, an amide compound is produced by bringing a nitrile compound into contact with the improved nitrile hydratase. Then, the amide compound produced upon contact is collected. Accordingly, an amide compound is produced.

(212) The isolated and purified nitrile hydratase as described above is used as an enzymatic catalyst. In addition, a gene is introduced so as to express an improved nitrile hydratase in a proper host as described above and the culture after the host is incubated or the processed products of the culture may also be used. Processed products are, for example, incubated cells immobilized with acrylamide gel or the like, those processed by glutaraldehyde, those supported by inorganic carriers such as alumina, silica, zeolite, diatomaceous earth and the like.

(213) Here, “contact” means that an improved nitrile hydratase and a nitrile compound are present in the same reaction system or incubation system: for example, an isolated and purified improved nitrile hydratase and a nitrile compound are mixed; a nitrile compound is added into a incubation vessel of a cell to express an improved nitrile hydratase gene; cells are incubated in the presence of a nitrile compound; a cell extract is mixed with a nitrile compound; and so on.

(214) A nitrile compound as a substrate is selected by considering the substrate specificity of the enzyme, stability of the enzyme in the substrate and the like. As for a nitrile compound, acrylonitrile is preferred. The reaction method and the method for collecting an amide compound after the completion of reactions are properly selected depending on the characteristics of the substrate and the enzymatic catalyst.

(215) The enzymatic catalyst is preferred to be recycled as long as its activity is not deactivated. From the viewpoint of preventing deactivation and of recycling ease, the enzymatic catalyst is preferred to be used as a processed product.

EXAMPLES

(216) In the following, examples of the present invention are described in detail. However, the present invention is not limited to those. Rhodococcus rhodochrous J1 strain is registered under accession number “FERM BP-1478” at the International Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology (Central 6, 1-1-1 Higashi, Tsukuba, Ibaraki), deposited Sep. 18, 1987.

Preparation Example 1

Preparation of Plasmid pSJ034

(217) As a template to perform the amino-acid substitution of the present invention, plasmid pSJ034 (FIG. 1) having the nitrile hydratase gene of the J1 strain was produced by the following method.

(218) Plasmid pSJ034 is capable of expressing nitrile hydratase in a Rhodococcus strain. Plasmid pSJ034 was produced from pSJ023 by the method disclosed in JP publication H10-337185. Namely, partially cleaved at the XbaI site and ligated with the Sse8387I linker, plasmid pSJ033 was prepared so that one XbaI site of plasmid pSJ023 was substituted with Sse8387I. Next, plasmid pSJ033 was partially cleaved at the Sse8387I site, and a Klenow fragment was used to blunt the ends so as to cause self ligation. Accordingly, plasmid pSJ034 was obtained. Here, pSJ023 is a transformant “R. rhodochrous ATCC 12674/pSJ023,” and is internationally registered under accession number “FERM BP-6232” at the International Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology (Central 6, 1-1-1 Higashi, Tsukuba, Ibaraki), deposited Mar. 4, 1997.

Preparation Example 2

Preparation of Plasmid pFR005

(219) (1) Construction of Mutant Gene Library

(220) As for a template plasmid, pER855A (FIG. 5) was used, prepared by modifying plasmid pER855 (see JP publication 2010-172295) as follows: counted downstream from the N-terminal amino-acid residue of the amino-acid sequence (SEQ ID NO: 2) in the β subunit, an amino-acid residue at position 167 was mutated from asparagine (N) to serine (S); an amino-acid residue at position 219 was mutated from valine (V) to alanine (A); an amino-acid residue at position 57 was mutated from serine (S) to methionine (M); an amino-acid residue at position 114 was mutated from lysine (K) to tyrosine (Y); and an amino-acid residue at position 107 was mutated from threonine (T) to lysine (K).

(221) First, introduction of a mutation into the nitrile hydratase gene was conducted as follows:

(222) <Composition of PCR Reaction Mixture>

(223) TABLE-US-00005 sterile water 20 μL pER855A (1 ng/mL)  1 μL Forward primer (10 mM)  2 μL Reverse primer (10 mM)  2 μL PrimeSTAR MAX (2x) 25 μL total 50 μL
<PCR Reaction Conditions>
(98° C. for 10 sec, 55° C. for 5 sec, 72° C. for 90 sec)×30 cycles
<Primers> Primers for Saturation Mutagenesis at β17

(224) TABLE-US-00006 β17RM-F: (SEQ ID NO: 63) ggatacggaccggtcNNStatcagaaggacgag β17RM-R: (SEQ ID NO: 64) ctcgtccttctgataSNNgaccggtccgtatcc
<Reaction Conditions>
(94° C. for 30 sec, 65° C. for 30 sec, 72° C. for 3 min)×30 cycles

(225) After the completion of PCR, 5 μL of the reaction mixture was provided for 0.7% agarose gel electrophoresis, an amplified fragment of 11 kb was confirmed, and 1 μL DpnI (provided with the kit) was added to the PCR reaction mixture, which was then reacted at 37° C. for an hour. Accordingly, the template plasmid was removed. After that, the reaction mixture was purified using Wizard SV Gel and PCR Clean-Up System (Promega KK), and transformation was introduced into JM109 using the purified PCR reaction product. A few thousand obtained colonies were collected from the plate, and plasmid DNA was extracted using QIAprep Spin Miniprep Kit (Qiagen) to construct a mutant gene library.

(226) (2) Producing Rhodococcus Transformant

(227) The cells of Rhodococcus rhodochrous strain ATCC 12674 at a logarithmic growth phase were collected by a centrifugal separator, washed with ice-cooled sterile water three times and suspended in the sterile water. Then, 1 μL of plasmid prepared in (2) above and 10 μL of the bacterial-cell suspension were mixed and ice-cooled. The plasmid DNA and the bacterial-cell suspension were supplied into a cuvette, and electric pulse treatment was conducted at 2.0 KV and 200Ω using an electroporation device, Gene Pulser II (Bio-Rad Laboratories, Inc.).

(228) The cuvette with the mixture processed by electric pulse was let stand for 10 minutes under ice-cold conditions, and a heat-shock treatment was conducted at 37° C. for 10 minutes. Then, 500 μL of an MYK culture medium (0.5% polypeptone, 0.3% Bacto yeast extract, 0.3% Bacto malt extract, 0.2% K.sub.2HPO.sub.4, 0.2% KH.sub.2PO.sub.4) was added and let stand at 30° C. for 5 hours, and the strain was then applied on an MYK agar medium containing 50 μg/mL kanamycin. The colony obtained after being incubated at 30° C. for 3 days was used as a transformant. In the same manner, transformant pER 855A was prepared as a comparative strain.

(229) (3) Amide Treatment on Rhodococcus Strain Transformant

(230) The Rhodococcus transformant containing nitrile hydratase gene, obtained in (2) above and ATCC 12674/pER855A as a comparative strain were used for screening. In a 96-hole deep-well plate, 1 mL each of a GGPK culture medium (1.5% glucose, 1% sodium glutamate, 0.1% yeast extract, 0.05% K.sub.2HPO.sub.4, 0.05% KH.sub.2P O.sub.4, 0.05% MgSO.sub.4.7H.sub.2O, 1% CoCl.sub.2, 0.1% urea, 50 μg/mL kanamycin, pH 7.2) was supplied. In each culture medium, the above strain was inoculated, and subjected to liquid culture at 30° C. for 3 days.

(231) Next, 30 μL of the liquid culture obtained above was dispensed in a 96-hole plate and the culture medium was removed by centrifugation. Lastly, 40 μL of a 50% acrylamide solution was added to suspend the bacteria. The transformant suspended in a high-concentration acrylamide solution was put in an incubator to completely deactivate the comparative strain through heat treatment conducted at 50° C. for 30 minutes. The remaining nitrile hydratase activity was measured as follows.

(232) First, after the acrylamide treatment, a transformant was washed with a 50 mM phosphate buffer (pH 7.0) and the activity was measured by the following method. The washed transformant and 50 mM phosphate buffer (pH 7.0) were supplied to a test tube and preincubated at 30° C. for 10 minutes, and an equivalent volume of a 5% acrylonitrile solution (pH 7.0) was added and reacted for 10 minutes. Then, one tenth volume of 1 M phosphoric acid was added to terminate the reaction. Next, the transformant was removed from the terminated reaction mixture by centrifugation, and the mixture was diluted to a proper concentration for analysis by HPLC (WAKOSIL 5C8 (Wako Pure Chemical Industries) 250 mm long, 10% acetonitrile containing 5 mM phosphoric acid, flow rate of mobile phase at 1 mL/min, wavelength of a UV absorption detector 260 nm). Using untreated cells for which acrylamide treatment was not conducted, activity was measured for comparison. Then, based on the obtained activity values, the remaining activity after acrylamide treatment was determined.

(233) Among hundreds of transformants containing a mutant nitrile hydratase gene obtained above, mutant enzyme pFR005 showing resistance to a high-concentration acrylamide was selected.

(234) (4) Confirming Base Sequence

(235) To confirm the base sequence of the nitrile hydratase gene, plasmid was recovered from the selected strains. Rhodococcus transformants were inoculated in 10 mL of an MYK culture medium (0.5% polypeptone, 0.3% Bacto yeast extract, 0.3% malt extract, 1% glucose, 50 μg/mL kanamycin) and incubated for 24 hours, and a 20% sterile glycine solution was added to make the final concentration of 2%, and further incubated for another 24 hours. Then, the bacterial cells were recovered by centrifugation, washed with a TES buffer (10 mM Tris-HCl (pH 8)-10 mM NaCl-1 mM EDTA), suspended in 2 mL of 50 mM Tris-HCl (pH8)-12.5% sucrose-100 mM NaCl-1 mg/mL lysozyme, and subjected to shaking culture at 37° C. for 3 hours. Then, 0.4 mL of 10% SDS was added and the mixture was shaken gently for an hour at room temperature, to which 2.1 mL of 5 M sodium acetate buffer (pH 5.2) was added and let stand in ice for an hour. Next, the mixture was centrifuged for an hour at 10,000×g at 4° C. to obtain a supernatant, to which a 5-times volume ethanol was added and let stand at −20° C. for 30 minutes. Then, the mixture was centrifuged at 10,000×g for 20 minutes. The precipitate was washed with 10 mL of 70% ethanol and dissolved in 100 μL of a TE buffer. Accordingly, a DNA solution was obtained.

