COILED-COIL MEDIATED TETHERING OF CRISPR/CAS AND EXONUCLEASES FOR ENHANCED GENOME EDITING
20220307011 · 2022-09-29
Assignee
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C07K2319/80
CHEMISTRY; METALLURGY
C12N15/1055
CHEMISTRY; METALLURGY
International classification
Abstract
The invention provides a method for enhanced genome engineering using CRISPR/Cas system tethered to exonucleases via different systems. By connecting Cas9 and exonucleases via heterodimeric peptides that form coiled-coils or via heterodimerization systems, greater indel mutations at desired genomic region occurs, resulting in higher genome editing rate. This novel improved CRISPR/Cas system can be exploited in different cell origins and organisms in various fields, where genome engineering is required and desired.
Claims
1-15 (canceled)
16. A combination comprising a first component (a) and a second component (b), wherein a) the first component comprises an endonuclease capable of inducing a double stranded DNA break or a nickase capable of inducing a DNA nick, preferably a Cas protein or mutant thereof, fused with a first protein or protein domain, and b) the second component comprises an exonuclease or a cytidine deaminase, preferably APOBEC protein, fused to a second protein or protein domain, wherein the first and the second components are capable of heterodimerizing with each other via interaction of the first protein or protein domain and the second protein or protein domain, and wherein the first protein or protein domain and the second protein or protein domain are orthogonal protein partners forming a coiled-coil structure, in particular a coiled-coil structure in parallel or antiparallel orientation.
17. The combination according to claim 16, wherein heterodimerization of the first protein or protein domain and the second protein or domain is inducible via a chemical or non-chemical signal.
18. The combination according to claim 17, wherein the chemical inducing heterodimerization is a small molecule such as rapalog, gibberellin or abscisic acid or any known small molecule.
19. The combination according to claim 17, wherein the non-chemical signal inducing heterodimerization is light with a predetermined wave length.
20. The combination according to claim 16, wherein the first protein or protein domain and the second protein or domain are selected from the group consisting of: i) FKBP and FRB; ii) FKBP and calcineurin catalytic subunit A (CnA); iii) FKBP and cyclophilin; iv) gyrase B (GyrB) and GyrB; v) DmrA and DmrC; vi) ABI and PYL1; vii) GAI and GID1; viii) CIB1 and CRY2; ix) LOV and PDZ; x) PIF and PHYB; xi) FKF1-GI; and xii) UVR8-COP1.
21. The combination according to claim 16, further comprising a donor DNA molecule, which is a single-stranded or double-stranded DNA molecule, particularly a single-stranded DNA molecule, wherein the donor DNA molecule may carry a desired mutation.
22. The combination according to claim 16, wherein the first component comprises Cas9 or Cas9 nickase and the second component comprises an exonuclease, or wherein the first component comprises dCas9 and the second component comprises a cytidine deaminase, preferably APOBEC.
23. A nucleic acid molecule, or a combination of nucleic acid molecules, comprising a first nucleic acid sequence encoding the first component (a) and a second nucleic acid sequence encoding the second component (b) of the combination according to claim 16.
24. A vector comprising the nucleic acid molecule(s) according to claim 23.
25. A cell or non-human organism comprising the combination according to claim 1, nucleic acid molecule(s) comprising a first nucleic acid sequence encoding the first component (a) and a second nucleic acid sequence encoding the second component (b) of the combination according to claim 1, or a vector comprising the nucleic acid molecule(s) comprising a first nucleic acid sequence encoding the first component (a) and a second nucleic acid sequence encoding the second component (b) of the combination according to claim 1, wherein the cell is not a human germ line cell.
26. A medicament comprising i) a combination as defined in claim 1, ii) a nucleic acid molecule comprising a first nucleic acid sequence encoding the first component (a) and a second nucleic acid sequence encoding the second component (b) of the combination according to claim 1, iii) a vector comprising nucleic acid molecule(s) comprising a first nucleic acid sequence encoding the first component (a) and a second nucleic acid sequence encoding the second component (b) of the combination according to claim 1, or iv) a cell or non-human organism comprising i), ii), or iii).
27. A method for treating a eukaryotic target cell or a eukaryotic target organism, comprising administering the medicament according to claim 26, wherein the eukaryotic target cell is not a human germ line cell and wherein the medicament results in genome editing.
28. The method according to claim 27, wherein the target cell is a vertebrate target cell, in particular a mammalian target cell, preferably a human target cell or wherein the target organism is a mammalian target organism, particularly a human.
29. The method according to claim 28, wherein the vertebrate target cell is an induced or embryonic pluripotent stem cell of a eukaryotic target organism, particularly a human induced or embryonic pluripotent stem cell.
30. The method according to claim 27, wherein the genome editing comprises introducing a donor DNA molecule optionally carrying a desired mutation, into the eukaryotic target cell or eukaryotic target organism, wherein said donor DNA molecule is a single-stranded or double-stranded DNA molecule.
31. The method according to claim 30, wherein said donor DNA molecule is a single-stranded DNA molecule.
32. A method for editing the genome of a eukaryotic target cell or eukaryotic target organism comprising introducing a combination as defined in claim 1, a nucleic acid molecule comprising a first nucleic acid sequence encoding the first component (a) and a second nucleic acid sequence encoding the second component (b) of the combination according to claim 1, or a vector comprising nucleic acid molecule(s) comprising a first nucleic acid sequence encoding the first component (a) and a second nucleic acid sequence encoding the second component (b) of the combination according to claim 1, into a eukaryotic target cell or eukaryotic target organism, wherein the cell is not a human germ line cell.
