BIOFILM TRANSFORMATION

Abstract

The invention relates to a method for the transformation of host cells of a biofilm with heterologous nucleic acid, wherein the host cells are within the extracellular matrix of the biofilm, the method comprising: adding the heterologous nucleic acid to the biofilm; and applying inertial cavitation to the biofilm in the presence of the heterologous nucleic acid to facilitate transformation of host cells within the biofilm with the heterologous nucleic acid. The invention further relates to associated methods, uses and kits for transformation of host cells of a biofilm.

Claims

1. A method for the transformation of host cells of a biofilm with heterologous nucleic acid, wherein the host cells are within the extracellular matrix of the biofilm, the method comprising: adding the heterologous nucleic acid to the biofilm; and applying inertial cavitation to the biofilm in the presence of the heterologous nucleic acid to facilitate transformation of host cells within the biofilm with the heterologous nucleic acid.

2. The method according to claim 1, wherein the level of inertial cavitation activity is monitored by sensing the acoustic cavitation noise and that information is used to adjust exposure parameters in real time.

3. The method according to claim 1 or claim 2, wherein the biofilm is in situ.

4. The method according to claim 1 or claim 2 or claim 3, wherein an enclosure is applied to the biofilm when adding the heterologous nucleic acid to the biofilm.

5. The method according to claim 4, wherein the enclosure comprises an access port for administration/delivery of the heterologous nucleic acid, and/or other substances, into the enclosure.

6. The method according to claim 4 or claim 5, wherein the enclosure comprises a secondary enclosure that is arranged to retain and release the heterologous nucleic acid and/or other substances into the enclosure.

7. The method according to any preceding claim, further comprising an incubation period of at least 30 seconds between adding the heterologous nucleic acid and applying the ultrasound.

8. The method according to any preceding claim, wherein the biofilm is located in a watercourse, a channel, a pipe, a pellicle, an oil or water feed, a stream, a river, a water body, a reactor, a dispersed/suspended growth system, an attached growth system, an aquifer, the internal and/or external body of a ship or boat, soil crumbs, a plant leaf surface or plant roots; or wherein the biofilm is in a microbial fuel cell (MFC).

9. The method according to any preceding claim, wherein the inertial cavitation is induced by application of ultrasound.

10. The method according to any preceding claim, wherein the heterologous nucleic acid is a plasmid or vector.

11. The method according to any preceding claim, wherein the heterologous nucleic acid encodes a gene and/or or a regulatory element that is capable of modifying the host cell phenotype.

12. The method according to any preceding claim, wherein the heterologous nucleic acid encodes a gene and/or regulatory element of a gene involved in, or that is arranged to modify one or more functions from the group comprising, quorum sensing, cell metabolism, heat/cold resistance, heat-shock resistance, chemical resistance, antibiotic resistance, cell aggregation, cell adhesion, cell export, membrane transport molecules, cell or EPS dispersal enzymes, and stress regulons; or a combination thereof; or wherein the heterologous nucleic acid encodes a redox pathway or one or more parts thereof.

13. The method according to any preceding claim, wherein the heterologous nucleic acid encodes an enzyme, a membrane transporter, a pore molecule, and/or a regulatory element associated therewith.

14. The method according to any preceding claim, wherein the heterologous nucleic acid encodes a gene selected from any of the group comprising protein-degrading enzymes, such as protease and peptidase; polysaccharide-degrading enzymes and oligosaccharide-degrading enzymes, such as endocellulase, chitinase, α-glucosidase, β-glucosidase, β-xylosidase, N-acetyl-β-d-glucosaminidase, chitobiosidase, and β-glucuronidase; lipid-degrading enzymes, such as lipase and esterase; phosphomonoesterases, such as phosphatase; oxidoreductases, such as phenol oxidase, peroxidase; and extracellular redox activity; or combinations thereof; or wherein the heterologous nucleic acid encodes a one or more, or all, genes of the gene cluster mtrCAB or ribADEHC.

15. The method according to any preceding claim, wherein the heterologous nucleic acid is arranged to promote survival or growth of a selected species of bacteria in the biofilm relative to other species.

16. The method according to any preceding claim, wherein the heterologous nucleic acid is applied to the biofilm in a CaCl.sub.2 solution, or in the presence of CaCl.sub.2.

17. A method of adapting a biofilm in situ, the method comprising transformation of host cells within the extracellular matrix of the biofilm with heterologous nucleic acid, wherein the method comprises: adding the heterologous nucleic acid to the biofilm; and applying inertial cavitation to the biofilm in the presence of the heterologous nucleic acid to facilitate transformation of host cells within the biofilm with the heterologous nucleic acid, wherein the heterologous nucleic acid encodes a gene and/or or a regulatory element that is capable of modifying the host cell phenotype, or the heterologous nucleic acid is arranged to knockout a host cell gene, or regulatory sequence thereof, of the host cell.

18. The method according to claim 17, wherein an enclosure is applied to the biofilm, and the heterologous nucleic acid is added within the enclosure.

19. A method of decontaminating feedstock in a waste water treatment process, the method comprising: flowing the feedstock over a biofilm wherein cells of the biofilm have been genetically modified in situ in order to increase their ability to reduce the contaminant, such as an aromatic, in the feedstock and/or increase the resistance of the biofilm to the contaminant in the feedstock.

20. Use of ultrasound to transform host cells within the extracellular matrix of a biofilm.

21. The use according to claim 20, wherein the use is to transform cells of a biofilm in situ.

22. Use of cavitation to transform host cells within the extracellular matrix of a biofilm.

23. The use according to claim 22, wherein the cavitation can be produced from ultrasound or other physical methods.

24. A kit for transformation of host cells within the extracellular matrix of a biofilm, wherein the kit comprises: an inertial cavitation generator; an enclosure; and optionally, nucleic acid for transformation.

25. The kit according to claim 24, further comprising CaCl.sub.2.

26. A method of generating electricity from a microbial fuel cell (MFC) comprising: culturing bacteria in a biofilm in an anode compartment of the MFC, wherein the bacteria of the biofilm have been transformed with heterologous nucleic acid encoding one or more genes of a redox pathway; supplying an oxidant and a substrate for oxidation that are substrates of the redox pathway; generating electricity by allowing electrons released by the bacteria from the substrate oxidation in the anode compartment to be transferred to a cathode compartment of the MFC through a conductive material, whereby the transferred electrons in the cathode compartment are combined with oxygen and the protons are diffused through a proton exchange membrane.

Description

[0121] Embodiments of the invention will now be described in more detail, by way of example only, with reference to the accompanying figures.

[0122] FIG. 1—(A) Ultrasound-based transformation of biofilm growing on open surface enclosed with barrier in the form of a movable cup. (B) Ultrasound-based transformation of biofilm growing within a pipe enclosed with movable barriers at both ends. (C) Ultrasound-based transformation of biofilm growing within a tank enclosed with movable barrier.

[0123] FIG. 2—(A) Experiment demonstrating the transformation of biofilms in flowcells under different experimental conditions. (B) GFP signal (left) and PI signal (right) after 10 s of 40 kHz ultrasound treatment and ˜1 ng/mL plasmid. (C) PI signal (right) and lack of GFP signal (left) after 10 s of 40 kHz ultrasound treatment and no plasmid. (D) PI signal (right) and lack of GFP signal (left) after no ultrasound treatment and no plasmid. (E) PI signal (right) and lack of GFP signal (left) after no ultrasound treatment and ˜1 ng/mL plasmid. All experiments were carried out with the addition of 0.3 mL CaCl.sub.2 which contained the plasmid, where relevant.

[0124] FIG. 3—Waste bottles following flowcell experiments. Growth is only seen in the waste bottle from the flow cell treated with ultrasound and plasmid.

[0125] FIG. 4—0-5 h after transformation with ultrasound. Within 5 h, some transformed cells begin to express sfGFP but with limited cell replication. Left image, white are cells that are transformed and have expressed sfGFP.

[0126] FIG. 5—24 h after transformation with ultrasound. More transformed cells are expressing sfGFP (left image; white) and possibly growth of transformed cells into micro-colonies in media+Km.

[0127] FIG. 6—48 h after transformation with ultrasound. (A) More cells expressing sfGFP and possibly growth of transformed cells in media+Km (B) More cells expressing sfGFP and growth of transformed cells in media+Km. sfGFP expression is shown as white in the left images.

[0128] FIG. 7—5 days after transformation with ultrasound. Transformed cells growing among non-transformed dead or persister cells. sfGFP expression is shown as white in the left images and identifies transformed cells.

[0129] FIG. 8—5 days after transformation without ultrasound. A layer of non-transformed dead or persister cells with no expression of sfGFP in media+Km.

[0130] FIG. 9—Media contains antibiotics to select for transformed cells over non-transformed cells within the biofilm. No growth detected in the waste media bottle of the flow cells with plasmids but without ultrasound treatment. This is a proof-of-concept that native biofilms are able to acquire new properties (e.g. antibiotic resistance).

[0131] FIG. 10. Percentage of transformed cells in biofilms that are treated with or without ultrasound. Biofilms were incubated with 1 ng/mL plasmid and 50 mM CaCl.sub.2 for 10 minutes prior to treatment.

[0132] FIG. 11. Data on transformation efficiency and inertial cavitation signal vs voltage. Voltage applied to the ultrasound system determines the level of cavitation activity, as indicated by broadband noise and expressed as the cavitation index. From the graph, cavitation index and transformation efficiency followed the same trend where higher cavitation is accompanied with higher transformation efficiency, which is an indication that inertial cavitation is involved in transformation of cells in biofilms.