(236) Next, the sequence including nitrile hydratase was amplified by a PCR method.

(237) <Composition of PCR Reaction Mixture>

(238) TABLE-US-00007 template plasmid 1 μL 10x PCR buffer (made by NEB) 10 μL  primer NH-19 (50 μM) 1 μL primer NH-20 (50 μM) 1 μL 2.5 mM dNTPmix 8 μL sterile water 79 μL  Taq DNA polymerase (made by NEB) 1 μL
<Primers>

(239) TABLE-US-00008 NH-19: (SEQ ID NO: 65) GCCTCTAGATATCGCCATTCCGTTGCCGG NH-20: (SEQ ID NO: 66) ACCCTGCAGGCTCGGCGCACCGGATGCCCAC
<Reaction Conditions>
(94° C. for 30 sec, 65° C. for 30 sec, 72° C. for 3 min)×30 cycles

(240) After completion of PCR, 5 μL of the reaction mixture was subjected to 0.7% agarose gel electrophoresis to detect a 2.5 kb PCR amplified product. After Exo-SAP treatment (Amersham Pharmacia Biotech) on the PCR reaction mixture, samples for alignment analysis were prepared by a cycle sequencing method, and were analyzed using CEQ-2000XL (Beckman Coulter). As a result, the mutation positions of pFR005 were confirmed to be Nβ167S, Vβ219A, Sβ57M, Kβ114Y, Tβ107K and Pβ17G. Namely, in plasmid pFR005, proline at position 17 in the β subunit was mutated to glycine, serine at position 57 in the β subunit was mutated to lysine, tyrosine at position 107 in the β subunit was mutated to lysine, lysine at position 114 in the β subunit was mutated to tyrosine, asparagine at position 167 in the β subunit was mutated to serine, and valine at position 219 in the β subunit was mutated to alanine.

Example 1

Preparation of Improved Nitrile Hydratase

(241) Using pSJ034 formed in preparation example 1, amino-acid substitution was conducted. The following composition of a reaction mixture, reaction conditions and primers were used for the PCR.

(242) <Composition of PCR Reaction Mixture>

(243) TABLE-US-00009 sterile water 20 μL pSJ034 (1 ng/mL)  1 μL Forward primer (10 mM)  2 μL Reverse primer (10 mM)  2 μL PrimeSTAR MAX (2x) 25 μL total 50 μL
<PCR Reaction Conditions>
(98° C. for 10 sec, 55° C. for 5 sec, 72° C. for 90 sec)×30 cycles
<Primers>

(244) TABLE-US-00010 TABLE 5 SEQ substituted name of ID amino acid primer sequence NO C β48C-F TCGTGGTGCGACAAGTCGCGGTTCTTC 13 β48C-R CTTGTCGCACCACGATATGCCCTTGAG 14 D β48D-F TCGTGGGACGACAAGTCGCGGTTCTTC 15 β48D-R CTTGTCGTCCCACGATATGCCCTTGAG 16 E β48E-F TCGTGGGAGGACAAGTCGCGGTTCTTC 17 β48E-R CTTGTCCTCCCACGATATGCCCTTGAG 18 H β48H-F TCGTGGCACGACAAGTCGCGGTTCTTC 19 β48H-R CTTGTCGTGCCACGATATGCCCTTGAG 20 I β48I-F TCGTGGATCGACAAGTCGCGGTTCTTC 21 β48I-R CTTGTCGATCCACGATATGCCCTTGAG 22 K β48K-F TCGTGGAAGGACAAGTCGCGGTTCTTC 23 β48K-R CTTGTCCTTCCACGATATGCCCTTGAG 24 M β48M-F TCGTGGATGGACAAGTCGCGGTTCTTC 25 β48M-R CTTGTCCATCCACGATATGCCCTTGAG 26 N β48N-F TCGTGGAACGACAAGTCGCGGTTCTTC 27 β48N-R CTTGTCGTTCCACGATATGCCCTTGAG 28 P β48P-F TCGTGGCCGGACAAGTCGCGGTTCTTC 29 β48P-R CTTGTCCGGCCACGATATGCCCTTGAG 30 Q β48Q-F TCGTGGCAGGACAAGTCGCGGTTCTTC 31 β48Q-R CTTGTCCTGCCACGATATGCCCTTGAG 32 S β48S-F TCGTGGTCCGACAAGTCGCGGTTCTTC 33 β48S-R CTTGTCGGACCACGATATGCCCTTGAG 34 T β48T-F TCGTGGACCGACAAGTCGCGGTTCTTC 35 β48T-R CTTGTCGGTCCACGATATGCCCTTGAG 36

(245) After the completion of PCR, 5 μL of the reaction mixture was subjected to 0.7% agarose gel electrophoresis and an 11-kb PCR amplified product was detected. Then, 1 μL of DpnI (provided in the kit) was added to the PCR reaction mixture and reacted at 37° C. for an hour to remove the template plasmid. After the reaction was completed, the reaction mixture was purified using Wizard SV Gel and PCR Clean-Up System (made by Promega KK), and the purified PCR product was used to transform JM109. From the obtained culture, plasmid DNA was extracted using QIAprep Spin Miniprep Kit (made by Qiagen), and the base sequence of the nitrile hydratase was confirmed using automated sequencer CEQ 8000 (made by Beckman Coulter, Inc.). Obtained plasmids were named as follows.

(246) TABLE-US-00011 TABLE 6 name of plasmid amino-acid substitution pSJ102 Wβ48C pSJ103 Wβ48D pSJ104 Wβ48E pSJ107 Wβ48H pSJ108 Wβ48I pSJ109 Wβ48K pSJ111 Wβ48M pSJ112 Wβ48N pSJ113 Wβ48P pSJ114 Wβ48Q pSJ116 Wβ48S pSJ117 Wβ48T

Example 2

Preparation of Rhodococcus Transformant

(247) Cells of Rhodococcus rhodochrous strain ATCC 12674 in a logarithmic growth phase were collected using a centrifuge, washed three times with ice-cold sterile water, and suspended in the sterile water. Then, 1 μL of plasmid prepared in example 1 and 10 μL of the bacterial-cell suspension were mixed and ice-cooled. The DNA and the bacterial-cell suspension were supplied in a cuvette, and electric pulse treatment was conducted using an electroporation device, Gene Pulser (Bio-Rad Laboratories), under conditions of 2.0 kV and 200Ω. The electric-pulse processed mixture was let stand in an ice-cold condition for 10 minutes, and subjected to heat shock at 37° C. for 10 minutes. After 500 μL of an MYK culture medium (0.5% polypeptone, 0.3% Bacto yeast extract, 0.3% Bacto malt extract, 0.2% K.sub.2HPO.sub.4, 0.2% KH.sub.2PO.sub.4) was added and let stand at 30° C. for 5 hours, the strain was applied onto an MYK agar culture medium containing 50 μg/mL kanamycin and incubated at 30° C. for 3 days. The obtained colony after incubating at 30° C. for 3 days was used as a transformant.

(248) Each transformant obtained above was inoculated into an MYK culture medium (50 μg/mL kanamycin), and subjected to shaking culture at 30° C. for 2 days. Then, 1% culture was inoculated into a GGPK culture medium (1.5% glucose, 1% sodium glutamate, 0.1% yeast extract, 0.05% K.sub.2HPO.sub.4, 0.05% KH.sub.2P O.sub.4, 0.05% Mg.sub.2O.sub.4.7H.sub.2O, 1% CoCl.sub.2, 0.1% urea, 50 μg/mL kanamycin, pH 7.2), and subjected to shaking culture at 30° C. for 3 days. Bacterial cells were collected by using a centrifuge, and were washed with a 100 mM phosphate buffer (pH 7.0) to prepare a bacterial-cell suspension.

Example 3

Improved Nitrile Hydratase Activity

(249) The nitrile hydratase activity in the obtained bacterial-cell suspension was measured by the following method: 0.2 mL of the bacterial-cell mixture and 4.8 mL of a 50 mM phosphate buffer (pH 7.0) were mixed, to which 5 mL of a 50 mM phosphate buffer (pH 7.0) containing 5.0% (w/v) acrylonitrile was further added. Next, the mixture was reacted while being shaken at 10° C. for 10 minutes. Then, bacterial cells were filtered and the amount of produced acrylamide was determined using gas chromatography.

(250) <Analysis Conditions>

(251) analysis instrument: gas chromatograph GC-14B (Shimadzu Corporation) detector: FID (detection at 200° C.) column: 1 m glass column filled with PoraPak PS (column filler made by Waters Corp.) column temperature: 190° C.

(252) Nitrile hydratase activity was determined by conversion from the amount of acrylamide. Here, regarding nitrile hydratase activity, the amount of enzyme to produce 1 μmol of acrylamide per 1 minute is set as 1 U. Table 7 shows relative activities when the parent strain activity without amino-acid substitution was set at 1.0.

(253) TABLE-US-00012 TABLE 7 Measurement results of catalytic activity amino-acid name of catalytic activity substitution plasmid (relative value) none (parent strain) pSJ034 1.0 (comp. example) Wβ48D pSJ103 1.2 Wβ48E pSJ104 1.6 Wβ48K pSJ109 1.1 Wβ48M pSJ111 3.1 Wβ48N pSJ112 1.8 Wβ48P pSJ113 2.0 Wβ48S pSJ116 1.1 Wβ48T pSJ117 1.3

(254) From the results above, enhanced enzymatic activity was confirmed in the improved nitrile hydratase in which an amino acid at position 48 in the β subunit was substituted with aspartic acid, lysine, asparagine, proline, serine or threonine.

Example 4

Preparation and Evaluation of Improved Nitrile Hydratase

(255) Plasmid pFR005 formed in preparation example 2 as a template plasmid was used to substitute an amino acid at position 48 of the β subunit.

(256) Namely, using the method in example 1, each of the improved nitrile hydratases with a substituted amino acid were prepared, and a transformant was obtained by the method in example 2. Further, the enzymatic activity was measured by the same method in example 3. The results are shown in Table 8.

