Nucleic acid particles, methods and use thereof
09737557 · 2017-08-22
Assignee
Inventors
Cpc classification
C12N2320/32
CHEMISTRY; METALLURGY
A61K31/713
HUMAN NECESSITIES
C12N15/111
CHEMISTRY; METALLURGY
A61K9/50
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
C12N15/88
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12P19/34
CHEMISTRY; METALLURGY
International classification
A61K31/713
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K9/16
HUMAN NECESSITIES
C12N15/88
CHEMISTRY; METALLURGY
A61K9/50
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
Abstract
The present invention provides, among other things, a particle which includes a core comprised of self-assembled one or more nucleic acid molecules, the core being characterized by an ability to adopt at least two configurations: a first configuration having a first greatest dimension greater than 2 μm and; a second configuration having a second greatest dimension less than 500 nm, wherein addition of a film coating converts the core from its first configuration to its second configuration. Methods of making and using of provided particles are also disclosed.
Claims
1. A particle, comprising: a core, comprising one or more self-assembled nucleic acid molecules in a crystalline structure comprising a lamellar sheet, wherein addition of a film coating to the particle converts the core from a first configuration to a second configuration, wherein the first configuration has a first greatest dimension that is greater than 2 μm and; the second configuration has a second greatest dimension that is less than 500 nm.
2. The particle of claim 1, wherein the core contains a single nucleic acid molecule.
3. The particle of claim 1, wherein the core comprises a plurality of nucleic acid molecules.
4. The particle of claim 3, wherein the nucleic acid molecules have different nucleic acid sequences.
5. The particle of claim 3, wherein all nucleic acid molecules within the core have substantially the same nucleic acid sequence.
6. The particle of claim 3, wherein the nucleic acid molecules within the core have sequences that share at least one common sequence element.
7. The particle of claim 1, wherein at least one nucleic acid molecule within the core has a nucleotide sequence that comprises multiple copies of at least a first sequence element.
8. The particle of claim 1, wherein at least one nucleic acid molecule within the core has a nucleotide sequence that comprises multiple copies of each of at least a first and a second sequence element.
9. The particle of claim 8, wherein the at least one nucleic acid molecule has a nucleotide sequence that comprises alternating copies of the first and second sequence elements.
10. The particle of claim 8, wherein the at least one nucleic acid molecule has a nucleotide sequence that comprises multiple copies of each of three or more sequence elements.
11. The particle of claim 1, wherein at least one nucleic acid molecule has a nucleotide sequence that includes one or more sequence elements found in a natural source.
12. The particle of claim 11, wherein the at least one nucleic acid molecule has a nucleotide sequence that includes a first sequence element that is found in a first natural source and a second sequence element that is found in a second natural source.
13. The particle of claim 12, wherein the first and second natural sources are the same.
14. The particle of claim 12, wherein the first and second natural sources are different.
15. The particle of claim 1, wherein at least one nucleic acid molecule in the core has a nucleotide sequence that represents an assemblage of sequence elements found in one or more source nucleic acid molecules.
16. The particle of claim 15, wherein the at least one nucleic acid molecule has a nucleotide sequence that represents an assemblage of at least two different sequence elements found in two different source nucleic acid molecules.
17. The particle of claim 1, wherein at least a portion of the nucleic acid molecules within a core is cleavable.
18. The particle of claim 1, wherein the nucleic acid molecules within a core comprise single-stranded, double-stranded, triple-stranded nucleic acids or combination thereof.
19. The particle of claim 1, wherein the nucleic acid molecules within a core are arranged in a crystalline structure comprising lamellar sheets.
20. The particle of claim 1, wherein the nucleic acid molecules within a core comprise a stem-loop or linear structure.
21. The particle of claim 1, wherein the core comprises about 1×10.sup.3 to 1×10.sup.8 copies of a sequence element.
22. The particle of claim 1, wherein the core comprises at least 1×10.sup.6 copies of a sequence element.
23. The particle of claim 1, wherein the nucleic acid molecules have a molecular weight of at least about 1×10.sup.10 g/mol, about 1×10.sup.9 g/mol, about 1×10.sup.8 g/mol, about 1×10.sup.7 g/mol, about 1×10.sup.6 g/mol, or about 1×10.sup.5 g/mol.
24. The particle of claim 1, wherein the core has a negative or positive surface charge.
25. The particle of claim 1, further comprising one or more agents for delivery within the core.
26. The particle of claim 25, wherein the agent is a chemotherapeutic agent selected from the group consisting of doxorubicin, carboplatin, cisplatin, cyclophosphamide, docetaxel, erlotinib, etoposide, fluorouracil, gemcitabine, imatinib mesylate, irinotecan, methotrexate, paclitaxel, sorafinib, sunitinib, topotecan, vincristine, and vinblastine.
27. The particle of claim 1, wherein the second greatest dimension of the core is less than 500 nm, less than 200 nm, less than 100 nm, less than 50 nm, less than 20 nm or less than 10 nm.
28. The particle of claim 1, further comprising a film coated on the core, and wherein the core is in the second configuration.
29. The particle of claim 28, wherein the film comprises at least one material selected from the group consisting of an organic material and an inorganic material.
30. The particle of claim 28, wherein the film comprises a polymer.
31. The particle of claim 30, wherein the film comprises a lipid.
32. The particle of claim 28, wherein the film comprises at least one polyelectrolyte layer.
33. The particle of claim 32, wherein the polyelectrolyte layer is degradable or non-degradable.
34. The particle of claim 32, wherein the polyelectrolyte layer is or comprises a polycation or polyanion.
35. The particle of claim 34, wherein the polycation is one or more member of the group consisting of polyethylenimine, poly(L-lysine) (PLL), and poly(lactic acid) (PLA).
36. The particle of claim 28, wherein the film comprises a layer-by-layer (LBL) film.
37. The particle of claim 36, wherein the LBL film comprises multiple polyelectrolyte layers.
38. The particle of claim 37, wherein the LBL film comprises multiple polyelectrolyte layers of alternating charges.
39. The particle of claim 28, wherein the film further comprises one or more agents.
40. The particle of claim 28, wherein the particle has a surface charge.
41. A method for forming the particle of claim 1 comprising: assembling one or more nucleic acid molecules into a core with a crystalline structure comprising lamellar sheets.
42. A method for forming the particle of claim 1 comprising: assembling one or more nucleic acid molecules into a core, wherein the core has a first greatest dimension greater than 2 pm, and coating the core with a film, wherein the coated core has a second greatest dimension less than 500 nm.
43. The method of claim 42, further comprising forming the nucleic acid molecules via rolling circle amplification (RCA), rolling circle transcription (RCT) or both.
44. The method of claim 43, wherein the step of forming comprises using a circular nucleic acid template.
45. The method of claim 44, wherein the step of forming comprises hybridizing the circular nucleic acid template with a primer.
46. The method of claim 45, wherein the primer is complementary to a portion of the circular nucleic acid template.
47. The method of claim 44, wherein the step of forming further comprises amplifying the circular nucleic acid template using an enzyme.
