RESISTANCE IN PLANTS OF SOLANUM LYCOPERSICUM TO THE TOBAMOVIRUS TOMATO BROWN RUGOSE FRUIT VIRUS

Abstract

The invention relates to a Solanum lycopersicum plant resistant to Tomato Brown Rugose Fruit virus comprising in its genome the combination of the Tm-1 resistance gene on chromosome 2, and at least one quantitative trait locus (QTL) chosen from QTL3 on chromosome 11, QTL1 on chromosome 6 and QTL2 on chromosome 9, that independently confer to the plant foliar and/or fruit tolerance to TBRFV, wherein said QTLs are present in the genome of a plant of the seeds HAZTBRFVRES1 NCIMB accession number 42758. The combination of at least one of these QTLs with the Tm-1 gene delays, reduces or inhibits the replication or multiplication of the virus in the plants of the invention. The invention is also directed to parts of these plants with TBRFV resistance phenotype, as well as progeny, to the use of these plants for introgressing the resistance in another genetic background, as well as to different methods for obtaining tomato plants or seeds with increased resistance to Tomato Brown Rugose Fruit virus.

Claims

1. A Solanum lycopersicum plant resistant to Tomato Brown Rugose Fruit virus (TBRFV) comprising in its genome the combination of: a. the Tm-1 resistance gene on chromosome 2, and b. at least one quantitative trait locus (QTL) chosen from QTL3 on chromosome 11, QTL1 on chromosome 6 and QTL2 on chromosome 9, that independently confer to the plant foliar and/or fruit tolerance to TBRFV, wherein said QTLs are present in the genome of a plant of the seeds HAZTBRFVRES1 NCIMB accession number 42758.

2. A S. lycopersicum plant according to claim 1 comprising in its genome the combination of: a. the Tm-1 resistance gene on chromosome 2, preferably homozygously, b. said QTL3 on chromosome 11 homozygously, and c. said QTL2 on chromosome 9 heterozygously.

3. A S. lycopersicum plant according to claim 1 comprising in its genome the combination of the Tm-1 resistance gene and at least two QTLs chosen amongst QTL1, QTL2 and QTL3, wherein at least one of said QTLs is heterozygous.

4. A S. lycopersicum plant according to claim 1 comprising homozygously in its genome the combination of: a. the Tm-1 resistance gene on chromosome 2, and b. said QTL3 on chromosome 11.

5. A S. lycopersicum plant according to any one of claims 1 to 4, wherein said plant delays, reduces or inhibits the replication or multiplication of the virus or reduces the virus titer in the plant.

6. A S. lycopersicum plant according to any one of claims 1 to 5, wherein said TBRFV virus is the Israeli strain of TBRFV.

7. A S. lycopersicum plant according to any one of claims 1 to 6, further comprising the Tm-2 resistance gene, preferably heterozygously.

8. A S. lycopersicum plant according to any one of claims 1 to 7, wherein said QTLs are to be found, for QTL1, on chromosome 6, within the chromosomal region delimited by TO-0005197 (SEQ ID NO:1) and TO-015581 (SEQ ID NO:2), for QTL2, on chromosome 9, within the chromosomal region delimited by TO-0180955 (SEQ ID NO:3) and TO-0196109 (SEQ ID NO:6) and for QTL3, on chromosome 11, within the chromosomal region delimited by TO-0122252 (SEQ ID NO:7) and TO-0162427 (SEQ ID NO:18).

9. The S. lycopersicum plant according to any one of claims 1 to 8, characterized by the presence in the genome of said S. lycopersicum plant of at least one of the following alleles: allele T of TO-0005197 and/or allele C of TO-0145581 for the presence of QTL1, allele G of TO-0180955 and/or allele C of TO-0196724 and/or allele G of TO-0145125 and/or allele G of TO-0196109 for the presence of QTL2, allele T of TO-0122252 and/or allele C of TO-0144317 and/or allele T of TO-0142270 and/or allele G of TO-0142294 and/or allele A of TO-0142303 and/or, allele A of TO-0142306 and/or allele G of TO-0182276 and/or allele G of TO-0181040 and/or allele G of TO-0123057 and/or allele A of TO-0125528 and/or allele C of TO-0162432 and/or allele T of TO-0162427 for the presence of QTL3, in combination with allele A of SNP marker TO-0200838 (SEQ ID No: 21).

10. The plant according to any one of claims 1 to 9, wherein said plant is a progeny of an hybrid between a plant grown from the seeds of HAZTBRFVRES1 (NCIMB accession number 42758) and a S. lycopersicum plant bearing the Tm-1 gene.

11. A cell of a S. lycopersicum plant according to any one of claims 1 to 10, comprising in its genome the combination of the Tm-1 gene and at least one of said QTL1 on chromosome 6, said QTL2 on chromosome 9 and/or said QTL3 on chromosome 11, wherein said combination confers the resistance to TBRF virus.

12. Plant part of a S. lycopersicum plant according to any one of claims 1 to 10, in particular seeds, explants, reproductive material, scion, cutting, seed, fruit, root, rootstock, pollen, ovule, embryo, protoplast, leaf, anther, stem, petiole or flowers, wherein said plant part comprises cells according to claim 11.

13. Seed of a S. lycopersicum plant, which develops into a plant resistant to TBRFV according to any one of claims 1 to 10.

14. A tissue culture of cells of the plant according to any one of claims 1 to 10, wherein the cells are derived from embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, stems, petioles, roots, root tips, seeds, flowers, cotyledons, and/or hypocotyls, and contain in their genome said QTL1 on chromosome 6, said QTL2 on chromosome 9 and/or said QTL3 on chromosome 11 independently conferring fruit or foliar tolerance to TBRF virus, in combination with the Tm-1 gene.

15. A method for detecting and/or selecting S. lycopersicum plants resistant to TBRFV, inhibiting, reducing or delaying the replication of the virus, comprising the steps of: a. Detecting at least one of the following markers: allele T of TO-0122252, allele C of TO-0144317, allele T of TO-0142270, allele G of TO-0142294, allele A of TO-0142303, allele A of TO-0142306, allele G of TO-0182276, allele G of TO-0181040, allele G of TO-0123057, allele A of TO-0125528, allele C of TO-0162432 and allele T of TO-0162427, and b. Detecting the homozygous presence of the Tm-1 gene, preferably detecting allele A of SNP marker TO-0200838.