(257) TABLE-US-00013 TABLE 8 Measurement results of catalytic activity name catalytic activity of plasmid amino-acid substitution (relative value) pFR005 Pβ17G, Sβ57K, Tβ107K, Kβ114Y, 1.0 (comp. Nβ167S, Vβ219A example) pER1102 Pβ17G, Sβ57K, Tβ107K, Kβ114Y, 1.6 Nβ167S, Vβ219A, Wβ48C pER1103 Pβ17G, Sβ57K, Tβ107K, Kβ114Y, 1.7 Nβ167S, Vβ219A, Wβ48D pER1104 Pβ17G, Sβ57K, Tβ107K, Kβ114Y, 1.3 Nβ167S, Vβ219A, Wβ48E pER1107 Pβ17G, Sβ57K, Tβ107K, Kβ114Y, 1.2 Nβ167S, Vβ219A, Wβ48H pER1108 Pβ17G, Sβ57K, Tβ107K, Kβ114Y, 1.6 Nβ167S, Vβ219A, Wβ48I pER1109 Pβ17G, Sβ57K, Tβ107K, Kβ114Y, 1.4 Nβ167S, Vβ219A, Wβ48K pER1112 Pβ17G, Sβ57K, Tβ107K, Kβ114Y, 3.7 Nβ167S, Vβ219A, Wβ48M pER1113 Pβ17G, Sβ57K, Tβ107K, Kβ114Y, 1.7 Nβ167S, Vβ219A, Wβ48N pER1114 Pβ17G, Sβ57K, Tβ107K, Kβ114Y, 1.7 Nβ167S, Vβ219A, Wβ48P pER1116 Pβ17G, Sβ57K, Tβ107K, Kβ114Y, 1.9 Nβ167S, Vβ219A, Wβ48Q pER1117 Pβ17G, Sβ57K, Tβ107K, Kβ114Y, 1.8 Nβ167S, Vβ219A, Wβ48S pER1119 Pβ17G, Sβ57K, Tβ107K, Kβ114Y, 1.1 Nβ167S, Vβ219A, Wβ48T

(258) From the results above, the same enzymatic activity was confirmed in the mutant nitrile hydratase when the amino acid at X.sub.4 (corresponding to an amino acid at position 48 in the β subunit) in the amino-acid sequence shown in SEQ ID NO: 50 was substituted with an amino acid selected from among cysteine, glutamic acid, aspartic acid, histidine, isoleucine, lysine, methionine, asparagine, proline, glutamine, serine and threonine.

Example 5

SDS-Polyacrylamide Gel Electrophoresis

(259) Using a sonicator VP-300 (TAITEC Corporation), the bacterial-cell suspension prepared in example 2 was homogenized for 10 minutes while being ice-cooled. Next, the bacterial-cell homogenate was centrifuged at 13500 rpm for 30 minutes and a cell-free extract was obtained from the supernatant. After the protein content of the cell extract was measured using a Bio-Rad protein assay kit, the cell extract was mixed with a polyacrylamide gel electrophoresis sample buffer (0.1 M Tris-HCl (pH 6.8), 4% w/v SDS, 12% v/v β mercaptoethanol, 20% v/v glycerol, and a trace of bromophenol blue), and boiled for 5 minutes for denaturation. A 10% acrylamide gel was prepared and denatured samples were applied to have an equivalent protein mass per one lane to conduct electrophoresis analysis (FIG. 4).

(260) As a result, since hardly any difference was observed in the band strength of nitrile hydratase in all the samples, the expressed amount of nitrile hydratase was found to be the same. Accordingly, the enzymatic specific activity was found to be attributed to the improved enzymatic activity.

Example 6

Preparation of Transformant Containing Nitrile Hydratase Derived from Rhodococcus Rhodochrous M8 Strain (Hereinafter Referred to as M8 Strain)

(261) (1) Preparation of Chromosomal DNA from M8 Strain

(262) The M8 strain (SU 1731814) is obtained from the Russian Institute of Microorganism Biochemistry and Physiology (VKPM S-926). In 100 mL of an MYK culture medium (0.5% polypeptone, 0.3% Bacto yeast extract, 0.3% Bacto malt extract, 0.2% K.sub.2HPO.sub.4, 0.2% KH.sub.2PO.sub.4, pH 7.0), the M8 strain was subjected to shaking culture at 30° C. for 72 hours. The culture mixture was centrifuged, and the collected bacterial cells were suspended in 4 mL of a Saline-EDTA solution (0.1 M EDTA, 0.15 M NaCl, pH 8.0). Then, 8 mg of lysozyme was added to the suspension, which was shaken at 37° C. for 1˜2 hours and was frozen at −20° C.

(263) Next, 10 mL of Tris-SDS solution (1% SDS, 0.1M NaCl, 0.1 M Tris-HCl (pH 9.0)) was added to the suspension while the suspension was gently shaken. Proteinase K (Merck KGaA) was further added (final concentration of 0.1 mg) and shaken at 37° C. for 1 hour. Next, an equivalent volume of TE saturated phenol was added, agitated (TE: 10 mM Tris-HCl, 1 mM EDTA (pH 8.0)) and then centrifuged. The supernatant was collected and a double volume of ethanol was added and DNA strands were wrapped around a glass rod. Then, the phenol was removed through centrifugation by successively adding 90%, 80%, and 70% ethanol.

(264) Next, the DNA was dissolved in a 3 mL TE buffer, to which a Ribonuclease A solution (processed at 100° C. for 15 minutes) was added to have a 10 μg/mL concentration and shaken at 37° C. for 30 minutes. Proteinase K (Merck KGaA) was further added and shaken at 37° C. for 30 minutes. After an equivalent volume of TE saturated phenol was added and centrifuged, the mixture was separated into upper and lower layers.

(265) An equivalent volume of TE saturated phenol was further added to the upper layer and centrifuged to separate into upper and lower layers. Such a process was repeated. Then, an equivalent volume of chloroform (containing 4% isoamyl alcohol) was added, centrifuged and the upper layer was collected. Then, a double volume of ethanol was added to the upper layer and the DNA strands were collected by wrapping them around a glass rod. Accordingly, chromosomal DNA was obtained.

(266) (2) Using PCR, Preparation of Improved Nitrile Hydratase from Chromosomal DNA Derived from M8 Strain

(267) The nitrile hydratase derived from the M8 strain is described in a non-patent publication (Veiko, V. P. et al., “Cloning, Nucleotide Sequence of Nitrile Hydratase Gene from Rhodococcus rhodochrous M8,” Russian Biotechnology (Mosc.) 5, 3˜5 (1995)). The sequences of β subunit, α subunit and activator are respectively identified in SEQ ID NOs: 37, 38 and 39. Based on the sequence information, primers of SEQ ID numbers 40 and 41 in the sequence listing were synthesized and PCR was performed using the chromosomal DNA prepared in step (1) above as a template.

(268) <Composition of PCR Reaction Mixture>

(269) TABLE-US-00014 sterile water 20 μL template DNA (chromosomal DNA)  1 μL primer M8-1 (10 mM)  2 μL primer M8-2 (10 mM)  2 μL PrimeSTAR MAX (2x) 25 μL total 50 μL
<Primers>

(270) TABLE-US-00015 M8-1: (SEQ ID NO: 40) GGTCTAGAATGGATGGTATCCACGACACAGGC M8-2: (SEQ ID NO: 41) cccctgcaggtcagtcgatgatggccatcgattc
<Reaction Conditions>
(98° C. for 10 sec, 55° C. for 5 sec, 72° C. for 30 sec)×30 cycles

(271) After the completion of PCR, 5 μL of the reaction mixture was subjected to 0.7% agarose gel electrophoresis (0.7 wt. % Agarose I, made by Doj in Chemical Co., Ltd.) and an amplified fragment of 1.6 kb was detected. The reacted mixture was purified using Wizard SV gel and PCR Clean-Up System (Promega KK).

(272) Next, the collected PCR product was coupled with a vector (pUC118/Hinc II site) using a ligation kit (made by Takara Shuzo Co., Ltd.) so that competent cells of E. coli JM109 were transformed using the reaction mixture. A few clones from the obtained transformant colony were inoculated into 1.5 mL of an LB-Amp culture medium, and incubated at 37° C. for 12 hours while being shaken. After incubation was finished, the bacterial cells were collected from the culture through centrifugation. Plasmid DNA was extracted from the collected bacterial cells using QIAprep Spin Miniprep Kit (Qiagen). The base sequence of nitrile hydratase in the obtained plasmid DNA was confirmed using a sequencing kit and automated sequencer CEQ 8000 (Beckman Coulter, Inc.) (SEQ ID NO: 62).

(273) Next, the obtained plasmid DNA was cleaved with restriction enzymes XbaI and Sse8387I, and subjected to 0.7% agarose gel electrophoresis so as to collect a nitrile hydratase gene fragment (1.6 kb), which was then inserted into XbaI-Sse8387I site of plasmid pSJ042. The obtained plasmid was named pSJ-NO1A. Here, pSJ042 as a plasmid capable of expressing nitrile hydratase in Rhodococcus J1 strain was prepared by a method described in JP publication 2008-154552 (the content is incorporated in this application by reference). Plasmid pSJ023 used for preparation of pSJ042 is registered as transformant ATCC 12674/pSJ023 (FERM BP-6232) at the International Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology (Central 6, 1-1-1 Higashi, Tsukuba, Ibaraki), deposited Mar. 4, 1997.

Example 7

Preparation and Evaluation of Improved Nitrile Hydratase

(274) Using plasmid pSJ-NO1A obtained in example 6, the amino acid at position 48 of the β subunit was substituted. The same method in example 1 was employed for amino-acid substitution to prepare an improved nitrile hydratase. Next, using the same method in example 3, a transformant of Rhodococcus rhodochrous ATCC 12674 strain and its bacterial-cell suspension were prepared. Then, the enzymatic activity was measured by the same method as in example 4. The results are shown in Table 9.