33. A method for the in vitro editing of a genome of a eukaryotic target cell, comprising introducing a combination as defined in claim 1, a nucleic acid molecule comprising a first nucleic acid sequence encoding the first component (a) and a second nucleic acid sequence encoding the second component (b) of the combination according to claim 1, or a vector comprising nucleic acid molecule(s) comprising a first nucleic acid sequence encoding the first component (a) and a second nucleic acid sequence encoding the second component (b) of the combination according to claim 1, into a eukaryotic target cell, wherein the cell is not a human germ line cell.
34. The method according to claim 33, wherein said eukaryotic target cell is a mammalian target cell.
35. The method according to claim 34, wherein said mammalian target cell is a human target cell.
Description
FIGURE LEGENDS
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
DEFINITIONS
[0022] The term CRISPR/Cas system, as used herein relates to one or more gRNA that guides catalytically active Cas9 or its variants or inactive nickase Cas9 or its variants protein to the desired genomic site where DSB formations are formed through specific Cas9 action after appropriate PAM recognition. Cas9 protein in this invention is fused with heterodimerization system at N- or C-terminus that allows tethering with certain exonucleases.
[0023] Cas protein, as used herein relates to Cas9 and its variants and homologous derived from Streptococcus pyogenes that recognizes NGG or NAG PAM. This invention relies also on all other DNA catalytically active or inactive endonucleases (dCas9) or nickases derived from all types of CRISPR system.
[0024] APOBEC polypeptide, as used herein relates to proteins that have deaminase activity and are connected with Cas9 and its variants and causes single base editing.
[0025] Genome editing, as used herein relates to any modification to genomic and/or non-genomic DNA due to CRISPR/Cas system and its efficiency to cause DSBs. Sequentially single base editing, knockin or knockout cells and/or organisms are processed.
[0026] Organism, as used herein relates to any living organism.
[0027] The term exonucleases as used herein, relates to any sort of enzymes that are able to cleave nucleotides from polynucleotide chain in 3′ and/or 5′ direction and are connected to heterodimerization system at N- or C-terminus.
[0028] The term “heterodimerization system”, as used herein, refers to a pair of peptides or peptide domains that form coiled-coils or that connect in the presence of an inductor or a signal for dimerization. The term “heterodimerization”, as used herein, refers to protein domains or peptide pairs that connect to other domains of a different type through covalent or non-covalent interactions. The term “constitutive dimerization domains”, as used herein, refers to dimerization domains that connect themselves independently, such as, for example, coiled coils. The term “inducible heterodimerization domain”, as used herein, refers to heterodimerization domains that merge only in the presence of a heterodimerization inductor.
[0029] The term “heterodimerization inductor” refers to a signal, a chemical or non-chemical ligand, which cause the heterodimerization of protein domains that do not have intrinsic affinity with each other and cannot be connected independently in the absence of a heterodimedimerization ligand or signal. A heterodimerization inductor according to the invention can be a small molecule, such as rapalog, abscisic acid, or gibberellin. According to this invention, a heterodimerization inductor can also be light with certain wavelength.
[0030] Light induced heterodimerization system, as used herein, refers to protein partners CIB1 or its homologous and CRY2PHR, derived from Arabidopsis thaliana or are produced synthetically and heterodimerize in the presence of blue light with certain wavelength, approximately 450 nm. Another blue light induced heterodimerization system is LOVpep and ePDZB protein partners, derived from Avena sativa. This invention also relates to 650 nm wavelength red light induced heterodimerization system, where protein partners PIF and PHYB or its synthetic homologous are used. Another light induced heterodimerization system that this invention relies is heterodimerization of FKF1 and GI protein partners from Gigantea sp. The term “chemical ligand”, as used herein, refers to a small molecule, such as rapamycin and its rapalogs that can bind to proteins, preferably to FKBP-FRB heterodimerization domains; to plant hormones, such as abscisic acid and giberellin that can bind to proteins, preferably to ABI-PYL1and GID-GAI1 heterodimerization domains.
[0031] The term peptide pair that form coiled coils, used herein refers to any peptide pair, heterodimerizing or homodimerizing peptides that express coiled coil structural motif, a combination of hydrophobic and electrostatic interactions between amino acid residues within heptads of alpha-helices that results in heterodimerization or homodimerization.
[0032] The term “orthogonal”, as used herein, refers to the characteristic of the components of the engineered CRISPR/Cas system tethered to certain exonucleases via different heterodimerization systems to take place separately, i.e., that the individual parts of different heterodimerization systems do not interact with parts of other heterodimerization systems of endogenous or exogenous signaling pathways. The main feature of the orthogonal system is that the input signal of each system leads to the heterodimerization independently of the presence or absence of other systems or their input and output signals.
[0033] The term “cell”, as used herein, refers to an eukaryotic or prokaryotic cell, a cellular or multicellular organism (cell line) cultured as a single cell entity that has been used as a recipient of nucleic acids and includes the daughter cells of the original cell that has been genetically modified by the inclusion of nucleic acids. The term refers primarily to cells of higher developed eukaryotic organisms, preferably vertebrates, preferably mammals. This invention relies also on non-vertebrates cells, preferably plant cells.
[0034] The term “cells” also refers to human cell lines and plant cells. Naturally, the descendants of one cell are not necessarily completely identical to the parents in morphological form and its DNA complement, due to the consequences of natural, random or planned mutations. A “genetically modified host cell” (also “recombinant host cell”) is a host cell into which the nucleic acid has been introduced. The eukaryotic genetically modified host cell is formed in such a way that a suitable nucleic acid or recombinant nucleic acid is introduced into the appropriate eukaryotic host cell. The invention hereafter includes host cells and organisms that contain a nucleic acid according to the invention (transient or stable) bearing the operon record according to the invention. Suitable host cells are known in the field and include eukaryotic cells. It is known that proteins can be expressed in cells of the following organisms: human, rodent, cattle, pork, poultry, rabbits and the like. Host cells may include cultured cell lines of primary or immortalized cell lines.