16. A method for detecting and/or selecting S. lycopersicum plants resistant to TBRFV, inhibiting, reducing or delaying the replication of the virus, said method comprising: a) Assaying tomato plants for the combination in its genome of the Tm-1 resistance gene on chromosome 2, and at least one genetic marker genetically linked to a QTL chosen from QTL3 on chromosome 11, QTL1 on chromosome 6 and QTL2 on chromosome 9, independently conferring to the plant foliar and/or fruit tolerance to TBRFV, b) Selecting a plant comprising the Tm-1 gene and the genetic marker and the chosen QTL conferring foliar and/or fruit tolerance to TBRFV, wherein the chosen QTL and the genetic marker are to be found, for QTL1, on chromosome 6, within the chromosomal region delimited by TO-0005197 (SEQ ID NO:1) and TO-015581 (SEQ ID NO:2), for QTL2, on chromosome 9, within the chromosomal region delimited by TO-0180955 (SEQ ID NO:3) and TO-0196109 (SEQ ID NO:6) and for QTL3, on chromosome 11, within the chromosomal region delimited by TO-0122252 (SEQ ID NO:7) and TO-0162427 (SEQ ID NO:18).

17. A method for conferring resistance to TBRFV to S. lycopersicum plants, comprising the steps of: a) Crossing a plant grown from the deposited seeds NCIMB 42758, or progeny thereof, bearing QTL1, QTL2 and/or QTL3 conferring TBRFV tolerance, and a S. lycopersicum plant, preferably devoid of said QTL(s), and bearing the Tm-1 gene, b) Selecting a plant in the progeny thus obtained, bearing one, two or three of the QTL1, QTL2 and/or QTL3 in combination with the Tm-1 gene; c) Optionally self-pollinating one or several times the plant obtained at step b) and selecting in the progeny thus obtained a plant having resistance to TBRFV, wherein said resistance delays, reduces or inhibits the replication or multiplication of the virus.

18. A method for conferring resistance to TBRFV to S. lycopersicum plants, comprising the steps of: a1) Crossing a plant grown from the deposited seeds NCIMB 42758 or progeny thereof, bearing QTL1, QTL2 and/or QTL3 conferring TBRFV tolerance, and a S. lycopersicum plant, preferably devoid of said QTL(s), and bearing the Tm-1 gene, thus generating F1 hybrids, a2) Selfing the F1 hybrids to create F2 population, b) Selecting individuals in the progeny thus obtained having resistance to TBRFV, wherein said resistance delays, reduces or inhibits the replication of the virus.

19. The method of claim 17 or 18, wherein SNPs markers are used in steps b) and/or c) for selecting plants bearing QTL1, QTL2 and/or QTL3 conferring TBRFV tolerance and/or for selecting plants bearing the Tm-1 gene.

20. A method for breeding S. lycopersicum plants having resistance to TBRFV, comprising the steps of crossing a plant grown from the deposited seeds NCIMB 42758 or progeny thereof bearing QTL1, QTL2 and/or QTL3 conferring TBRFV tolerance, with a S. lycopersicum plant bearing the Tm-1 gene.

21. A S. lycopersicum plant obtainable by the method according to any one of claims 17 to 20.

22. A method for improving the yield of tomato plants in an environment infested by TBRFV comprising growing resistant tomato plants comprising in their genome the combination of: a. the Tm-1 resistance gene on chromosome 2, and b. at least one QTL, and preferably two QTLs, chosen from QTL3 on chromosome 11, QTL1 on chromosome 6 and QTL2 on chromosome 9, wherein said QTLs are present in the genome of a plant of the seeds HAZTBRFVRES1 NCIMB accession number 42758 and independently confer to tomatoes foliar and/or fruit tolerance to TBRFV.

23. The method according to claim 22, wherein said plant comprises the combination of the Tm-gene on chromosome 2 and a QTL on chromosome 11, wherein said QTL is present in the genome of a plant of the seeds HAZTBRFVRES1 NCIMB accession number 42758 and confers foliar tolerance to TBRFV.

24. A method for reducing the loss on tomato production in condition of TBRFV infestation, comprising growing resistant tomato plants comprising in their genome the combination of: the Tm-1 resistance gene on chromosome 2, and at least one QTL, and preferably two QTLs, chosen from QTL3 on chromosome 11, QTL1 on chromosome 6 and QTL2 on chromosome 9, wherein said QTLs are present in the genome of a plant of the seeds HAZTBRFVRES1 NCIMB accession number 42758 and independently confer to tomatoes foliar and/or fruit tolerance to TBRFV.

25. A method of protecting a field, tunnel, greenhouse or glasshouse of tomato plants from TBRFV infestation, comprising growing resistant tomato plants comprising in their genome the combination of: the Tm-1 resistance gene on chromosome 2, and at least one QTL, and preferably two QTLs, chosen from QTL3 on chromosome 11, QTL1 on chromosome 6 and QTL2 on chromosome 9, wherein said QTLs are present in the genome of a plant of the seeds HAZTBRFVRES1 NCIMB accession number 42758 and independently confer to tomatoes foliar and/or fruit tolerance to TBRFV.

26. Use of a tomato plant resistant to TBRFV for controlling TBRFV infestation of a field, tunnel, greenhouse or glasshouse, wherein said tomato plant comprises in its genome the combination of the Tm-1 resistance gene on chromosome 2, and at least one QTL, and preferably two QTLs, chosen from QTL3 on chromosome 11, QTL1 on chromosome 6 and QTL2 on chromosome 9, wherein said QTLs are present in the genome of a plant of the seeds HAZTBRFVRES1 NCIMB accession number 42758 and independently confer to tomatoes foliar and/or fruit tolerance to TBRFV.

Description

LEGEND OF FIGURES

[0195] FIG. 1: Results of the first ELISA tests conducted at 45 DPI (“Microlab” 1st scoring at 45 DPI) illustrating the presence or absence of TBRFV coat protein in leaves of tested plants.

[0196] This figure reports the optical density, as measured at 405 nm in the ELISA test, for 4 different plants.

[0197] FIG. 2: Results of the ELISA tests conducted at 75 DPI (“Microlab” 2.sup.nd scoring at 75 DPI) illustrating the presence or absence of TBRFV coat protein in leaves of tested plants.

[0198] This figure reports the optical density, as measured at 405 nm in the ELISA test, for 4 different plants.

[0199] FIG. 3: Results of the ELISA tests conducted at around 110 DPI illustrating the presence or absence of TBRFV coat protein in leaves of tested plants.

[0200] This figure reports the optical density, as measured at 405 nm in the ELISA test, for 4 different plants.

[0201] FIG. 4: Results of the ELISA tests conducted at 70 DPI on different QTLs combinations, illustrating the presence or absence of TBRFV coat protein in leaves of tested plants.

[0202] FIG. 5: Results of the ELISA tests conducted at 91 DPI on different QTLs combinations, illustrating the presence or absence of TBRFV coat protein in leaves of tested plants.

[0203] FIG. 6: Results of the evaluation of foliar symptoms at 31 days post ToBRFV inoculation.