(275) TABLE-US-00016 TABLE 9 Measurement results of catalytic activity catalytic activity name of plasmid amino-acid substitution (relative value) pSJ-N01A none (parent strain) 1.0 (comp. example) pSJR13 Wβ48M 2.4 pSJR21 Wβ48N 2.3

(276) From the results in table 9, when the amino acid at position 48 of the β subunit was substituted, the enzymatic activity of the improved nitrile hydratase was confirmed to be enhanced the same as in example 3.

Example 8

Preparation of Improved Nitrile Hydratase

(277) Using plasmid pSJ034 formed in preparation example 1, amino-acid substitution was conducted. The following composition of reaction mixture, reaction conditions and primers shown in table 2 were used for the PCR.

(278) <Composition of PCR Reaction Mixture>

(279) TABLE-US-00017 sterile water 20 μL pSJ034 (1 ng/mL)  1 μL Forward primer (10 mM)  2 μL Reverse primer (10 mM)  2 μL PrimeSTAR MAX (2x) 25 μL total 50 μL
<PCR Reaction Conditions>
(98° C. for 10 sec, 55° C. for 5 sec, 72° C. for 90 sec)×30 cycles
<Primers>

(280) TABLE-US-00018 TABLE 10 SEQ substituted name of ID amino acid primer sequence NO A β37A-F GTCAATTGCGACTTGGATGCATCTCAAG 67 β37A-R CCAAGTCGCAATTGACAGGGTCCGACC 68 D β37D-F GTCAATTGACACTTGGATGCATCTCAAG 69 β37D-R CCAAGTGTCAATTGACAGGGTCCGACC 70 F β37F-F GTCAATTTTCACTTGGATGCATCTCAAG 71 β37F-R CCAAGTGAAAATTGACAGGGTCCGACC 72 I β37I-F GTCAATTATCACTTGGATGCATCTCAAG 73 β37I-R CCAAGTGATAATTGACAGGGTCCGACC 74 M β37M-F GTCAATTATGACTTGGATGCATCTCAAG 75 β37M-R CCAAGTCATAATTGACAGGGTCCGACC 76 T β37T-F GTCAATTACCACTTGGATGCATCTCAAG 77 β37T-R CCAAGTGGTAATTGACAGGGTCCGACC 78 V β37V-F GTCAATTGTCACTTGGATGCATCTCAAG 79 β37V-R CCAAGTGACAATTGACAGGGTCCGACC 80

(281) After the completion of PCR, 5 μL of the reaction mixture was subjected to 0.7% agarose gel electrophoresis and an amplified fragment of 1 kb was confirmed. Then, 1 μL of DpnI (provided with a kit) was added to the PCR reaction mixture and reacted at 37° C. for an hour to remove the template plasmid. The reacted mixture was purified using Wizard SV gel and PCR Clean-Up System (Promega), and JM109 was transformed using the purified PCR reaction product. Then, a plasmid DNA was extracted from the obtained culture using QIAprep Spin Miniprep Kit (Qiagen), and the base sequence of the nitrile hydratase was confirmed using an automated sequencer CEQ 8000 (Beckman Coulter, Inc.) Obtained plasmids were named as shown in Table 11.

(282) TABLE-US-00019 TABLE 11 name of plasmid amino-acid substitution pSJ120 Lβ37A pSJ122 Lβ37D pSJ124 Lβ37F pSJ127 Lβ37I pSJ129 Lβ37L pSJ130 Lβ37M pSJ136 Lβ37T pSJ137 Lβ37V

Example 9

Preparation of Rhodococcus Transformant

(283) Cells of Rhodococcus rhodochrous ATCC 12674 strain in a logarithmic growth phase were collected using a centrifuge, washed three times with ice-cold sterile water, and suspended in the sterile water. Then, 1 μL of plasmid prepared in example 1 and 10 μL of the bacterial-cell suspension were mixed and ice-cooled. The DNA and the bacterial-cell suspension were supplied in a cuvette, and electric pulse treatment was conducted using an electroporation device, Gene Pulser (Bio-Rad Laboratories), under conditions of 2.0 kV and 200Ω. The electric-pulse processed mixture was let stand in an ice-cold condition for 10 minutes, and subjected to heat shock at 37° C. for 10 minutes. After 500 μL of an MYK culture medium (0.5% polypeptone, 0.3% Bacto yeast extract, 0.3% Bacto malt extract, 0.2% K.sub.2HPO.sub.4, 0.2% KH.sub.2PO.sub.4) was added and let stand at 30° C. for 5 hours, and applied onto an MYK agar culture medium containing 50 μg/mL kanamycin and incubated at 30° C. for 3 days. The obtained colony after incubating at 30° C. for 3 days was used as a transformant.

(284) Each transformant obtained above was inoculated into an MYK culture medium (50 μg/mL kanamycin), and subjected to shaking culture at 30° C. for 2 days. Then, 1% culture was each inoculated into a GGPK culture medium (1.5% glucose, 1% sodium glutamate, 0.1% yeast extract, 0.05% K.sub.2HPO.sub.4, 0.05% KH.sub.2PO.sub.4, 0.05% Mg.sub.2O.sub.4.7H.sub.2O, 1% CoCl.sub.2, 0.1% urea, 50 μg/mL kanamycin, pH 7.2), and shaking culture was performed at 30° C. for 3 days. Bacterial cells were collected by using a centrifuge and were washed with a 100 mM phosphate buffer (pH 7.0) to prepare a bacterial-cell suspension.

Example 10

Improved Nitrile Hydratase Activity

(285) The nitrile hydratase activity in the obtained bacterial-cell suspension was measured by the following method: 0.2 mL of the bacterial-cell mixture and 4.8 mL of a 50 mM phosphate buffer (pH 7.0) were mixed, to which 5 mL of a 50 mM phosphate buffer (pH 7.0) containing 5.0% (w/v) acrylonitrile was further added. Next, the mixture was reacted while being shaken at 10° C. for 10 minutes. Then, bacterial cells were filtered and the amount of produced acrylamide was determined using gas chromatography.

(286) <Analysis Conditions>

(287) analysis instrument: gas chromatograph GC-14D (Shimadzu Corporation) detector: FID (detection at 200° C.) column: 1 m glass column filled with PoraPak PS (column filler made by Waters Corp.) column temperature: 190° C.

(288) Nitrile hydratase activity was determined by conversion from the amount of acrylamide. Here, regarding nitrile hydratase activity, the amount of enzyme to produce 1 μmol of acrylamide per 1 minute is set as 1 U. Table 12 shows relative activities when the parent strain activity without amino-acid substitution was set at 1.0.

(289) TABLE-US-00020 TABLE 12 amino-acid name of catalytic activity substitution plasmid (relative value) none (parent strain) pSJ034 1.0 (comp. example) Lβ37A pSJ120 1.3 Lβ37D pSJ122 1.5 Lβ37F pSJ124 1.2 Lβ37I pSJ127 1.2 Lβ37M pSJ130 1.2 Lβ37T pSJ136 1.2 Lβ37V pSJ137 1.3

(290) From the results above, enhanced enzymatic activity was confirmed in the enzyme in which an amino acid at position 37 in the β subunit was substituted with an amino acid selected from among alanine, valine, asparagine, threonine, phenylalanine, isoleucine and methionine.

Example 11

SDS-Polyacrylamide Gel Electrophoresis

(291) Using a sonicator VP-300 (TAITEC Corporation), the bacterial-cell suspension prepared in example 2 was homogenized for 10 minutes while it was ice-cooled. Next, the bacterial-cell homogenate was centrifuged at 13500 rpm for 30 minutes and a cell-free extract was obtained from the supernatant. After the protein content of the cell extract was measured using a Bio-Rad protein assay kit, the cell extract was mixed with a polyacrylamide gel electrophoresis sample buffer (0.1 M Tris-HCl (pH 6.8), 4% w/v of SDS, 12% v/v of β mercaptoethanol, 20% v/v of glycerol, and a trace of bromophenol blue), and boiled for 5 minutes for denaturation. A 10% acrylamide gel was prepared, and denatured samples were applied to have an equivalent protein mass per one lane to conduct electrophoresis analysis.

(292) As a result, since hardly any difference was observed in the band strength of nitrile hydratase in all the samples, the expressed amount of nitrile hydratase was found the same. Accordingly, enzymatic specific activity was found to be attributed to be the improved enzymatic activity.

Example 12

Preparation and Evaluation of Improved Nitrile Hydratase

(293) Plasmid pFR005 below was used as a template plasmid substitute an amino acid at position 37 of the β subunit.

(294) Namely, using the method in example 1, an improved nitrile hydratase with a substituted amino acid was prepared, and a transformant of Rhodococcus rhodochrous ATCC 12674 strain and its bacterial-cell suspension were obtained by the method in example 2. Further, the enzymatic activity was measured by the same method in example 3. The results are shown in Table 13.

(295) TABLE-US-00021 TABLE 13 catalytic activity name of plasmid amino-acid substitution (relative value) pFR005 Pβ17G, Sβ57K, Nβ167S, Tβ107K, 1.0 (comp. Kβ114Y, Vβ219A example) pER1121 Pβ17G, Sβ57K, Nβ167S, Tβ107K, 1.6 Kβ114Y, Vβ219A, Lβ37A pER1140 Pβ17G, Sβ57K, Nβ167S, Tβ107K, 1.3 Kβ114Y, Vβ219A, Lβ37D

(296) From the results above, the amino-acid substitution according to the present invention applies not only to a wild-type nitrile hydratase but to a mutant nitrile hydratase to exhibit the same effects.

Example 13

Preparation of Improved Nitrile Hydratase

(297) Using pSJ034 formed in preparation example 1, amino-acid substitution was conducted. The following composition of a reaction mixture, reaction conditions and primers shown in Table 14 were used for the PCR.

