METHOD FOR PREDICTING SURVIVAL FOLLOWING STREPTOCOCCUS INIAE INFECTION

20220307092 · 2022-09-29

    Inventors

    Cpc classification

    International classification

    Abstract

    Methods of predicting survival following Streptococcus iniae infection in tilapia, the method comprising determining the alleles present at one or more, optionally two or more, DNA polymorphism in the tilapia and predicting whether or not the tilapia will survive Streptococcus iniae infection based on the determination of the alleles, methods of detecting in a sample from a tilapia the presence or absence of the alleles present at one or more, optionally two or more, DNA polymorphism associated with survival following Streptococcus iniae infection, relating methods of obtaining an indication of risk of a tilapia becoming infected by Streptococcus iniae comprising, methods of producing broodstock, offspring or eggs using so selected tilapia, all optionally using DNA polymorphisms located on linkage group 8 of the tilapia genome.

    Claims

    1. A method of predicting survival following Streptococcus iniae infection in tilapia, the method comprising determining the alleles present at one or more DNA polymorphism in the tilapia and predicting whether or not the tilapia will survive Streptococcus iniae infection based on the determination of the alleles.

    2. A method of detecting in a sample from a tilapia the presence or absence of the alleles present at one or more DNA polymorphism associated with survival following Streptococcus iniae infection.

    3. The method according to claim 1, wherein the alleles are indicative of the tilapia surviving following Streptococcus iniae infection.

    4. The method according to claim 1, wherein the alleles are indicative of the tilapia dying following Streptococcus iniae infection.

    5. A method of obtaining an indication of risk of a tilapia becoming infected by Streptococcus iniae comprising the method according to claim 2.

    6. The method according to claim 1, wherein the one or more DNA polymorphism is located on linkage group 8 of the tilapia genome.

    7. The method according to claim 1, wherein the alleles in the sample are analysed by nucleotide sequencing.

    8. The method according to claim 1, wherein the one or more DNA polymorphism is selected from the group consisting of: NC_031973.1_7142946; NC_031973.1_9167743; NC_031973.1_6323968; NC_031973.1_7142916; NC_031973.1_7497722; NC_031973.1_7775443; NC_031973.1_7782524; NC_031973.1_9209387; and NC_031973.1_9485417; and NC_031973.1_5545222.

    9. The method according to claim 1, wherein the method comprises determining the alleles present at two or more DNA polymorphism in the tilapia, preferably determining the alleles present at NC_031973.1_9209387 and NC_031973.1_9485417.

    10. A method of producing broodstock, comprising (i) selecting a tilapia that is predicted to survive following Streptococcus iniae infection by a method comprising the method according to claim 1; and (ii) using the tilapia to form the broodstock.

    11. The broodstock produced by the method according to claim 10.

    12. A method of producing tilapia offspring, comprising: (i) selecting a tilapia that is predicted to survive following Streptococcus iniae infection by a method comprising the method according to claim 1; and (ii) using the tilapia to produce offspring.

    13. The offspring produced by the method according claim 12.

    14. A method of producing tilapia eggs, comprising: (i) selecting a tilapia that is predicted to survive following Streptococcus iniae infection by a method comprising the method according to claim 1; and (ii) using the tilapia to produce the eggs.

    15. The eggs produced by the method according to claim 14.

    16. The method according to claim 1, wherein the tilapia is a Nile tilapia.

    Description

    [0035] The present invention is described by way of example with reference to the accompanying drawings in which:

    [0036] FIG. 1 shows the accumulated mortality over 21 days of a S. iniae challenge test;

    [0037] FIG. 2 shows the mean percentage survival rate mortality for each family rank ordered from low to high survival rate;

    [0038] FIG. 3 shows the GWAS results for S. iniae using software ASReml V4.0 for model with SNP fitted as random effect, in which “Unknown” corresponds to markers in regions with unknown position on the genome;

    [0039] FIG. 4 shows the GWAS results for S. iniae using the package NAM implemented in R where SNP is fitted as random effect, in which “Unknown” corresponds to markers in regions with unknown position on the genome;

    [0040] FIG. 5 shows the total genetic value plotted against the mean family survival for the markers tested by ASReml; and

    [0041] FIG. 6 shows the total genetic value plotted against the mean family survival for the markers tested by NAM.

    EXAMPLE 1—IDENTIFYING SNPS THAT PREDICT SURVIVAL FOLLOWING STREPTOCOCCUS INIAE INFECTION

    [0042] Nile tilapia (Oreochromis niloticus) were used in a genome-wide association study for survival following Streptococcus iniae infection. A total of 144 full sib families were produced using 72 sires and 144 dams. Families were produced by natural mating in single pair breeding units. A hierarchical nested design was used where each male was mated with two different females.

    [0043] Families were reared in separate units until the fish grew large enough to tag—i.e. reached their tagging size. On average 61 days after egg collection, fish from all families were Passive Integrated Transponder (PIT)-tagged and representatives from all families were stocked in two holding tanks. At the time of tagging, tissue samples from the pelvic fin of individual fish were obtained, and stored in ethanol 97% in separate 1.5 ml Eppendorf tubes with individual identification. After collection, samples were kept at −20° C. and sent for analysis.

    [0044] Streptococcus iniae Challenge Test

    [0045] Fish were placed in eight acclimation units. A total of 2686 fish having an average weight of around 30 g were individually injected with S. iniae and PIT-tag registered. Fish were then stocked together in a large tank. Mortality was recorded daily during acclimation and after injection, registering PIT tag and date of mortality for each fish.