[0204] Ch11-S, Ch11-H, Ch11-R means respectively absence of QTL3 on chromosome 11 (S), presence heterozygously of said QTL3 (H), or presence homozygously of said QTL3 (R).

[0205] Ch9-S, Ch9-H, Ch9-R means respectively absence of QTL2 on chromosome 9 (S), presence heterozygously of said QTL2 (H), or presence homozygously of said QTL2 (R).

[0206] Tm1-S, Tm1-H, Tm1-R means respectively absence of Tm-1 gene on chromosome 2 (S), presence heterozygously of the Tm1 gene (H), or presence homozygously of said Tm1 gene (R).

[0207] FIG. 7: Results of the ELISA tests conducted at 35 DPI on different QTLs combinations, illustrating the presence or absence of TBRFV coat protein in leaves of tested plants.

[0208] This figure reports the optical density, as measured at 405 nm in the ELISA test. The QTLs and Tm1 gene combinations are as explained for FIG. 6.

[0209] FIG. 8: Results of the evaluation of fruit symptoms at 112 days post ToBRFV inoculation.

[0210] The genotypes tested are as detailed for FIG. 6.

EXAMPLES

Example 1: Material and Methods

[0211] Lines Description:

[0212] Line Haz-Tm1:

[0213] This line is a commercial indeterminate tomato of loose type with regular round and red fruits of about 120 g. The plant has light green foliage and is resistant to TMV race 0.

[0214] Test resistance: Line Haz-Tm1 was tested in 2 repeats of 10 plants each (total of 20 plants) for TBRFV resistance. The susceptible controls used were as follow (table 2):

TABLE-US-00002 TABLE 2 Susceptible No. of Foliar Fruit control name Rep. plants symptoms symptoms HA-29628 1 10 Severe Light HA-29628 2 10 Severe Light HA-29406 1 10 Severe Severe HA-29406 2 10 Severe Severe “Rep” is the number of the repeat “No. of plants” is the number of plants in the repeat.

[0215] Line NB2: Used to Make the Population

[0216] This line is an indeterminate tomato of loose type with globe and intense red fruits of about 160 gr. The plant has dark green foliage and is resistant to Stemphylium, Verticillium, Nematode, Fol race 1 race 2, TMV race 2.

[0217] Symptoms:

[0218] The symptoms of TBRFV infection are as follows:

[0219] Mild foliar symptoms: usually mosaic which is not severe, without significant distortion of the leaflets shape.

[0220] Severe foliar symptoms: leaflets are distorted, in many cases there is also “shoestrings” symptoms, almost always mosaic is severe.

[0221] Mild fruit symptoms: some yellow lesions (sometimes looks like “blotchy” symptoms), but no misshapen, distorted fruits.

[0222] Severe fruit symptoms: typical misshapen fruits, sometimes also “chocolate spots”.

[0223] TBRFV symptoms Scoring: 4 scoring values, as described in WO2018/219941, with 4 corresponding to the absence of symptoms and 1 corresponding to severe symptoms.

[0224] ELISA Protocol:

[0225] Each sample containing 1-2 tomato leaves is crushed with homogenizer.

[0226] 3 ml buffer SEB (Sample Extraction Buffer) were added and the sample is homogenized with bag mixer for 30 seconds.

[0227] The ToMV prime ELISA protocol of PrimeDiagnostics was then followed; this diagnostic test was chosen as it allows the detection of ToBRFV infection, although designed for ToMV infection.

[0228] Student's T-Test

[0229] The t-test is used to determine if the means of two sets of data are significantly different from each other.

[0230] In the comparison circles graph (see Figures), the position of the circles corresponds to the means of the various groups. The distance between the circles' centers represents the actual difference. The outside angle of intersection of the comparison circles is informative about whether the group means are significantly different.

[0231] Circles for means that are significantly different either do not intersect, or intersect slightly, so that the outside angle of intersection is less than 90 degrees.

[0232] Markers:

[0233] The SNP markers suitable for detection of tolerance QTLs are disclosed below.

[0234] Table 3: list of SNPs, their position and the alleles found in susceptible plants (1st nucleotide mentioned: S allele) vs. the alleles of the markers linked to the tolerance (2.sup.nd nucleotide mentioned: T allele). Table 4: sequences of the SNPs.

TABLE-US-00003 TABLE 3 SNP Chromosome Position SL2.40 S/T allele TO-0005197  6 33932438 C/T TO-0145581  6 33933905 T/C TO-0180955  9  4800680 A/G TO-0196724  9  5203457 T/C TO-0145125  9 40025769 A/G TO-0196109  9 59014540 T/G TO-0122252 11  8090264 A/T TO-0144317 11  8334467 T/C TO-0142270 11  8633469 C/T TO-0142294 11  8764030 A/G TO-0142303 11  8903092 C/A TO-0142306 11  9318832 G/A TO-0182276 11  9548029 A/G TO-0181040 11  9797143 A/G TO-0123057 11  9825111 T/G TO-0125528 11  9837711 G/A TO-0162432 11 10015478 T/C TO-0162427 11 10018811 C/T