48. The method of claim 47, wherein the enzyme is Φ29 DNA polymerase, T7 polymerase or both.
49. The method of claim 42, wherein the step of coating comprises mixing the core in a coating solution.
50. The method of claim 49, wherein the coating solution comprises polyethylenimine.
51. The method of claim 42, wherein the step of coating further comprises sequentially assembling additional layers.
Description
BRIEF DESCRIPTION OF THE DRAWING
(1) The Drawing, comprised of several Figures, is for illustration purposes only, not for limitation.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS
(22) The present invention, among other things, describes compositions of nucleic acid particles and methods and uses thereof.
(23) Particles
(24) Particles used in accordance with various embodiments of the present disclosure can contain a particle core, which can optionally be coated by a film. Upon coating, a particle can be converted from a first configuration to a second configuration.
(25) In some embodiments, the greatest dimension of a particle (in its first or second configuration) may be greater or less than 5 μm, 2 μm, 1 μm, 800 nm, 500 nm, 200 nm, 100 nm, 90 nm, 80 nm, 70 nm, 60 nm, 50 nm, 40 nm, 30 nm, 20 nm, 10 nm, or even 5 nm. In some embodiments, the greatest dimension a particle (in its first or second configuration) may be in a range of any two values above. In some embodiments, a particle in a first configuration has the greatest dimension in a range of about 5 μm to about 2 μm or about 2 μm to about 1 μm. In some embodiments, a particle in a second configuration has the greatest dimension in may be in a range of about 500 nm to about 200 nm, about 200 nm to about 100 nm or about 100 nm to about 50 nm. In some embodiments, a particle can be substantially spherical. In some embodiments, the dimension of a particle is a diameter, wherein the diameter can be in a range as mentioned above.
(26) In various embodiments, a particle described herein can comprise a particle core, a coating film (including one or more layers; in some embodiments one or more polyelectrolyte layers), and one or more agents such as diagnostic, therapeutic and/or targeting agents.
(27) Nucleic Acid-Containing Core
(28) A particle core can consist of or include one or more nucleic acid molecules. In some embodiments, a core is comprised of a plurality of nucleic acid molecules. Individual nucleic acid molecules within a core can have different nucleic acid sequences or substantially the same nucleic acid sequence. In some embodiments, nucleic acid molecule(s) within a core have sequences that share at least one common sequence element.
(29) In some embodiments, at least one nucleic acid molecule in a core has a nucleotide sequence that comprises multiple copies of at least a first sequence element. In some embodiments, at least one nucleic acid molecule in a core has a nucleotide sequence that comprises multiple copies of each of at least a first and a second sequence element. In some embodiments, at least one nucleic acid molecule has a nucleotide sequence that comprises alternating copies of the first and second sequence elements. In some embodiments, at least one nucleic acid molecule has a nucleotide sequence that comprises multiple copies of each of three or more sequence elements.
(30) In some embodiments, at least one nucleic acid molecule has a nucleotide sequence that includes one or more sequence elements found in a natural source. In some embodiments, at least one nucleic acid molecule has a nucleotide sequence that includes a first sequence element that is found in a first natural source and a second sequence element that is found in a second natural source. The first and second natural sources can be the same or difference.
(31) In some embodiments, at least one nucleic acid molecule has a nucleotide sequence that represents an assemblage of sequence elements found in one or more source nucleic acid molecules. In some embodiments, at least one nucleic acid molecule has a nucleotide sequence that represents an assemblage of at least two different sequence elements found in two different source nucleic acid molecules.
(32) In some embodiments, nucleic acid molecule(s) within a core have nucleotide sequences that fold into higher order structures (e.g., double and/or triple-stranded structures). In some embodiments, nucleic acid molecule(s) within a core have nucleotide sequences that comprise two or more complementary elements. In some embodiments, such complementary elements can form one or more (optionally alternative) stem-loop (e.g., hairpin) structures. In some embodiments, nucleic acid molecule(s) within a core have nucleotide sequences that include one or more portions that remain single stranded (i.e., do not pair intra- or inter-molecularly with other core nucleic acid sequence elements).
(33) In some embodiments, at least one nucleic acid molecules in a core contains at least one cleavage site. In some embodiments, a cleavage site is a bond or location susceptible to cleavage by a cleaving agent such as a chemical, an enzyme (e.g., nuclease, dicer, DNAase and RNAase), radiation, temperature, etc. In some embodiments, the cleaving agent is a sequence specific cleaving agent in that it selectively cleaves nucleic acid molecules at a particular site or sequence.
(34) In some embodiments, at least one nucleic acid molecules in a core contains at least one cleavage site susceptible to cleavage after delivery or localization of a particle as described herein to a target site of interest. In some embodiment, nucleic acid molecule(s) in a core have a plurality of cleavage sites and/or are otherwise arranged and constructed so that multiple copies of a particular nucleic acid of interest are released at the target site, upon delivery of a particle as described herein.
(35) In some embodiments, nucleic acid molecule(s) within a core have a self-assembled structure and/or are characterized by an ability to self-assemble in that it/they fold(s) into a stable three-dimensional structure, typically including one or more non-covalent interactions that occur between or among different moieties within the nucleic acid, without requiring assistance of non-nucleic acid entities. In some embodiments, nucleic acid molecule(s) within a core are arranged in a crystalline structure comprising lamellar sheets. In some embodiments, a core comprises or consists of one or more entangled nucleic acid molecules.
(36) In some embodiments, nucleic acid molecule(s) in a core have a molecular weight greater than about 1×10.sup.10 g/mol, about 1×10.sup.9 g/mol, about 1×10.sup.8 g/mol, about 1×10.sup.7 g/mol, about 1×10.sup.6 g/mol, or about 1×10.sup.5 g/mol.
(37) As described herein, in some embodiments, nucleic acid molecule(s) in a core includes multiple copies of at least one sequence element (e.g., concatenated in one or more long nucleic acid molecules whose sequence comprises or consists of multiple copies of the sequence element, and/or as discrete nucleic acid molecules each of which has a sequence that comprises or consists of the element, or a combination of both) whose length is within the range between a lower length of at least 5, 10, 15, 20, 25, 30, 35, 40, 45, or more and an upper length of not more than 10000, 9000, 8000, 7000, 6000, 5000, 4000, 3000, 2000, 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100, 90, 80, 70, 60, 50, 40, 30 or less, wherein the upper length is greater than the lower length.