    [0046] Most of the fish died on the first and second day after injection, and after day 5 daily mortalities were below 1% daily and after day 12 practically no further mortalities occurred (FIG. 1). The test was terminated after 21 days. Accumulated mortality at the end of test was 46%.

    [0047] Brain tissue samples were collected from 265 fish that died during the trial, and 99% of these samples yielded pure cultures of S. iniae suggesting the bacteria became systemic.

    [0048] A high variation in mean survival rate for each family among the fish injected with S. iniae was observed, which ranges from 0% to 100%, with a coefficient of variation of 55% (FIG. 2).

    [0049] The Pearson correlation between the mean family weight at the beginning of the challenge and S. iniae survival was negative but very low in magnitude (r=−0.10), suggesting that the variation in individual body weight had a marginal, if any, impact on survival during the trial.

    [0050] Training Population

    [0051] For each of the challenge tests a training population was constructed as a subsample of the fish sent to test. Families were clustered according to their genetic distances estimated from pedigree. From resulting clusters, half-sib families which maximize phenotypic variation were identified and within each family individuals were randomly sampled. After this process, 39 families were selected to create the training populations for S. iniae.

    [0052] This population provided a total of 312 samples from a mean of 8.5 individuals per family, which exhibited a survival rate of 0.52±0.5 (mean f standard deviation).

    [0053] Tissue samples were then transferred to deep 96 well plates, filled with 97% ethanol and genotyped.

    [0054] Genotyping, Allele Call and Allele Filtering

    [0055] Genotyping was performed using double digest restriction-site associated DNA sequencing (ddRADseq), a methodology where genome complexity is reduced by randomly cutting the DNA using restriction enzymes. The resulting fragments are then separated by their molecular weight and sequenced for posterior allele calling.

    [0056] Allele calls were generated in VCF (Variant Call Format). For allele call, sequences were aligned to the tilapia genome assembly with GenBank assembly accession number GCA_001858045.2. In total, 83,752 SNPs were reported.

    [0057] SNPs were then filtered for a minimum allele frequency (MAF) of0.05, allele call and Hardy Weinberg equilibrium p<le.sup.−6. Two levels allele call were used to filter SNPs: 0.9 resulting in 16,440 SNPs after filtering. Data filtering was done using R statistical software.

    [0058] Statistical Analysis

    [0059] Statistical analysis was performed using ASReml V4.0 and R using the package NAM. The general fitted model was as follow:


    y=μ+Xb+Za+e

    Where y is the vector of phenotypic records, μ is the overall mean, b is the unknown random allele substitution effect of the evaluated SNP, and a is the random additive genetic effect.

    [0060] Significance of including each SNP was tested using a likelihood ratio test, which represents the improvement that each SNP provides to the model when not including the marker effect. Bonferroni corrected threshold was estimated at 5% significance.

    [0061] Allele substitution effect was estimated as:


    allele substitution=(effect of first homozygote−effect of the second homozygote)/2

    [0062] Genetic variance explained by a SNP was estimated as σ.sub.SNP.sup.2=2pga.sup.2, where p and q are allele frequencies, and a is the estimated allele substitution effect.

    [0063] Markers

    [0064] Genome-wide analysis results were summarized using Manhattan plots. FIG. 3 shows to results where SNP was fitted as random effect using the software ASReml, and FIG. 4 shows results for the model using the NAM package.

    [0065] All models and software showed association in the same region in linkage group 8, and moreover, for the same markers.

    [0066] A summary of results obtained using ASReml and NAM is shown in Tables 1 and 2, respectively. The numbers identifying each SNP (SNP id) consist of a prefix (“NC_031973.1”) corresponding to the GenBank accession and version number for linkage group LG8 derived from genome assembly with GenBank assembly accession number GCA_001858045.2, and a suffix identifying the position of the SNP within NC_031973.1.

    TABLE-US-00001 TABLE 1 Summary of results for markers using a model where SNP effect is fit as random effect using the software ASReml V4.1. Genetic Substi- variance tution Freq of the SNP id σ.sub.p.sup.2 σ.sub.SNP.sup.2 σ.sub.a.sup.2 effect of p SNP NC_031973.1_5545222 0.284 0.193 0.055 0.211 0.151 0.054 NC_031973.1_7142946 0.294 0.259 0.077 0.266 0.333 0.118 NC_031973.1_9167743 0.292 0.234 0.068 −0.229 0.167 0.064 NC_031973.1_9209387 0.285 0.208 0.059 −0.195 0.168 0.055 NC_031973.1_9485417 0.297 0.271 0.080 0.276 0.333 0.123

    TABLE-US-00002 TABLE 2 Summary of results for markers using of a model where SNP effect is fit as random effect using the package NAM. Genetic Substi- Fre- variance tution quency of the SNP id σ.sup.2.sub.SNP h.sup.2 effect of p SNP NC 031973.1_6323968 0.054 0.195 −0.320 0.198 0.102 NC 031973.1_7142916 0.042 0.159 0.282 0.199 0.09 NC 031973.1_7142946 0.029 0.114 0.232 0.333 0.103 NC 031973.1_7497722 0.038 0.141 0.265 0.154 0.069 NC 031973.1_7775443 0.034 0.13 0.252 0.182 0.075 NC 031973.1_7782524 0.045 0.166 −0.291 0.179 0.086 NC 031973.1_9167743 0.051 0.185 −0.311 0.167 0.086 NC 031973.1_9209387 0.052 0.186 −0.312 0.168 0.087 NC 031973.1_9485417 0.041 0.159 0.279 0.333 0.124

    [0067] An additional run of ASReml, where the five markers were fitted as random effects in the same model and random polygenic effect included, was used to obtain predicted phenotypes and correlations between predicted phenotypes and observed phenotypes. Pearson correlation value was 0.62 meaning that the five markers could predict the survival of fish with a high-medium reliability.