(298) <Composition of PCR Reaction Mixture>

(299) TABLE-US-00022 sterile water 20 μL pSJ034 (1 ng/mL) 1 μL Forward primer (10 mM) 2 μL Reverse primer (10 mM) 2 μL PrimeSTAR MAX (2×) 25 μL total 50 μL
<PCR Reaction Conditions>
(98° C. for 10 sec, 55° C. for 5 sec, 72° C. for 90 sec)×30 cycles
<Primers>

(300) TABLE-US-00023 TABLE 14 SEQ substituted name of ID amino acid primer Sequence NO A α83A-F GGTGAGGCGGCACACCAAATTTCGGCG  83 α83A-R GTGTGCCGCCTCACCGGCATAGCCC  84 C α83C-F GGTGAGTGCGCACACCAAATTTCGGCG  85 α83C-R GTGTGCGCACTCACCGGCATAGCCC  86 D α83D-F GGTGAGGACGCACACCAAATTTCGGCG  87 α83D-R GTGTGCGTCCTCACCGGCATAGCCC  88 E α83E-F GGTGAGGAGGCACACCAAATTTCGGCG  89 α83E-R GTGTGCCTCCTCACCGGCATAGCCC  90 F α83F-F GGTGAGTTCGCACACCAAATTTCGGCG  91 α83F-R GTGTGCGAACTCACCGGCATAGCCC  92 G α83G-F GGTGAGGACGCACACCAAATTTCGGCG  93 α83G-R GTGTGCGCCCTCACCGGCATAGCCC  94 H α83H-F GGTGAGCACGCACACCAAATTTCGGCG  95 α83H-R GTGTGCGTGCTCACCGGCATAGCCC  96 M α83M-F GGTGAGATGGCACACCAAATTTCGGCG  97 α83M-R GTGTGCCATCTCACCGGCATAGCCC  98 P α83P-F GGTGAGCCGGCACACCAAATTTCGGCG  99 α83P-R GTGTGCCGGCTCACCGGCATAGCCC 100 S α83S-F GGTGAGTCCGCACACCAAATTTCGGCG 101 α83S-R GTGTGCGGACTCACCGGCATAGCCC 102 T α83T-F GGTGAGACCGCACACCAAATTTCGGCG 103 α83T-R GTGTGCGGTCTCACCGGCATAGCCC 104

(301) After the completion of PCR, 5 μL of the reaction mixture was subjected to 0.7% agarose gel electrophoresis and an amplified fragment of 11 kb was confirmed. Then, 1 μL of DpnI (provided with a kit) was added to the PCR reaction mixture and reacted at 37° C. for an hour to remove the template plasmid. The reacted mixture was purified using Wizard SV gel and PCR Clean-Up System (Promega), and JM109 was transformed using the purified PCR reaction product. Then, a plasmid DNA was extracted from the obtained culture using QIAprep Spin Miniprep Kit (Qiagen), and the base sequence of the nitrile hydratase was confirmed using an automated sequencer CEQ 8000 (Beckman Coulter, Inc.) Obtained plasmids were named as shown in Table 15.

(302) TABLE-US-00024 TABLE 15 name of plasmid amino-acid substitution pSJ127 Qα83A pSJ152 Qα83C pSJ153 Qα83D pSJ154 Qα83E pSJ155 Qα83F pSJ156 Qα83G pSJ157 Qα83H pSJ130 Qα83M pSJ132 Qα83N pSJ159 Qα83P pSJ161 Qα83S pSJ162 Qα83T

Example 14

Preparation of Rhodococcus Transformant

(303) Cells of Rhodococcus rhodochrous strain ATCC 12674 in a logarithmic growth phase were collected using a centrifuge, washed three times with ice-cold sterile water, and suspended in the sterile water. Then, 1 μL of plasmid prepared in example 1 and 10 μL of the bacterial-cell suspension were mixed and ice-cooled. The DNA and the bacterial-cell suspension were supplied in a cuvette, and electric pulse treatment was conducted using an electroporation device, Gene Pulser (Bio-Rad Laboratories), under conditions of 2.0 kV and 200Ω. The electric-pulse processed mixture was let stand in an ice-cold condition for 10 minutes, and subjected to heat shock at 37° C. for 10 minutes. After 500 μL of an MYK culture medium (0.5% polypeptone, 0.3% Bacto yeast extract, 0.3% Bacto malt extract, 0.2% K.sub.2HPO.sub.4, 0.2% KH.sub.2PO.sub.4) was added and let stand at 30° C. for 5 hours, and applied onto an MYK agar culture medium containing 50 μg/mL kanamycin and incubated at 30° C. for 3 days. The obtained colony after incubating at 30° C. for 3 days was used as a transformant.

(304) Each transformant obtained above were inoculated into an MYK culture medium (50 μg/mL kanamycin), and subjected to shaking culture at 30° C. for 2 days. Then, 1% culture was inoculated into a GGPK culture medium (1.5% glucose, 1% sodium glutamate, 0.1% yeast extract, 0.05% K.sub.2HPO.sub.4, 0.05% KH.sub.2P O.sub.4, 0.05% Mg.sub.2O.sub.4.7H.sub.2O, 1% CoCl.sub.2, 0.1% urea, 50 μg/mL kanamycin, pH 7.2), and shaking culture was performed at 30° C. for 3 days. Then, bacterial cells were collected by using a centrifuge and were washed with a 100 mM phosphate buffer (pH 7.0) to prepare a bacterial-cell suspension.

Example 15

Improved Nitrile Hydratase Activity

(305) The nitrile hydratase activity in the obtained bacterial-cell suspension was measured by the following method: 0.2 mL of the bacterial-cell mixture and 4.8 mL of a 50 mM phosphate buffer (pH 7.0) were mixed, to which 5 mL of a 50 mM phosphate buffer (pH 7.0) containing 5.0% (w/v) acrylonitrile was further added. Next, the mixture was reacted while being shaken at 10° C. for 10 minutes. Then, bacterial cells were filtered and the amount of produced acrylamide was determined using gas chromatography.

(306) <Analysis Conditions>

(307) analysis instrument: gas chromatograph GC-14B (Shimadzu Corporation) detector: FID (detection at 200° C.) column: 1 m glass column filled with PoraPak PS (column filler made by Waters Corp.) column temperature: 190° C.

(308) Nitrile hydratase activity was determined by conversion from the amount of acrylamide. Here, regarding nitrile hydratase activity, the amount of enzyme to produce 1 μmol of acrylamide per 1 minute is set as 1 U. Table 16 shows relative activities when the parent strain activity without amino-acid substitution was set at 1.0.

(309) TABLE-US-00025 TABLE 16 catalytic activity name of plasmid amino-acid substitution (relative value) pSJ034 none (parent strain) 1.0 (comp. example) pSJ127 Qα83A 5.3 pSJ152 Qα83C 3.7 pSJ153 Qα83D 1.9 pSJ154 Qα83E 1.2 pSJ155 Qα83F 1.8 pSJ156 Qα83G 4.4 pSJ157 Qα83H 1.9 pSJ130 Qα83M 2.3 pSJ132 Qα83N 5.7 pSJ159 Qα83P 1.5 pSJ161 Qα83S 5.8 pSJ162 Qα83T 3.8

(310) From the results above, enhanced enzymatic activity was confirmed in the enzyme in which an amino acid at position 83 in the α subunit was substituted with an amino acid selected from among alanine, aspartic acid, phenylalanine, histidine, methionine and asparagine.

Example 16

Preparation and Evaluation of Improved Nitrile Hydratase

(311) Plasmid pFR005 formed below was used as a template plasmid to substitute an amino acid at position 83 of the α subunit.

(312) Namely, using the method in example 1, an improved nitrile hydratase with a substituted amino acid was prepared, and a transformant of Rhodococcus rhodochrous strain ATCC 12674 and its bacterial-cell suspension were obtained by the method in example 2. Further, the enzymatic activity was measured by the same method in example 3. The results are shown in Table 17.

(313) TABLE-US-00026 TABLE 17 name of catalytic activity plasmid amino-acid substitution (relative value) pFR005 Pβ17G, Sβ57K, Tβ107K, Kβ114Y, 1.0 (comp. Nβ167S, Vβ219A example) pER1127 Pβ17G, Sβ57K, Tβ107K, Kβ114Y, 5.1 Nβ167S, Vβ219A, Qα83A pER1129 Pβ17G, Sβ57K, Tβ107K, Kβ114Y, 1.9 Nβ167S, Vβ219A, Qα37L pER1130 Pβ17G, Sβ57K, Tβ107K, Kβ114Y, 2.7 Nβ167S, Vβ219A, Qα83M pER1132 Pβ17G, Sβ57K, Tβ107K, Kβ114Y, 4.8 Nβ167S, Vβ219A, Qα37N

(314) From the results above, the amino-acid substitution according to the present invention applies not only to a wild-type nitrie hydratase but to a mutant nitrile hydratase to exhibit the same effects.

Example 17

Preparation of Transformant Containing Nitrile Hydratase Derived from Rhodococcus Rhodochrous M8 Strain (Hereinafter Referred to as M8 Strain)

(315) (1) Preparation of Chromosomal DNA from M8 Strain

(316) The M8 strain (SU 1731814) is obtained from Russian Institute of Microorganism Biochemistry and Physiology (VKPM S-926). In a 100 mL MYK culture medium (0.5% polypeptone, 0.3% Bacto yeast extract, 0.3% Bacto malt extract, 0.2% K.sub.2HPO.sub.4, 0.2% KH.sub.2PO.sub.4, pH 7.0), the M8 strain was subjected to shaking culture at 30° C. for 72 hours. The culture mixture was centrifuged, and the collected bacterial cells were suspended in 4 mL of Saline-EDTA solution (0.1 M EDTA, 0.15 M NaCl, pH 8.0). Then, 8 mg of lysozyme was added to the suspension, which was shaken at 37° C. for 1˜2 hours and was frozen at −20° C.

(317) Next, 10 mL of Tris-SDS solution (1% SDS, 0.1M NaCl, 0.1 M Tris-HCl (pH 9.0)) was added to the suspension while the suspension was gently shaken. Proteinase K (Merck KGaA) was further added (final concentration of 0.1 mg) and shaken at 37° C. for 1 hour. Next, an equivalent volume of TE saturated phenol was added, agitated (TE: 10 mM Tris-HCl, 1 mM EDTA (pH 8.0)) and then centrifuged. The supernatant was collected, a double volume of ethanol was added and DNA strands were wrapped around a glass rod. Then, the phenol was removed through centrifugation by successively adding 90%, 80%, and 70% ethanol.