(38) Particles described herein are characterized by a high loading of nucleic acids. In some embodiments, a particle core comprises at least about 1×10.sup.3, about 1×10.sup.4, about 1×10.sup.5, about 1×10.sup.6, about 1×10.sup.7, about 1×10.sup.8, about 1×10.sup.9, or about 1×10.sup.10 copies of a particular sequence element of interests. In some embodiments, a particle core comprises copies of a particular sequence element of interests in a range of about 1×10.sup.3 to about 1×10.sup.4, about 1×10.sup.4 to about 1×10.sup.5, about 1×10.sup.5 to about 1×10.sup.6, about 1×10.sup.6 to about 1×10.sup.7, about 1×10.sup.7 to about 1×10.sup.8, about 1×10.sup.8 to about 1×10.sup.9, or about 1×10.sup.9 to about 1×10.sup.10. In some embodiments, a particle core comprises copies of a particular sequence element of interests in a range of about 1×10.sup.3 to about 1×10.sup.10, about 1×10.sup.4 to about 1×10.sup.8 or about 1×10.sup.5 to about 1×10.sup.7. In some embodiments, a particle core comprises copies of a particular sequence element of interests in a range of any two values above.
(39) Nucleic acid molecules can carry positive or negative charges. Alternatively, they can be neutral. In some embodiments, a nucleic acid-containing particle core may have a positive or negative surface charge.
(40) In some embodiments, nucleic acid molecules for use in a nucleic acid core as described herein comprise or consist of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), peptide nucleic acid (PNA), morpholino and locked nucleic acid (LNA), glycol nucleic acid (GNA) and/or threose nucleic acid (TNA).
(41) In some embodiments, utilized nucleic acid molecules comprise or consist of one or more oliogonucleotides (ODN), DNA aptamers, DNAzymes, siRNAs, shRNAs, RNA aptamers RNAzymes, miRNAs or combination thereof.
(42) In some embodiments, nucleic acid molecules for use in accordance with the present invention have nucleotide sequence(s) that include(s) one or more coding sequences; one or more non-coding sequences, and/or combinations thereof.
(43) In some embodiments, a coding sequence includes a gene sequence encoding a protein. Exemplary proteins include, but are not limited to brain derived neurotrophic factor (BDNF), glial derived neurotrophic factor (GDNF), neurotrophic factor 3 (NT3), fibroblast growth factor (FGF), transforming growth factor (TGF), platelet transforming growth factor, milk growth factor, endothelial growth factors (EGF), endothelial cell-derived growth factors (ECDGF), alpha-endothelial growth factors, beta-endothelial growth factor, neurotrophic growth factor, nerve growth factor (NGF), vascular endothelial growth factor (VEGF), 4-1 BB receptor (4-1BBR), TRAIL (TNF-related apoptosis inducing ligand), artemin (GFRalpha3-RET ligand), BCA-1 (B cell-attracting chemokinel), B lymphocyte chemoattractant (BLC), B cell maturation protein (BCMA), brain-derived neurotrophic factor (BDNF), bone growth factor such as osteoprotegerin (OPG), bone-derived growth factor, megakaryocyte derived growth factor (MGDF), keratinocyte growth factor (KGF), thrombopoietin, platelet-derived growth factor (PGDF), megakaryocyte derived growth factor (MGDF), keratinocyte growth factor (KGF), platelet-derived growth factor (PGDF), bone morphogenetic protein 2 (BMP2), BRAK, C-10, Cardiotrophin 1 (CT1), other chemokines, interleukins and combinations thereof.
(44) Coating Films
(45) Particles provided by the present invention may include a coating film on a nucleic acid-containing core. In some embodiments, a film substantially covers at least one surface of a particle core. In some embodiments, a film substantially encapsulates a core.
(46) A film can have an average thickness in various ranges. In some embodiments, an averaged thickness is about or less than 200 nm, 100 nm, 50 nm, 40 nm, 30 nm, 20 nm, 15 nm, 10 nm, 5 nm, 1 nm, 0.5 nm, or 0.1 nm. In some embodiments, an averaged thickness is in a range from about 0.1 nm to about 100 nm, about 0.5 nm to about 50 nm, or about 5 nm to about 20 nm. In some embodiments, an averaged thickness is in a range of any two values above.
(47) In some embodiments, a coating film include one or more layers. A plurality of layers each can respectively contain one or more materials. According to various embodiments of the present disclosure, a layer can consist of or comprise metal (e.g., gold, silver, and the like), semi-metal or non-metal, and metal/semi-metal/non-metal oxides such as silica (SiO.sub.2). In certain embodiments, a layer can consist of or comprise a magnetic material (e.g., iron oxide).
(48) Additionally or alternatively, materials of a layer can be polymers. For example, a layer can be polyethyleneimine as demonstrated in Example 1. In some embodiments, a layer is or includes one or more polymers, particularly polymers that which have been approved for use in humans by the U.S. Food and Drug Administration (FDA) under 21 C.F.R. §177.2600, including, but not limited to, polyesters (e.g. polylactic acid, poly(lactic-co-glycolic acid), polycaprolactone, polyvalerolactone, poly(1,3-dioxan-2-one)); polyanhydrides (e.g. poly(sebacic anhydride)); polyethers (e.g., polyethylene glycol); polyurethanes; polymethacrylates; polyacrylates; polycyanoacrylates; copolymers of PEG and poly(ethylene oxide) (PEO). In some embodiments, a polymer is a lipid.
(49) In some embodiments, a layer is or includes at least a degradable material. Such a degradable material can be hydrolytically degradable, biodegradable, thermally degradable, enzymatically degradable, and/or photolytically degradable polyelectrolytes. In some embodiments, degradation may enable release of one or more agents associated with a particle described herein.
(50) Degradable polymers known in the art, include, for example, certain polyesters, polyanhydrides, polyorthoesters, polyphosphazenes, polyphosphoesters, certain polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, poly(amino acids), polyacetals, polyethers, biodegradable polycyanoacrylates, biodegradable polyurethanes and polysaccharides. For example, specific biodegradable polymers that may be used include but are not limited to polylysine (e.g., poly(L-lysine) (PLL)), poly(lactic acid) (PLA), poly(glycolic acid) (PGA), poly(caprolactone) (PCL), poly(lactide-co-glycolide) (PLG), poly(lactide-co-caprolactone) (PLC), and poly(glycolide-co-caprolactone) (PGC). Another exemplary degradable polymer is poly(beta-amino esters), which may be suitable for use in accordance with the present application.
(51) In some embodiments, layer-by-layer (LBL) films can be used alternatively or in addition to other layers to coat a particle core in accordance with the present invention. A LBL film may have any of a variety of film architectures (e.g., numbers of layers, thickness of individual layers, identity of materials within films, nature of surface chemistry, presence and/or degree of incorporated materials, etc), as appropriate to the design and application of a coated particle core as described herein. In certain embodiments, a LBL film may has a single layer.
(52) LBL films may be comprised of multilayer units in which alternating layers have opposite charges, such as alternating anionic and cationic layers. Alternatively or additionally, LBL films for use in accordance with the present invention may be comprised of (or include one or more) multilayer units in which adjacent layers are associated via other non-covalent interactions. Exemplary non-covalent interactions include, but are not limited to ionic interactions, hydrogen bonding interactions, affinity interactions, metal coordination, physical adsorption, host-guest interactions, hydrophobic interactions, pi stacking interactions, van der Waals interactions, magnetic interactions, dipole-dipole interactions and combinations thereof. Detailed description of LBL films can be found in U.S. Pat. No. 7,112,361, the contents of which are incorporated herein by reference. Features of the compositions and methods described in the patent may be applied in various combinations in the embodiments described herein.