TABLE-US-00004 TABLE 4 Sequences of the SNPs linked to the tolerance QTLs 'DFJ Sequence of the SNPs: the allele associated with the Tomato Brown SEQ ID rugose Fruit virus tolerance in mentioned second in the bracket TO-0005197  1 GTCGGACCAAGAAACCATATTTGGTAACGGGTTCGAGTTGCTGCCTGAACCTTTTAGCCC[C/T] TTGCAATATTTGTGAAGTGATATTCCTTTGTGTTATTATAATTTTTCGTTTTGAGTTTT TO-0145581  2 TTCAGAGAGCAACACTCCTGCAAGACCAACTCGGAGTAATTCAGTAACTCGACCTTCCAT[T/C] TCTAGCTCTCAGTATAGTACTTACTCAAATAAATCAGGCTCTATTCTAAACACAAGCTCT TO-0180955  3 TTCCGAAATGAGGACGATCCATCAGCTTCTTCAGCTGAGAGCCCCTGGTC[A/G]ACATACCAG AATTCTGTTTTTCTAAAACTGTCCAAAATCTCCTGTAAAGA TO-0196724  4 GATTTGAATGCCTTGCCACAGCCAGAGGATGACGA[T/C]GAGATTTTTGGACAACAATTAGAA GATGAACCACA TO-0145125  5 AGAGAATGATATCACTGCCTTAGTTTCTCAATTAAAAGTTGTGCAAAAACAAAACACACA[A/G] CTAGATGAAGAAAACAGAGCATTCGCCTCAAAGCTTCAGACAAAAGAAGTTGAGAACAAC TO-0196109  6 TACAATACCTTCTGGCATCCCTTTCCGCAAAACGA[T/G]AGATCTTTAGTATCAAAACCGAGAG CACTGTCACC TO-0122252  7 ATGGCAATAGTGAACTGCAGATACAACTGAAATTGCAGAACACCCTTAAA[A/T]ATAGAATCA ATAGAAAGTTGCAACAATATTTGAATGATGAAGCAACAAAG TO-0144317  8 AGCCATTGTGATTGTGTCTGTTGTACATTACCAAAATTCTCTAGAGAAAG[T/C]GATACACAT GCCAGCCCTATCGATATAAAGCAACGCAAGGTGGATTCTGC TO-0142270  9 AACACCAGGTAGAGAGCACAGCGAAACAATGGCCTCAGGAAGATCTACTT[C/T]GCGAAGTGC AGCAAGCCACTCCATACCTCCACCAGGCTTTGATTTCAGTG TO-0142294 10 TCAACTGCAACTTTAACAGCTGATTCAACTTCTTCTTCTTTCGAAACATC[A/G]CATTGAATG TAACGACCTCCAATAGATTCAGCTAAACTTGTACCTACTTC TO-0142303 11 GAGGAGCTATCAACTTCATAGTCAGATTCAGAAAATGATTCAGATGAGGA[C/A]GTGGCTGAT TCTTCTTGTTTTCTTTTCTTCCTTCTGCTCGAACTCTCTCC TO-0142306 12 CAGAAATAATAGAAAATCAGAAAGAAAAATCAGCTTTCTAAATGGAAAAG[G/A]CGATGGCAC TATGTTTGAAGTTTTAAGCAACTTTTCTGAAGTCCCAAAAG TO-0182276 13 CTCCTATTGAACATCCTGAAAACTTGTGTCTACATCATGAGAAGATGCAGGCCAATC[A/G]CT CAGTACATGGAATGCACGAGCATGTTAGGGGAATTCTAACGCAAAGCATAAGCTTGATACTTGA ATAAAAGATGAAACATACTTACTTCTTCTCAAACT TO-0181040 14 CTCTTGGTGACAAACCACTGGCTCAATTTCTTCGCGAAGCTAAAGCTATC[A/G]CTGATGAGC TTGTCACGGCAGGCACACGTGTCTCCTGATGAATTCAATGC TO-0123057 15 CATTACTGTTGAGATATCTCATCGGCAACCCCTGGAGCTTGCCCACCCGC[T/G]TGTCCTCCA GGATCTGATTTCAGAAAGGATGAATAGTAACTGTGTTTCAG TO-0125528 16 CAAGAACCCAACGACTTCTTCTTCTTTGCTTATTGAAAAACTTGGTTTTGAAATGAAAGG[G/A] ATCGAGAAATTGGATACTCAGTGGTTCTCTACTACTAAACCTTCTCCTGATTTTAAGAAA TO-0162432 17 TGATCGACAATTCTTGTTGTTGTTGAAACTCTGCAAGTGAGAGAGGGATG[T/C]ATATAG AG AAAGGATATTGGTAAAGGACAATTCTAGAAGGGTCTAGGGAA TO-0162427 18 GCACCAGTTATAGTAATGTCCTGCTTCTTTCCTGTACCCTTATCAGTAGC[C/T]GTGACAGAA AGAATACCGTTGGTGTCAATGTCGAACTTCACTTCAATCTG

[0235] For Tm-1, a marker was developed based on information of Ishibashi et al, 2007: Four in-gene SNPs were defined, KASPar assays were developed and only one was found to be suitable.

[0236] Marker code: TO-0200838

[0237] Sequence of the SNP: the allele associated with the virus resistance is mentioned first (i.e. A) in the bracket:

TABLE-US-00005 (SEQ ID No: 21) CAAAGCTCTT/GGAAACTTTCCTAAGTAT/AAGCTAATG[A/G]TGAAC AGAATCTTGCTGGAGTA/GATTGGCCTTGGGGGTAGTGGAGGAACA.

[0238] KASPar Marker Primers:

[0239] Primer Forward Fam:

TABLE-US-00006 (SEQ ID No: 22) GAAGGTGACCAAGTTCATGCTCAATYACTCCAGCAAGATTCTGTTCAT

[0240] Primer Forward Vic:

TABLE-US-00007 (SEQ ID No: 23) GAAGGTCGGAGTCAACGGATTACTCCAGCAAGATTCTGTTCAC

[0241] Primer Reverse Common:

TABLE-US-00008 ((SEQ ID No: 24) CAAAGCTCTKGAAACTTTCCTAAGTA

Example 2: Resistance Sources

[0242] First Resistance Source

[0243] The inventors have first identified a cultivated tomato (Solanum lycopersicum) line—line Haz-Tm1 as having high level of foliar resistance to TBRFV. This line was also known to contain the gene Tm-1.

[0244] According to the literature and known to the skilled breeder, the Tm-1 was initially introgressed from a wild tomato species Solanum habrochaites PI126445 into the cultivated tomato species Solanum lycopersicum view a view to imparting ToMV/TMV resistance. Resistance by this gene to ToMV was however broken within a year of its introduction to commercial tomato cultivars in 1960s. Therefore, this gene is rarely, if any, found in the currently commercial varieties and can no longer be considered as a resistance gene to ToMV or TMV.

[0245] A marker for Tm-1 gene (on chromosome 2) was developed based on the public gene sequence. Four SNPs were defined, KASPar assays were developed and only one was found to be suitable. The inventors first found that line Haz-Tm1 was highly resistant to TBRFV, in two trials under artificial laboratory test.

[0246] The inventors then later also screened the line Haz-Tm1 for fruit resistance under field conditions in greenhouse trial (natural infection). The trial was transplanted in a 4 dunam (corresponding to 4,000 m.sup.2) greenhouse. The results showed that line Haz-Tm1 exhibited mild symptoms of TBRFV on the fruits, mostly at the latest stages of the plant growth. It was concluded that line Haz-Tm1 probably has high resistance to foliar symptoms and mild and insufficient resistance to fruit symptoms.

[0247] Line Haz-Tm1 was then re-tested in tests, including ELISA test, which included: [0248] (1) sowing in “54” trays, [0249] (2) mechanical inoculation of young seedlings [0250] (3) scoring—observation of Tobamoviruses symptoms [0251] (4) Checking presence/absence of the virus with an Immunostrip kit (AGDIA) and with an ELISA test in three-point times [0252] (5) plantlets planted in the greenhouse to full growing cycle.