[0133] FIG. 12. Qualitative description of cavitation level at different voltages.

[0134] FIG. 13. Plot of frequency response of the system as a function of hydrophone position in the resonator (depth). The hydrophone was positioned at an acoustic node for cavitation noise measurements at 81.4 kHz (indicated by yellow ‘+’ in plot). The top (water surface) of the resonator is located at −8 mm.

[0135] FIG. 14. Examples of cavitation noise measured at 30V, 60V, and 190V. Left panel=no cavitation, Middle panel=unclear, and Right panel=clear cavitation or strong cavitation.

[0136] FIG. 15. Frequency spectrum of cavitation noise measured at drive levels from 15-210 V. The numbers correspond to regions qualitatively labeled ‘no cavitation’ (1 and 2), ‘unclear’ (3, 4 and 5), and ‘clear cavitation’ or ‘strong cavitation’ (6, 7 and 8). The low end roll-off is due to the high-pass filter.

[0137] FIG. 16. Plot of the cavitation index as a function of drive voltage.

[0138] FIG. 17. Schematic diagram of ultrasound-based DNA delivery (UDD) into bacterial cells of mature biofilms established in a) microfluidic flow cells and b) microbial fuel cell (MFC). Ultrasound treatments were applied in a commercially available 40 kHz ultrasound clean bath. Diagram is not drawn to scale.

[0139] FIG. 18. Green fluorescence signal and bright field imaging for biofilm samples after 120 h with a) both addition of plasmid and ultrasound treatment (+P/+U), b) only addition of plasmid (+P/−U), c) only ultrasound treatment (−P/+U) and d) no plasmid and no ultrasound treatment. Green fluorescence signal and bright field imaging for biofilm samples with both addition of plasmid and ultrasound treatment after e) 5 h, f) 24 h, g) 48 h, h) 120 h.

[0140] FIG. 19. a) Current density (I) over time, b) Polarisation curve (Current density vs. Potential) and c) Power curve of MFC reactors with S. oneidensis MR-1 WT (1), MR-1/YYDT-C5 mutant (2) and MR-1 Δbfe strains (3) with 20 mM sodium lactate as sole carbon source. Measurement was conducted via Linear Sweep Voltammetry (E.sub.begin=0.8V, E.sub.end=0.0V, E.sub.step=0.1V, scan rate=0.1 mV/s) once steady-state current was achieved over 1 kΩ resistor (˜day 6). Error bars represent standard deviation of triplicate measurements. d) Optical density at 600 nm (OD.sub.600) of anodic culture of MFC reactors utilising S. oneidensis MR-1 WT, MR-1/YYDT-C5 mutant and MR-1 Δbfe strains with 20 mM sodium lactate as sole carbon source. Measurement was done using 1 cm cuvette (1 mL sample size). e) Biofilm quantification using crystal violet assay: optical density at 595 nm (OD.sub.595) of cell-bound crystal violet solution from anodic biofilm cells of the MFC reactors. f) Amount of lactate consumed by each reactor. Produced metabolites were mainly acetate, with succinate and pyruvate in trace amounts (data not shown). Measurements in Figure d), e) and f) were done at the end of MFC experiment (day 13). Error bars represent standard deviation of triplicate measurements. P values on top of the bars denote differences between sample pairs based on nested mixed-factor ANOVA test followed by Tukey's HSD post hoc test. P values showing statistically significant (p<0.05) differences are presented in bold.

[0141] FIG. 20. a) Current density (I) of double-compartment MFC reactors running at 1 kΩ load with 20 mM initial concentration of sodium lactate; b) extracellular flavins concentration of MFC reactors after 14 days of operation. Four different type of reactors: MR-1/YYDT-C5 strain (MR-1/YYDT-C5_US, 4), MR-1 WT with addition of plasmid and ultrasound treatment (WT_P_US, 1), MR-1 WT with only ultrasound treatment (WT_US, 2), and WT with only addition of plasmid (WT_P, 3). Ultrasound was performed for 30 s on day 6 (arrow—A) for appropriate MFC setups. On day 9, kanamycin (10 μg/mL) and 10 mM of additional lactate was added into each reactor (arrow—B). On day 13, additional kanamycin was added to reach final concentration of 50 μg/mL (arrow—C). Shaded regions represent standard deviations of triplicate measurements. P values on top of the bars were calculated for the last day of measurement and denote differences between sample pairs based on nested mixed-factor ANOVA test followed by Tukey's HSD post hoc test. P values showing statistically significant (p<0.05) differences are presented in bold.

[0142] FIG. 21. The growth media outputs of the flow cells under various conditions: presence of plasmids with ultrasound treatment (+P/+U), presence of plasmid without ultrasound treatment (+P/−U), absence of plasmid with ultrasound treatment (−P/+U), and absence of both plasmid and ultrasound treatment (−P/−U).

EXAMPLES

Example 1

Proof of Concept Study

[0143] Biofilms were grown in four flow-cells for 72 hours. Each flow-cell received a different treatment to determine the effectiveness of ultrasound treatment in the transformation of intact biofilms. Plasmids used in the experiment were encoded with green fluorescent protein (gfp) and kanamycin resistance. The flow-cells were treated as follows:

[0144] Flow-cell 1: 0.3 mL CaCl.sub.2 containing ˜1 ng/mL plasmid was added to the flow-cell, followed by 10 seconds of 40 kHz ultrasound treatment.

[0145] Flow-cell 2: 0.3 mL CaCl.sub.2 containing no plasmid was added to the flow-cell, followed by 10 seconds of 40 kHz ultrasound treatment.

[0146] Flow-cell 3: 0.3 mL CaCl.sub.2 containing no plasmid was added to the flow-cell. No ultrasound treatment was given.

[0147] Flow-cell 4: 0.3 mL CaCl.sub.2 containing ˜1 ng/mL plasmid was added to the flow-cell. No ultrasound treatment was given.

[0148] Following treatment, kanamycin was added to the growth media to select for transformed cells. To further confirm successful transformation, all flow-cells were stained with PI and imaged under confocal laser scanning microscope, using the same settings for each flowcell. Only flow-cell 1, treated with both the plasmid and ultrasound showed expression of gfp (FIG. 3). Waste from the flow-cells was collected in waste bottles which were assessed for cell growth following the experiment. Only the waste bottle from flow-cell 1, treated with both the plasmid and ultrasound, showed evidence of cell growth (FIG. 4), demonstrating that cells in flow-cell 1 had resistance to kanamycin.

Example 2

gfp Expression and Cell Growth After Transformation

[0149] Biofilm was grown in flow-cells for 3 days to reach maturation before 1 ng/μl plasmid (pBBR1.MCS_sfGFP, harbouring superfolder green fluorescence protein and kanamycin (Km) resistance gene) in 50 mM CaCl.sub.2 was introduced to the flow-cells and incubated for 10 minutes. The length of incubation is dependent on the thickness of the biofilm. After the incubation period, flow-cells were treated with 42 kHz ultrasound for 10 s. 1/10 Luria-Bertani broth (LB) was reintroduced onto the flow-cell at 20 mL/h for 2 hours, then replaced with 1/10 LB with Km (5 μg/mL) at 20 mL/h for 5 days.

[0150] FIG. 4 demonstrates the initial transformation of cells which begin to express sfGFP within 5 hours of transformation. Increasing levels of sfGFP expression is identified over the subsequent 48 hours and after 5 days non-transformed dead or persister cells can be identified among the transformed sfGFP cells in the biofilm (FIGS. 5-7). Biofilms that were exposed to the plasmid, but not the ultrasound treatment, showed no evidence of transformation after 5 days (FIG. 8) and no growth was seen in the waste bottles connected the flow-cell (FIG. 9). FIG. 10 shows percentage of transformed cells over total cells in biofilm after ultrasound treatment with and without plasmids.

Example 3

Mechanism of Ultrasound-Based Transformation in Biofilms

[0151] Transformation efficiency of cells were measured under different voltage applied to the ultrasound transducer producing different amount/strength of cavitation (cavitation index). There is a strong correlation between cavitation index and transformation efficiency, which is an indication that cavitation is one of the key mechanisms in ultrasound-based transformation in biofilms. (FIG. 11).

Example 4

Cavitation Noise Measurements in 80 kHz Resonator

[0152] Introduction

[0153] The purpose was to conduct a quantitative measurement of cavitation noise in an 80 kHz resonator system and complement the description shown in FIG. 12.

[0154] Equipment Used

[0155] Function generator—LeCroy Wavestation 2022

[0156] Power Amplifier—Amplifier Research 75A250A

[0157] Hydrophone—Dynasen CA1136-6″ with CA1146 cable

[0158] Oscilloscope—LeCroy LT344

[0159] Voltage probe—LeCroy PP006 10:1

[0160] Current probe—Pearson

[0161] Methods

[0162] The transducer and horn (with o-ring) were inserted completely into the resonator leaving 3.5-4 cm space above the transducer to the top of the cylindrical resonator. The resonator was filled with degassed water at room temperature.