(53) In some embodiments, a layer can have or be modified to have one or more functional groups. Apart from changing the surface charge by introducing or modifying surface functionality, functional groups (within or on the surface of a layer) can be used for association with any agents (e.g., detectable agents, targeting agents, or PEG).
(54) Agents
(55) In some embodiments, the present invention provides compositions that comprise one or more agents. In some embodiments, one or more agents are associated independently with a core, a film coating the core, or both. For example, agents can be covalently linked to or hybridized to a nucleic acid-containing core, and/or encapsulated in a coating film of a particle described herein. In certain embodiments, an agent can be associated with one or more individual layers of an LBL film that is coated on a core, affording the opportunity for exquisite control of loading and/or release from the film.
(56) In theory, any agents including, for example, therapeutic agents (e.g. antibiotics, NSAIDs, glaucoma medications, angiogenesis inhibitors, neuroprotective agents), cytotoxic agents, diagnostic agents (e.g. contrast agents; radionuclides; and fluorescent, luminescent, and magnetic moieties), prophylactic agents (e.g. vaccines), and/or nutraceutical agents (e.g. vitamins, minerals, etc.) may be associated with the LBL film disclosed herein to be released.
(57) In some embodiments, compositions described herein include one or more therapeutic agents. Exemplary agents include, but are not limited to, small molecules (e.g. cytotoxic agents), nucleic acids (e.g., siRNA, RNAi, and microRNA agents), proteins (e.g. antibodies), peptides, lipids, carbohydrates, hormones, metals, radioactive elements and compounds, drugs, vaccines, immunological agents, etc., and/or combinations thereof. In some embodiments, a therapeutic agent to be delivered is an agent useful in combating inflammation and/or infection.
(58) In some embodiments, a therapeutic agent is or comprises a small molecule and/or organic compound with pharmaceutical activity. In some embodiments, a therapeutic agent is a clinically-used drug. In some embodiments, a therapeutic agent is or comprises an antibiotic, anti-viral agent, anesthetic, anticoagulant, anti-cancer agent, inhibitor of an enzyme, steroidal agent, anti-inflammatory agent, anti-neoplastic agent, antigen, vaccine, antibody, decongestant, antihypertensive, sedative, birth control agent, progestational agent, anti-cholinergic, analgesic, anti-depressant, anti-psychotic, β-adrenergic blocking agent, diuretic, cardiovascular active agent, vasoactive agent, anti-glaucoma agent, neuroprotectant, angiogenesis inhibitor, etc.
(59) In some embodiments, a therapeutic agent may be a mixture of pharmaceutically active agents. For example, a local anesthetic may be delivered in combination with an anti-inflammatory agent such as a steroid. Local anesthetics may also be administered with vasoactive agents such as epinephrine. To give but another example, an antibiotic may be combined with an inhibitor of the enzyme commonly produced by bacteria to inactivate the antibiotic (e.g., penicillin and clavulanic acid).
(60) In some embodiments, a therapeutic agent may be an antibiotic. Exemplary antibiotics include, but are not limited to, β-lactam antibiotics, macrolides, monobactams, rifamycins, tetracyclines, chloramphenicol, clindamycin, lincomycin, fusidic acid, novobiocin, fosfomycin, fusidate sodium, capreomycin, colistimethate, gramicidin, minocycline, doxycycline, bacitracin, erythromycin, nalidixic acid, vancomycin, and trimethoprim. For example, β-lactam antibiotics can be ampicillin, aziocillin, aztreonam, carbenicillin, cefoperazone, ceftriaxone, cephaloridine, cephalothin, cloxacillin, moxalactam, penicillin G, piperacillin, ticarcillin and any combination thereof.
(61) An antibiotic used in accordance with the present disclosure may be bacteriocidial or bacteriostatic. Other anti-microbial agents may also be used in accordance with the present disclosure. For example, anti-viral agents, anti-protazoal agents, anti-parasitic agents, etc. may be of use.
(62) In some embodiments, a therapeutic agent may be or comprise an anti-inflammatory agent. Anti-inflammatory agents may include corticosteroids (e.g., glucocorticoids), cycloplegics, non-steroidal anti-inflammatory drugs (NSAIDs), immune selective anti-inflammatory derivatives (ImSAIDs), and any combination thereof. Exemplary NSAIDs include, but not limited to, celecoxib (Celebrex®); rofecoxib (Vioxx®), etoricoxib (Arcoxia®), meloxicam (Mobic®), valdecoxib, diclofenac (Voltaren®, Cataflam®), etodolac (Lodine®), sulindac (Clinori®), aspirin, alclofenac, fenclofenac, diflunisal (Dolobid®), benorylate, fosfosal, salicylic acid including acetylsalicylic acid, sodium acetylsalicylic acid, calcium acetylsalicylic acid, and sodium salicylate; ibuprofen (Motrin), ketoprofen, carprofen, fenbufen, flurbiprofen, oxaprozin, suprofen, triaprofenic acid, fenoprofen, indoprofen, piroprofen, flufenamic, mefenamic, meclofenamic, niflumic, salsalate, rolmerin, fentiazac, tilomisole, oxyphenbutazone, phenylbutazone, apazone, feprazone, sudoxicam, isoxicam, tenoxicam, piroxicam (Feldene®), indomethacin (Indocin®), nabumetone (Relafen®), naproxen (Naprosyn®), tolmetin, lumiracoxib, parecoxib, licofelone (ML3000), including pharmaceutically acceptable salts, isomers, enantiomers, derivatives, prodrugs, crystal polymorphs, amorphous modifications, co-crystals and combinations thereof.
(63) Those skilled in the art will recognize that this is an exemplary, not comprehensive, list of agents that can be released using compositions and methods in accordance with the present disclosure. In addition to a therapeutic agent or alternatively, various other agents may be associated with a coated device in accordance with the present disclosure.
(64) Methods and Uses
(65) The present invention among other things provide methods of making and using particles described herein. In some embodiments, nucleic acid molecules as described may self-assemble into a core. Optionally, such a core can be coated with a film, wherein the core is characterized by being converted from a first configuration to a second configuration upon coating.
(66) Those of ordinary skill in the art will appreciate that nucleic acid molecules for use in particle cores in accordance with the present invention may be prepared by any available technology. In some aspects, the present invention encompasses the recognition that rolling circle amplification (RCA) and/or rolling circle transcription (RCT) can be a particularly useful methodology for production of nucleic acid molecules for use herein. Exemplary RCA strategies include, for example, single-primer initiated RCA and by various two-primer amplification methods such as ramification amplification (RAM), hyperbranched RCA, cascade RCA, and exponential RCA. In certain embodiments, RNA-containing molecules can be produced via rolling circle transcription (RCT).