[0035] The term “nucleic acids”, as used herein, refers to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length and is not limited to single, double or higher chains of DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers with a phosphorothioate polymer backbone made from purine and pyrimidine bases or other natural, chemical or biochemically modified, synthetic or derived nucleotide bases.
[0036] The term “protein”, as used herein, refers to the polymeric form of amino acids of any length, which expresses any function, for instance localizing to a specific location, localizing to specific DNA sequence, facilitating and triggering chemical reactions, transcription regulation.
[0037] The term “recombinant”, as used herein, means that a particular nucleic acid (DNA or RNA) is a product of various combinations of cloning, restriction and/or ligation leading to a construct having structurally coding or non-coding sequences different from endogenous nucleic acids in a natural host system.
[0038] The insertion of the vectors into the host cells is carried out by conventional methods known from the field of science, and the methods relate to transformation or transfection and include: chemically induced insertion, electroporation, micro-injection, DNA lipofection, cellular sonication, gene bombardment, viral DNA input, as well as other methods. The entry of DNA may be of transient or stable. Transient refers to the insertion of a DNA with a vector that does not incorporate the DNA of the invention into the cell genome. A stable insertion is achieved by incorporating DNA of the invention into the host genome. The insertion of the DNA of the invention, in particular for the preparation of a host organism having stably incorporated a nucleic acid, e.g. a DNA, of the invention, can be screened by the presence of markers. The DNA sequence for markers refers to resistance to antibiotics or chemicals and may be included on a DNA vector of the invention or on a separate vector.
[0039] The insertion of the CRISPR/Cas tethered with certain exonucleases via different heterodimerization systems are delivered to the cell as plasmid DNA or as mRNA or a proteins or as RNA:protein complexes where different parts of CRISPR/Cas system tethered with certain exonucleases via different heterodimerization systems can be as DNA or RNA or protein.
DETAILED DESCRIPTION OF THE INVENTION
[0040] The invention relates to an enhanced CRISPR/Cas system that is made of a combination of two orthogonal protein partners of different heterodimerization (HD) systems or coiled-coil forming peptide pairs, connected with a Cas protein and certain exonucleases that reconstitute upon addition of an inductor of heterodimerization or via intrinsic affinity of peptide pairs that form coiled-coils. Functionally, enhanced CRISPR/Cas system influences the higher rate of genome editing based on larger insertion and/or deletion mutations that arise in higher percentage of genetically modified cells or organisms.
[0041] Chemical and non-chemical control over the activation of enhanced CRISPR/Cas system tethered to certain exonucleases via different heterodimerization systems of gene modified cells or organisms of this invention presents a novel way of gene editing in different research area, e.g. cancer therapy, new model organism production, new drug development etc.
[0042] The invention provides a combination comprising a first component (a) and a second component (b), wherein
[0043] a) the first component comprises an endonuclease capable of inducing a double stranded DNA break or a nickase capable of inducing a DNA nick, preferably a Cas protein or mutant thereof, fused with a first protein or protein domain, and
[0044] b) the second component comprises an exonuclease, fused to a second protein or protein domain,
[0045] wherein the first and the second components are capable of heterodimerizing with each other via interaction of the first protein or protein domain and the second protein or protein domain.
[0046] The combination of the invention represents a modified CRISPR/Cas system. The endonuclease of the first component (a) can in particular be a Cas protein, a Cas nickase or dCas9 protein. The second component (b) can in particular be an exonuclease or cytidine deaminase, in particular APOBEC protein.
[0047] According to a particular aspect of the invention, heterodimerization of the first protein or protein domain and the second protein or domain is inducible via a chemical or non-chemical signal. The (at least one) first protein or protein domain of the first component can be a single protein partner of a selected chemically or non-chemically inducible heterodimerization system (e.g. ABI-PYL1, FKBP-FRB or DmrC-DmrA, GAI-GID1) or non-chemically (e.g. CIBN-CRY2PHR, LOvpep-ePDZb, PIF-PHYB, FKF1-GI) that is genetically fused to a Cas protein or its variants; for example: CIBN or LOVpep or PIF or FKF1 or ABI or FKBP or GAI can be connected to a Cas protein or its variants (e.g. Cas9, Cas9nickase, Cpf1).
[0048] The second protein or protein domain of the second component can be a second protein partner of a selected heterodimerization system (e.g. ABI-PYL1, FKBP-FRB or DmrC-DmrA, GAI-GID1, CIBN-CRY2PHR, LOvpep-ePDZb, PIF-PHYB, FKF1-GI) that is genetically fused to a certain exonuclease (e.g. human EXO1, EXOIII E.coli, TREX2 etc.).
[0049] Addition of a chemical inductor of heterodimerization (HD) can trigger heterodimerization of the first component and the second component by heterodimerization of two protein partners (i.e. the at least one protein or protein domain and the second protein or protein domain), thereby resulting in a functional modified CRISPR/Cas system tethered with certain exonucleases, which can influence the genome modification of any GOI.
[0050] A chemical inductor for triggering heterodimerization of the at least one first protein or protein domain of the a) first component and the second protein or protein domain of the b) second component can be, e.g. rapalog (e.g. rapamycin) for triggering heterodimerization of a FKBP-FRB HD system (the at least one first protein domain is FKBP, the second protein domain is FRB), abscisic acid for triggering heterodimerization of a ABI-PYL1 HD system (the at least one first protein domain is ABI, the second protein domain is PYL1), gibberellin for triggering heterodimerization of a GID-GA1 HD system (the at least one first protein domain is GID, the second protein domain is GA1) or any other relevant physiological chemical signal.