    [0068] The locations and identity of the alleles for the markers are set out in Table 3.

    TABLE-US-00003 TABLE 3 Allele locations and identity. Increased Decreased Chro- Position survival survival SNP id mosome (bp) allele (R) allele (S) NC_031973.1_5545222 8 5545222 A G NC_031973.1_6323968 8 6323968 A G NC_031973.1_7142916 8 7142916 A G NC_031973.1_7142946 8 7142946 C T NC_031973.1_7497722 8 7497722 T C NC_031973.1_7775443 8 7775443 T A NC_031973.1_7782524 8 7782524 C T NC_031973.1_9167743 8 9167743 T C NC_031973.1_9209387 8 9209387 G A NC_031973.1_9485417 8 9485417 T C

    [0069] Predictive Ability

    [0070] The ability of markers to predict survival was assessed for sets obtained by ASReml and NAM separately. For both sets of markers total genotypic value (Ĝ) was estimated for each family with both parents genotyped as:


    Ĝ=Wv

    where W is a matrix with allele dosage with values 1 for heterozygotes and 0 or 2 for the first and second homozygote, and v is the vector of marker effects.

    [0071] The predictive ability of the markers was estimated as Pearson correlation of Ĝ and mean family survival. Predictive ability for the ASReml set of markers was 0.76 (FIG. 5) and for the NAM set of markers was 0.75 (FIG. 6).

    [0072] For a family, the total genotypic value was estimated as the mean Ĝ value from both parents. Then the predictive ability of the markers was estimated as Pearson correlation of Ĝ and mean family survival.

    [0073] Values were estimated for cases using one up to all markers of each set, including all possible combinations of SNPs and when either one or both progenitors were genotyped.

    [0074] Relationship of the Haplotype Cross and Average Survival

    [0075] The relationship between tilapia haplotypes and challenge test survival was assessed to demonstrate the feasibility of using SNP markers for selection of fish that are likely to survive S. iniae infection.

    [0076] Haplotypes for nine SNPs were extracted and then related to mean family survival following S. iniae infection. Alleles were recoded as R and S for increased survival and reduced survival, respectively.

    [0077] For each QTL found according to linkage disequilibrium, the mean average survival by haplotype of the crosses was determined (Tables 4 to 20). To simplify the reading of the data, when one of the breeders had a missing genotype, the cross was removed. For markers NC_031973.1_6323968, NC_031973.1_7782524, NC_031973.1_9167743 and NC_031973.1_9209387, at least one of the progenitors contributed an R allele and the mean survival of their families increased. Thus, these markers were designated to indicate survival following infection.

    [0078] The contrary occurs with markers NC_031973.1_7142916, NC_031973.1_7142946, NC_031973.1_7497722, NC_031973.1_7775443 and NC_031973.1_9485417, in which crosses one of the progenitors contribute with at least one S allele, and the mean family survival is reduced. Thus, these markers were designated to indicate death following infection.

    [0079] Sire-Dam Haplotype

    [0080] For each candidate SNP/marker, mean average survival of the haplotype of one of the breeders at the time (sire or dam) was determined (Tables 4 to 20). A correlation of breeder haplotype and mean survival was observed.

    TABLE-US-00004 TABLE 4 Survival by haplotype for SNP NC_031973.1_5545222. Sire RR RS Dam RR RS SS Missing RR RS SS Missing N 81 26 1 4 11 5 1 3 Mean 65.14 34.17 50 49.08 57.2 34.86 22.22 35.98 Min 12.5 0 50 0 15 5 22.22 5 Max 100 77.78 50 100 95.24 52.63 22.22 52.94 Q25 45 15 50 19.74 23.02 20 22.22 27.5 Median 70.59 34.17 50 48.16 71.43 46.67 22.22 50 Q75 85 60.51 50 77.5 77.71 50 22.22 51.47

    TABLE-US-00005 TABLE 5 Survival by haplotype for SNP NC_031973.1_5545222. Sire SS Missing Dam RR RS RR N 3 1 7 Mean 15 0 43.14 Min 5 0 0 Max 33.33 0 90 Q25 5.83 0 10 Median 6.67 0 26.32 Q75 20 0 82.84

    TABLE-US-00006 TABLE 6 Survival by haplotype for SNP NC_031973.1_6323968. Sire RR RS Dam SS Missing RR RS SS Missing N 2 2 4 14 17 3 Mean 92.5 63.16 91.04 71.59 65.75 56.54 Min 85 26.32 85 33.33 22.22 50 Max 100 100 95.24 100 95 66.67 Q25 88.75 44.74 88.36 55.26 52.63 51.47 Median 92.5 63.16 91.96 72.56 73.33 52.94 Q75 96.25 81.58 94.64 88.93 81.25 59.8