(67) The present invention specifically encompasses the recognition that RCA/RCT may be particularly useful for production of long nucleic acid molecules, and/or furthermore may generate nucleic acid molecules. Those skilled in the art will appreciate that a nucleic acid molecule produced by RCA/RCT will typically have a nucleotide sequence comprising or consisting of multiple copies of the complement of the circular template being amplified.
(68) In some embodiments, a template used for RCA/RCT as described herein is or comprises deoxyribonucleic acid (DNA), ribonucleic acid (RNA), peptide nucleic acid (PNA), morpholino and locked nucleic acid (LNA), glycol nucleic acid (GNA) and/or threose nucleic acid (TNA).
(69) In some embodiments, a template used for RCA/RCT as described herein has a nucleotide sequence that includes one or more coding sequences, one or more non-coding sequences, and/or combinations thereof.
(70) In some particular embodiments of RCA/RCT contemplated herein, a polymerase selected from the group consisting of φ29 DNA polymerase and T7 is utilized to perform the RCA/RCT (see, for example, Example 1).
(71) More details of RCA can be found in US Patent Application No. 2010/0189794, the contents of which are incorporated herein by reference. Features of the compositions and methods described in the application may be applied in various combinations in the embodiments described herein. In some embodiments, a first single-stranded nucleic acid molecule is formed by RCA. In some embodiments, the first single-stranded nucleic acid molecule is formed with the aid of a first primer and a nucleic acid polymerase. In some embodiments, a second single-stranded nucleic acid molecule is formed by amplifying the first single-stranded nucleic acid with the aid of a second primer and a polymerase. In some embodiments, a third single-stranded nucleic acid molecule is formed by amplifying the second single-stranded nucleic acid molecule with the aid of a third primer and a polymerase.
(72) A RCA can be repeated with as many primers as desired, e.g., 4, 5, 6, 7, 8, 9, 10 or more primers can be used. In some embodiments, a plurality of primers can be added to templates to form nucleic acid molecules, wherein the plurality can comprise at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 primers. In some embodiments, more than 100 primers are used. In some embodiments, random fragments of short nucleic acid fragments, e.g., comprising digested or otherwise degraded DNAs, are used as non-specific primers to prime the formation of nucleic acid molecules using rolling circle amplification. As described herein and will be appreciated by those of skill in the art, polymerization reaction conditions can be adjusted as desired to form nucleic acid molecules and self-assembled particles. For example, reaction conditions that favor stringent nucleic acid hybridization, e.g., high temperature, can be used to favor more specific primer binding during amplification.
(73) In some aspects, the present invention specifically encompasses the recognition that LBL assembly may be particularly useful for coating a particle core described herein. There are several advantages to coat particle cores using LBL assembly techniques including mild aqueous processing conditions (which may allow preservation of biomolecule function); nanometer-scale conformal coating of surfaces; and the flexibility to coat objects of any size, shape or surface chemistry, leading to versatility in design options. According to the present disclosure, one or more LBL films can be assembled and/or deposited on a core to convert it to a condensed configuration with a smaller size. In some embodiments, a coated core having one or more agents for delivery associated with the LBL film, such that decomposition of layers of the LBL films results in release of the agents. In some embodiments, assembly of an LBL film may involve one or a series of dip coating steps in which a core is dipped in coating solutions. Additionally or alternatively, it will be appreciated that film assembly may also be achieved by spray coating, dip coating, brush coating, roll coating, spin casting, or combinations of any of these techniques.
(74) In some embodiments, particles described herein including nucleic acid-containing core can be subjected to a cleavage agent, so that nucleic acid molecules are cleaved into multiple copies of a particular nucleic acid of interest and such copies can be released.
(75) In some embodiments, at least one nucleic acid in a nucleic acid core contains at least one cleavage site. In some embodiments, a cleavage site is a bond or location susceptible to cleavage by a cleaving agent such as a chemical, an enzyme, radiation, temperature, etc. In some embodiments, the cleaving agent is a sequence specific cleaving agent in that it selectively cleaves nucleic acid molecules at a particular site or sequence.
(76) In some embodiments, at least one nucleic acid in a nucleic acid core contains at least one cleavage site susceptible to cleavage after delivery or localization of a particle as described herein to a target site of interest. In some embodiment, nucleic acid(s) in a core have a plurality of cleavage sites and/or are otherwise arranged and constructed so that multiple copies of a particular nucleic acid of interest are released at the target site, upon delivery of a particle as described herein.
(77) In some embodiments, particles are provided with a nucleic acid core that comprises one or more sequence elements that targets a particular disease, disorder, or condition of interest (e.g., cancer, infection, etc). For example, provided particles and methods can be useful for dysregulation of genes.
(78) In some embodiments, particles are provided with a nucleic acid core that comprises a plurality of different sequence elements, for example targeting the same disease, disorder or condition of interest. To give but one example, in some embodiments, particles are provided with a nucleic acid core that comprises a plurality of sequence elements, each of which targets a different cancer pathway, for example, as an siRNA that inhibits expression of a protein whose activity contributes to or supports the pathway.
(79) The present invention encompasses the recognition that particles can be designed and/or prepared to simultaneously deliver to a target site (e.g., to a cancer cell) a plurality of different nucleic acid agents (e.g., siRNAs), each of which is directed to a different specific molecular target of interest (e.g., an mRNA encoding a cancer-related protein). The present invention further encompasses the recognition that the described technology permits facile and close control of relative amounts of such different nucleic acid agents that are or can be delivered (e.g., substantially simultaneously) to the site. To give but one example, RCA/RCT templates can be designed and/or assembled with desired relative numbers of copies of different sequences of interest (e.g., complementary to different siRNAs of interest), so as to achieve precise control over the stoichiometry of delivered siRNA(s). In some embodiments, such control achieves synergistic effects (e.g., with respect to inhibiting tumor growth).
(80) In some embodiments, provided particles are administered or implanted using methods known in the art, including invasive, surgical, minimally invasive and non-surgical procedures, depending on the subject, target sites, and agent(s) to be delivered. Particles described herein can be delivered to a cell, tissue, organ of a subject. Examples of target sites include but are not limited to the eye, pancreas, kidney, liver, stomach, muscle, heart, lungs, lymphatic system, thyroid gland, pituitary gland, ovaries, prostate, skin, endocrine glands, ear, breast, urinary tract, brain or any other site in a subject.
EXEMPLIFICATION
Example 1
(81) In this Example, an impactful approach is demonstrated to use the DNA/RNA machinery provided by nature to generate RNAi in polymeric form, and in a manner that actually assembles into its own compact delivery cargo system. Thus, the RNAi is generated in stable form with multiple copy numbers at low cost, and distributed in a form that can readily be adapted for systemic or targeted delivery.