[0253] Sowing in nursery trays on 9.sup.th October

[0254] Mechanical inoculation: on 31.sup.st October

[0255] Transplanting part of the trial in Brurim (greenhouses GH 3 and 4): 5.sup.th November

[0256] Transplanting part of the trial in Mivtahinn greenhouse: 13.sup.th November

[0257] 1.sup.st Scoring and sampling for ELISA test: 16.sup.th and 17.sup.th December

[0258] 2.sup.nd Scoring and sampling for ELISA test: 14.sup.th January

[0259] 3.sup.rd Scoring and sampling for ELISA test: 19.sup.th February.

[0260] The results of the 1.sup.st scoring, around 45 days post inoculation (DPI) are detailed in table 5. At this stage, there are no fruits, thus only the foliar resistance is assayed.

TABLE-US-00009 TABLE 5 1.sup.st scoring of foliar symptoms at 45 DPI Total mild Severe no. of Healthy symptoms symptoms No. Line name Location plants (score 4) (score 2 or 3) (score 1) Remarks 1 Haz. Tm-S  GH. 3  5  5 Typical GH. 4  5  5 “shoestrings” Mivtahim 10 10 4 Haz. Tm-1  GH. 3  5 5 GH. 4  5 5 Mivtahim 10 9  1 5 Haz. Tm-22 GH. 3  5  5 Typical severe GH. 4  5  5 mosaic Mivtahim 10 10

[0261] The results of the ELISA test are illustrated in FIG. 1.

[0262] 2.sup.nd Scoring

[0263] The phenotypic scoring of the 2.sup.nd scoring gave similar results as obtained in the 1st scoring. The results of the ELISA test are illustrated in FIG. 2.

[0264] 3.sup.rd scoring

[0265] The results of the 3.sup.rd scoring, around 110 DPI are detailed in table 6. At this stage, there are fruits, thus foliar and fruit resistance are scored.

TABLE-US-00010 TABLE 6 3.sup.rd scoring of foliar symptoms at 110 DPI Foliar symptoms Fruit symptoms Mild Mild Total No symp. Severe No symp. Severe no. of symp. (score 2 symp. symp. (score 2 symp. No. Line name Location plants (score 4) or 3) (score 1) (score 4) or 3) (score 1) 1 Haz. Tm-S  GH. 3  5  5  5 GH. 4  5  5  5 Mivtahim 10 10 10 4 Haz. Tm-1  GH. 3  5 5  5 GH. 4  5 5  5 Mivtahim 10 10 10 5 Haz. Tm-22 GH. 3  5  5  5 GH. 4  5  5  5 Mivtahim 10 10 10

[0266] The results of the ELISA test are illustrated in FIG. 3.

[0267] The ELISA results suggest that line Haz. Tm-1 has a defense mechanism that delays the virus reproduction in the plant.

[0268] Second Resistance Source

[0269] WO2018219941 discloses tolerance QTL to TBRFV, essentially a foliar tolerance QTL, QTL3, on chromosome 11 and two fruit tolerance QTLs, QTL1 and 2, on chromosomes 6 and 9 respectively.

Example 3: Combining by Crossing the Two Sources

[0270] Population Creation:

[0271] A cross between line Haz-Tm1 and line-NB2 was done to produce F1 seeds, the F1 was later self pollinated to produce F2 seeds. F2 seeds were sown in trays and selection for homozygous to tolerance QTL3 (i.e. QTL on chromosome 11) was done using one representative marker such as TO-0142306; these plants were advanced to produce F3 seeds, which are referred in the examples as population 1 (see table 7).

[0272] Plant Genotyping and Selection:

[0273] F3 seeds (population 1) were sown in trays, around 500 plantlets were obtained. From each F3 plantlet a leaf disc was sampled for DNA extraction and DNA was used for molecular marker analysis. For selection, two molecular markers were used, one for the TM-1 gene on chromosome 2 and the second representative of the QTL on chromosome 9 (QTL2), QTL for chromosome 11 (tolerance QTL3) was already fixed in the F2 as homozygote resistant (see population creation).

[0274] Results:

[0275] Crosses were made between line Haz. Tm-1 and one breeding line NB2 that contains the QTLs on chromosome 11 and QTL on chromosome 9. F3 seeds were obtained as disclosed above.

[0276] F3 plants were preselected in the tray using molecular markers linked to the tolerance QTLs and Tm-gene and the selected plants were mechanically inoculated at young seedlings level, plantlets were planted in the greenhouse in Bsor and grown in greenhouse.

[0277] Molecular marker analysis included one marker per QTL.

[0278] Tables 7 and 9 present different F3 plants from the population 1 containing different genotypes at the 3 loci (QTL2, QTL3 and Tm-1), the resistance based on phenotypic scoring and ELISA results of each plant. Controls are also indicated. The healthy controls were not infected.

[0279] Table 7 presents the results at 70 DPI and table 9 at 91 DPI.

[0280] Some of the foliar symptoms reported in the tables might have been increased due to the presence of pepinovirus in the greenhouse as well as severe temperature conditions. It is indeed well known that symptoms of tobamovirus infection are increased when temperature is increased. This means that the medium to severe symptoms observed in this assay, could, in milder conditions, be considered as mild symptoms only. This assay was indeed designed to be discriminative between resistant plants on one side and tolerant or susceptible plants on the other side, and not between resistant/tolerant plants and susceptible plants.