    TABLE-US-00007 TABLE 7 Survival by haplotype for SNP NC_031973.1_6323968. Sire SS Missing Dam RR RS SS Missing RS SS N 1 21 49 13 4 7 Mean 76.47 74.72 39.81 30.34 56.21 47.08 Min 76.47 33.33 0 0 12.5 10 Max 76.47 100 100 76.47 83.33 90 Q25 76.47 65 20 5 38.12 15.04 Median 76.47 75 36.84 21.05 64.51 41.18 Q75 76.47 85 55 57.89 82.6 79.17

    TABLE-US-00008 TABLE 8 Survival by haplotype for SNP NC_031973.1_7142916. Sire RR RS Missing Dam RR RS SS Missing RR RS SS Missing RR RS N 71 23 1 7 17 10 2 3 7 2 Mean 67.41 38.88 0 45.25 49.89 29.01 23.61 35.98 55.05 7.89 Min 12.5 0 0 0 0 5 22.22 5 10 0 Max 100 77.78 0 95.45 95.24 52.63 25 52.94 90 15.79 Q25 47.37 20 0 13.16 23.81 15.2 22.92 27.5 18.16 3.95 Median 75 36.84 0 40 60 25 23.61 50 82.35 7.89 Q75 85.71 64.08 0 77.5 75 45 24.31 51.47 83.33 11.84

    TABLE-US-00009 TABLE 9 Survival by haplotype for SNP NC_031973.1_7142946. Sire RR RS Dam RR RS SS Missing RR RS SS Missing N 46 27 4 7 22 19 5 2 Mean 72.58 47.2 21.53 45.9 62.56 35.83 19.89 51.47 Min 30 0 0 0 0 5 15 50 Max 100 89.47 36.84 100 100 66.67 25 52.94 Q25 60 21.64 10.71 13.16 48.22 24.42 15 50.74 Median 78.17 45 24.64 40 71.83 40 22.22 51.47 Q75 88.98 67.79 35.46 77.5 80.67 48.53 22.22 52.21

    TABLE-US-00010 TABLE 10 Survival by haplotype for SNP NC_031973.1_7142946. Sire SS Missing Dam RS NA RR RS SS N 1 1 5 2 1 Mean 5 5 55.14 7.89 83.33 Min 5 5 10 0 83.33 Max 5 5 90 15.79 83.33 Q25 5 5 10 3.95 83.33 Median 5 5 82.35 7.89 83.33 Q75 5 5 83.33 11.84 83.33

    TABLE-US-00011 TABLE 11 Survival by haplotype for SNP NC_031973.1_7497722. Sire RR RS Missing Dam RR RS Missing RR RS SS Missing RR RS N 80 25 3 15 7 1 3 8 1 Mean 64.66 35.61 32.11 47.54 30.16 22.22 35.98 59.68 0 Min 0 0 0 0 5 22.22 5 10 0 Max 100 77.78 70 95.24 52.63 22.22 52.94 95.45 0 Q25 45 15 13.16 18.61 17.89 22.22 27.5 22.24 0 Median 70.29 35.29 26.32 60 21.05 22.22 50 81.18 0 Q75 85.18 50 48.16 75.74 48.33 22.22 51.47 85 0

    TABLE-US-00012 TABLE 12 Survival by haplotype for SNP NC_031973.1_7775443. Sire RR RS Missing Dam RR RS SS Missing RR RS SS Missing RR RS N 80 22 2 6 15 5 1 3 7 2 Mean 65.34 36.97 23.53 33.92 47.54 34.02 22.22 35.98 52.43 10 Min 12.5 0 0 0 0 5 22.22 5 10 0 Max 100 77.78 47.06 72.22 95.24 52.63 22.22 52.94 90 20 Q25 45 16.25 11.76 6.58 18.61 15.79 22.22 27.5 18.16 5 Median 72.14 36.07 23.53 30.66 60 46.67 22.22 50 65 10 Q75 85.71 59.87 35.29 61.25 75.74 50 22.22 51.47 82.84 15

    TABLE-US-00013 TABLE 13 Survival by haplotype for SNP NC_031973.1_7782524. Sire RR RS Dam RS SS Missing RR RS SS Missing N 1 4 1 4 14 20 7 Mean 85 74.82 26.32 91.04 76.55 66.68 51.47 Min 85 46.67 26.32 85 50 22.22 50 Max 85 100 26.32 95.24 100 95 52.94 Q25 85 51.14 26.32 88.36 65 58.75 50.74 Median 85 76.32 26.32 91.96 75.73 71.96 51.47 Q75 85 100 26.32 94.64 88.93 79.52 52.21

    TABLE-US-00014 TABLE 14 Survival by haplotype for SNP NC_031973.1_7782524. Sire SS Missing Dam RR RS SS Missing RS SS N 1 28 56 5 1 6 Mean 76.47 66.56 37.08 18 82.35 36.61 Min 76.47 12.5 0 0 82.35 0 Max 76.47 100 100 70 82.35 90 Q25 76.47 47.19 16.45 0 82.35 10 Median 76.47 73.61 35 5 82.35 18.16 Q75 76.47 83.75 48.03 15 82.35 69.08