(82) In vitro rolling circle transcription by T7 RNA polymerase to create RNA microsponges
(83) Ligased circular DNA templates (0.3 μM) were incubated with T7 RNA polymerase (5 units/μL) at 37° C. for 20 hours in the reaction buffer (8 mM Tris-HCl, 0.4 mM spermidine, 1.2 mM MgCl.sub.2, and 2 mM dithiothreitol) including 2 mM rNTP in final concentration. For fluorescently labeling RNA particle, Cyanine 5-dUTP (0.5 mM) was added. The resultant solution was pipetted several times and then sonicated for 5 min to break possible connection of the particles. The solution was centrifuged at 6000 rpm for 6 min to remove the supernatant. Then, RNase free water was added to wash the particles. The solution was sonicated again for 1 min then centrifuged. Repeat this washing step 3 more times to remove the reagents of RCT. Measurement of RNA microsponge concentration was conducted by measuring fluorescence using Quant-iT RNA BR assay kits (Invitrogen). 10 μl of RNA microsponge solution or standard solution was incubated with 190 μl of working solution for 10 min at room temperature. The fluorescence was measured at 630/660 nm by Fluorolog-3 spectrofluorometer (Horiba Jobin Yvon).
(84) Treatment of RNAi Microsponges with Recombinant Dicer
(85) RNAi microsponges were digested with from 1 unit to 1.5 unit recombinant Dicer (Genlantis, San Diego, Calif.) in 12 μl of reaction solution (1 mM ATP, 5 mM MgCl2, 40% (v/v) Dicer reaction buffer). The samples treated for different reaction time from 12 h to 48 h were collected and were then inhibited by adding Dicer stop solution (Genlantis, San Diego, Calif.).
(86) Degradation Experiments of RNAi Microsponges
(87) RNA microsponges were incubated for 24 hrs in 10% of serum at 37° C. Degradation experiments with various concentrations of RNase were also performed for 24 hrs at 37° C. (NEB, Ipswich, Mass.).
(88) Characterization of RNAi Microsponges
(89) JEOL JSM-6060 and JSM-6070 scanning electron microscopes were used to obtain high resolution digital images of the RNA microsponges. The sample was coated with Au/Pd. JEOL 2000FX transmission electron microscope was used to obtain the internal structure of the RNA particle. Zeiss AxioSkop 2 MAT fluorescent microscope was used to image green fluorescently stained RNA microsponges by SYBR II. For characterization of crystalline structure of RNA microsponge, laboratory X-ray powder diffraction (XRD) patterns were recorded using a PANalytical X'Pert Pro diffractometer, fitted with a solid state X'Celerator detector. The diffractometer uses Cu Kα radiation (λ(Kα.sub.1)=1.5406 Å, λ(Kα.sub.2)=1.5433 Å, weighted average λ=1.5418 Å) and operates in Bragg geometry. The data were collected from 5° to 40° at a scan rate of 0.1°/min.
(90) Assembly of PEI Layer on RNAi Microsponges
(91) For assembly of outer layer, RNA microsponges were mixed with PEI solution, used at a final concentration of up to 5.0 mg/ml. Free PEI was easily removed by centrifugation at 13,700 rpm for 30 min. Repeat this step 2 more times. The PEI layered RNA particles were resuspended in PBS solution (pH 7.4) or MilliQ water.
(92) In vitro siRNA Knockdown Experiments
(93) T22 cells were maintained in growth media comprised of Minimum Essential Media-Alpha Modification (MEM) supplemented with 10% fetal bovine serum (FBS) and 1% Penicillin-Streptomycin. 3 days prior to knockdown experiments, cells were seeded in 6-well plates at 30,000 cells per well. 2 days prior to transfection, each well was co-transfected with 3.5 g each of pRL-CMV and gWIZ-Luc using Fugene-HD according the manufacturer's instructions. 1 day prior to transfection, cells were trypsinized and re-seeded in 96-well plates at an initial seeding density of 2000 cells/well. Cells were allowed to attach and proliferate for 24 hours. All knockdown experiments were performed in triplicate. 50 μL of fluorescently labeled RNAi-MS and RNAi-MS/PEI were added to 250 μL phenol-free Opti-MEM at the final concentration of up to 21.2 fM. Lipofectamine/siRNA complexes were formed at a 4:1 ratio (v/w). Growth media was removed and Opti-MEM was added to cells, followed by RNAi-microsponges or complexes in PBS, for a total volume of 150 μL per well, with no less than 100 μL Opti-MEM per well. Cells were incubated with siRNA constructs for 4 hours, after which media was removed and replaced with 10% serum-containing growth medium. A Luciferase assay was performed as using the Dual-Glo Luciferase Assay Kit (Promega, Madison, Wis.) and measured on a Perkin Elmer Plate 1420 Multilabel Counter plate reader. GFP expression was measured after quenching of the luciferase signal with the Stop-and-Glo reagent from Promega.
(94) In vivo siRNA Knockdown Experiments
(95) T22-Luc is a genetically defined mouse ovarian cancer cell line (p53−/−, Akt, myc) that stably expresses luciferase after infection with pMSCV-puro-Firefly luciferase viral supernatant and selecting the cells in a medium containing 2.0 ìg/ml of puromycin for 1 week. T22-Luc tumors were induced on both hind flanks of female nude mice (5 weeks old) with a single injection of 2-5 million cells in 0.1 mL media. After the tumors grew to ˜100 mm.sup.3 in volume, intratumoral injections of RNAi-microsponges were given in volumes of 50 uL. To determine the degree of luciferase knockdown, D-Luciferin (Xenogen) was given via intraveneously (tail vein injection, 25 mg/kg) and bioluminescence images were collected on a Xenogen IVIS Spectrum Imaging System (Xenogen, Alameda, Calif.) 10 minutes after injection. Living Image software Version 3.0 (Xenogen) was used to acquire and quantitate the bioluminescence imaging data sets.
(96) Chemicals and DNA Sequences: T7 RNA polymerase and Ribonucleotide Solution Mix were purchased from New England Biolabs (Beverly, Mass.) in pure form at a concentration of 50,000 units/ml and 80 mM, respectively. RNase Inhibitor (RNAsin Plus) was purchased from Promega (Madison, Wis.) at a concentration of 40 units/μl. Linear 25,000 g/mol (Mw) polyethyleneimine (PEI) was purchased from Polysciences Inc. (Warrington, Pa.). Other chemical reagents were purchased from Sigma Aldrich (St. Louis, Mo.). Oligonucleotides were commercially synthesized and PAGE purified (Integrated DNA Technologies, Coralville, Iowa). Sequences of the oligonucleotides are listed in Table 1. siRNA for control experiments was purchased from Dharmacon RNAi Technologies. Dual-Glo Luciferase Assay System was purchased from Promega (Madison, Wis.). All other cell culture reagents were purchased from Invitrogen. GFP- and Luciferase-expressing T22 cells were a gift of the laboratory of Phil Sharp (MIT). Vivo Tag 645 and Cyanine 5-dUTP was purchased from Visen/PerkinElmer.