[0051] Addition of a non-chemical inductor of heterodimerization (HD) can trigger heterodimerization of the first component and the second component by heterodimerization of two protein partners (i.e. the at least one protein or protein domain and the second protein or protein domain), thereby resulting in a functional modified CRISPR/Cas system tethered with certain exonucleases, which can influence the genome modification of any GOI.
[0052] A non-chemical inductor for triggering heterodimerization of the at least one first protein or protein domain of the a) first component and the second protein or protein domain of the b) second component can be light with appropriate wave length, e.g. blue light (e.g. 450 nm wave length) for triggering heterodimerization of a CIBN-CRY2PHR HD system (the at least one first protein domain is CIBN, the second protein domain is CRY2PHR) or LOVpep-ePDZb HD system (the at least one first protein domain is LOVpep, the second protein domain is ePDZb). Other inductor for light induced heterodimerization is red light (e.g. 650 nm wave length) for triggering heterodimerization of a PIF-PHYB HD system (the at least one first protein domain is PIF, the second protein domain is PHYB) or for triggering heterodimerization of a FKF1-GI HD system (the at least one first protein domain is FKF1, the second protein domain is GI) or any other relevant physiological non-chemical signal.
[0053] In a further embodiment of the invention, the heterodimerization between endonuclease or nickase (e.g. Cas protein or variant or mutant thereof) and certain exonuclease can be achieved using peptide pairs that form coiled-coils due to the intrinsic affinity and electrostatic interactions and thus bringing certain exonucleases into close proximity of DSB allowing exonuclease to additionally recise DNA in 3′ and/or 5′ manner. In this embodiment, enhancing the function of regular CRISPR/Cas system through additional DNA recizing with certain exonucleases can result in greater percentage of genome modification compared to normal CRISPR/cas system or system where CRISPR/Cas and certain exonucleases are cooexpressed in tested cell or organism (see, e.g.
[0054] The first component of peptide pair coiled-coil induced heterodimerization system can be at least one peptide or peptide domain from peptide pair that form coiled-coils of a selected peptide pairs (e.g. P3-P4, N5-N6, P3S-P4S etc) that is genetically fused to a Cas protein or its variants; for example: P3, N5 or P3S can be connected to Cas9 protein or its variants (e.g. Cas9, Cas9nickase, Cpf1 etc.).
[0055] The second component of peptide pair coiled-coil induced heterodimerization system can be at least one peptide or peptide domain from peptide pair that form coiled-coils of a selected peptide pairs (e.g. P3-P4, N5-N6, P3S-P4S etc.) that is genetically fused to a certain exonucleases (human EXO1, EXOIII E.coli, TREX2 etc).
[0056] In a further embodiment of the invention, the selected pair of peptide pair that form coiled-coils are chosen based on their physical properties (e.g. Kd values, their orthogonality properties etc.). Peptide pairs that form coiled-coils can have strong heterodimerization properties: for example, peptide pair N5-N6 exhibit stronger heterodimerization affinity than peptide pair P3S-P4S. From this follows that percentage of genome editing in N5-N6 used heterodimerizing peptide pair that form coiled-coils for enhanced CRISPR/Cas system tethered with certain exonucleases is greater than for the example where P3S-P4S heterodimerizing peptide pair that form coiled-coils is used, that exhibit poor heterodimerization properties.
[0057] In a further embodiment, heterodimerization of peptide pairs, which form coiled-coils, can be obtained by using peptide pairs that heterodimerize in parallel (e.g. N5-N6, P3-P4 etc.) or anti-parallel (e.g.P3-AP4) manner.
[0058] In a further embodiment the use of heterodimerization systems for tethering CRISPR/Cas system with certain exonucleases, additional DNA recession with certain exonucleases and sequential improvement in genome editing does not enhance possible off-target activities of CRISPR/Cas system.
[0059] In a further embodiment, the modified CRISPR/Cas system tethered to certain exonucleases via different heterodimerization systems according to the invention comprises several repeats of the at least one first protein domain and/or the second protein domain, e.g. 10 repeats of a coiled coil. In this embodiment, the genome editing can be further enhanced. Several repeats (for example 10 repeats of coiled coil of a peptide pair) of the at least one first protein domain can then bind to several repeats (for example 10 repeats of coiled coil) of the second protein domain, which is fused to certain exonuclease. The first component comprising the at least one first protein domain having several repeats then heterodimerizes with the second component comprising the second protein domain having several repeats after the appropriate chemical inductor is added. In this embodiment, the repeats can act as constitutive dimerization domains that assemble upon the heterodimerization signal by the chemical inductor as orthogonal coiled coil pairs.
[0060] In a further embodiment, the at least one first protein domain of the chemical signal-inducible heterodimerization protein complex of the first component is selected from the group consisting of the pairs: [0061] i) FKBP and FRB; [0062] ii) FKBP and calcineurin catalytic subunit A (CnA); [0063] iii) FKBP and cyclophilin; [0064] iv) gyrase B (GyrB) and GyrB; [0065] v) DmrA and DmrC; [0066] vi) ABI and PYL1; and [0067] vii) GAI and GID1, and
the second protein domain of the second component is selected from the group consisting of the pairs: [0068] i) FKBP and FRB; [0069] ii) FKBP and calcineurin catalytic subunit A (CnA); [0070] iii) FKBP and cyclophilin; [0071] iv) gyrase B (GyrB) and GyrB; [0072] v) DmrA and DmrC; [0073] vi) ABI and PYL1; and [0074] vii) GAI and GID1.