    TABLE-US-00015 TABLE 15 Survival by haplotype for SNP NC_031973.1_9167743. Sire RR RS Dam RS SS Missing RR RS SS Missing N 1 2 1 4 10 20 2 Mean 85 100 26.32 91.04 77.77 64.7 51.47 Min 85 100 26.32 85 50 22.22 50 Max 85 100 26.32 95.24 100 95 52.94 Q25 85 100 26.32 88.36 65 51.14 50.74 Median 85 100 26.32 91.96 78.89 68.63 51.47 Q75 85 100 26.32 94.64 93.33 79.52 52.21

    TABLE-US-00016 TABLE 16 Survival by haplotype for SNP NC_031973.1_9167743. Sire SS Missing Dam RR RS SS Missing RS SS N 1 30 61 4 1 6 Mean 76.47 67.36 37.6 37.17 82.35 36.61 Min 76.47 12.5 0 0 82.35 0 Max 76.47 100 100 73.68 82.35 90 Q25 76.47 48.68 15.79 3.75 82.35 10 Median 76.47 73.61 35 37.5 82.35 18.16 Q75 76.47 84.58 55.56 70.92 82.35 69.08

    TABLE-US-00017 TABLE 17 Survival by haplotype for SNP NC_031973.1_9209387. Sire RR RS Dam RS SS Missing RR RS SS Missing N 3 1 2 4 12 21 3 Mean 89.81 100 63.16 91.04 73.93 66.65 45.42 Min 85 100 26.32 85 50 22.22 33.33 Max 94.44 100 100 95.24 100 95 52.94 Q25 87.5 100 44.74 88.36 64.54 55 41.67 Median 90 100 63.16 91.96 72.56 70.59 50 Q75 92.22 100 81.58 94.64 81.43 78.95 51.47

    TABLE-US-00018 TABLE 18 Survival by haplotype for SNP NC_031973.1_9209387. Sire SS Missing Dam RR RS SS Missing RS SS N 2 27 57 4 1 5 Mean 75.74 66.25 36.27 24.7 82.35 38.67 Min 75 12.5 0 0 82.35 0 Max 76.47 100 100 70 82.35 90 Q25 75.37 47.02 15.79 3.75 82.35 10 Median 75.74 72.22 35 14.4 82.35 10 Q75 76.1 84.17 47.37 35.36 82.35 83.33

    TABLE-US-00019 TABLE 19 Survival by haplotype for SNP NC_031973.1_9485417. Sire RR RS Dam RR RS SS Missing RR RS SS Missing N 36 33 6 3 28 13 5 4 Mean 73.71 59.6 31.84 22.11 58.15 29.26 21.71 44.49 Min 12.5 0 15.79 0 5 0 5 5 Max 100 100 45 40 95.24 52.63 35.29 70 Q25 64.54 38.89 24.17 13.16 40 15 21.05 38.75 Median 82.29 65 33.42 26.32 64.38 27.78 22.22 51.47 Q75 89.47 75 40.09 33.16 77.09 46.67 25 57.21

    TABLE-US-00020 TABLE 20 Survival by haplotype for SNP NC_031973.1_9485417. Sire SS Missing Dam RR RS SS RR RS SS N 3 4 1 4 2 1 Mean 56.11 12 0 48.33 54.33 0 Min 33.33 0 0 10 26.32 0 Max 75 22.22 0 90 82.35 0 Q25 46.67 7.5 0 10 40.33 0 Median 60 12.89 0 46.67 54.33 0 Q75 67.5 17.4 0 85 68.34 0

    [0081] A wide range of values on the mean average survival was observed because crosses were not design according to their SNP genotypes. However, the RR haplotypes was always associated with a higher mean survival.

    [0082] Analysing Multiple SNPs Increases Accuracy of Survival Prediction

    [0083] The accuracy of survival prediction was quantified according the varied with sequencing strategy. The accuracy increased as the number of analysed SNPs increased (Tables 21 and 22). The accuracy also increased if both parents rather than one parent was genotyped (Table 21). Additionally, the accuracy if the dam progenitor rather than the sire progenitor was genotyped (Table 22).

    TABLE-US-00021 TABLE 21 Summary of predictive ability when both or one progenitor were genotyped using different numbers of SNPs. Method Number Predictive Progenitor for estimate of SNPs accuracy genotyped marker effects included Mean MM Max Both parents ASReml 1 0.572 0.481 0.606 genotyped 2 0.674 0.600 0.720 3 0.717 0.679 0.751 4 0.744 0.733 0.756 5 0.763 0.763 0.763 NAM 1 0.547 0.437 0.606 2 0.643 0.438 0.725 3 0.679 0.485 0.758 4 0.700 0.547 0.758 5 0.714 0.603 0.763 6 0.725 0.662 0.760 7 0.733 0.694 0.758 8 0.741 0.719 0.754 9 0.748 0.748 0.748 One of the ASReml 1 0.400 0.333 0.445 parents (sire 2 0.481 0.430 0.520 or dam) 3 0.516 0.477 0.543 4 0.538 0.531 0.549 5 0.553 0.553 0.553 NAM 1 0.392 0.314 0.445 2 0.466 0.323 0.532 3 0.497 0.359 0.557 4 0.514 0.402 0.559 5 0.526 0.437 0.573 6 0.535 0.492 0.570 7 0.542 0.520 0.565 8 0.548 0.537 0.561 9 0.553 0.553 0.553