(97) TABLE-US-00001 TABLE 1 Oligonucleotide sequences of linear ssDNA and T7 promoter. Strand Sequence Linear ssDNA 5′-Phosphate-ATAGTGAGTCGTATTAACGTACCAACAACTTACGCTG AGTACTTCGATTACTTGAATCGAAGTACTCAGCGTAAGTTTAGAGGCATAT CCCT-3′ (SEQ ID NO: 1) Promoter 5′-TAATACGACTCACTATAGGGAT-3′ (SEQ ID NO: 2) Linear ssDNA
(98) Circularization of Linear DNA: 0.5 μM of phosphorylated linear ssDNA (ATAGTGAGTCGTATTAACGTACCAACAACTTACGCTGAGTACTTCGATTACTTGAAT CGAAGTACTCAGCGTAAGTTTAGAGGCATATCCCT) (SEQ ID NO: 1) was hybridized with equimolar amounts of short DNA strands containing the T7 promoter sequence (TAATACGACTCACTATAGGGAT) (SEQ ID NO: 2) by heating at 95° C. for 2 min and slowly cooling to 25° C. over 1 hour. The circular DNA is synthesized by hybridizing a 22 base T7 promoter with a 92 base oligonucleotide which has one larger (16 bases) and one shorter (6 bases) complementary sequence to the T7 promoter (Table 1). The nick in the circular DNA was chemically closed by T4 DNA ligase (Promega, Madison, Wis.), following commercial protocol.
(99) Gel Electrophoresis: The resultant solution after dicer treatment of the RNA microsponges was run in a 3% agarose ready gel (Bio-Rad) at 100 V at 25° C. in Tris-acetate-EDTA (TAE) buffer (40 mM Tris, 20 mM acetic acid and 1 mM EDTA, pH 8.0, Bio-Rad) for 90 min. The gel was then stained with 0.5 mg/ml of ethidium bromide in TAE buffer. The gel electrophoresis image was used to calculate the number of siRNA from RNA particle. By comparing the band intensity of cleaved 21 bp RNA strands to standard RNA strands, the amount of siRNA, which was converted from RNAi microsponges, was calculated (Table 2). Although up to 460 ng of siRNA can be theoretically obtained from 1 μg of RNAi microsponges, the particles were experimentally converted to 94.5 ng of siRNA by Dicer treatment under optimal conditions.
(100) TABLE-US-00002 TABLE 2 Peak positions and d-spadings for RNAi-microsponge Peak position, Spacing q [Å.sup.−1] d [Å] 0.57 11.00 1.18 5.32 1.77 3.56 2.16 2.91 1.04 6.02 2.08 3.03
Spacing was determined by Bragg's Law.
d=nλ/2 sin θ
Also, the scattering vector q was determined from the following equation.
q=4π sin θ/λ
To determine the thickness of crystallite was determined from Scherrer's Formula.
D=2πK/Δq
Here, K=0.9 is the Scherrer constant, and Δq is the radial full width at half maximum of a given Bragg spot. D is thickness of crystallite. λ is the wavelength of the x-ray radiation (here, λ is 1.54).
(101) TABLE-US-00003 Thickness of FWHM, Δq [Å.sup.−1] Crystallite, D [Å] 0.077 73.3
Here, the crystallite thickness is estimated to be ˜7.4 nm as determined from the Scherrer equation. The 7.4 nm is close to the theoretical length of double stranded 21 bp siRNA by considering that one base pair corresponds to 2.6-2.9 Å of length along the strand (21×2.6-2.9=54.6-60.9 Å). Considering that the polymer might fold according to the structure displayed
(102) Dynamic Light Scattering (DLS) and Zeta Potential: The size and surface charge of RNAi microsponges were measured using Zeta PALS and Zeta Potential Analyzer software (Brookhaven Instruments Corp., Holtsville, N.Y.). The RNAi microsponges were diluted in Milli-Q water and all measurement were carried out at 25° C. Three measurements each with 10 sub-runs were performed for each sample. Molecular weight of RNA microsponges, 1.36×10.sup.10 g/mole, was obtained from Zeta PALS software.
(103) Calculation of Amount of siRNA Generated from RNAi Microsponges: From the measured molecular weight of the RNA microsponges, the number of periodically repeated 92 base RNA strands (from 92 base circular DNA templates) in a single RNA microsponge was calculated as follows:
Molecular Weight of 92 base RNA strand=28587 g/mole
Number of 92 base RNA strands(cleavable RNA strands) in one RNA microsponge=1.36×10.sup.10/28587=4.76×10.sup.5
In theory, 480000 of siRNA can be maximally generated from one RNAi microsponge.
Experimentally, the amount of cleaved siRNA from one RNA microsponge was determined using the gel electrophoresis results.
siRNA from one RNA particle=Amount of siRNA from 1 μg of RNA microsponge/amount of 1 μg of RNA microsponge=(0.0945 μg/12600 μg/mol)/(1 μg/1.36×10.sup.10/mol)=102,000
(104) According to gel electrophoresis results following the Dicer treatment, 102,000 siRNA strands were generated from one RNAi microsponge under optimal conditions. This result shows that 21% of potential RNAi is converted as siRNA. In our hypothesis, some portion of the RNA is not as readily accessed by dicer in a more close-packed self-assembled RNA structure. Therefore, multimers such as dimer, trimer, and tetramer of repeat RNA unit as incomplete dicing products could be produce.
(105) Calculation of Amount of Liposome by Lipofectamine with siRN: The number of liposome can be calculated by the following equation,
N.sub.liposome=N.sub.lipid/N.sub.tot
If 100 nm liposomes are unilamellar structure, the number of lipids in a 100 nm size liposome is about 80047. With 2 mg/ml of Lipofectamine™ reagent (Invitrogen) solution, which is 3:1 (w/w) liposome formulation of DOSPA (2,3-dioleoyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propaniminium trifluoroacetate) and DOPE (dioleoyl-L-a-phosphatidylethanolamine), 1:4 ratio of siRNA/Lipo (w/v) is formed.
(106) Based on our calculation, about 150 times more number of liposomes that are made of lipofectamine agent are needed to deliver same number of siRNA in comparison to microsponges. For example, to deliver 1 nmole of siRNA, 1.5 pmole of liposome is necessary (in case of RNAi-MS, about 10 fmole of RNA-MS can deliver 1 nmole of siRNA). This is an important issue for the cell type that does not easily allow cellular uptake and low off-target/toxicity.
(107) Materials for In Vitro Biological Characterization: The siRNA was purchased from Dharmacon RNAi Technologies. Dual-Glo Luciferase Assay System and Fugene-HD were purchased from Promega. All other cell culture reagents were purchased from Invitrogen. T22 cells stably expressing both GFP and firefly luciferase, untransfected T22 cells, and pRL-CMV (Renilla luciferase) plasmid were a gift of the laboratory of Phil Sharp (MIT). gWIZ-Luc (Firefly luciferase) plasmid was obtained from Aldevron. (Firefly) Branched 25,000 g/mol (M.sub.w) polyethyleneimine (PEI) and other chemical reagents were purchased from Sigma Aldrich. Vivo Tag 645 was purchased from Visen/PerkinElmer.