TABLE-US-00011 TABLE 7 ELISA results at 70 DPI, and symptoms scoring of F3 plants. R stands for Resistant homozygote genotype, i.e. marker allele which is linked to resistance (or tolerance for the tolerance QTLs), S stands for “susceptible homozygote genotype”. O.D.1 and O.D.2 correspond to the results of two distinct assays. Chr11 QTL refers to tolerance QTL3; Chr9 QTL refers to tolerance QTL2. Chr11 Tm-1 Chr9 O.D. O.D. ELISA foliar Code Detail QTL Gene QTL (405 nm) 1 (405 nm) 2 result symptoms Blank ELISA control 0.093 0.095 Positive ELISA control 1.475 2.196 control Negative ELISA control 0.096 0.110 control Cut-off Calculation 0.192 0.219 (2*NegCntr) H-1 Healthy control 0.092 0.105 negative N.A. H-2 Healthy control 0.091 0.095 negative N.A. H-3 Healthy control 0.102 0.115 negative N.A. H-4 Healthy control 0.089 0.101 negative N.A. H-5 Healthy control 0.133 0.166 negative N.A. H-6 Healthy control 0.128 0.156 negative N.A. H-7 Healthy control 0.099 0.116 negative N.A. H-8 Healthy control 0.116 0.141 negative N.A. 6305 population 1 R R R 0.172 0.227 Slightly no positive 6328 population 1 R R R 0.112 0.127 negative no 6381 population 1 R R R 0.088 0.100 negative no 6415 population 1 R R R 0.131 0.154 negative no 6429 population 1 R R R 0.093 0.105 negative no 6450 population 1 R R R 0.120 0.149 negative no 6464 population 1 R R R 0.116 0.143 negative no 6470 population 1 R R R 0.112 0.136 negative no 6472 population 1 R R R 0.111 0.134 negative no 6317 population 1 R R S 0.342 0.502 slightly no positive 6338 population 1 R R S 0.311 0.443 slightly no positive 6339 population 1 R R S 0.401 0.576 slightly no positive 6344 population 1 R R S 0.254 0.352 slightly no positive 6368 population 1 R R S 0.514 0.742 slightly no positive 6373 population 1 R R S 0.289 0.393 slightly no positive 6386 population 1 R R S 0.200 0.279 slightly no positive 6414 population 1 R R S 0.175 0.262 slightly no positive 6432 population 1 R R S 0.226 0.327 slightly no positive 6314 population 1 R S S 1.365 2.030 positive mild 6321 population 1 R S S 1.307 1.930 positive mild 6324 population 1 R S S 1.444 2.153 positive mild 6327 population 1 R S S 1.689 2.488 positive mild 6300 population 1 R S R 1.462 2.171 positive Medium- severe 6333 population 1 R S R 1.402 2.126 positive Medium- severe 6378 population 1 R S R 1.405 2.091 positive Medium- severe 6380 population 1 R S R 1.397 2.099 positive Medium- severe 1409-1 population 1 S S R 1.389 2.086 positive severe 1409-2 population 1 S S R 1.434 2.099 positive severe 1409-3 population 1 S S R 1.369 2.084 positive severe 1409-4 population 1 S S R 1.642 2.441 positive severe Blank ELISA control 0.148 0.185 Positive ELISA control 1.504 2.228 control Negative ELISA control 0.127 0.162 control Cut-off Calculation 0.254 0.324 (2*NegCnrl) Haz Tm-S-1 Susceptible 1.328 2.007 positive severe control Haz Tm-S-2 Susceptible 1.421 2.142 positive severe control Haz Tm-S-3 Susceptible 1.457 2.168 positive severe control Haz Tm-S-4 Susceptible 1.394 2.094 positive severe control Haz Tm-S-5 Susceptible 1.375 2.094 positive severe control Haz Tm-S-6 Susceptible 1.386 2.109 positive severe control

TABLE-US-00012 TABLE 8 ELISA means of the reads at 70 DPI for the different QTLs combination and controls: No of Lower Upper Genotype Plants Mean Std Error 95% 95% Haz Tm-S control 6 2.10233 0.04735 2.0064 2.1983 Healthy control 8 0.12438 0.04101 0.0413 0.2075 chr11-R; Tm-1-R; chr9-R 9 0.14167 0.03866 0.0633 0.2200 chr11-R; Tm-1-R; chr9-S 9 0.43067 0.03866 0.3523 0.5090 chr11-R; Tm-1-S; chr9-R 4 2.12175 0.05799 2.0042 2.2393 chr11-R; Tm-1-S; chr9-S 4 2.15025 0.05799 2.0327 2.2678 chr11-S; Tm-1-S; chr9-R 4 2.17750 0.05799 2.0600 2.2950

[0281] FIG. 4 illustrates the results of the ELISA test for the different QTLs combinations and controls, at 70 DPI.

[0282] It can be deduced that the combination of the Tm-1 gene and at least one of the tolerance QTL gives rise to a large decrease in the detection level of ToBRFV virus coat protein in the plants, and that the combination of the Tm-1 gene with two tolerance QTLs gives a ToBRFV detection level as low as the level found in non-infected healthy plants (Chr11-R, Tm-1-R, Chr9-R).

TABLE-US-00013 TABLE 9 ELISA results at 91 DPI, and symptoms scoring of F3 plants. R stands for Resistant homozygote genotype, i.e. marker allele which is linked to resistance (or tolerance for the tolerance QTLs), S stands for “susceptible homozygote genotype”. OD.1 and O.D.2 correspond to the results of two distinct assays. Chr11 QTL refers to tolerant QTL3; Chr9 QTL refers to tolerant QTL2. Chr11 Tm-1 Chr9 O.D. O.D. ELISA foliar Fruit Code Detail QTL Gene QTL (405 nm) 1 (405 nm) 2 result symptoms symptoms Remarks Blank ELISA control 0.097 0.110 Positive ELISA control 1.717 2.711 control Negative ELISA control 0.117 0.137 control Cut-off Calculation 0.232 0.271 (2*NegCntr) H-1 Healthy control 0.128 0.165 negative na na Control for ELISA H-2 Healthy control 0.154 0.209 negative na na Control for ELISA H-3 Healthy control 0.111 0.139 negative na na Control for ELISA H-4 Healthy control 0.107 0.129 negative na na Control for ELISA H-5 Healthy control 0.118 0.146 negative na na Control for ELISA H-6 Healthy control 0.131 0.166 negative na na Control for ELISA H-7 Healthy control 0.119 0.147 negative na na Control for ELISA H-8 Healthy control 0.117 0.146 negative na na Control for ELISA 6305 population 1 R R R 0.385 0.608 Slightly no no No clear symptoms positive but has some blotchy 6328 population 1 R R R 0.327 0.507 Slightly no no No clear symptoms positive but has some blotchy 6381 population 1 R R R 0.229 0.342 Slightly no no No clear symptoms positive but has some blotchy 6415 population 1 R R R 0.193 0.275 Slightly no no No clear symptoms positive but has some blotchy 6429 population 1 R R R 0.264 0.388 Slightly no no No clear symptoms positive but has some blotchy 6450 population 1 R R R 0.156 0.209 Slightly no no No clear symptoms positive but has some blotchy 6464 population 1 R R R 0.214 0.308 Slightly no no No clear symptoms positive but has some blotchy 6470 population 1 R R R 0.216 0.316 Slightly no no No clear symptoms positive but has some blotchy 6472 population 1 R R R 0.407 0.633 Slightly no no No clear symptoms positive but has some blotchy 6317 population 1 R R S 0.543 0.856 Slightly no no No clear symptoms positive but has some blotchy 6338 population 1 R R S 0.260 0.400 Slightly no no No clear symptoms positive but has some blotchy 6339 population 1 R R S 0.263 0.396 Slightly no no No clear symptoms positive but has some blotchy 6344 population 1 R R S 0.206 0.293 Slightly no no No clear symptoms positive but has some blotchy 6368 population 1 R R S 0.346 0.526 Slightly no no No clear symptoms positive but has some blotchy 6373 population 1 R R S 0.251 0.377 Slightly no no No clear symptoms positive but has some blotchy 6386 population 1 R R S 0.195 0.286 Slightly no no No clear symptoms positive but has some blotchy 6414 population 1 R R S 0.280 0.439 Slightly no no No clear symptoms positive but has some blotchy 6432 population 1 R R S 0.296 0.453 Slightly no no No clear symptoms positive but has some blotchy 6314 population 1 R S S 0.801 1.259 positive severe Medium Some distortion on fruit with pointed blossom end 6321 population 1 R S S 0.631 0.982 positive severe Medium Some distortion on fruit with pointed blossom end 6324 population 1 R S S 0.760 1.203 positive severe Medium Some distortion on fruit with pointed blossom end 6327 population 1 R S S 0.978 1.558 positive severe Medium Some distortion on fruit with pointed blossom end 6300 population 1 R S R 0.978 1.593 positive severe Mild No significant distortion, no pointed blossom end 6333 population 1 R S R na na na na na Dead plant 6378 population 1 R S R 0.985 1.594 positive severe Mild No significant distortion, no pointed blossom end 6380 population 1 R S R 1.083 1.751 positive severe Mild No significant distortion, no pointed blossom end 1409-1 population 1 S S R 1.012 1.623 positive severe No 1409-2 population 1 S S R 0.803 1.278 positive severe No 1409-3 population 1 S S R 0.754 1.180 positive severe No 1409-4 population 1 S S R na na na na na Dead plant Blank ELISA control 0.109 0.128 Positive ELISA control 1.919 2.830 control Negative ELISA control 0.131 0.161 control Cut-off Calculation 0.263 0.321 (2*NegCnrl) Haz Tm-S-1 Susceptible 1.144 1.698 positive severe Mild-Med. control Sym Haz Tm-S-2 Susceptible 1.280 1.890 positive severe Mild-Med. control Sym Haz Tm-S-3 Susceptible 1.148 1.709 positive severe Mild-Med. control Sym Haz Tm-S-4 Susceptible 1.049 1.560 positive severe Mild-Med. control Sym Haz Tm-S-5 Susceptible 0.929 1.399 positive severe Mild-Med. control Sym Haz Tm-S-6 Susceptible 0.953 1.428 positive severe Mild-Med. control Sym