(318) Next, the DNA was dissolved in a 3 mL TE buffer, to which a Ribonuclease A solution (processed at 100° C. for 15 minutes) was added to have a 10 μg/mL concentration and shaken at 37° C. for 30 minutes. Proteinase K (Merck KGaA) was further added and shaken at 37° C. for 30 minutes. After an equivalent volume of TE saturated phenol was added and centrifuged, the mixture was separated into upper and lower layers.

(319) An equivalent volume of TE saturated phenol was further added to the upper layer and centrifuged to separate into upper and lower layers. Such a process was repeated. Then, an equivalent volume of chloroform (containing 4% isoamyl alcohol) was added, centrifuged and the upper layer was collected. Then, a double volume of ethanol was added and the DNA strands were collected by wrapping them around a glass rod. Accordingly, chromosomal DNA was obtained.

(320) (2) Using PCR, Preparation of Improved Nitrile Hydratase from Chromosomal DNA Derived from the M8 Strain

(321) The nitrile hydratase derived from the M8 strain is described in a non-patent publication (Veiko, V. P. et al., “Cloning, Nucleotide Sequence of Nitrile Hydratase Gene from Rhodococcus rhodochrous M8,” Russian Biotechnology (Mosc.) 5, 3-5 (1995)). The sequences of β subunit and α subunit are respectively identified as SEQ ID NOs: 17 and 18. Based on the sequence information, primers of SEQ ID NOs: 115 and 116 in the sequence listing were synthesized and PCR was performed using the chromosomal DNA prepared in step (1) above as a template.

(322) <Composition of PCR Reaction Mixture>

(323) TABLE-US-00027 sterile water 20 μL template DNA (chromosomal DNA) 1 μL primer M8-1 (10 mM) 2 μL primer M8-2 (10 mM) 2 μL PrimeSTAR MAX (2×) 25 μL total 50 μL
<Primers>

(324) TABLE-US-00028 M8-1: (SEQ ID NO: 115) GGTCTAGAATGGATGGTATCCACGACACAGGC M8-2: (SEQ ID NO: 116) CCCCTGCAGGTCAGTCGATGATGGCCATCGATTC
<PCR Reaction Conditions>
(98° C. for 10 sec, 55° C. for 5 sec, 72° C. for 30 sec)×30 cycles

(325) After completion of PCR, 5 μL of the reaction mixture was subjected to 0.7% agarose gel electrophoresis (0.7 wt. % Agarose I, made by Dojin Chemical Co., Ltd.) and an amplified fragment of 1.6 kb was detected. The reacted mixture was purified using Wizard SV gel and PCR Clean-Up System (Promega KK).

(326) Next, the collected PCR product was coupled with a vector (pUC118/Hinc II site) using a ligation kit (made by Takara Shuzo Co., Ltd.) so that competent cells of E. coli JM109 were transformed using the reaction mixture. A few clones from the obtained transformant colonies were inoculated into 1.5 mL of an LB-Amp culture medium, and subjected to shaking culture at 37° C. for 12 hours. After incubation was finished, the bacterial cells were collected from the culture through centrifugation. A plasmid DNA was extracted from the collected bacterial cells using QIAprep Spin Miniprep Kit (Qiagen). The base sequence of nitrile hydratase in the obtained plasmid DNA was confirmed using a sequencing kit and automated sequencer CEQ 8000 (Beckman Coulter, Inc.).

(327) Next, the obtained plasmid DNA was cleaved at restriction enzyme XbaI and Sse8387I, and subjected to 0.7% agarose gel electrophoresis so as to collect nitrile hydratase gene fragments (1.6 kb), which were then introduced into XbaI-Sse8387I site of plasmid pSJ042. The obtained plasmid was named pSJ-NO1A. Here, pSJ042 as a plasmid capable of expressing nitrile hydratase in Rhodococcus J1 strain was prepared by a method described in JP publication 2008˜154552. Plasmid pSJ023 used for preparation of pSJ042 is registered as transformant ATCC 12674/pSJ023 (FERM BP-6232) at the International Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology (Central 6, 1-1-1 Higashi, Tsukuba, Ibaraki), deposited Mar. 4, 1997.

Example 18

Preparation and Evaluation of Improved Nitrile Hydratase

(328) Using plasmid pSJ-NO1A obtained in example 5, the amino acid at position 83 of the α subunit was substituted. The same method as in example 1 was employed for amino-acid substitution to prepare an improved nitrile hydratase. Next, using the same method as in example 2, a transformant of Rhodococcus rhodochrous ATCC 12674 strain and its bacterial-cell suspension were prepared. Then, the enzymatic activity was measured by the same method as in example 4. The results are shown in Table 18.

(329) TABLE-US-00029 TABLE 18 catalytic activity name of plasmid amino-acid substitution (relative value) pSJ-N01A none (parent strain) 1.0 (comp. example) pSJR17 Qα83M 6.9

(330) From the results above, pSJR17 in which the amino acid at position 83 of the α subunit was substituted with methionine was found to have an enhanced enzymatic activity the same as in example 4.

Example 19

Preparation of Improved Nitrile Hydratase

(331) Using plasmid pSJ034 formed in preparation example 1, amino-acid substitution was conducted. The following composition of a reaction mixture, reaction conditions and primers were used for the PCR.

(332) <Composition of PCR Reaction Mixture>

(333) TABLE-US-00030 sterile water 20 μL pSJ034 (1 ng/mL) 1 μL Forward primer (10 mM) 2 μL Reverse primer (10 mM) 2 μL PrimeSTAR MAX (2×) 25 μL total 50 μL
<PCR Reaction Conditions>
(98° C. for 10 sec, 55° C. for 5 sec, 72° C. for 90 sec)×30 cycles
<Primers> Saturation Mutagenesis for α82

(334) TABLE-US-00031 α82RM-F: (SEQ ID NO: 129) ATGCCGGTNNSCAGGCACACCAAATTT α82RM-R: (SEQ ID NO: 130) TGTGCCTGSNNACCGGCATAGCCCAAT

(335) After the completion of PCR, 5 μL of the reaction mixture was subjected to 0.7% agarose gel electrophoresis and an amplified fragment of 1 kb was confirmed. Then, 1 μL of DpnI (provided with a kit) was added to the PCR reaction mixture and reacted at 37° C. for an hour to remove the template plasmid. The reacted mixture was purified using Wizard SV gel and PCR Clean-Up System (Promega), and JM109 was transformed using the purified PCR reaction product. Then, a plasmid DNA was extracted from the obtained culture using QIAprep Spin Miniprep Kit (Qiagen), and the base sequence of the nitrile hydratase was confirmed using an automated sequencer CEQ 8000 (Beckman Coulter, Inc.) Obtained plasmids were named as shown in Table 19.

(336) TABLE-US-00032 TABLE 19 name of plasmid amino-acid substitution pSJ173 Eα82C pSJ174 Eα82F pSJ175 Eα82H pSJ176 Eα82I pSJ177 Eα82K pSJ178 Eα82M pSJ179 Eα82Q pSJ180 Eα82R pSJ181 Eα82T pSJ182 Eα82Y

Example 20

Preparation of Rhodococcus Transformant

(337) Cells of Rhodococcus rhodochrous ATCC 12674 strain in a logarithmic growth phase were collected using a centrifuge, washed three times with ice-cold sterile water, and suspended in the sterile water. Then, 1 μL of plasmid prepared in example 2 and 10 μL of the bacterial-cell suspension were mixed and ice-cooled. The DNA and the bacterial-cell suspension were supplied in a cuvette, and electric pulse treatment was conducted using an electroporation device, Gene Pulser (Bio-Rad Laboratories), under conditions of 2.0 kV and 200). The electric-pulse processed mixture was let stand in an ice-cold condition for 10 minutes, and subjected to heat shock at 37° C. for 10 minutes. After 500 μL of an MYK culture medium (0.5% polypeptone, 0.3% Bacto yeast extract, 0.3% Bacto malt extract, 0.2% K.sub.2HPO.sub.4, 0.2% KH.sub.2PO.sub.4) was added and let stand at 30° C. for 5 hours, and applied onto an MYK agar culture medium containing 50 μg/mL kanamycin and incubated at 30° C. for 3 days. The obtained colony after incubating at 30° C. for 3 days was used as a transformant.

(338) Each transformant obtained above was inoculated into an MYK culture medium (50 kanamycin), subjected to shaking culture at 30° C. for 2 days. Then, 1% culture was inoculated into a GGPK culture medium (1.5% glucose, 1% sodium glutamate, 0.1% yeast extract, 0.05% K.sub.2HPO.sub.4, 0.05% KH.sub.2PO.sub.4, 0.05% Mg.sub.2O.sub.4′7H.sub.2O, 1% CoCl.sub.2, 0.1% urea, 50 μg/mL kanamycin, pH 7.2), and subjected to shaking culture at 30° C. for 3 days. Then, bacterial cells were collected by using a centrifuge and were washed with a 100 mM phosphate buffer (pH 7.0) to prepare a bacterial-cell suspension.

Example 21

Improved Nitrile Hydratase Activity

(339) The nitrile hydratase activity in the obtained bacterial-cell suspension was measured by the following method.

(340) After 0.2 mL of the bacterial-cell mixture and 4.8 mL of a 50 mM phosphate buffer (pH 7.0) were mixed, 5 mL of a 50 mM phosphate buffer (pH 7.0) containing 5.0% (w/v) acrylonitrile was further added, and the mixture was reacted while being shaken at 10° C. for 10 minutes. Then, bacterial cells were filtered and the amount of produced acrylamide was determined by gas chromatography.

(341) <Analysis Conditions>

(342) analysis instrument: gas chromatograph GC2014 (Shimadzu Corporation) detector: FID (detection at 200° C.) column: 1 m glass column filled with PoraPak PS (column filler made by Waters Corp.) column temperature: 190° C.

(343) Nitrile hydratase activity was determined by conversion from the amount of acrylamide. Here, regarding nitrile hydratase activity, the amount of enzyme to produce 1 μmol of acrylamide per 1 minute is set as 1 U. Table 20 shows relative activities when the parent strain activity without amino-acid substitution was set at 1.0.