[0163] A function generator (LeCroy Wavestation 2022), attenuator (−20 dB; Digi-Key 367-1120-ND) and power amplifier (Amplifier Research 75A250A) were used to excite the transducer at frequency near the nominal design resonance of the system (80 kHz). The drive voltage (10:1 Probe PP006, LeCroy) and current (1 Volt/Ampere; Pearson 6016) were monitored on the oscilloscope (CH1 and CH2 respectively; LeCroy LT344). A detector consisting of a 0.05″ diameter×0.020″ thick PZT disc (Dynasen CA1136-6″ with CA1146 cable) was used as a hydrophone to measure the in-situ acoustic pressure and cavitation noise. The hydrophone signal was fed to an active high-pass filter (Krohn-Hite 34A; −24 dB/octave) with cutoff frequency (−3 dB) set to 1 MHz and +20 dB output gain and digitized on the oscilloscope (CH4; 5 MS/s, 20 us/div, 4.5 ms trigger delay).

[0164] The method of using a hydrophone in direct contact with the water was selected for the purpose of producing a quick and reliable measurement of cavitation noise. It should be noted that the presence of the hydrophone in the acoustic field could affect the resonance behavior of the system and the cavitation threshold. Preliminary experiments suggested this method resulted in a resonance frequency/threshold consistent with the same that was observed when the hydrophone was removed, however this effect was not quantified. The hydrophone was positioned at an acoustic node to minimize the effect of the standing wave acoustic signal at the fundamental frequency on the detection of the cavitation noise. The system was tuned to the optimal frequency ‘by-ear’, such that cavitation noise could just be detected at moderate drive level (120 V) but such that changing the frequency up or down (eg. by 0.1 kHz caused the cavitation noise to turn off). The optimal frequency was found to be 81.4 kHz. In subsequent trials it was observed that the electrical current to the transducer went through a phase change in the frequency range 81.3-81.4 kHz, confirming this was a resonance frequency of the system. A plot of the frequency response of the system as a function of hydrophone position was obtained as a sanity check and is shown in FIG. 13. The frequency spectrum was obtained using spectrum analyzer (HP3585A) with tracking generator and drive voltage set at low level (+0 dBm output.fwdarw.−20 dB attenuator.fwdarw.Power Amplifier at lowest gain) in conjunction with a robotic positioning system (Velmex) and automated MATLAB script.

[0165] Results

[0166] Cavitation Noise

[0167] The measured acoustic signal is shown in FIG. 14 and the frequency spectrum is shown in FIG. 15. The peaks in the spectrum at low drive levels occur at multiples of the drive frequency and could be due to harmonics generated by nonlinearities in the mechanical system (eg. similar mechanism to the vibrations which cause the audible ‘system noise’) or possibly nonlinearities in the PZT disc sensor such as radial modes or strain saturation. Audible observations included a high-pitch ringing ‘system noise’ audible at 15V, 30V and 60V. At 90V and 120V cavitation noise was intermittent and ‘system noise’ audible but not necessarily louder than at lower levels. At 160V, 190V and 210V strong cavitation noise was observed and the ‘system noise’ was mostly masked by the cavitation noise.

[0168] A cavitation index can be used to aid interpretation of the cavitation noise data. The cavitation index is defined here as the arithmetic mean of the values of the frequency spectrum between 100 kHz and 2.5 MHz and quantifies the broadband noise generated by microbubble collapse (Sabraoui 2011, Inserra 2014). The cavitation index has been plotted in FIG. 16 on a linear scale by taking the anti-logarithm.

REFERENCES

[0169] Cochrane, J. An acoustic cavitation reactor for quantifying the effect of cavitation on cell suspensions. M. Eng. Report, Wadham College, University of Oxford, 2018.

[0170] Inserra C, Labelle P, Der Loughian C, Lee J-L, Fouqueray M, Ngo J, Poizat A, Desjouy C, Munteanu B, Lo C-W, Vanbelle C, Rieu J-P, Chen W-S, Béra J-C. Monitoring and control of inertial cavitation activity for enhancing ultrasound transfection: The SonInCaRe project. IRBM 2014; 35:94-99.

[0171] Sabraoui A, Inserra C, Gilles B, Bera J C, Mestas J L. Feedback loop process to control acoustic cavitation. Ultrason Sonochem 2011; 18:589-94.

Example 2

Biofilm Engineering: Applications of Ultrasound-Based DNA Delivery (UDD) Toward In-Situ Bacterial Transformation in Established Biofilms

SUMMARY

[0172] The ability to augment native and established biofilm communities has long been a goal but the technology remains elusive. In this study, we explored the potential of the ultrasound-based DNA delivery (UDD) system to induce in-situ plasmid uptake by non-competent bacterial cells of established biofilms). DNA fragments (i.e. plasmids) containing genes coding for super folding green fluorescence protein (sfGFP) and flavin synthesis pathway were introduced into established bacterial biofilms cultured in microfluidic flow and microbial fuel cells (MFC) respectively employing UDD. Phenotypic signals of successful bacterial transformation in established biofilms were observed, where UDD-treated P. putida UWC1 biofilms developed green fluorescence signal in flow cells and UDD-treated S. oneidensis MR-1 biofilms generated higher bioelectricity production in MFC compared to the control group. The effects of UDD were amplified in subsequent growth under selective pressure. This study reports on a scalable method developed for the first time towards genetic and phenotypic control of established biofilms for environmental, industrial and medical applications.

[0173] Here more direct and immediate ways of augmenting biofilms central to the functioning of many engineering systems (e.g. bioreactor) have been developed. In the previous study, successful applications of low frequency 40 kHz ultrasound for transferring plasmids into three different bacterial species in their planktonic states were achieved with a high rate (9.8±2.3×10.sup.−6 per mg) of gene uptake.sup.17. An aim for this study is to determine the potential of ultrasound-based DNA delivery (UDD) for biofilms in microfluidic flow cells and MFCs, while demonstrating the scalability of this technology.

[0174] Results

[0175] Ultrasound-Mediated DNA Delivery (UDD) in Flow Cell Biofilms

[0176] A flow cell system was set up to examine the effectiveness of UDD to transfer plasmids to established biofilm (FIG. 17a). After 3 days of incubation UWC1 biofilms were established in flow cells and treated under 4 conditions: with both addition of plasmid and ultrasound treatment (+P/+U), with only ultrasound treatment (−P/+U), with only addition of plasmid (+P/−U), and without addition of plasmid nor ultrasound treatment (−P/−U). The frequency of ultrasound was 40 kHz. The ultrasound treatment time was 10 s. The plasmid pBBR1MCS-2_Plux_sfGFP (Table 1) contained a broad host pBBR1 backbone and the superfold gfp gene was fused with a constitutive promoter. Five hours after addition of plasmid and ultrasound treatment, small spots of green fluorescence signal were observed across the +P/+U biofilm samples (FIG. 18e), presumably produced by UWC1 cells that were successfully transformed. All samples were subjected to longer incubation period under constant flow of growth media containing kanamycin to exert selection pressure for transformed cells over non-transformed ones. Clusters of green fluorescence signals formed after 24 hours (FIG. 18f) in +P/+U biofilm samples and the area of green fluorescence signal continued to expand over 48 hours (FIG. 18g) and 120 hours (FIG. 18h). Over the same period, samples without either ultrasound treatment (+P/−U, FIG. 2b) or the addition of plasmid (−P/+U, FIG. 2c) or both (−P/−U, 2d) showed no signs of sfGFP production. The growth media outputs of the flow cell were also examined and only +P/+U samples showed ‘cloudiness’ indicating bacterial growth, whilst there no signs of any growth in the other samples (FIG. 21). This suggests that ultrasound mediated DNA delivery transfer plasmid into biofilm had occurred.

[0177] The samples from the established biofilms in four treatments were taken and cultured in LB medium with kanamycin. Only the samples from +P/+U treatment can grow but the samples from other three controls were unable to grow in the presence of kanamycin. The plasmids were extracted and the sequence confirmed that the recovered plasmid was pBBR1MCS-2_Plux_sfGFP. These results demonstrated that both ultrasound and plasmid are required for bacterial transformation to take place, and provided the proof-of-concept where UDD can be deployed towards in-situ bacterial transformation within established biofilms.

[0178] Flavin Electron Shuttles are the Dominant Mechanism of Electron Transfer in Shewanella oneidensis MR-1