TABLE-US-00014 TABLE 10 ELISA means of the reads for the different QTLs combination and controls (91DPI) No of Lower Upper Genotype Plants Mean Std Error 95% 95% Haz Tm-S control 6 1.61400 0.06391 1.4845 1.7435 Healthy control 8 0.15588 0.05535 0.0437 0.2680 chr11-R; Tm-1-R; chr9-R 9 0.39844 0.05218 0.2927 0.5042 chr11-R; Tm-1-R; chr9-S 9 0.44733 0.05218 0.3416 0.5531 chr11-R; Tm-1-S; chr9-R 4 1.64550 0.07827 1.4869 1.8041 chr11-R; Tm-1-S; chr9-S 4 1.25050 0.07827 1.0919 1.4091 chr11-S; Tm-1-S; chr9-R 4 1.40075 0.07827 1.2422 1.5593

[0283] FIG. 5 illustrates the results of the ELISA test for the different QTLs combinations and controls, at 91 DPI.

[0284] Results presented in table 9 and table 10 confirm the resistance of the plants comprising Tm-1 and at least one tolerance QTL, and demonstrates that this resistance is still present 3 months after infection, thus protecting the plants from foliar and fruit damages.

Example 4: Genetic Modification of Tomato Seeds by Ethyl Methane Sulfonate (EMS)

[0285] Seeds of a tomato varieties are to be treated with EMS by submergence of approximately 2000 seeds per variety into an aerated solution of either 0.5% (w/v) or 0.7% EMS for 24 hours at room temperature.

[0286] Approximately 1500 treated seeds per variety per EMS dose are germinated and the resulting plants are grown, preferably in a greenhouse, for example, from May to September, to produce seeds. Following maturation, M2 seeds are harvested and bulked in one pool per variety per treatment. The resulting pools of M2 seeds are used as starting material to identify the individual M2 seeds and the plants with a fruit and/or a foliar tolerance to Tomato Brown Rugose Fruit virus.

Example 5: ToBRFV Quarantine Trail—Testing for Different Combinations of QTLs and Tm-1

[0287] In this trial, the inventors tested various combinations of the QTLs of Chromosome 11 (QTL3, or Ch11 as in example 3), of Chromosome 9 (QTL2 or Ch9 as in example 3) and Tm-1 on chromosome 2 and a susceptible control having the Tm2 gene (Haz Tm-R). The healthy control corresponds to a plant not exposed to the virus. The material and methods are as disclosed for Example 3, especially with regard to foliar and fruit notation and Elisa tests.

[0288] Time Table [0289] Sowing: T0 [0290] Sampling for DNA extraction: T0+14 days [0291] Mechanical inoculation: T0+28 days [0292] Transplanting in the quarantine: T0+29 days=1 DPI [0293] 1.sup.st scoring (foliar symptoms): 31 DPI [0294] Sampling for ELISA: 35 DPI [0295] 2.sup.nd scoring (fruit symptoms): 112 DPI

[0296] Results: [0297] 1.sup.st scoring (foliar symptoms) & ELISA (31 DPI)

[0298] General observation: no fruit set yet, significant foliar symptoms in all the susceptible genotypes plants.

[0299] Foliar symptoms index: 1—severe foliar symptoms, 9—no visible symptoms. The mean foliar symptoms are illustrated on FIG. 6.

[0300] It is observed that the addition of the Tm-1 gene improves the scoring, and that the improvement is even better when the Tm-1 gene is present homozygously.

[0301] It is moreover observed that 3 genotypes give no symptoms, namely [Ch11-R Tm1-R Ch9-H], [Ch11-R Tm1-R Ch9-R] and [Ch11-R Tm1-R Ch9-S]. At this early stage (31 DPI) the QTL2 on chromosome 9 (fruit tolerance QTL) does not contribute to the foliar resistance.

[0302] Three other genotypes, namely [Ch11-R Tm1-H Ch9-H], [Ch11-R Tm1-H Ch9-R] and [Ch11-R Tm1-H Ch9-S] present also an important foliar resistance, although slightly less important than the 3 previous genotypes.

[0303] Elisa test was carried out four days after, at 35 DPI.

[0304] The results are reported in table 11 and illustrated in FIG. 7.