    TABLE-US-00022 TABLE 22 Summary of predictive ability when either sire or dam were genotyped using different numbers of SNPs. Method Number Predictive Progenitor for estimate of SNPs accuracy genotyped marker effects included Mean Min Max Sire ASReml 1 0.340 0.269 0.426 2 0.414 0.313 0.479 3 0.446 0.380 0.481 4 0.467 0.446 0.494 5 0.482 0.482 0.482 NAM 1 0.321 0.198 0.426 2 0.398 0.215 0.492 3 0.429 0.250 0.487 4 0.446 0.275 0.502 5 0.458 0.329 0.499 6 0.467 0.397 0.498 7 0.473 0.443 0.498 8 0.478 0.463 0.492 9 0.482 0.482 0.482 Dam ASReml 1 0.457 0.399 0.524 2 0.544 0.464 0.613 3 0.584 0.533 0.626 4 0.608 0.570 0.621 5 0.622 0.622 0.622 NAM 1 0.456 0.412 0.524 2 0.531 0.418 0.616 3 0.562 0.454 0.658 4 0.581 0.468 0.656 5 0.595 0.517 0.654 6 0.605 0.551 0.659 7 0.614 0.580 0.654 8 0.622 0.602 0.644 9 0.628 0.628 0.628

    [0084] Sequence Listing of Alleles Indicating Increased Survival and Decreased Survival

    [0085] The sequences of the alleles indicating increased survival and decreased survival for each SNP with flanking regions are shown below. The residue showing the survival allele is highlighted in bold between square brackets. The length of the flanking regions around the alleles shown below is arbitrary. The nucleic acid of the allele and its position within the linkage group defines the SNP. If required, longer flanking regions may be determined by standard sequence analysis methods from the full sequence of the linkage group as defined by the sequence with GenBank accession no. NC_031973.1.