[0179] The biofilms of Shewanella oneidensis MR-1 wild type (WT), MR-1 Δbfe (knockout of bfe gene for bacterial flavin adenine dinucleotide [FAD] exporter).sup.18 and MR-1/YYDT-C5 (MR-1 with plasmid pYYDT-C5 containing the entire flavin biosynthesis gene cluster ribADEHC cloned from Bacillus subtilis).sup.19 were established in the MFC system. The steady-state current density generated by the MR-1 WT reached 13.7±0.3 μA/cm.sup.2, compared to 7.6±0.1 μA/cm.sup.2 for the MR-1 Δbfe and 31.5±1.8 μA/cm.sup.2 for the MR-1/YYDT-C5 mutant (p<0.05) (FIG. 19a; Table 2). After 13 days of operation, MR-1/YYDT-C5 showed highest current density vs. potential as compared to MR-1 WT and MR-1 Δbfe (FIG. 19b). The maximum power output of the MR-1 WT was 2.61±0.35 μW/cm.sup.2, compared to 0.83±0.19 μW/cm.sup.2 from the MR-1 Δbfe, whilst MR-1/YYDT-C5 reached 5.25±1.18 μW/cm.sup.2 (p<0.05) (FIG. 19c). The OD.sub.600 of anodic culture in the MR-1 WT reactors reached 0.129±0.005, whilst that of MR-1/YYDT-C5 and MR-1 Δbfe peaked at a density of 0.098±0.005 and 0.114±0.005 respectively (FIG. 19d). The OD.sub.595 of cell-bound crystal violet solution from anodic biofilm cells of the MR-1 WT was found to be 0.411±0.030, and 0.267±0.031 for MR-1/YYDT-C5 and 0.458±0.030 for MR-1 Δbfe (FIG. 19e). This translated into the number of attached cells in the biofilm as (2.74±0.18)×10.sup.5/cm.sup.2 for MR-1 WT, (1.78±0.24)×10.sup.5/cm.sup.2 for MR-1/YYDT-C5 and (3.05±0.20)×10.sup.5/cm.sup.2 for MR-1 Δbfe. Consumption of lactate in MR-1 WT, MR-1/YYDT-C5 and MR-1 Δbfe were measured as 12.0±0.6 mM, 9.5±0.7 mM and 11.6±0.6 mM respectively (FIG. 19f). The reduction of flavin by bfe gene knockout in MR-1 Δbfe only produced 31% power and the increase of flavin by overexpression of ribADEHC in MR-1/YYDT-C5 boosted power generation by 2-fold, in comparison with MR-1 WT (Table 2). These results demonstrate that flavin-enabled electron shuttling was the dominant mechanism of bioelectricity generation in MR-1, which is in-agreement with previous study.sup.18. It also suggests that the introduction of the gene cluster encoding flavin biosynthesis (e.g. pYYDT-C5) into an established biofilm of MFCs has the potential to significantly enhance electricity production performance.

[0180] Ultrasound-Based DNA Delivery (UDD) in Microbial Fuel Cells (MFC)

[0181] The transfer of pYYDT-C5 plasmid into MR-1 WT biofilms via UDD in MFC was investigated employing the setup represented in FIG. 17b. The effect of pYYDT-C5 on bioelectricity generation in established biofilms was investigated in MFC systems. The treatments included ultrasound and the addition of plasmid (WT_P_US), a positive control MR-1/YYDT-C5 strain (MR-1/YYDT-C5_US), and two negative controls: the addition of plasmid (WT_P) without ultrasound and ultrasound treatment without plasmid (WT_US).

[0182] As with the previous experiment, the electricity generation of MR-1/YYDT-C5 positive control system (28.0±3.3 μA/cm.sup.2) was consistently higher than the MR-1 WT system throughout the experiment (FIG. 20a). After current generation reached steady state after approximately 4 days for all MFC systems, the addition of plasmid and/or ultrasound treatment was conducted between day 5 and 6. Current production in all treated MFC systems dropped immediately after ultrasound treatment was performed, but current production was fully recovered after approximately 24 hrs (FIG. 20). This observation indicates that ultrasound treatment can result in temporary disturbance of the MFC system, possibly mild physical disruption of biofilm structure, but cells in biofilm were able to restructure themselves and fully recover with no permanent detectable detriment afterwards.

[0183] Forty-eight hrs after ultrasound treatment, the WT_P_US system started to generate higher current than that of WT_US. At the end of the experiment, the WT_P_US system generated a current of 21.9±1.2 μA/cm.sup.2, 61% higher (p<0.05) than that of the WT_US system (13.6±1.6 μA/cm.sup.2) (FIG. 20a; Table 3). This suggests the successful application of UDD in the established biofilms within the MFC, resulting in the increased production of flavins by the WT_P_US system over time. The WT_P system produced similar current to WT_US (14.9±0.6 μA/cm.sup.2), indicating that bacterial transformation only occurred in treatments where both plasmids and ultrasound addition were combined. Three days after the ultrasound treatment, kanamycin (10 μg/mL) and lactate (10 mM) were added into all reactors as selective pressure for transformed cell growth and to maintain high electron donors concentration, respectively. We estimate that a time gap of 3 days was sufficient to enable the transformed bacterial cells, which were maintained at room temperature, to produce the necessary proteins in low-growth minimum media to resist the antibiotics. Additional kanamycin (40 μg/mL) was added on day 13. The addition of antibiotics on the separate occasions had no detectable effects on the current produced by the controls, since the mode of action of kanamycin did not initiate immediate killing of cells but instead interferes with protein synthesis and prevents cell replication.sup.16. This indicated that the established cell density in those reactors had reached optimum concentration before the antibiotics were added and that the process was not catalyst limited. Injection of additional lactate on day 9 also had no detectable effect of improving performance on bioelectricity production, indicating that the reaction was not substrate-limited either.

[0184] The quantity of flavins secreted by Shewanella strain played a significant role in influencing the current generation in MFC system.sup.13. After 14 days of operation, the amount of extracellular flavins in each MFC reactor was quantified. The WT_P_US system generated about 50% higher concentration (p<0.05) of extracellular flavins (103.3±8.3 μM) compared to the WT_US and WT_P systems (70.9±5.9 μM, and 74.8±7.3 μM respectively) (FIG. 4b, Table 3). The enhanced flavin production in WT_P_US system was attributed to the additional synthesis pathway encoding on pYYDT-C5 plasmid, which was introduced into Shewanella oneidensis biofilm via UDD. This quantity analysis of flavin confirmed the transfer of the plasmid via ultrasound. MR-1/YYDT-C5 positive control system contained the greatest concentration of flavin (289.7±57.7 μM), which is consistent with the current generation result.

[0185] The extraction and sequencing of plasmids from transformed cells in the WT_P_US MFC system (Table 8) provided additional evidence for the successful transfer of the pYYDT-C5 plasmid into S. oneidensis in MFC biofilm. These results combined provide strong evidence of the ability of UDD to deliver desired genes in situ into bacterial biofilm. This demonstrates that such UDD is able to enhance biofilm-based bioelectrochemical performance in MFCs without the need of re-building biofilm, which is highly desirable for industrial large-scale applications.

[0186] Discussion

[0187] In-Situ Plasmid Uptake by Bacterial Cell in Flow Cell Biofilms Via UDD

[0188] In-situ bacterial transformations in biofilms were usually limited to competent cells.sup.20. In this study, we attempted to non-invasively and remotely introduce gene into mature biofilm in-situ using ultrasound mediated gene transfer (UDD).

[0189] A pBBR1MCS-2_P.sub.Lux_sfGFP plasmid (8822 bp) was constructed using the broad-host-range cloning vector backbone pBBR1MCS-2 and DNA fragments encoding sfGFP and the positive-feedback luxI and luxR system..sup.21 sfGFP and the positive-feedback luxI and luxR system was used here as they provide a strong green fluorescence signal in transformed bacteria cells..sup.22 This pBBR1MCS-2_P.sub.Lux_sfGFP plasmid was employed as delivery DNA for P. putida UWC1 biofilms grown in commercially available microfluidic flow cells systems (FIG. 17a). UWC1 was used in ultrasound-mediated DNA delivery (UDD) because it is an environmentally and industrially relevant bacterium and is not naturally competent..sup.24 We have shown that applying low frequency ultrasound (40 kHz) to biofilms in the presence of plasmids results in the in-situ uptake of pBBR1MCS-2_P.sub.Lux_sfGFP plasmid by bacterial cells, which developed green fluorescence signals within the biofilm after 5 hours of incubation (FIG. 18).

[0190] However, the key bottleneck of all transformation techniques, including conventional ones such as electroporation and chemical transformation, is low transformation efficiency where it ranges typically between 10.sup.−9 to 10.sup.−5 transformant per cell.sup.17. With such low ratio of transformant as compared to non-transformed cells within the biofilm, it would not be expected for UDD to have much of an impact on the overall functionality of the biofilm. To overcome this challenge, one option was the use of selection pressure after UDD application to restrict the growth of non-transformed cells and allow transformed cells with the selected fitness to multiply more freely within the biofilm.

[0191] In this study, kanamycin was used as a selection pressure to enhance the impact of UDD on the general functionality of the biofilms, as seen from the increasing magnitude of green fluorescence signals over time (FIGS. 18a, b, c and g). This method is particularly useful in applications such as industrial wastewater treatment, where different contaminants that may induce toxic shock in the biofilms within bioreactors. For instance, sudden surges of copper content in wastewater may induce toxic shock in biofilms.sup.25 and upset their bioreactors, leading to long bioreactor downtime and the release of untreated wastewater into the environment. Current mitigation methods to protect the environment and prevent government regulatory penalties include dilution to reduce copper concentration per unit wastewater and/or procurement of specially formulated sludge to treat the high copper, both incurring huge financial costs and significant bioreactor downtime. The UDD technique described may potentially bridge the gap by transforming bacteria in the biofilm and sludge bioreactors to express the appropriate functionality (e.g. copper resistance) over time in the presence of a selection pressure (e.g. copper).

[0192] We have developed an UDD method for bacterial transformation within established biofilms in microfluidic flow cells. With this method, bacteria cells within established biofilms can acquire specific genes of interest (in this case, luxI, luxR and sfGFP) through bacterial transformation, allowing the biofilms to display new phenotypes and functionalities. Our previous work focus on bacteria transformation for cells in suspension.sup.17, and UDD has not been demonstrated in biofilms prior to this work. It has since been shown by others that the same method is able to transfer nucleic acids into Gram-positive bacteria.sup.26, but similarly for cells in suspension. The advantage of ultrasound for gene transfer over conventional methods such as electroporation and chemical transformation is that it is more suitable for scale-up for industrial use.