(344) TABLE-US-00033 TABLE 20 catalytic activity name of plasmid amino-acid substitution (relative value) pSJ042 none (parent strain) 1.0 (comp. example) pSJ173 Eα82C 2.6 pSJ174 Eα82F 4.3 pSJ175 Eα82H 1.3 pSJ176 Eα82I 3.6 pSJ177 Eα82K 4.2 pSJ178 Eα82M 3.6 pSJ179 Eα82Q 2.3 pSJ180 Eα82R 4.2 pSJ181 Eα82T 1.2 pSJ182 Eα82Y 2.1

(345) From the results above, enhanced enzymatic activity was confirmed in the enzyme in which an amino acid at position 82 in the α subunit was substituted with an amino acid selected from among cysteine, phenylalanine, histidine, isoleucine, lysine, methionine, glutamine, arginine, threonine and tyrosine.

Example 22

SDS-Polyacrylamide Gel Electrophoresis

(346) Using a sonicator VP-300 (TAITEC Corporation), the bacterial-cell suspension prepared in example 3 was homogenized for 10 minutes while being ice-cooled. Next, the bacterial-cell homogenate was centrifuged at 13500 rpm for 30 minutes and a cell-free extract was obtained from the supernatant. After the protein content of the cell extract was measured using a Bio-Rad protein assay kit, the cell extract was mixed with a polyacrylamide gel electrophoresis sample buffer (0.1 M Tris-HCl (pH 6.8), 4% w/v SDS, 12% v/v β mercaptoethanol, 20% v/v glycerol, and a trace of bromophenol blue), and boiled for 5 minutes for denaturation. A 10% acrylamide gel was prepared, and denatured samples were applied to have an equivalent protein mass per one lane to conduct electrophoresis analysis.

(347) As a result, since hardly any difference was observed in the band strength of nitrile hydratase in all the samples, the expressed amount of nitrile hydratase was found the same. Accordingly, enzymatic specific activity was found to be attributed to the improved enzymatic activity.

Example 23

Preparation of Improved Nitrile Hydratase

(348) Using plasmid pSJ034 formed in preparation example 1, amino-acid substitution was conducted. The following composition of a reaction mixture, reaction conditions and primers were used for the PCR.

(349) <Composition of PCR Reaction Mixture>

(350) TABLE-US-00034 sterile water 20 μL pSJ034 (1 ng/mL) 1 μL Forward primer (10 mM) 2 μL Reverse primer (10 mM) 2 μL PrimeSTAR MAX (2×) 25 μL total 50 μL
<PCR Reaction Conditions>
(98° C. for 10 sec, 55° C. for 5 sec, 72° C. for 90 sec)×30 cycles
<Primers>
saturation mutagenesis primer for α85

(351) TABLE-US-00035 α85RM-F: (SEQ ID NO: 133) CAGGCANNSCAAATTTCGGCGGTCTTC α85RM-R: (SEQ ID NO: 134) AATTTGSNNTGCCTGCTCACCGGCATA

(352) After the completion of PCR, 5 μL of the reaction mixture was subjected to 0.7% agarose gel electrophoresis and an amplified fragment of 1 kb was confirmed. Then, 1 μL of DpnI (provided with a kit) was added to the PCR reaction mixture and reacted at 37° C. for an hour to remove the template plasmid. The reacted mixture was purified using Wizard SV gel and PCR Clean-Up System (Promega), and JM109 was transformed using the purified PCR reaction product. Then, a plasmid DNA was extracted from the obtained culture using QIAprep Spin Miniprep Kit (Qiagen), and the base sequence of the nitrile hydratase was confirmed using an automated sequencer CEQ 8000 (Beckman Coulter, Inc.) Obtained plasmids were named as shown in Table 21.

(353) TABLE-US-00036 TABLE 21 name of plasmid amino-acid substitution pSJ165 Hα85C pSJ166 Hα85E pSJ167 Hα85F pSJ168 Hα85I pSJ169 Hα85N pSJ170 Hα85Q pSJ171 Hα85S pSJ172 Hα85Y

Example 24

Preparation of Rhodococcus Transformant

(354) Cells of Rhodococcus rhodochrous ATCC 12674 strain in a logarithmic growth phase were collected using a centrifuge, washed three times with ice-cold sterile water, and suspended in the sterile water. Then, 1 μL of plasmid prepared in example 2 and 10 μL of the bacterial-cell suspension were mixed and ice-cooled. The DNA and the bacterial-cell suspension were supplied in a cuvette, and electric pulse treatment was conducted using an electroporation device, Gene Pulser (Bio-Rad Laboratories), under conditions of 2.0 kV and 200Ω. The electric-pulse processed mixture was let stand in an ice-cold condition for 10 minutes, and subjected to heat shock at 37° C. for 10 minutes. After 500 μL of an MYK culture medium (0.5% polypeptone, 0.3% Bacto yeast extract, 0.3% Bacto malt extract, 0.2% K.sub.2HPO.sub.4, 0.2% KH.sub.2PO.sub.4) was added and let stand at 30° C. for 5 hours, and applied onto an MYK agar culture medium containing 50 μg/mL kanamycin and incubated at 30° C. for 3 days. The obtained colony after incubating at 30° C. for 3 days was used as a transformant.

(355) Each transformant obtained above was inoculated into an MYK culture medium (50 μg/mL kanamycin), and subjected to shaking culture at 30° C. for 2 days. Then, 1% culture was each inoculated into a GGPK culture medium (1.5% glucose, 1% sodium glutamate, 0.1% yeast extract, 0.05% K.sub.2HPO.sub.4, 0.05% KH.sub.2PO.sub.4, 0.05% Mg.sub.2O.sub.4.7H.sub.2O, 1% CoCl.sub.2, 0.1% urea, 50 μg/mL kanamycin, pH 7.2), and shaking culture was performed at 30° C. for 3 days. Bacterial cells were collected by using a centrifuge and were washed with a 100 mM phosphate buffer (pH 7.0) to prepare a bacterial-cell suspension.

Example 25

Improved Nitrile Hydratase Activity

(356) The nitrile hydratase activity of the bacterial-cell suspension was measure as follows.

(357) After 0.2 mL of the bacterial-cell mixture and 4.8 mL of a 50 mM phosphate buffer (pH 7.0) were mixed, 5 mL of a 50 mM phosphate buffer (pH 7.0) containing 5.0% (w/v) acrylonitrile was further added, and the mixture was reacted while being shaken at 10° C. for 10 minutes. Then, bacterial cells were filtered and the amount of produced acrylamide was determined by gas chromatography.

(358) <Analysis Conditions>

(359) analysis instrument: gas chromatograph GC2014 (Shimadzu Corporation) detector: FID (detection at 200° C.) column: 1 m glass column filled with PoraPak PS (column filler made by Waters Corp.) column temperature: 190° C.

(360) Nitrile hydratase activity was determined by conversion from the amount of acrylamide. Here, regarding nitrile hydratase activity, the amount of enzyme to produce 1 μmol of acrylamide per 1 minute is set as 1 U. Table 22 shows relative activities when the parent strain activity without amino-acid substitution was set at 1.0.

(361) TABLE-US-00037 TABLE 22 catalytic activity name of plasmid amino-acid substitution (relative value) pSJ042 none (parent strain) 1.0 (comp. example) pSJ165 Hα85C 1.5 pSJ166 Hα85E 1.9 pSJ167 Hα85F 1.8 pSJ168 Hα85I 2.1 pSJ169 Hα85N 2.3 pSJ170 Hα85Q 2.1 pSJ171 Hα85S 2.5 pSJ172 Hα85Y 1.5

(362) From the results above, enhanced enzymatic activity was confirmed in the enzyme in which an amino acid at position 85 in the α subunit was substituted with an amino acid selected from among cysteine, glutamic acid, phenylalanine, isoleucine, asparagine, glutamine, serine and tyrosine.

Example 26

SDS-Polyacrylamide Gel Electrophoresis

(363) Using a sonicator VP-300 (TAITEC Corporation), the bacterial-cell suspension prepared in example 3 was homogenized for 10 minutes while being ice-cooled. Next, the bacterial-cell homogenate was centrifuged at 13500 rpm for 30 minutes and a cell-free extract was obtained from the supernatant. After the protein content of the cell extract was measured using a Bio-Rad protein assay kit, the cell extract was mixed with a polyacrylamide gel electrophoresis sample buffer (0.1 M Tris-HCl (pH 6.8), 4% w/v SDS, 12% v/v β mercaptoethanol, 20% v/v glycerol, and a trace of bromophenol blue), and boiled for 5 minutes for denaturation. A 10% acrylamide gel was prepared, and denatured samples were applied to have an equivalent protein mass per one lane to conduct electrophoresis analysis.

(364) As a result, since hardly any difference was observed in the band strength of nitrile hydratase in all the samples, the expressed amount of nitrile hydratase was found to be the same. Accordingly, the enzymatic specific activity was found to be attributed to the improved enzymatic activity.

POTENTIAL INDUSTRIAL APPLICABILITY

(365) According to the present invention, a novel improved (mutant) nitrile hydratase is provided with enhanced catalytic activity. Such an improved nitrile hydratase with enhanced catalytic activity is very useful to produce amide compounds.

(366) According to the present invention, a nitrile hydratase is obtained from DNA encoding the improved nitrile hydratase above, a recombinant vector containing the DNA, a transformant containing the recombinant vector, and a culture of the transformant, and a method for producing such a nitrile hydratase is also provided. Moreover, a method for producing an amide compound using the protein (improved nitrile hydratase), the culture or the processed product of the culture is provided according to the present invention.

(367) According to the present invention, a novel improved (mutant) nitrile hydratase is provided with enhanced catalytic activity. Such an improved nitrile hydratase with enhanced catalytic activity is very useful to produce amide compounds.

(368) According to the present invention, a nitrile hydratase is obtained from genomic DNA encoding the improved nitrile hydratase above, a recombinant vector containing the genomic DNA, a transformant containing the recombinant vector, and a culture of the transformant, and a method for producing such a nitrile hydratase is also provided. Moreover, a method for producing an amide compound using the protein (improved nitrile hydratase), the culture or the processed product of the culture is provided according to the present invention.

(369) Accession Numbers

(370) Rhodococcus rhodochrous J1 strain is internationally registered under accession number “FERM BP-1478” at the International Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology, (Central 6, 1-1-1 Higashi, Tsukuba, Ibaraki), deposited Sep. 18, 1987.