[0075] In a further embodiment, the at least one first protein domain of the light signal-inducible heterodimerization protein complex of the first component is selected from the group consisting of the pairs: [0076] i) CIB1 and CRY2; [0077] ii) LOV and PDZ; [0078] iii) PIF and PHYB; [0079] iv) FKF1-GI [0080] v) UVR8-COP1,
and the second protein domain of the second component is selected from the group consisting of the pairs: [0081] i) CIB1 and CRY2; [0082] ii) LOV and PDZ; [0083] iii) PIF and PHYB; [0084] iv) FKF1-GI [0085] v) UVR8-COP1.
[0086] In a further embodiment of the invention, the at least one first protein domain and the second protein domain can be from two different proteins and can have orthologous properties.
[0087] The invention further provides an isolated nucleic acid molecule, or a combination of isolated nucleic acid molecules, comprising a first nucleic acid sequence encoding the first component (a) and a second nucleic acid sequence encoding the second component (b) of the combination according to the invention as defined above. The invention further provides a vector, preferably an expression vector, encoding the nucleic acid molecule(s) of the invention.
[0088] In particular, the invention provides isolated nucleic acid molecules comprising sequences comprising or consisting of SEQ ID NOs: 1-18, as per the enclosed sequence listing. The invention further provides vectors comprising nucleic acid sequences comprising or consisting of SEQ ID NOs: 1-18, as per the enclosed sequence listing.
[0089] The invention further provides a vector encoding the isolated nucleic acids for protein isolation of the invention.
[0090] The invention further provides a cell or organism comprising the combination, the nucleic acid molecule(s) or the vector according to the invention as defined above, provided that the cell is not a human germ line cell.
[0091] The invention further provides the combination, the nucleic acid molecule(s) or the vector according to the invention as defined above for use in medicine, or for use as a medicament. The invention further provides the combination, the nucleic acid molecule(s) or the vector according to the invention as defined above for use in a method of treating cancer. In one embodiment of the invention, the aforementioned use comprises the use of a chemical inductor of heterodimerization. Preferably, the cells for use in a method of treating cancer are modified T cells. Preferably, the types of cancer to be treated according to the aforementioned use according to the invention include, CML, B-cell lymphoma, acute lymphoblastic leukemia, chronic lymphocytic leukemia, Hodgkins and Non-Hodgkins Lymphomas, mezotelioma, ovarian cancer, prostate cancer etc.
[0092] The invention further provides a method for making knockout cells or organisms in more efficient manner where invention provides the combination, the nucleic acid molecule(s) or the vector according to the invention as defined above where genome editing is enhanced by the tethered exonucleases.
[0093] The invention further provides a method for making knockin cells or organisms in more efficient manner where invention provides the combination, the nucleic acid molecule(s) or the vector according to the invention as defined above where genome editing is enhanced by the tethered exonucleases and by coaddition of template DNA.
[0094] The invention further provides the combination, the nucleic acid molecule(s) or the vector according to the invention as defined above for use as a tool for drug new sources of fuel development etc.
[0095] The examples described in more detail below are designed to best describe the invention. These examples do not limit the scope of the invention, but are merely intended to provide a better understanding of the invention and its use.
Example 1: Preparation of Constructs for Modified CRISPR/Cas System Tethered with Certain Exonucleases Via Different Heterodimerization Systems
[0096] Preparation of DNA coding for modified CRISPR/Cas system tethered with certain exonucleases via different heterodimerization systems. In order to prepare DNA constructs, the inventors used molecular biology methods such as: chemical transformation of competent E. coli cells, plasmid DNA isolation, polymerase chain reaction (PCR), reverse transcription—PCR, PCR linking, nucleic acid concentration determination, DNA agarose gel electrophoresis, isolation of fragments of DNA from agarose gels, chemical synthesis of DNA, DNA restriction with restriction enzymes, cutting of plasmid vectors, ligation of DNA fragments, purification of plasmid DNA in large quantities. The exact course of experimental techniques and methods are well known to experts in the field and are described in the manuals of molecular biology.
[0097] All the work was performed using sterile techniques, which are also well known to the experts in the field. All plasmids, completed constructs and partial constructs were transformed into the bacteria Escherichia coli by chemical transformation. Plasmids for transfection into cell lines (animal or human) have been isolated using a DNA isolation kit that removes endotoxins.
[0098] In the described cases, the Cas9 protein was selected from all types of CRISPR system. Exonucleases were selected among known exonucleases. The Cas9 was connected via a peptide linker with different protein domains of different heterodimerization systems or with peptide from peptide pairs that form coiled-coils at C-terminus. Exonucleases were connected via a peptide linker with different protein domains of different heterodimerization systems or with peptide from peptide pairs that form coiled-coils at N-terminus.
[0099] The sequences of Cas9 and certain exonucleases according to the invention are listed in Table 1. All operons were prepared by techniques according to methods known to experts in the field. The operons were inserted into plasmids suitable for eukaryotic systems. The suitability of the nucleotide sequence was confirmed by the inventors by sequencing and restriction analysis.