[0193] UDD Induced In-Situ Bacterial Transformation in MFC

[0194] Employing S. oneidensis MR-1 strains of varying flavin production and bioelectricity generation capabilities, enabled the establishment of a double-compartment MFC reactor system which allowed reliable evaluation of bioelectricity output by strains. It laid the foundation of employing the MFC system to evaluate the potential impact of UDD on the bioelectricity generation by MR-1. MR-1 was selected as a model organism due to its unique extracellular electron transfer ability.sup.27 and the fact that it is not naturally competent. pYYDT-C5 plasmid was used for delivery DNA to S. oneidensis MR-1 WT as the plasmid contains the entire flavin biosynthesis gene cluster ribADEHC cloned from Bacillus subtilis, which was previously shown to improve the bioelectricity generation of the transformed MR-1 as compared to the MR-1 WT.sup.13.

[0195] We have shown that applying low frequency ultrasound (40 kHz) to S. oneidensis biofilms growing on electrodes in the presence of plasmids results in the in-situ uptake of pYYDT-C5 plasmid by bacterial cells, which generated almost twice as much bioelectricity in the MFC after 8 days of incubation as compared to negative controls. The pYYDT-C5 plasmid used here is a relatively large plasmid (10450 Bp). While it is well recognised that transformation efficiency decreases with increasing plasmid size.sup.28, our results showed that the UDD technology is not limited to the delivery of small plasmid but is also effective for relatively large plasmids as well. Since UDD seems to be a physical phenomenon where cell membrane permeability is acoustically enhanced.sup.17, it is possible that bacterial transformation via UDD involving the uptake of mega-plasmids can be achieved.sup.29.

[0196] UDD-treated biofilms in MFC were only able to match around 70% of the level of bioelectricity generated by MR-1/YYDT-C5 positive control system by day 14. Compared to the results for the application of UDD in flow cells biofilm, it is evident that bacterial transformation efficiency can be a limiting factor preventing treated biofilms from achieving the maximum theoretical productivity. To alleviate this limitation, appropriate use of selective pressure can be used to amplify the effects of UDD treatment on the biofilm to exhibit high productivity.

[0197] It was previously suggested that the mechanism of transdermal protein delivery using low frequency ultrasound, such as 20 kHz, is attributed mainly to cavitational effects..sup.30, 31, 32 In a similar vein, it is possible that the mechanism of UDD in biofilms is via acoustic cavitation where microbubbles, formed on the surface of and/or within biofilms, that can oscillate or implode.sup.33, 34, resulting in temporary porosity in the cell membrane. The biofilm matrix, containing extracellular polymeric substances such as lipids, polypeptides and polysaccharides of diverse chemical charges, is an ideal adsorption material for the extracellular DNA or plasmids of interest to be introduced to the biofilms. The high cell density in the biofilms, potentially coupled with proximity between the bacteria and plasmids of interest in the biofilm matrix, provide a suitable environment for acoustic-enhanced horizontal gene transfer to take place within non-competent bacterial biofilm communities.

[0198] Scaling Up UDD in Biofilms for Industrial Applications

[0199] The goal of this study was to introduce new functionalities in established biofilms in bioreactors of different scales via in-situ UDD. UDD-induced gene transfer on biofilms grown in both microbial flow cells and MFC system was successfully demonstrated, with working volumes of 0.16 cm.sup.3 and 300 cm.sup.3 respectively, demonstrating a scale-up of 1875 times in operating volume. These results provide good evidence that UDD has enormous promise in terms of bacterial transformation at industrial scale. DNA fragments containing genes of interest may be introduced in-situ into established biofilms cultured in bioreactors, reducing downtime and ensuring continuous operations. UDD can also be deployed in the fields where native biofilm communities established in contaminated soils can be augmented by genes known to be effective at biodegradation or metal resistance. It would also be possible to influence gut microbiome of animals and human beings for agricultural or medical purposes using this approach. Thus, the ability to influence the phenotype of established biofilms creates new possibilities in controlling their behaviour in environmental, industrial and even medical settings.

[0200] Material and Methods

[0201] Chemicals, Bacteria and Plasmids

[0202] All chemicals are from Sigma-Aldrich (United Kingdom) and used without modification unless otherwise stated. The strains and plasmids used in this study are listed in Table 1.

[0203] pBBR1MCS-2_P.sub.Lux_sfGFP plasmid (8822 bp), containing the broad-host-range cloning vector backbone pBBR1MCS2, sfGFP and the positive-feedback luxI and luxR system, was employed as delivery DNA for P. putida UWC1 while pYYDT-C5 (10450 bp, provided by Yang et al.sup.13), containing entire flavin biosynthesis gene cluster ribADEHC, was employed as delivery DNA for S. oneidensis MR-1 WT. Briefly, plasmid DNA were extracted and purified from bacterial cultures at their respective mid-exponential phase using a QIAprep Spin Miniprep kit (QIAGEN, Germany). DNA concentration was determined using a NanoQuant Plate™ and Spark microplate reader (TECAN, Switzerland). More information on plasmid preparation can be found in supplementary information (SI).

[0204] Construction of pBBR1MCS-2_P.sub.Lux_sfGFP Plasmid

[0205] pTD103luxI_sfGFP (from Jeff Hasty, Addgene plasmid #48885; http://n2t.net/addgene:48885; RRID:Addgene_48885) was cut via restriction digest using BglII then AvrII. The P.sub.lux_sfGFP fragment, containing sfGFP and the positive-feedback luxI and luxR system, was isolated following separation via gel electrophoresis. P.sub.lux_sfGFP was ligated into a pBBR1MCS-2 plasmid backbone (from Kenneth Peterson, Addgene plasmid #85168; http://n2t.net/addgene:85168; RRID:Addgene_85168) which had been linearised by restriction digest with BamHI and XbaI. The resulting pBBR1MCS-2_P.sub.lux_sfGFP plasmid was transformed into C2987 NEB-5α E. coli which were screened via M13 colony PCR. Plasmids were extracted from positive transformants.

[0206] Growth of P. putida UWC1 Biofilms

[0207] Biofilms of P. putida UWC1 were grown in three-channel flow cells (channel dimensions, 1×4×40 mm.sup.3; Merck, Germany) using 1/10.sup.th-strength LB medium (Lennox) continuously supplied through a peristaltic pump. The flow system, consisting of 2L glass bottles (Fisher Scientific, United Kingdom), Masterflex silicone tubing and peristaltic pump (Cole-Palmer, United Kingdom), bubble trap and flowcells (Merck, Germany), was assembled and sterilized as described previously..sup.23 Each flow cell channel was inoculated with 0.3 mL overnight culture (diluted to an OD.sub.600 of 0.1) using a 1 mL syringe and 26G needle (BD, U.S.A.). After inoculation, the medium flow was stopped for 1 h to allow initial attachment followed by continuous media flow with a flow rate of 10 mL/h.

[0208] Ultrasound DNA Delivery Into Flow Cell Biofilms

[0209] A total of four sets of flow cells were used to cultivate biofilms where 3-day-old biofilms were treated under 4 conditions: with both addition of plasmid and ultrasound treatment (+P/+U), with only ultrasound treatment (−P/+U), with only addition of plasmid (+P/−U), and without both addition of plasmid and ultrasound treatment (−P/−U). The peristaltic pump connected to the flow cells were switched off prior to ultrasound treatment. 0.3 mL of 10 mM CaCl.sub.2 solution with or without 1 ug/mL of pBBR1MCS-2_P.sub.lux_sfGFP plasmid (coding for green fluorescence protein) was injected into the appropriate flow cells. Tubing at both ends of the flow cells were clamped and the flow cells were incubated at room temperature for 10 minutes. The flow cells were fully submerged in a 40 kHz Branson 3510 ultrasound water bath (Emerson Electric, U.S.A) and appropriate flow cells were subjected to ultrasound treatment for 10 seconds. After resting for a further 10 minutes, the clamps at both ends of the flow cells were removed and the peristaltic pump was switched back on at a flow rate of 10 mL/h. After 2 hours of flow, the growth media were changed to 1/10th-strength LB medium containing 10 μg/mL kanamycin for the rest of the experiment and waste bottles were replaced as and when required. Biofilms samples within the flow cells were viewed using ZEISS LSM 900 with Airyscan 2 confocal laser-scanning microscope (Carl Zeiss AG, Germany) for signs of green fluorescence signal.

[0210] Bacterial samples were collected from within the flowcells using sterile needles and syringes, resuspended in sterile 0.9% NaCl solution, and spread on LB agar plates containing 50 μg/mL kanamycin. Any colonies formed on the agar plates were resuspended in sterile 0.9% NaCl solution and underwent plasmid extraction procedure using Monarch® Plasmid Miniprep Kit (New England Biolabs, United Kingdom) according to manufacturer's instructions. Concentration of plasmid samples were determined using a NanoQuant Plate™ and Spark microplate reader (TECAN, Switzerland), while size of plasmids in samples were compared with pBBR1MCS-2_PLux_sfGFP using horizontal gel electrophoresis systems (Bio-Rad, United Kingdom) according to manufacturer's instructions.

[0211] MFC Reactor Setup

[0212] Double-compartment MFC reactors with a working volume of 300 mL was used to investigate current production. The anode was made of 3.0×3.0 cm2 carbon cloth (H23, 95 g/m2, Quintech). The cathode was carbon cloth with Pt catalyst (1 mg/cm2, PtC 60%, 2.5×4.0 cm2; FuelCellStore). Titanium wire was used to connect the electrodes to the outside of the reactors. Nafion© 117 was used as the exchange membrane to separate the two compartments.