    TABLE-US-00023 NC_031973.1_7142946 increased survival allele [SEQ ID NO: 1]: AGCAAATCGCATGTGTGAGCCAGCCCGAAGTCACAGGAGCTGTCCTTGGTGCTGAGAGGGAG GCAGCTGTYCGAGTGTTTTCCTGAACAGACCTGAAGCC[C]GCTGGAYTTTGTTTCTTTCCT TCAGCTAATCCTTTCCATGCAGCCTGCATCAGGATGTCAATTCATAATAAAAAGTATACAGG CACCAAGCAGTCAATCA NC_031973.1_7142946 decreased survival allele [SEQ ID NO: 2]: AGCAAATCGCATGTGTGAGCCAGCCCGAAGTCACAGGAGCTGTCCTTGGTGCTGAGAGGGAG GCAGCTGTYCGAGTGTTTTCCTGAACAGACCTGAAGCC[T]GCTGGAYTTTGTTTCTTTCCT TCAGCTAATCCTTTCCATGCAGCCTGCATCAGGATGTCAATTCATAATAAAAAGTATACAGG CACCAAGCAGTCAATCA NC_031973.1_7775443 increased survival allele [SEQ ID NO: 3]: TGTCTGACAGTCCTTATTCAGCACTGATGATGGAGGCCTAYCAGAGGCCAGCATTTCGGGCT CCTGCTAACATTACAAAATAAAATACCAGCTCGTATGT[T]TGACTTACTGAAACCTGCATG TCCTCTCACGGCYCAGTGCTGGTCGGCAGCGCCYGGGGGTGAAGCGATGTCACGACYCYGTG CACGTTTACATCATCGT NC_031973.1_7775443 decreased survival allele [SEQ ID NO: 4]: TGTCTGACAGTCCTTATTCAGCACTGATGATGGAGGCCTAYCAGAGGCCAGCATTTCGGGCT CCTGCTAACATTACAAAATAAAATACCAGCTCGTATGT[A]TGACTTACTGAAACCTGCATG TCCTCTCACGGCYCAGTGCTGGTCGGCAGCGCCYGGGGGTGAAGCGATGTCACGACYCYGTG CACGTTTACATCATCGT NC_031973.1_6323968 increased survival allele [SEQ ID NO: 5]: TTTTTTGCTCTGTGTGGTGGTTTTATGGCTTCTTCACACTAACATGGTTCTTATGTAAATAG TTCCTGAGATGTTYGTCCTGGAGGAGCAGCACAGTGCA[A]ATCTCCACGCTGTAAGCCTGA ACAAACTGATGCTTGTTCAGCCCTTTGATGCTGAAGGCAAATTAAAGAGCGCTGGCTCTCCA CGCYTCCTCTGGTATAA NC_031973.1_6323968 decreased survival allele [SEQ ID NO: 6]: TTTTTTGCTCTGTGTGGTGGTTTTATGGCTTCTTCACACTAACATGGTTCTTATGTAAATAG TTCCTGAGATGTTYGTCCTGGAGGAGCAGCACAGTGCA[G]ATCTCCACGCTGTAAGCCTGA ACAAACTGATGCTTGTTCAGCCCTTTGATGCTGAAGGCAAATTAAAGAGCGCTGGCTCTCCA CGCYTCCTCTGGTATAA NC_031973.1_7142916 increased survival allele [SEQ ID NO: 7]: CACTCTGGTGGATGTTGAGAAGCTAATGTGAGCAAATCGCATGTGTGAGCCAGCCCGAAGTC ACAGGAGCTGTCCTTGGTGCTGAGAGGGAGGCAGCTGT[A]CGAGTGTTTTCCTGAACAGAC CTGAAGCCYGCTGGAYTTTGTTTCTTTCCTTCAGCTAATCCTTTCCATGCAGCCTGCATCAG GATGTCAATTCATAATA NC_031973.1_7142916 decreased survival allele [SEQ ID NO: 8]: CACTCTGGTGGATGTTGAGAAGCTAATGTGAGCAAATCGCATGTGTGAGCCAGCCCGAAGTC ACAGGAGCTGTCCTTGGTGCTGAGAGGGAGGCAGCTGT[G]CGAGTGTTTTCCTGAACAGAC CTGAAGCCYGCTGGAYTTTGTTTCTTTCCTTCAGCTAATCCTTTCCATGCAGCCTGCATCAG GATGTCAATTCATAATA NC_031973.1_7497722 increased survival allele [SEQ ID NO: 9]: GCATATGCAGAATYAAAGAACCATYGAGCTGTGATTTGACAAAGGAAGCTGCGAGAGTGTGC AGCGCTTTCATTGAAAAGCTAAAACACAAAATCCATTT[T]ATGGGGTTAAAAATGGGATTG GGCAGGTGGGYGACTCACCTGTCTTCTTGGTGGAAAGCCTATAAGATCAGCTGACCTGCTCA TTGCTGTGTCTCTGACG NC_031973.1_7497722 decreased survival allele [SEQ ID NO: 10]: GCATATGCAGAATYAAAGAACCATYGAGCTGTGATTTGACAAAGGAAGCTGCGAGAGTGTGC AGCGCTTTCATTGAAAAGCTAAAACACAAAATCCATTT[C]ATGGGGTTAAAAATGGGATTG GGCAGGTGGGYGACTCACCTGTCTTCTTGGTGGAAAGCCTATAAGATCAGCTGACCTGCTCA TTGCTGTGTCTCTGACG NC_031973.1_9167743 increased survival allele [SEQ ID NO: 11]: GCTCTGGAAAGTGACTTAACATCAGAGTGTGCTGATCYTGTGTGCGTTTGTGTAAACTGTGG GAGCAGGAAGCAGTCAGCACCTCTTCAAAGTAAGAGTC[T]AGTGTTTGCGCTGCTCTGATT TTAGCGGCTGGACTGGAAGAATCGTCCCGTCTGCACGGGTTGACCTTCTGTGATCTGTGATC AGAACTTCGGAGTTACT NC_031973.1_9167743 decreased survival allele [SEQ ID NO: 12]: GCTCTGGAAAGTGACTTAACATCAGAGTGTGCTGATCYTGTGTGCGTTTGTGTAAACTGTGG GAGCAGGAAGCAGTCAGCACCTCTTCAAAGTAAGAGTC[C]AGTGTTTGCGCTGCTCTGATT TTAGCGGCTGGACTGGAAGAATCGTCCCGTCTGCACGGGTTGACCTTCTGTGATCTGTGATC AGAACTTCGGAGTTACT NC_031973.1_7782524 increased survival allele [SEQ ID NO: 13]: CCCTTTTTAATGCCTCACTTTTCTCTGATTGYCCTCCTCTGACAYACAGAAGGTTTCAGCAG CAGCTGGCTGTAGTTTCTCYGCTCACACCTGAGCTTTG[C]GGTCAGATGACCAYGTCAGGG TYTCTCYGTGACATCACACATATCCGTGTCTGTGCTGCCCTGGAGATCTGCCGTACCTGATG ATGGGAACCTCTAAGAA NC_031973.1_7782524 decreased survival allele [SEQ ID NO: 14]: CCCTTTTTAATGCCTCACTTTTCTCTGATTGYCCTCCTCTGACAYACAGAAGGTTTCAGCAG CAGCTGGCTGTAGTTTCTCYGCTCACACCTGAGCTTTG[T]GGTCAGATGACCAYGTCAGGG TYTCTCYGTGACATCACACATATCCGTGTCTGTGCTGCCCTGGAGATCTGCCGTACCTGATG ATGGGAACCTCTAAGAA NC_031973.1_9209387 increased survival allele [SEQ ID NO: 15]: AGACATTCCCTACAGATCTGCAAACTTGGATTACTTCGAGTATTCATCAGTCGCCCAACAAC AGAAACTGAATAGAAAACAGCTGGAACACCTGGATGTA[G]GAGTGCTGTGACACAACTTCA GATTTTAACTGTGAGCTCAGTTTACTGAATTACTGAACAACTTATACATCATCCTCATCACC ACCATCATCATCATCCT NC_031973.1_9209387 decreased survival allele [SEQ ID NO: 16]: AGACATTCCCTACAGATCTGCAAACTTGGATTACTTCGAGTATTCATCAGTCGCCCAACAAC AGAAACTGAATAGAAAACAGCTGGAACACCTGGATGTA[A]GAGTGCTGTGACACAACTTCA GATTTTAACTGTGAGCTCAGTTTACTGAATTACTGAACAACTTATACATCATCCTCATCACC ACCATCATCATCATCCT NC_031973.1_9485417 increased survival allele [SEQ ID NO: 17]: AATGCACYTGACCTCTGAACACTCACAGAAATCTAAAAACGAGYCATCTGATGTAAACTGAC CTGAAGACTGAAGAGAAGAAGACAGGAGGAAGTAAAGC[T]GTYAAGAAGCAGTGCCTGCAG CTGGAGCACCACCACCAYCCACACYCACTGCCATGGAAACAACCGCGGGTAGTTTCCATGGC AGAGTGTCACTGACTAT NC_031973.1_9485417 decreased survival allele [SEQ ID NO: 18]: AATGCACYTGACCTCTGAACACTCACAGAAATCTAAAAACGAGYCATCTGATGTAAACTGAC CTGAAGACTGAAGAGAAGAAGACAGGAGGAAGTAAAGC[C]GTYAAGAAGCAGTGCCTGCAG CTGGAGCACCACCACCAYCCACACYCACTGCCATGGAAACAACCGCGGGTAGTTTCCATGGC AGAGTGTCACTGACTAT NC_031973.1_5545222 increased survival allele [SEQ ID NO: 19]: TATCGGTCTCATCCAGCCTGGGACTGGGTTAGGTCACCTAGAAGGAACTGGAAAGAACCACT ACTCTGCTTAGCCTGCTGCCACCACAACCCAACCGCAG[A]GGGAACATGGTGATGCTCTTA TTTCTCCCTTCTGTTATTCTCAGAGGGAACCACTCACACTTTCTGCTGCTGGCAGACATCTG CTCATCACTGGGCTGAA NC_031973.1_5545222 decreased survival allele [SEQ ID NO: 20]: TATCGGTCTCATCCAGCCTGGGACTGGGTTAGGTCACCTAGAAGGAACTGGAAAGAACCACT ACTCTGCTTAGCCTGCTGCCACCACAACCCAACCGCAG[C]GGGAACATGGTGATGCTCTTA TTTCTCCCTTCTGTTATTCTCAGAGGGAACCACTCACACTTTCTGCTGCTGGCAGACATCTG CTCATCACTGGGCTGAA