TABLE-US-00001 TABLE 1 Fusion proteins of components of exemplary artificial engineered NFAT2 transcription factors. 1 Cas9-P4 pcDNA3 Cas9 from Streptococcus pyogenes fused with P4 peptide, that form coiled-coil 2 Cas9-P3 pcDNA3 Cas9 from Streptococcus pyogenes fused with P3 peptide, that form coiled-coil 3 Cas9-N5 pcDNA3 Cas9 from Streptococcus pyogenes fused with N5 peptide, that form coiled-coil 4 Cas9-N6 pcDNA3 Cas9 from Streptococcus pyogenes fused with N6 peptide, that form coiled-coil 5 Cas9-P3S pcDNA3 Cas9 from Streptococcus pyogenes fused with P3S peptide, that form coiled-coil 6 Cas9-P4S pcDNA3 Cas9 from Streptococcus pyogenes fused with P4S peptide, that form coiled-coil 7 Cas9-AP4 pcDNA3 Cas9 from Streptococcus pyogenes fused with AP4 peptide, that form coiled-coil 8 P4-EXO111 pcDNA3 Exonuclease EXOIII, derived from Escherichia coli fused with P4 peptide, that form coiled-coil 9 P3-EXO111 pcDNA3 Exonuclease EXOIII, derived from Escherichia coli fused with P3 peptide, that form coiled-coil 10 N5-EXO111 pcDNA3 Exonuclease EXOIII, derived from Escherichia coli fused with N5 peptide, that form coiled-coil 11 N6-EXO111 pcDNA3 Exonuclease EXO111, derived from Escherichia coli fused with N6 peptide, that form coiled-coil 12 P3S-EXO111 pcDNA3 Exonuclease EXOIII, derived from Escherichia coli fused with P3S peptide, that form coiled-coil 13 P4S-EXO111 pcDNA3 Exonuclease EXOIII, derived from Escherichia coli fused with P4S peptide, that form coiled-coil 14 AP4-EXO111 pcDNA3 Exonuclease EXOIII, derived from Escherichia coli fused with AP4 peptide, that form coiled-coil 15 P3-TREX2 pcDNA3 Exonuclease TREX2, derived from Mus musculus fused with P3 peptide, that form coiled-coil 16 P4-TREX2 pcDNA3 Exonuclease TREX2, derived from Mus musculus fused with P4 peptide, that form coiled-coil 17 P3-EXO1 pcDNA3 Exonuclease EXO1, derived from Homo sapiens fused with P3 peptide, that form coiled-coil 18 P4-EXO1 pcDNA3 Exonuclease EXO1, derived from Homo sapiens fused with P4 peptide, that form coiled-coil
[0100] Methods and techniques of cultivating cell cultures are well known to experts in the field and are therefore briefly described in order to illustrate the implemented examples. Cells from the HEK293T cell line were grown at 37° C. and 5% CO.sub.2. For cultivation, a DMEM medium containing 10% FBS was used, containing all the necessary nutrients and growth factors. Cells K562 were grown in RPMI medium containing 10% FBS at 37° C. and 5% CO.sub.2. When the cell culture reached the appropriate density, the cells were grafted into a new breeding flask and/or diluted. For the use of cells in experiments, the number of cells was determined by a hemocytometer and seeded in density 1×10.sup.5 per hole into the microtiter plate with 24 holes 18-24 hours before transfection regarding HEK293 cells. The seeded plates were incubated at 37° C. and 5% CO.sub.2 until the cells were 50-70% confluent and ready for transfection by transfection reagent. The transfection was carried out according to the instructions of the transfection reagent manufacturer (e.g., JetPei, Lipofectamine 2000) and was adapted for the microtiter plate used. K562 (1×10.sup.4) were electroporated with the use of Neon electroporation system in 10 μl electroporation tips. Afterwards the cells were put in RPMI medium, containg 10% FBS in a well of 12 well plate. On the next day the inductor for heterodimerization were added if chemical and non-chemical induced heterodimerization system were used. 48 hours after transfection genomic DNA was isolated and desired area PCR amplified. Next T7E1 (T7 endonuclese 1) assay was performed to determine the percentage of indel mutations.
Example 2. Defining the Most Successful Exonuclease Cooexpressed with CRISPR/Cas System for Enhacing Genome Editing at eGFP Genomic Region
[0101] To detect the most efficient exonuclease cooexpression of certain exonucleases with CRISPR/Cas system was used. HEK293 cell line that stably expresses eGFP was used.
[0102] HEK293T, stably expressing eGFP cells, seeded in 24-well plates, were transfected one day prior to the experiment with plasmids, which encode for one of the examined exonuclease and a separate plasmid that encodes CRISPR/Cas system; Cas9 protein from Streptococcus pyogenes and gRNA (targeting sequence in eGFP genomic region: GGCGAGGGCGATGCCACCTA).
[0103] To analyze the genome editing activity of cooexpression of certain exonuclease and CRISPR/Cas system, cells were analyzed on flow cytometry 48 hours after transfection. We measured the fluorescence intensity in cell population respectively and presented results in % of MFI (mean fluorescence intensity)
Results:
[0104] It is clear from
Example 3. Activity of Modified CRISPR/Cas System Tethered with Certain Exonucleases Via Heterodimerizing Peptide Pairs that Form Coiled-Coils
[0105] To test the activity of modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs HEK293 cells were used to determine the activity of modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs. Cells were transfected with constructs that express CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs; for example Cas9-P3 or Cas9-P4 with combination of P3-EXO1 or P4-EXO1 or P3-EXOIII or P4-EXOIII or P3-mTREX2. For control, cells were transfected with regular CRISPR/Cas9 system or were cooexpressed with CRISPR/Cas9 system and certain exonuclease (e.g. EXO1 or EXOIII or mTREX2). gRNA for human EMX1 gene (targeting sequence: GAGTCCGAGCAGAAGAAGAA) or human VEGF gene (targeting sequence: GGTGAGTGAGTGTGTGCGTG) or human MYD88 (GGCTGAGAAGCCTTTACAGG) were used. 48 hours genomic DNA from transfected cells was isolated and genomic region around predicted DSB was PCR amplified. Next T7E1 assay was carried out. Presence and quantification of indel mutation was determined by Syber gold stained PAGE (polyacrylamide gel electrophoresis) gel analysis. Percentage of indel mutations was calculated by ImageJ software. Also next-generation sequencing (NGS) was performed from 150 base pair long amplicons.