[0213] Reactors were assembled and initially filled with deionised water, then autoclaved to achieve sterility. The water was then replaced with appropriate media; Standard M9 minimal salt, supplemented with trace minerals, amino acids and vitamins was chosen as the anodic compartment media and prepared according to Cao et al..sup.17 with slight modifications. The list of chemicals and their corresponding concentrations in each stock are given in Tables 4, 5, and 6. The M9 salt solution was autoclaved before the trace elements were added in 1:100 dilution from their stocks via 20 um pore-size membrane sterile filtration. The final medium was supplemented with 20 mM sodium DL-lactate and 0.75 mM IPTG as pYYDT-C5 plasmid inducer. Cathodic compartment media was phosphate buffer saline (PBS), prepared by dissolving two 500 mg PBS tablets in 1 L deionised water, then autoclaved to achieve sterility.

[0214] Fixed resistors of 1 kΩ were used to complete the circuit. Keithley Instrument Datalogger 2701 was used to measure the voltage across the resistor every 10 minutes. Before bacterial injection, the anodic compartment was bubbled with nitrogen for 15 minutes to create anaerobic condition. Throughout the experiment, the anodic and cathodic compartments was continuously gassed with nitrogen and air, respectively. Three independent replicate reactors were run for each different system.

[0215] Polarisation and Power Curve Construction

[0216] The power production of wild-type S. oneidensis MR-1 and its flavin deficient/enhancement mutant counterparts was measured via polarisation curve construction. A potentiostat (PalmSens 4-channel Multi EmStat.sup.3+) was used to perform Linear Sweep Voltametry (LSV) on the MFC reactors, with the voltage varied between the theoretical open-circuit potential to zero. (E.sub.begin=0.8V, E.sub.end=0.0V, E.sub.step=0.1V, scan rate=0.1 mV/s). Power curve was constructed by multiplying the resulted current with its corresponding potential according to Ohm's law, with the power normalised by the anode surface area

P=IV   (1)

[0217] Where P is power, I is electric current and V is the applied potential.

[0218] Planktonic and Biofilm Cell Quantification

[0219] The concentration of planktonic cells in the reactor was determined by its optical density using light spectrometer (UV-1800 Shimadzu), at wavelength of 600 nm. Cuvette length of 1 cm with sample size of 1 mL was used, with fresh anodic media as blank to exclude background reading.

[0220] Biofilm cell concentration was measured using crystal violet assay. Anode was immersed in 20 mL of 0.1% crystal violet solution, then washed with 20 mL sterile deionised water twice. Finally, the cell bound crystal violet was dissolved in 20 mL of 70% isopropanol. Four independent replicates of 100 μL aliquot of the final solution was measured for its absorbance at 595 nm, and normalised with background reading of crystal violet originating from a cell-free anode. The OD.sub.595 value is proportional to the number of cells attached on the biofilm, with the OD-to-cell number conversion was calculated using standard curve of known cell density.

[0221] Metabolites Quantification and Coulombic Efficiency

[0222] The amount of remaining lactate and produced metabolites were quantified via high-performance liquid chromatography (HPLC) equipped with acid column Hi Plex-H (250×4.6 mm, particle size 8 μm, Agilent). The eluent was 0.005 M H.sub.2SO.sub.4 with flow rate of 0.6 mL/min, and signal was detected using UV detector at 210 nm and 55° C. 1 mL of reactors' medium was sampled and filtered using 0.2 ul pore-size membrane filter to remove cells before being measured for its chemical concentration. Prior to the MFC experiment, standard curves of lactate and possible metabolites (acetate, pyruvate, format and succinate) were constructed.

[0223] Coulombic efficiency was calculated as the ratio of charge recovered as electric current to the total theoretical number of charge available from oxidation of lactate to acetate. Recovered electrons as electric current was measured as the integration of current over time

Q.sub.r=∫.sub.0.sup.tIdt   (2)

[0224] Where Q.sub.r is total charge recovered as current and t is the total duration of operation. And total number of electrons available from lactate oxidation is

Q.sub.A=zFVΔC   (3)

[0225] Where Q.sub.A is the total available charge, z is the no of electrons released per molecule of lactate oxidised (z=4), F is the Faraday constant (96,485 C mol.sup.−1) V is the anodic compartment volume and ΔC is the change in lactate concentration.

[0226] In-Situ Plasmid Transfer Into S. oneidensis MR-1 in MFC

[0227] The effect of pYYDT-C5 plasmid transfer into S. oneidensis MR-1 via ultrasound was investigated in terms of the current production of its MFC system. Late-stationary phase culture of MR-1 was injected into the reactor to achieve an initial OD of 0.01. After reaching stable current generation across 1 kΩ resistor, 0.1 μg/mL of the plasmid was injected into appropriate reactors (WT_P_US). Ultrasound was then performed for 30 s at frequency 42 kHz (±6%) to transfer the plasmid into the cell, and current production was continued to be monitored. As controls, reactors with wild-type (WT_US) and MR-1/YYDT-C5 strain (MR-1/YYDT-C5_US) without further addition of plasmid were also experimented as controls. Another control of WT strain with plasmid addition, but without ultrasound treatment, was also measured to exclude the effect of such treatment (WT_P). Three independent replicate reactors were run for each system (target and three controls; 12 reactors in total). Injection of kanamycin and lactate was done using sterile syringe and needle through one of the ports on the side of the reactor. Kanamycin was added from 50 mg/mL stock to achieve desired final concentration in the reactor. Lactate was added from its 1M stock, pre-filter sterilised to achieve sterility.

[0228] The efficiency of plasmid transfer was calculated at the end of the experiment. 20 mL of anodic cultures were sampled and centrifuged to obtain cell pellet. The cells were resuspended in 100 μL sterile water then plated on LB agar with 50 μg/mL kanamycin. The numbers of colonies formed were counted and this represented the cells which had obtained the plasmid. The plasmid transfer efficiency was calculated with reference to the total number of cells, transformed and non-transformed, based on its OD value and OD-to-cell number conversion that had been determined previously.

[0229] Flavin Quantification

[0230] Fluorescence spectroscopy was used to detect and quantify riboflavin and flavin mononucleotide (FMN) secreted by S. oneidensis in the MFC reactor. 100 μL of the cell-free supernatant of anodic media was transferred to a clear 96-well plate and read at 440 nm excitation and 525 nm emission. Four independent replicate aliquots were run for each reactor, and the background fluorescence was corrected by using fresh anodic media as the blank. Flavin concentration was determined using standard curves previously constructed with known concentrations of FMN (concentration range: 1 mg mL.sup.−1 to 1 ng mL.sup.−1).

[0231] Plasmid Sequencing and Verification

[0232] At the end of MFC experiment, the anodic biofilm was collected and centrifuged to obtain cell pellets. Plasmid extraction protocol using Monarch® Plasmid Miniprep Kit was performed and the obtained plasmid was quantified using NanoDrop and plate reader. Primers PRTac-SF3_for and ribC-02_R8_rev (Table 7) was used to sequence and identify the necessary plasmid fragment to confirm successful transfer of pYYDT-C5 plasmid into S. oneidensis.

[0233] Statistical Analysis

[0234] For all measurements involving replication, nested mixed-factor ANOVA test followed by Tukey's HSD post hoc test was performed to study the significance between the different treatment groups. P value of less than 0.05 denotes statistically significant difference between the systems of interest.

REFERENCES

[0235] 1. Stoodley P, Sauer K, Davies D G, Costerton J W. Biofilms as complex differentiated communities. Annual Reviews in Microbiology 56, 187-209 (2002).

[0236] 2. Meckenstock R U, et al. Biodegradation: updating the concepts of control for microbial cleanup in contaminated aquifers. (ed{circumflex over ( )}(eds). ACS Publications (2015).

[0237] 3. Halan B, Buehler K, Schmid A. Biofilms as living catalysts in continuous chemical syntheses. Trends Biotechnol 30, 453-465 (2012).

[0238] 4. Botyanszki Z, Tay P K R, Nguyen P Q, Nussbaumer M G, Joshi N S. Engineered catalytic biofilms: Site-specific enzyme immobilization onto E. coli curli nanofibers. Biotechnology and Bioengineering, n/a-n/a (2015).

[0239] 5. Singh R, Paul D, Jain R K. Biofilms: implications in bioremediation. Trends Microbiol 14, 389-397 (2006).

[0240] 6. Stewart P S, Franklin M J. Physiological heterogeneity in biofilms. Nat Rev Microbiol 6, 199-210 (2008).

[0241] 7. Elias S, Banin E. Multi-species biofilms: living with friendly neighbors. FEMS Microbiology Reviews 36, 990-1004 (2012).

[0242] 8. Hays S G, Patrick W G, Ziesack M, Oxman N, Silver P A. Better together: engineering and application of microbial symbioses. Current opinion in biotechnology 36, 40-49 (2015).

[0243] 9. Rosche B, Li X Z, Hauer B, Schmid A, Buehler K. Microbial biofilms: a concept for industrial catalysis? Trends Biotechnol 27, 636-643 (2009).

[0244] 10. Pagga U, Bachner J, Strotmann U. Inhibition of nitrification in laboratory tests and model wastewater treatment plants. Chemosphere 65, 1-8 (2006).

[0245] 11. Sorensen S J, Bailey M, Hansen L H, Kroer N, Wuertz S. Studying plasmid horizontal transfer in situ: a critical review. Nature Reviews Microbiology 3, 700-710 (2005).