    [0086] The background technology as set out in the following publications was used in the development and enablement of the present invention:

    [0087] Statistical Methods for QTL Detection and Software Used [0088] Fernando, R. and Grossman, M. (1989) ‘Marker assisted selection using best linear unbiased prediction’, Genetics, selection, evolution: GSE, 21(4), pp. 467-477. [0089] Gilmour, A. R. (2007) ‘Mixed model regression mapping for QTL detection in experimental crosses’, Computational Statistics & Data Analysis. North-Holland, 51(8), pp. 3749-3764. [0090] Massault, C., Bovenhuis, H., Haley, C. and de Koning, D. J. (2008) ‘QTL mapping designs for aquaculture’, Aquaculture. Elsevier B. V., 285(1-4), pp. 23-29. [0091] Goddard, M. E. and Hayes, B. J. (2009) ‘Mapping genes for complex traits in domestic animals and their use in breeding programmes.’, Nature reviews. Genetics. Nature Publishing Group, 10(6), pp. 381-91. [0092] Xavier, A., Xu, S., Muir, W. M. and Rainey, K. M. (2015) ‘NAM: association studies in multiple populations: FIG. 1.’, Bioinformatics, 31(23), p. btv448.

    [0093] Methods in Molecular Biology [0094] Baird, N. A., Etter, P. D., Atwood, T. S., Currey, M. C., Shiver, A. L., Lewis, Z. A., Selker, E. U., Cresko, W. A. and Johnson, E. A. (2008) ‘Rapid SNP Discovery and Genetic Mapping Using Sequenced RAD Markers’, PLoS ONE. Edited by J. C. Fay. Public Library of Science, 3(10), p. e3376. [0095] Peterson, B. K., Weber, J. N., Kay. E. H., Fisher, H. S. and Hoekstra. H. E. (2012) ‘Double Digest RADseq: An Inexpensive Method for De Novo SNP Discovery and Genotyping in Model and Non-Model Species’, PLoS ONE. Edited by L. Orlando. Public Library of Science, 7(5), p. e37135. [0096] Reed, E., Nunez, S., Kulp, D., Qian, J., Reilly, M. P. and Foulkes, A. S. (2015) ‘A guide to genome-wide association analysis and post-analytic interrogation’, Statistics in Medicine, 34(28), pp. 3769-3792.

    [0097] Tilapia Genome [0098] Conte, M. A., Gammerdinger, W. J., Bartie, K. L., Penman, D. J. and Kocher, T. D. (2017) ‘A high quality assembly of the Nile Tilapia (Oreochromis niloticus) genome reveals the structure of two sex determination regions’. BMC Genomics. BioMed Central, 18(1), p. 341.

    Example 2—Selecting Broodstock Using SNP Markers for a Disease Resistance QTL

    [0099] Using the methods described herein. SNPs and combinations of SNPs, i.e. haplotypes, have been assigned breeding values for the survivability to Streptococcus iniae infection. The breeding value can be qualitative, i.e. increased survival or decreased survival, or quantitative, i.e. a numerical breeding value for the predicted survival of progeny to Streptococcus iniae infection. Each animal carries two haplotypes and two variants of the QTL. Each animal would be ascribed a breeding value as qualitative genotype, i.e. (i) increased survival:increased survival; (ii) increased survival:decreased survival; or (iii) decreased survival:decreased survival. Alternatively, each animal is ascribed the average breeding value of the two haplotypes carried by the individual.

    [0100] Breeding candidates are genotyped for the SNPs to determine the variants and haplotypes that they carry, and individual breeding values are determined based on their haplotypes.

    [0101] Individual males and females with the genotypes associated with the higher survivability or breeding values would be selected as broodstock. The males and females were mated according to good custom and practice of pedigree breeding programmes for the species. The resulting offspring are predicted to have improved pathogen resistance compared to the average disease resistance of the previous generation.