Result:
[0106] PAGE gel analysis of T7E1 treated samples from transfected cells with appropriate constructs in
[0107] PAGE gel analysis of T7E1 treated samples from transfected cells with appropriate constructs in
[0108] PAGE gel analysis of T7E1 treated samples from transfected cells with appropriate constructs in
[0109]
Example 4: Genome Editing of Modified CRISPR/Cas System Tethered with Certain Exonucleases Via Heterodimerizing Peptide Pairs is not due to the Higher Cas9 Protein Expression
[0110] Higher percentage of genome editing for desired GOI can be enhanced due to higher cas9 protein expression. Genome editing of modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs is not due to the higher Cas9 protein expression.
[0111] To experimentally determine that higher genome editing of modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs is not due to Cas9 protein overexpression we visualized Cas9 protein content via western blot and anti-Cas9 specific immunodetection. To show the same Cas9 protein expression, HEK293 cells were transfected with constructs that express empty pcDNA3 plasmid, CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs; for example Cas9-P3 with combination of P4-EXOIII. For control, cells were transfected with regular CRISPR/Cas9 system or were cooexpressed with CRISPR/Cas9 system and certain exonuclese (e.g. EXOIII). gRNA for human MYD88 (target sequence: GGCTGAGAAGCCTTTACAGG) was used. 48 hours cell lysates were prepared. The same amount of protein, determined by standard BCA assay, was analyzed on SDS PAGE gel analysis. Next, western blot transfer was performed and afterwards the membrane was stained with specific anti-Cas9 antibodies.
Result:
[0112]
Example 5: Higher Genome Editing due to the Modified CRISPR/Cas System Tethered with Certain Exonucleases Via Heterodimerizing Peptide Pairs does not Increase Unwanted Genome Modification at Off-Target Sites
[0113] When using CRISPR/Cas system with enhanced functionality there are some possibilities that increased on-target action of CRISPR/Cas bears also additional amplified off-target effect. To show that the modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs does not increase unwanted genome modification at off-target sites HEK293 cells where transfected with designated constructs for CRISPR/Cas. With standard T7E1 assay 48 hours after transfection potential three off-target sites for MYD88 gRNA (target sequence: GGCTGAGAAGCCTTTACAGG) were analyzed. Due to bioinformatics tool for gRNA design and scoring three potential off-target sites for MYD88 gRNA were predicted, for example: off-target site 1 was found in ANKRD52 gene (target sequence: ACTGTAAAGGCTGCTCTCCC); off-target site 2 was predicted to be in FUT9 gene (target sequence: TGCAGAGGAGCCTTTACATG) and off-target site 3 was determined in PSKH2 gene (target sequence: GCCAGACAAGGCTTTACAGG).
Result:
[0114] PAGE gel analysis of T7E1 treated samples from transfected cells with appropriate constructs depicted in
[0115] In
[0116] In
Example 6: Modified CRISPR/Cas System Tethered with Certain Exonucleases Via Heterodimerizing Peptide Pairs Poses Anticancer Therapeutical Properties
[0117] Modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs poses anticancer therapeutical properties when the cause of cancer is in genomic rearrangements. CML (chronic myelogenous leukemia) patients in all cases bear Philadelphia chromosome or BCR-ABL fusion gene (t9, 22; q34;q11) between chromosome 9 and 22. This chromosome has the causative role for coding a hybrid kinase, a tyrosine kinase signaling protein. Constitutive signaling of this kinase is causing cells uncontrollably to divide and proliferate. To determine the possible anti-CML therapeutic option, K562 cells (stably expressing firefly luciferase; K562-fLUC), which carry BCR-ABL fusion gene were electroporated with plasmid DNA of designated CRISPR/Cas9 constructs. gRNA with targeting sequence GACCTGTCTTTTAGACAGGC for leading Cas9 to BCR-ABL fusion gene was used. 72 hours after electroporation of K562-fLUC cells, D-luciferin (Xenogen) was added and bioluminescence was measured by using IVIS® Lumina Series III (Perkin Elmer). Data were analyzed with Living Image® 4.5.2 (Perkin Elmer).
[0118] To test the activity of modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs K562 cells were used to determine the activity of modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs. Cells were electroporated with constructs that express CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs; for example Cas9-P3 or Cas9-P4 or Cas9-N5 with combination of P4-EXOIII or P3-EXOIII or N6-EXOIII. For control, cells were electroporated with regular CRISPR/Cas9 system or were cooexpressed with CRISPR/Cas9 system and certain exonuclease (e.g. EXOIII). gRNA for human BCR-ABL fusion gene (targeting sequence GACCTGTCTTTTAGACAGGC) was used. 48 hours later genomic DNA from cells was isolated and genomic region around predicted DSB was PCR amplified. Next T7E1 assay was carried out. Presence and quantification of indel mutation was determined by Syber gold stained PAGE (polyacrylamide gel electrophoresis) gel analysis. Percentage of indel mutations was calculated by ImageJ software.
Result:
[0119]
[0120] PAGE gel analysis of T7E1 treated samples from transfected cells with appropriate constructs in
The Invention will be further described by the following items:
1. Modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing systems comprising two components: [0121] a) a first component comprising a Cas protein, fused with at least one first protein domain of a chemical and non-chemical signal-inducible heterodimerization protein complex, and [0122] b) a second component comprising a certain exonuclease, fused to a second protein domain that binds to the at least one first protein domain of the chemical and non-chemical signal-inducible heterodimerization protein complex.
2. Modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs that form coiled-coils comprising two components: [0123] a) a first component comprising a Cas protein, fused with at least one first peptide of peptide pair that form coiled-coils, and [0124] b) a second component comprising a certain exonuclease, fused to a second peptide of peptide pair that form coiled-coils.
[0125] 3. Modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing systems of item 1, wherein the at least one first protein domain of the chemical and non-chemical signal-inducible heterodimerization protein complex of the first component is selected from the group consisting of the pairs: [0126] i) FKBP and FRB; [0127] ii) FKBP and calcineurin catalytic subunit A (CnA); [0128] iii) FKBP and cyclophilin; [0129] iv) gyrase B (GyrB) and GyrB; [0130] v) DmrA and DmrC; [0131] vi) ABI and PYL1; [0132] vii) GAI and GID1; [0133] viii) CIB1 and CRY2 [0134] ix) LOV and PDZ; [0135] x) PIF and PHYB; [0136] xi) FKF1-GI [0137] xii) UVR8-COP1.
wherein the second protein domain of the second component is selected from the group consisting of the pairs: [0138] i) FKBP and FRB; [0139] ii) FKBP and calcineurin catalytic subunit A (CnA); [0140] iii) FKBP and cyclophilin; [0141] iv) gyrase B (GyrB) and GyrB; [0142] v) DmrA and DmrC; [0143] vi) ABI and PYL1; [0144] vii) GAI and GID1; [0145] viii) CIB1 and CRY2 [0146] ix) LOV and PDZ; [0147] x) PIF and PHYB; [0148] xi) FKF1-GI [0149] xii) UVR8-COP1.
4. Modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs of item 2, wherein peptide pairs are selected from any peptides natural and non-natural origin that form coiled-coils.
5. The Modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing systems of items 1 and 3 or the modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs that form coiled-coils of items 2 and 4, uses endonuclease or one or more nickase from any CRISPR type systems.
6. The Modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing systems of items 1 and 3 and 5 or the modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs that form coiled-coils of items 2 and 4-5, uses endonuclease or one or more nickase from any CRISPR type systems that cause one or more DSBs or one or more DNA nicks.
7. The Modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing systems of items 1 and 3 and 5-6 or the modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs that form coiled-coils of items 2 and 4-6, uses any enzyme that recise DNA strands in 3′ and/or 5′ manner.
8. The Modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing systems of items 6 and 7 or the modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs that form coiled-coils of items 6 and 7, influence genome editing at any selected genomic regions.
9. The Modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing systems of items 8 or the modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs that form coiled-coils of items 8, influence genome editing at any selected genomic regions with any designed one or more gRNA.
10. The modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing systems of items 8 and 9 or the modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs that form coiled-coils of items 8 and 9, influence genome editing in prokaryotic and eukaryotic cells.
11. DSBs developed after function of modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing systems of items 10 or the modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs that form coiled-coils of items 10 repair in any cell-repair mechanisms.
12. The modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing systems of items 11 or the modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs that form coiled-coils of items 11 is used for knockin and knockout cell or organisms production.
13. For knockin production modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing systems of items 11 or the modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs that form coiled-coils of items 11 additional DNA template is present.
14. DNA template of item 13 is present as a ssDNA or dsDNA.
15. The modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing systems of items 1 ad 4 and 6-14 comprises a chemical and non-chemical inductor of heterodimerization capable of inducing functional reconstitution of the modified CRISPR/Cas system tethered with exonucleases.
16. The regulatory system of items 1 and 3, wherein the at least one first protein domain and the second protein domain are from two different proteins and have orthologous properties.
17. The peptide pairs of item 2 and 4 form coiled-coils in parallel and anti-parallel formation.
18. The heterodimerizing system of items 1 and 4 and 6-16, wherein the first and second component form a heterodimer in the presence of a chemical inductor of heterodimerization to form the chemical signal-inducible heterodimerization protein complex, wherein the chemical inductor preferably is a small molecule.
19. The heterodimerizing system of items 1 and 4 and 6-16, wherein the first and second component form a heterodimer in the presence of a non-chemical inductor of heterodimerization to form the non-chemical signal-inducible heterodimerization protein complex, wherein the non-chemical inductor preferably is a light with designated wavelength, appropriate for heterodimerizing system protein partners.
20. The modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing systems of items 12 or the modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs that form coiled-coils of items 12 edits BCR-ABL fusion gene, thereby resulting in decreased deviation and proliferation of cells.
21. An isolated nucleic acid comprising a nucleic acid encoding a) the first component and/or b) the second component of the with certain exonucleases via heterodimerizing systems of items 1-20 or the modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs that form coiled-coils of items 1-20.
22. A vector encoding the isolated nucleic acid(s) of item 21.
23. Delivery of modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing systems of items 1-20 or the modified CRISPR/Cas system tethered with certain exonucleases via heterodimerizing peptide pairs that form coiled-coils of items 1-20 as CasRNPs.
24. A cell or organism comprising the system of items 1-23.
25. The cell or organism from item 24 for use as a medicament, disese model, drug development model, biofuel production, new food discoveries, method for treating cancer, method for treating genomic mutation derived diseases.
26. The heterodimerization systems of item 3 and heterodimerizing peptide pairs that form coiled-coils from claim 4 can be used for tethering dCas9 or Cas9 nickase with cytidine deaminase APOBEC.