(108) Cell Proliferation Assay: T22 cells were seeded at 2000 cells/well in a 96-well clear, flat-bottomed plate and transfected according to the above protocol. Cells were incubated with RNAi-microsponges or RNAi-microsponge/PEI for 4 hours, after which media was removed and replaced with 10% serum-containing growth medium. After 48 hours, each well was treated with 20 μ of MTT reagent (1 mg/mL in MEM) for an additional 4 hours. Media was then removed and formazan crystals were solubilized in 50:50 DMF:water with 5% SDS. After 12 hours, absorbance was read at 570 nm.
(109) Cell Uptake Test by Confocal Microscopy: 8-well Lab-Tek chamber slides (Thermo Fisher, Waltham, Mass.) were treated for 20 min with human fibronectin in PBS at 0.1 mg/mL. The fibronectin was removed and T22 cells were trypsinized and seeded in each well at a concentration of 4000 cells/well 24 h before transfection. 50 μL of fluorescently labeled RNAi-MS and RNAi-MS/PEI were added to 250 μL phenol-free Opti-MEM at the final concentration of up to 21.2 fM. After 4 hours, RNAi-microsponges were removed, cells were fixed with 3.7% formaldehyde in PBS, stained with Hoechst 33342 (Pierce) and Alexa Fluor 488® phalloidin (Invitrogen) and washed 3 times with PBS. Imaging was done on a PerkinElmer Ultraview spinning disc confocal (PerkinElmer, Waltham, Mass.).
(110) Materials for In Vivo siRNA Knockdown Experiments: T22-Luc cells were a generous gift from Dr. Deyin Xing, Professor Philip Sharp (MIT) and Dr. Sandra Orsulic (Cedars-Sinai medical center). Tumors from nude mice injected with Brca1 wild-type cell line C22 were used to generate T22 tumor cell lines (Cancer Res. 2006 Sep. 15; 66(18): 8949-53). T22-Luc is a genetically defined mouse ovarian cancer cell line (p53−/−, Akt, myc) that stably expresses luciferase after infection with pMSCV-puro-Firefly luciferase viral supernatant and selecting the cells in a medium containing 2.0 ìg/ml of puromycin for 1 week.
(111) Degradation Experiments of RNAi Microsponges: For degradation test, RNA microsponges were incubated for 24 hrs in 10% of serum at 37° C. (
(112) By taking advantage of new RNA synthetic methods for the generation of nanostructures via rational design, we utilize an enzymatic RNA polymerization to form condensed RNA structures that contain predetermined sequences for RNA interference by rolling circle transcription (RCT).
(113) Here we design and use RNA polymerase to generate elongated pure RNA strands as polymers that can self-assemble into organized nano- to microstructure, which is key for efficient delivery and high cargo capacity, offering the combined benefit of low off-target effects and low toxicity.sup.4. Using a new approach, we utilize the T7 promoter as a primer so that extremely high molecular weight RNA strands can be produced. As shown in
(114) The RNA transcripts form porous sponge-like superstructures with nanoscopic structure readily visible in scanning electron microscope (SEM) image (
(115) To examine the formation of the sponge-like spherical structures from their RNA strand building blocks, time-dependent experiments were performed during the RCT polymerization. The morphologies of the RNA superstructures were revealed by SEM after 1 h, 4 h, 8 h, 12 h, 16 h and 20 h RCT reaction time. As shown in
(116) The RNAi-microsponges have a highly localized concentration of RNA strands, as they essentially consist of near 100% potential RNAi. For this reason, these systems should be an effective means to deliver and generate siRNA through intracellular processing mechanisms. The RNA structures were designed to be cleaved by the enzyme Dicer by cutting double-stranded RNA into approximately 21-nt RNA duplexes in the cytoplasm, where it can be converted to siRNA by the RNA-induced silencing complex (RISC) for gene silencing (
(117) TABLE-US-00004 TABLE 3 Amount of cleaved siRNA from 1 μg of RNAi-microsponges from gel electrophoresis results. Intensity Amount (abitrary) Std. (ng) 21 bp of 159.3 16.4 93.8 ± 9.7 Reference dsRNA Ladder siRNA from 160.4 8.8 94.5 ± 5.2 RNA particles
(118) To enhance the cellular uptake of the RNA particle, the synthetic polycation, polyethylenimine (PEI) was used to condense the RNAi-microsponge and generate a net positively charged outer layer. Due to the high negative charge density of the RNAi-microsponge, cationic PEI was readily adsorbed onto the particles by electrostatic interaction. The change of particle surface charge (zeta potential) from −20 mV (RNAi-microsponge) to +38 mV (RNAi-microsponge/PEI) indicates the successful assembly of RNAi-microsponge with PEI (
(119) To confirm the cellular transfection of RNA particle, red fluorescence labeled RNAi-microsponge/PEI was incubated with T22 cells. RNAi-microsponge/PEI particles exhibited significant cellular uptake by the cancer cell line, compared with the uncondensed RNAi-microsponge (
(120) We demonstrated that a new class of siRNA carrier, the RNAi-microsponge, which introduces a new self-assembled structure that provides a route for the effective delivery of siRNA. The RNAi microsponge presents a means of rapidly generating large amounts of siRNA in a form that assembles directly into a drug carrier that can be used for direct transfection simply by coating with a positively charged polyion. Given the high cost of therapeutic siRNA and the need for high levels of efficiency, this approach could lead to much more directly accessible routes to therapies involving siRNA. The siRNA, which is highly prone to degradation during delivery, is protected within the microsponge in the crystalline form of polymeric RNAi. We can significantly reduce the difficulties of achieving high loading efficiency for siRNA using this approach. The microsponges are able to deliver the same transfection efficiency with a three order of magnitude lower concentration of siRNA particles when compared to typical commercially available nanoparticle-based delivery. Furthermore, the ease of modification of the RNA polymer composition enables the introduction of multiple RNA species for combination therapies. The RNAi microsponge presents a novel new materials system in general due to its unique morphology and nanoscale structure within the polymer particle, and provides a promising self-assembling material that spontaneously generates a dense siRNA carrier for broad clinical applications of RNAi delivery using the intrinsic biology of the cell.
Example 2
(121) In this Example, particles includes nucleic acid molecules comprising multiple sequences are demonstrated.
(122) To generate the RNAi combination system, we can incorporate RNAi combinations by assembling multiple siRNA and/or microRNA (miR) within a single RNAi microsponge. To achieve this goal, multiple RNA species can be designed within a single circular DNA template. Then self-assembled RNAi microsponge can be synthesized during RCT reaction by producing multiple components from a single circular DNA template (Engineering Strategy 1 in
(123)
Other Embodiments and Equivalents
(124) While the present disclosures have been described in conjunction with various embodiments and examples, it is not intended that they be limited to such embodiments or examples. On the contrary, the disclosures encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art. Accordingly, the descriptions, methods and diagrams of should not be read as limited to the described order of elements unless stated to that effect.
(125) Although this disclosure has described and illustrated certain embodiments, it is to be understood that the disclosure is not restricted to those particular embodiments. Rather, the disclosure includes all embodiments that are functional and/or equivalents of the specific embodiments and features that have been described and illustrated.