[0246] 12. Brim H, et al. Engineering Deinococcus radiodurans for metal remediation in radioactive mixed waste environments. Nature biotechnology 18, 85-90 (2000).

[0247] 13. Yang Y, et al. Enhancing bidirectional electron transfer of Shewanella oneidensis by a synthetic flavin pathway. ACS synthetic biology 4, 815-823 (2015).

[0248] 14. Collard J-M, et al. Plasmids for heavy metal resistance in Alcaligenes eutrophus CH34: mechanisms and applications. FEMS microbiology reviews 14, 405-414 (1994).

[0249] 15. Leonard S P, et al. Genetic engineering of bee gut microbiome bacteria with a toolkit for modular assembly of broad-host-range plasmids. ACS synthetic biology 7, 1279-1290 (2018).

[0250] 16. De Lorenzo V. Recombinant bacteria for environmental release: what went wrong and what we have learnt from it. Clinical microbiology and infection 15, 63-65 (2009).

[0251] 17. Song Y, et al. Ultrasound-mediated DNA transfer for bacteria. Nucleic Acids Research 35, e129-e129 (2007).

[0252] 18. Kotloski N J, Gralnick J A. Flavin electron shuttles dominate extracellular electron transfer by Shewanella oneidensis. MBio 4, e00553-00512 (2013).

[0253] 19. Liu T, et al. Enhanced Shewanella biofilm promotes bioelectricity generation. Biotechnol Bioeng 112, 2051-2059 (2015).

[0254] 20. Hendrickx L, Hausner M, Wuertz S. Natural genetic transformation in monoculture Acinetobacter sp. strain BD413 biofilms. Applied and environmental microbiology 69, 1721-1727 (2003).

[0255] 21. Prindle A, Samayoa P, Razinkov I, Danino T, Tsimring L S, Hasty J. A sensing array of radically coupled genetic ‘biopixels’. Nature 481, 39-44 (2012).

[0256] 22. Scott S R, Din M O, Bittihn P, Xiong L, Tsimring L S, Hasty J. A stabilized microbial ecosystem of self-limiting bacteria using synthetic quorum-regulated lysis. Nature microbiology 2, 1-9 (2017).

[0257] 23. Sternberg C, Tolker-Nielsen T. Growing and analyzing biofilms in flow cells. Curr Protoc Microbiol, 1B. 2.1-1B. 2.15 (2006).

[0258] 24. McCLURE N C, Weightman A J, Fry J C. Survival of Pseudomonas putida UWC1 containing cloned catabolic genes in a model activated-sludge unit. Applied and Environmental microbiology 55, 2627-2634 (1989).

[0259] 25. Cabrero A, Fernandez S, Mirada F, Garcia J. Effects of copper and zinc on the activated sludge bacteria growth kinetics. Water research 32, 1355-1362 (1998).

[0260] 26. Lin L, et al. Ultrasound-mediated DNA transformation in thermophilic Gram-positive anaerobes. PLoS One 5, (2010).

[0261] 27. Shi L, Squier T C, Zachara J M, Fredrickson J K. Respiration of metal (hydr)oxides by Shewanella and Geobacter: a key role for multihaem c-type cytochromes. Mol Microbiol 65, 12-20 (2007).

[0262] 28. Hanahan D. Studies on transformation of Escherichia coli with plasmids. Journal of molecular biology 166, 557-580 (1983).

[0263] 29. Taghavi S, Van der Lelie D, Mergeay M. Electroporation of Alcaligenes eutrophus with (mega) plasmids and genomic DNA fragments. Applied and environmental microbiology 60, 3585-3591 (1994).

[0264] 30. Mitragotri S, Blankschtein D, Langer R. Ultrasound-mediated transdermal protein delivery. Science 269, 850-853 (1995).

[0265] 31. Prausnitz M R, Mitragotri S, Langer R. Current status and future potential of transdermal drug delivery. Nature reviews Drug discovery 3, 115-124 (2004).

[0266] 32. Tang H, Blankschtein D, Langer R. Effects of low-frequency ultrasound on the transdermal permeation of mannitol: Comparative studies with in vivo and in vitro skin. Journal of pharmaceutical sciences 91, 1776-1794 (2002).

[0267] 33. Vyas N, et al. Which parameters affect biofilm removal with acoustic cavitation? A review. Ultrasound in medicine & biology 45, 1044-1055 (2019).

[0268] 34. Erriu M, et al. Microbial biofilm modulation by ultrasound: current concepts and controversies. Ultrasonics sonochemistry 21, 15-22 (2014).

[0269] 40. McCLURE N C, Weightman A J, Fry J C. Survival of Pseudomonas putida UWC1 containing cloned catabolic genes in a model activated-sludge unit. Appl Environ Microbiol 55, 2627-2634 (1989).

[0270] 41. Heidelberg J F, et al. Genome sequence of the dissimilatory metal ion-reducing bacterium Shewanella oneidensis. Nature biotechnology 20, 1118-1123 (2002).

[0271] 42. Dehio C, Meyer M. Maintenance of broad-host-range incompatibility group P and group Q plasmids and transposition of Tn5 in Bartonella henselae following conjugal plasmid transfer from Escherichia coli. Journal of bacteriology 179, 538-540 (1997).

[0272] 43. Kostylev M, Otwell A E, Richardson R E, Suzuki Y. Cloning should be simple: Escherichia coli DH5α-mediated assembly of multiple DNA fragments with short end homologies. PLoS One 10, (2015).

[0273] 44. Kovach M E, et al. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166, 175-176 (1995).

[0274] All references herein are incorporated by reference.

[0275] Tables

TABLE-US-00001 TABLE 1 Bacterial strains and plasmids used in this study. Bacterial strain or Reference plasmid Genotype, description or source Strains Pseudomonas A spontaneous rifampicin-resistant mutant of P. 40 putida UWC1 putida KT2440. Not naturally competent. UWC1/sfGFP P. putida UWC1: pBBR1MCS-2_P.sub.lux_sfGFP Shewanella Wild type strain of MR-1. Not naturally competent. 41 oneidensis MR-1 wild type (WT) MR-1 Δbfe Δbfe mutant of MR-1. Loss of ability to transport 18 the FAD into the periplasm, reduced extracellular flavins available for electron transfer. MR-1/YYDT-C5 S. oneidensis MR-1: pYYDT-C5 This study Escherichia coli A diaminopimelate (DAP) auxotroph due to 42 WM3064 mutation in dapA. Cannot undergo cell division without DAP. Escherichia coli A derivative of the E. coli DH5α. Competent cell 43 C2987 NEB-5α for laboratory genetic manipulation, from New England Biolabs (U.K.) Plasmid pBBR1MCS-2 Empty vector backbone with broad host-range 44 origin of replication (pBBR1) multiple cloning site with blue/white selection function, Kan.sup.R pBBR1MCS- Plasmid with positive-feedback luxI and luxR This 2_P.sub.lux_sfGFP system and superfolding green fluorescence protein study (sfGFP), Kan.sup.R pTD1031uxl_sfGFP Oscillator plasmids with positive-feedback luxI and 21 luxR system and superfolding green fluorescence protein (sfGFP), colE1, Kan.sup.R pYYDT-C5 Plasmid with entire flavin biosynthesis gene cluster 13 ribADEHC cloned from Bacillus subtilis, Kan.sup.R

TABLE-US-00002 TABLE 2 Steady-state current density and maximum power output of MFC running with MR-1 wild-type and mutants Current Density Max. Power Output [μA/cm.sup.2] [μW/cm.sup.2] MR-1 WT 13.7 ± 0.3 2.61 ± 0.35 MR-1 Δbfe  7.6 ± 0.1 0.83 ± 0.19 MR-1/YYDT-C5 31.5 ± 1.8 5.25 ± 1.18

TABLE-US-00003 TABLE 3 Final current density and extracellular flavin concentrations of UDD-treated MFC systems Current density Flavins concentrations [μA/cm.sup.2] [μM] WT_P_US 21.9 ± 1.2 103.3 ± 8.3 WT_US (−ve control) 13.6 ± 1.6  70.9 ± 5.9 WT_P (−ve control) 14.9 ± 0.6  74.8 ± 7.3 MR-1/YYDT-C5_US 28.0 ± 3.3 289.7 ± 57.7 (+ve control)

TABLE-US-00004 TABLE 4 Ingredients of vitamin stock (×100) Chemical FW mg/L Biotin (d-biotin) 244.3 2 Folic acid 441.1 2 Pyridoxine HCl 205.6 10 Riboflavin 376.4 5 Thiamine HCl 1.0 H.sub.2O 355.3 5 Nicotinic acid 123.1 5 d-Pantothenic acid, hemicalcium 238.3 5 salt B12 1355.4 0.1 p-Aminobenzoic acid 137.13 5 Thioctic acid (or lipoic acid) 206.3 5

TABLE-US-00005 TABLE 5 Ingredients of mineral stock (×100) Chemical FW g/L Nitrilotriacetic acid 199.1 1.5 MgSO4•7H2O 246.48 3 MnSO4•H2O 169.02 0.5 NaCl 58.44 1 FeSO4•7H2O 277.91 0.1 CaCl2•2H2O 146.99 0.1 CoCl2•6H2O 237.93 0.1 ZnCl2 136.28 0.13 CuSO4•5H2O 249.68 0.01 AlK(SO4)2•12H2O 474.38 0.01 H3BO3 61.83 0.01 Na2MoO4•2H2O 241.95 0.025 NiCl2•6H2O 237.6 0.024 Na2WO4•2H2O 329.86 0.025