TABLE-US-00015 TABLE 11 Elisa results (OD at 405 nm) Nb of Std Err Line/combination plants Mean Std Dev Mean Lower 95% Upper 95% Ch11-H Tm1-H Ch9-H 11 2.3586 0.27 0.0808133 2.1785367 2.5386633 Ch11-H Tm1-H Ch9-R 10 2.16279 0.407358 0.1288179 1.8713787 2.4541913 Ch11-H Tm1-H Ch9-S 10 1.71319 0.729089 0.2305581 1.1916314 2.2347486 Ch11-R Tm1-H Ch9-H 14 1.96077 0.388241 0.1037619 1.736604 2.1849318 Ch11-R Tm1-H Ch9-R 11 2.3096 0.277721 0.083736 2.1230245 2.4961755 Ch11-R Tm1-H Ch9-S 10 1.81148 0.588321 0.1860436 1.3906202 2.2323398 Ch11-R Tm1-R Ch9-H 10 0.59897 0.109245 0.0345463 0.5208209 0.6771191 Ch11-R Tm1-R Ch9-R 10 0.88279 0.38208 0.1208242 0.6094617 1.1561083 Ch11-R Tm1-R Ch9-S 10 0.75813 0.176183 0.0557138 0.6320965 0.8841635 Ch11-R Tm1-S Ch9-H 11 2.34288 0.143215 0.043181 2.2466685 2.4390951 Ch11-R Tm1-S Ch9-R 10 2.29042 0.222169 0.070256 2.131485 2.449345 Ch11-R Tm1-S Ch9-S 10 2.17247 0.134591 0.0425615 2.0761842 2.2687458 Ch11-S Tm1-S Ch9-H 10 2.14809 0.130071 0.0411319 2.0550431 2.2411369 Ch11-S Tm1-S Ch9-R 10 2.26306 0.185008 0.0585046 2.1307135 2.3954065 Ch11-S Tm1-S Ch9-S 7 2.37161 0.170053 0.064274 2.2143342 2.5288801 Haz. Tm-R 14 2.16388 0.143211 0.0382747 2.0811876 2.2465624 Healthy control 8 0.23817 0.049716 0.0175773 0.196605 0.2797325

[0305] It is observed that the plants having both QTL3 and Tm1 homozygously (Ch11-R Tm1-R) present a lower level of virus than all other genotypes.

[0306] From these foliar symptom scoring and ELISA tests at 31/35 DPI, it can be concluded that: [0307] 1. All plants having the Ch11-R—Tm-1-R combinations (3 combinations with Ch9 (QTL2) in all three states) are symptomless. These combinations are ELISA positive, but show a much lower virus content than all the other combinations. [0308] 2. Three combinations of Chr-11-R Tm-1-H give plants which are almost completely symptomless, but their ELISA does not appear statistically different from the susceptible genotypes at this specific stage of 30 DPI.

[0309] 2.sup.nd Scoring—Fruit Symptoms (112 DPI)

[0310] General observation: in most of the plants, few clusters with red fruits.

[0311] Fruit symptoms index: 1—severe foliar symptoms, 9—no visible symptoms.

[0312] Foliar symptoms are consistent with the 1.sup.st observation.

[0313] The fruit symptoms are reported on FIG. 8 and detailed in table 12.

TABLE-US-00016 TABLE 12 ToBRFV fruit symptoms at 112 DPI. Nb of Std Err Line/combination plants Mean Std Dev Mean Lower 95% Upper 95% Ch11-H Tm1-H Ch9-H 11 7.545455 2.207426 0.6655638 6.062486 9.028423 Ch11-H Tm1-H Ch9-R 10 8.6 0.843274 0.2666667 7.996758 9.203242 Ch11-H Tm1-H Ch9-S 10 3.8 2.149935 0.6798693 2.262029 5.337971 Ch11-R Tm1-H Ch9-H 14 8.714286 1.069045 0.2857143 8.097038 9.331534 Ch11-R Tm1-H Ch9-R 11 9 0 0 9 9 Ch11-R Tm1-H Ch9-S 10 6.4 2.503331 0.7916228 4.609225 8.190775 Ch11-R Tm1-R Ch9-H 10 8.4 1.897367 0.6 7.042706 9.757294 Ch11-R Tm1-R Ch9-R 10 9 0 0 9 9 Ch11-R Tm1-R Ch9-S 8 8 2.13809 0.7559289 6.212512 9.787488 Ch11-R Tm1-S Ch9-H 11 9 0 0 9 9 Ch11-R Tm1-S Ch9-R 10 9 0 0 9 9 Ch11-R Tm1-S Ch9-S 9 4.555556 2.962732 0.9875772 2.278199 6.832913 Ch11-S Tm1-S Ch9-H 8 5 2.390457 0.8451543 3.001528 6.998472 Ch11-S Tm1-S Ch9-R 4 4.5 1.914854 0.9574271 1.45304 7.54696 Ch11-S Tm1-S Ch9-S 7 4.142857 2.544836 0.9618576 1.789276 6.496438 Haz. Tm-R 11 1.545455 0.934199 0.2816715 0.917851 2.173058

[0314] It can be deduced that the presence of the QTL2 on chromosome 9 (Ch9), either homozygously or heterozygously, greatly improves the fruit resistance (see for example the first 3 genotypes on FIG. 8, where the fruit symptoms are absent with QTL2 at the homozygous state (Ch9-R) and mild when QTL2 is present heterozygously (Ch9-H), whereas these symptoms are more important when QTL2 is absent (Ch9-S).

[0315] This assay does not allow the discrimination between the genotypes [Ch11-R, Tm1-R/H, Ch9-H] and [Ch11-R, Tm1-S, Ch9-H] as both genotypes are scored at 9 in this protocol. The results of Example 3 however suggest that, on different conditions of ToBRFV infection or at a later stage of infection, the presence of Tm1 gene, either homozygously or heterozygously, provides an enhanced level of resistance with respect to plants corresponding to the genotype [Ch11-R, Ch9-H].

CONCLUSIONS

[0316] The presence of QTL3 on chromosome 11, preferably homozygously, in combination with Tm1 gene, provides the best foliar resistance, associated with a reduced virus titer when both are present homozygously (Ch11-R; Tm1-R).

[0317] This combination thus provides the best resistance at the first steps of ToBRFV infection; moreover, the foliar resistance ensures an adequate development of the plants, thus healthy plants with a better photosynthesis and an expected better fruit yield. In addition, the reduced virus titer implies that the plants are less likely to contaminate other surrounding plants and to propagate the virus, and the slower progression of the virus may allow to escape the more severe stages of infection, especially in case of late infection.

[0318] In order to ensure a good fruit resistance, this combination must preferably be combined with the QTL2 on chromosome 9 (Ch9-H or Ch9-R).

[0319] In conclusion, the genotypes corresponding to Ch11-R, Tm1-R and Ch9-H or R, provide globally the best results on the combined criteria of foliar resistance (advantageous for photosynthesis and yield), virus titer (less contamination and slower progression) and fruit resistance (increased yield of marketable fruits).