(371) In addition, pSJ023 is a transformant “R. rhodochrous ATCC 12674/pSJ023,” and is internationally registered under accession number FERM BP-6232 at the International Patent Organism Depositary, National Institute of Advanced Industrial Science (Central 6, 1-1-1 Higashi, Tsukuba, Ibaraki), deposited Mar. 4, 1997.

DESCRIPTION OF SEQUENCE LISTING

(372) SEQ ID NO: 1 base sequence of β subunit derived from Rhodococcus rhodochrous J1 strain (FERM BP-1478) SEQ ID NO: 2 amino-acid sequence of β subunit derived from Rhodococcus rhodochrous J1 strain (FERM BP-1478) SEQ ID NO: 3 base sequence of α subunit derived from Rhodococcus rhodochrous J1 strain (FERM BP-1478) SEQ ID NO: 4 amino-acid sequence of α subunit derived from Rhodococcus rhodochrous J1 strain (FERM BP-1478) SEQ ID NO: 5 amino-acid sequence of β subunit in Rhodococcus rhodochrous M8 (SU 1731814) SEQ ID NO: 6 amino-acid sequence of β subunit in Rhodococcus ruber TH SEQ ID NO: 7 amino-acid sequence of β subunit in Rhodococcus pyridinivorans MW33 (VKM Ac-1515D) SEQ ID NO: 8 amino-acid sequence of β subunit in Rhodococcus pyridinivorans S85-2 SEQ ID NO: 9 amino-acid sequence of β subunit in Rhodococcus pyridinivorans MS-38 SEQ ID NO: 10 amino-acid sequence of β subunit in Nocardia sp. JBRs SEQ ID NO: 11 amino-acid sequence of β subunit in Nocardia sp. YS-2002 SEQ ID NO: 12 amino-acid sequence of β subunit in Rhodococcus rhodochrous ATCC 39384 SEQ ID NO: 13 β48C-F primer SEQ ID NO: 14 β48C-R primer SEQ ID NO: 15 β48D-F primer SEQ ID NO: 16 β48D-R primer SEQ ID NO: 17 β48E-F primer SEQ ID NO: 18 β48E-R primer SEQ ID NO: 19 β48H-F primer SEQ ID NO: 20 β48H-R primer SEQ ID NO: 21 β48I-F primer SEQ ID NO: 22 β48I-R primer SEQ ID NO: 23 β48K-F primer SEQ ID NO: 24 β48K-R primer SEQ ID NO: 25 β48M-F primer SEQ ID NO: 26 β48M-R primer SEQ ID NO: 27 β48N-F primer SEQ ID NO: 28 β48N-R primer SEQ ID NO: 29 β48P-F primer SEQ ID NO: 30 β48P-R primer SEQ ID NO: 31 β48Q-F primer SEQ ID NO: 32 β48Q-R primer SEQ ID NO: 33 β48S-F primer SEQ ID NO: 34 β48S-R primer SEQ ID NO: 35 β48T-F primer SEQ ID NO: 36 β48T-R primer SEQ ID NO: 37 amino-acid sequence of β subunit in nitrile hydratase derived from M8 strain SEQ ID NO: 38 amino-acid sequence of α subunit in nitrile hydratase derived from M8 strain SEQ ID NO: 39 amino-acid sequence of activator in nitrile hydratase derived from M8 strain SEQ ID NO: 40 M8-1 primer SEQ ID NO: 41 M8-2 primer SEQ ID NO: 42 amino-acid sequence of β subunit in uncultured bacterium SP1 SEQ ID NO: 43 amino-acid sequence of β subunit in uncultured bacterium BD2 SEQ ID NO: 44 amino-acid sequence of β subunit in Comamonas testosterone SEQ ID NO: 45 amino-acid sequence of β subunit in Geobacillus thermoglucosidasius Q6 SEQ ID NO: 46 amino-acid sequence of β subunit in Pseudonocardia thermophila JCM 3095 SEQ ID NO: 47 amino-acid sequence of β subunit in Rhodococcus rhodochrous Cr4 SEQ ID NO: 48 amino-acid sequence of cysteine cluster of α subunit in iron-containing nitrile hydratase SEQ ID NO: 49 amino-acid sequence in cysteine cluster of α subunit in cobalt-containing nitrile hydratase SEQ ID NO: 50 predetermined amino-acid sequence to be used in the present invention SEQ ID NO: 51 amino-acid sequence of β subunit related to the present invention SEQ ID NO: 52 amino-acid sequence of β subunit in Rhodococcus ruber RH (CN 101463358) SEQ ID NO: 53 base sequence of nitrile hydratase J1D SEQ ID NO: 54 base sequence of nitrile hydratase 203 SEQ ID NO: 55 base sequence of nitrile hydratase 414 SEQ ID NO: 56 base sequence of nitrile hydratase 855 SEQ ID NO: 57 base sequence of the α subunit in nitrile hydratase D2 SEQ ID NO: 58 base sequence of nitrile hydratase 005 SEQ ID NO: 59 base sequence of nitrile hydratase 108A SEQ ID NO: 60 base sequence of nitrile hydratase 211 SEQ ID NO: 61 base sequence of nitrile hydratase 306A SEQ ID NO: 62 base sequence of a PCR fragment containing a primer sequence at both terminal of Rhodococcus rhodochrous M8 SEQ ID NO: 63 β17RM-F primer SEQ ID NO: 64 β17RM-R primer SEQ ID NO: 65 NH-19 primer SEQ ID NO: 66 NH-20 primer SEQ ID NO: 67 β37A-F primer SEQ ID NO: 68 β37A-R primer SEQ ID NO: 69 β37D-F primer SEQ ID NO: 70 β37D-R primer SEQ ID NO: 71 β37F-F primer SEQ ID NO: 72 β37F-R primer SEQ ID NO: 73 β37I-F primer SEQ ID NO: 74 β37I-R primer SEQ ID NO: 75 β37M-F primer SEQ ID NO: 76 β37M-R primer SEQ ID NO: 77 β37T-F primer SEQ ID NO: 78 β37T-R primer SEQ ID NO: 79 β37V-F primer SEQ ID NO: 80 β37V-R primer SEQ ID NO: 81 predetermined amino-acid sequence to be used in the present invention SEQ ID NO: 82 amino-acid sequence of β subunit related to the present invention SEQ ID NO: 83 α83A-F primer SEQ ID NO: 84 α83A-R primer SEQ ID NO: 85 α83C-F primer SEQ ID NO: 86 α83C-R primer SEQ ID NO: 87 α83D-F primer SEQ ID NO: 88 α83D-R primer SEQ ID NO: 89 α83E-F primer SEQ ID NO: 90 α83E-R primer SEQ ID NO: 91 α83F-F primer SEQ ID NO: 92 α83F-R primer SEQ ID NO: 93 α83G-F primer SEQ ID NO: 94 α83G-R primer SEQ ID NO: 95 α83H-F primer SEQ ID NO: 96 α83H-R primer SEQ ID NO: 97 α83M-F primer SEQ ID NO: 98 α83M-R primer SEQ ID NO: 99 α83P-F primer SEQ ID NO: 100 α83P-R primer SEQ ID NO: 101 α83S-F primer SEQ ID NO: 102 α83S-R primer SEQ ID NO: 103 α83T-F primer SEQ ID NO: 104 α83T-R primer SEQ ID NO: 105 amino-acid sequence of α subunit in Rhodococcus rhodochrous M8 (SU 1731814) SEQ ID NO: 106 amino-acid sequence of α subunit in Rhodococcus ruber TH SEQ ID NO: 107 amino-acid sequence of α subunit in Rhodococcus pyridinivorans MW33 (VKM Ac-1515D) SEQ ID NO: 108 amino-acid sequence of α subunit in Rhodococcus pyridinivorans S85-2 SEQ ID NO: 109 amino-acid sequence of α subunit in Nocardia sp. JBRs SEQ ID NO: 110 amino-acid sequence of α subunit in Nocardia sp. YS-2002 SEQ ID NO: 111 amino-acid sequence of α subunit in uncultured bacterium BD2 SEQ ID NO: 112 amino-acid sequence of α subunit in uncultured bacterium SP1 SEQ ID NO: 113 amino-acid sequence of α subunit in Pseudonocardia thermophila JCM 3095 SEQ ID NO: 114 amino-acid sequence of α subunit in Rhodococcus rhodochrous Cr4 SEQ ID NO: 115 M8-1 primer SEQ ID NO: 116 M8-2 primer SEQ ID NO: 117 amino-acid sequence in a cysteine cluster of α subunit in iron-containing nitrile hydratase SEQ ID NO: 118 amino-acid sequence in cysteine cluster of α subunit in cobalt-containing nitrile hydratase SEQ ID NO: 119 predetermined amino-acid sequence to be used in the present invention SEQ ID NO: 120 amino-acid sequence of α subunit related to the present invention SEQ ID NO: 121 amino-acid sequence of α subunit in Rhodococcus pyridinivorans MS-38 SEQ ID NO: 122 amino-acid sequence of α subunit in Rhodococcus rhodochrous ATCC 39384 SEQ ID NO: 123 amino-acid sequence of α subunit in Sinorhizobium medicae WSM419 SEQ ID NO: 124 amino-acid sequence of α subunit in Geobacillus thermoglucosidasius Q6 SEQ ID NO: 125 amino-acid sequence of α subunit in Comamonas testosterone SEQ ID NO: 126 amino-acid sequence of α subunit in Rhodococcus ruber RH (CN 101463358) SEQ ID NO: 127 α83N-F primer SEQ ID NO: 128 α83N-R primer SEQ ID NO: 129 α82RM-F primer SEQ ID NO: 130 α82RM-R primer SEQ ID NO: 131 amino-acid sequence of α subunit related to the present invention SEQ ID NO: 132 predetermined amino-acid sequence to be used in the present invention SEQ ID NO: 133 α85RM-F primer SEQ ID NO: 134 α85RM-R primer SEQ ID NO: 135 amino-acid sequence of α subunit related to the present invention SEQ ID NO: 136 predetermined amino-acid sequence to be used in the present invention