TABLE-US-00006 TABLE 6 Ingredients of amino acid stock (×100) Chemical FW g/L L-Glutamic acid 147.13 2 L-arginine 174.2 2 DL-serine 105.09 2

TABLE-US-00007 TABLE 7 pYYDT-C5 fragment to be detected by PRTac-SF3 for and ribC-02_R8_rev for UDD confirmation in MFC Forward (SEQ ID NO: 1): NNNNGGNNNNNNNNAGAGGAGAATCTAGTATGTTC CACCCAATCGAAGAAGCTTTAGATGCTTTAAAAAA AGGTGAAGTTATCATCGTTGTTGATGATGAAGATC GTGAAAACGAAGGTGATTTCGTTGCTTTAGCTGAA CACGCTACTCCAGAAGTTATCAACTTCATGGCTAC TCACGGTCGTGGTTTAATCTGTACTCCATTATCTG AAGAAATCGCTGATCGTTTAGATTTACACCCAATG GTTGAACACAACACTGATTCTCACCACACTGCTTT CACTGTTTCTATCGATCACCGTGAAACTAAAACTG GTATCTCTGCTCAAGAACGTTCTTTCACTGTTCAA GCTTTATTAGATTCTAAATCTGTTCCATCTGATTT CCAACGTCCAGGTCACATCTTCCCATTAATCGCTA AAAAAGGTGGTGTTTTAAAACGTGCTGGTCACACT GAAGCTGCTGTTGATTTAGCTGAAGCTTGTGGTTC TCCAGGTGCTGGTGTTATCTGTGAAATCATGAACG AAGATGGTACTATGGCTCGTGTTCCAGAATTAATC GAAATCGCTAAAAAACACCAATTAAAAATGATCAC TATCAAAGATTTAATCCAATACCGTTACAACTTAA CTACTTTAGTTGAACGTGAAGTTGATATCACTTTA CCAACTGATTTCGGTACTTTCAAAGTTTACGGTTA CACTAACGAAGTTGATGGTAAAGAACACGTTGCTT TCGTTATGGGTGATGTTCCATTCGGTGAANAACCA GTTTTAGTTCGTGTTCNNTCTGAATGTTTAACTGG TGATGTTTTCGGTTCTCANCGTTGTGATTGTGGTC CACAATTACNCGCTGCTTTAAACCAAATCGCTGCT GAAGGTCGNGGNGTTTNNTAAACTTACGTCANNNA GGTCNNNGTATCGGTTTAATCANNAAATTAAAAGC TTANAAATTANNNNAACAAGGTTANAANNNNGNTN NNNCTANNNNNNNNTNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNANNNNNNNNNNNNNNNNNNNNNCNNN NANNNNNNNNNNTANNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNAA Reverse (SEQ ID NO: 2): NNNNNGCTTCNNNGTNNNCCNTTTTCNNNTTGTTC AGTTAATTCTTTTGATACCGTTGAATTTACGTTCA GAACGGATACGTTTGTACCATTCGATTTTGATAGC AGCACCGTAAACTTCTTTGGTTGAAATCGAATAAG TTAACTTCGATAGATGGTTGTTTCTGGACGTTTTT CGTAGAAAGTTGGTTTGTAACCGATGTTACAAACA CCGTTTGTAAACTTCACCGTTAACTTCAGCTTTAA CAGCGTAAACACCAGTTGGTGGAACGATGTAAGAG TTGTTTAAACCAACGTTAGCAGTTGGGAAACCGAT AGTACGACCACGTTTATCACCGTGGATAACGATAC CTTTGATGAAGTATGGTTGACCTAATAAAACGTTA GCTAATTCAACATCACCGTTTTGTAAAGCAGTACG GATGTAAGAAGAAGAGATTTTTTTATCTTGTTCAG TTAATTTTTCAACCATAGTACAACCAGCTTTACCA TCTAAATCATCTGGCATAGTTTTCATAGTACCTTT ACCGTATTTACCGTAAGTGAAATCGAAACCAGCAA CAGCGTGTTGAACGTTTAAACCGATGATGTATTGA TCGATGAATTGTTTTGGAGATAAAGAAGCGAAAAC TTCGTTGAATTTAACAACGTATAAAACTTCAGTAC CTAATTGTTCGATTTGGTTGATTTTATCTTCTAAT GGAGTGATTAAATCTTTTGGTTCTTTATCACGACC TAAAACGTGAGATGGGTGTGGGTGGAAAGTCATAA CAGCTAAAGTTAAACCTTTTTCTTCAGCGATTTGT TTAGCAGTACCGATAACTTTTTGGTGACCTAAGTG AANNCCATCGAAGTAACCTAAAGCCNNAACAGATT TAGCTTGNTCTCNTTGATAATGGNGGGGNNNNNNN NNNGGGGAAANTNTNNNCNNNAGTTNNNNCNNNNN NNNNNNNNTANNNNAAANAACGGTTANNTNNNNNN TNNNNNNNNNNNNNNTTGACTANNNNACANATNNN NNNN

TABLE-US-00008 TABLE 8 Sequencing result of UDD-treated MFC-biofilm plasmid Forward (SEQ ID NO: 3): NNNNGGGNNNNGAAGAGGAGAATCTAGTATGTTCC ACCCAATCGAAGAAGCTTTAGATGCTTTAAAAAAA GGTGAAGTTATCATCGTTGTTGATGATGAAGATCG TGAAAACGAAGGTGATTTCGTTGCTTTAGCTGAAC ACGCTACTCCAGAAGTTATCAACTTCATGGCTACT CACGGTCGTGGTTTAATCTGTACTCCATTATCTGA AGAAATCGCTGATCGTTTAGATTTACACCCAATGG TTGAACACAACACTGATTCTCACCACACTGCTTTC ACTGTTTCTATCGATCACCGTGAAACTAAAACTGG TATCTCTGCTCAAGAACGTTCTTTCACTGTTCAAG CTTTATTAGATTCTAAATCTGTTCCATCTGATTTC CAACGTCCAGGTCACATCTTCCCATTAATCGCTAA AAAAGGTGGTGTTTTAAAACGTGCTGGTCACACTG AAGCTGCTGTTGATTTAGCTGAAGCTTGTGGTTCT CCAGGTGCTGGTGTTATCTGTGAAATCATGAACGA AGATGGTACTATGGCTCGTGTTCCAGAATTAATCG AAATCGCTAAAAAACACCAATTAAAAATGATCACT ATCAAAGATTTAATCCAATACCGTTACAACTTAAC TACTTTAGTTGAACGTGAAGTTGATATCACTTTAC CAACTGATTTCGGTACTTTCAAAGTTTACGGTTAC ACTAACGAAGTTGATGGTAAAGAACACGTTGCTTT CGTTATGGGTGATGTTCCATTCGGTGAANAACCAG TTTTAGTTCGNGTTCACTCTGAATGTTTAACTGNN GATGTTTTCGGTTCTNACCGTTGTGATTGTGGTCC ACAATTACNCGNTGCTTTAAACCAAATCGCTGCTG AAGGTCGNNNTNTTTTATNANACTTACGTCANNNA GGTNNNGGTNTCGGTTNAATCAACAAATTAAAAGC TTACAATTACANNNACAAGGTTANAAANNNNNNNN NNNTAANNANNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNANNNNNNNCNNNNNNNNNNN NNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNA Reverse (SEQ ID NO: 4): NNNNNCTTCTTTGTTTATCTTTTTCGATTTGTTCA GTTAATTCTTTGATACCGTTGAATTTACGTTCAGA ACGGATACGTTTGTACCATTCGATTTTGATAGCAG CACCGTAAACTTCTTGGTTGAAATCGAATAAGTTA ACTTCGATAGATGGTTGTTCTGGACGTTTTTCGTA GAAAGTTGGTTTGTAACCGATGTTACAAACACCGT TGTAAACTTCACCGTTAACTTCAGCTTTAACAGCG TAAACACCAGTTGGTGGAACGATGTAAGAGTTGTT TAAACCAACGTTAGCAGTTGGGAAACCGATAGTAC GACCACGTTTATCACCGTGGATAACGATACCTTTG ATGAAGTATGGTTGACCTAATAAAACGTTAGCTAA TTCAACATCACCGTTTTGTAAAGCAGTACGGATGT AAGAAGAAGAGATTTTTTTATCTTGTTCAGTTAAT TTTTCAACCATAGTACAACCAGCTTTACCATCTAA ATCATCTGGCATAGTTTTCATAGTACCTTTACCGT ATTTACCGTAAGTGAAATCGAAACCAGCAACAGCG TGTTGAACGTTTAAACCGATGATGTATTGATCGAT GAATTGTTTTGGAGATAAAGAAGCGAAAACTTCGT TGAATTTAACAACGTATAAAACTTCAGTACCTAAT TGTTCGATTTGGTTGATTTTATCTTCTAATGGAGT GATTAAATCTTTTGGTTCTTTATCACGACCTAAAA CGTGAGATGGGGTGTGGGGTGGAAAGTCATAACAG CTAAAGTTAAACCTTTTTCTTCAGCGATTTGTTTA GCAGTACCGATAACTTTTTGGTGACCTAAGTGAAC ACCATCGAAGTAACCTAAAGCNATAACNNNTTTAG NTTGNTCTTCTTTGATTAAKNGNGGGGGTGAATGA NNNNNAAAANTTT