Means and Methods for the Treatment of Nephropathy
20170233737 · 2017-08-17
Assignee
Inventors
Cpc classification
A61P29/00
HUMAN NECESSITIES
A61K31/7088
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
C12N15/115
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention is related to an antagonist of CCL2 for use in a method for the treatment and/or prevention of a disease, wherein the method comprises administering the antagonist to a subject, wherein the subject is suffering from proteinuria.
Claims
1. An antagonist of CCL2 for use in a method for the treatment and/or prevention of a disease, wherein the method comprises administering the antagonist to a subject, wherein the subject is suffering from proteinuria.
2. The antagonist of claim 1, wherein the disease is a renal disease.
3. The antagonist of claim 1, wherein the disease is nephropathy.
4. The antagonist of claim 1, wherein the disease is diabetic nephropathy.
5. The antagonist of claim 1, wherein the disease is a diabetes.
6. The antagonist of claim 1, wherein the disease is a cardiovascular disease primary and secondary amyloidosis, focal-segmental glomerulosclerosis, lupus nephritis, Fabry disease, glomerulonephritis, membranous glomerulopathy, hepatorenal syndrome, IgA nephropathy, cryoglobulinemia, multiple myeloma, Nagel-Patella syndrome, hereditary nephritis, polyarteriitis nodosa, purpura Schoenlein-Henoch, ANCA-associated vasculitides, nephrotic syndrome and rapid progressive glomerulonephritides.
7. The antagonist of claim 1, wherein the disease is hypertension.
8. (canceled)
9. The antagonist of claim 1, wherein proteinuria comprises a urinary albumin/creatine ratio (ACR) of at least 30 mg/g.
10.-11. (canceled)
12. The antagonist of claim 1, wherein proteinuria comprises a glomerular filtration rate of at least 90 ml/min/1.73 m.sup.2.
13.-29. (canceled)
30. The antagonist of claim 1, wherein the HbA1c value of the subject is above 7.95%.
31.-32. (canceled)
33. The antagonist of claim 1, wherein the subject has at least one of the following characteristics: (i) the subject is diagnosed type 2 diabetes mellitus according to the American Diabetes Association (ADA) definition; (ii) the subject is on stable treatment to control hypertension, hyperglycemia and/or dyslipidemia; or (iii) the subject is on stable treatment with angiotensin-converting enzyme inhibitors (ACEi) and/or Angiotensin II receptor blockers (ARBs).
34.-35. (canceled)
36. The antagonist of claim 1, wherein the subject has at least one of following characteristics. (i) the subject is not suffering from type 1 diabetes mellitus; (ii) the eGFR of the subject is not ≦25 ml/min/1.73 m.sup.2; and (iii) the subject did not have any cardiovascular event within 3 months prior to the onset of the administration of the antagonist; (iv) the subject is not suffering from uncontrolled hypertension, preferably the upper limit of the blood pressure of the subject is 180/110 mm Hg; (v) the subject was not subject to dialysis within 3 months prior to the onset of the administration of the antagonist; (vi) the subject did not experience any acute kidney injury within 3 months prior to the onset of the administration of the antagonist; (vii) the subject does not have or undergo any significant edema, leg ulcer and infectious disease; (viii) the subject does not use a drug selected from the group consisting of a thiazolidinedione class drug and an immune suppressant; (ix) the subject does not undergo steroid therapy except a steroid therapy for topical use or inhalation; or (x) the subject does not chronically use of non-steroidal anti-inflammatory drug (NSAIDs), cyclooxygenase type 2 (COX-2) inhibitors, two or more diuretic drugs and/or aliskiren.
37. (canceled)
38. The antagonist of claim 1, wherein the antagonist is an antagonist of the CCL2.CCR2 axis.
39. The antagonist of claim 1, wherein the antagonist is a Spiegelmer, an aptamer or both.
40.-46. (canceled)
47. The antagonist of claim 1, wherein the antagonist is a nucleic acid molecule comprising a type 2 MCP-1 binding nucleic acid molecule, a type 3 MCP-1 binding nucleic acid molecule, a type 4 MCP-1 binding nucleic acid molecule, a type 1A MCP-1 binding nucleic acid molecule, a type 1B MCP-1 binding nucleic acid molecule or a type 5 MCP-1 binding nucleic acid molecule, (a) whereby the type 2 MCP-1 binding nucleic acid molecule comprises in 5′->3′ direction a first terminal stretch of nucleotides, a central stretch of nucleotides, and a second terminal stretch of nucleotides, whereby (i) the first terminal stretch of nucleotides comprises a nucleotide sequence selected from the group comprising ACGCA, CGCA and GCA, (ii) the central stretch of nucleotides comprises a nucleotide sequence of CSUCCCUCACCGGUGCAAGUGAAGCCGYGGCUC, and (iii) the second terminal stretch of nucleotides comprises a nucleotide sequence selected from the group comprising UGCGU, UGCG and UGC, (b) whereby the type 3 MCP-1 binding nucleic acid molecule comprises in 5′->3′ direction a first terminal stretch of nucleotides, a first central stretch of nucleotides, a second central stretch of nucleotides, a third central stretch of nucleotides, a fourth central stretch of nucleotides, a fifth central stretch of nucleotides, a sixth central stretch of nucleotides, a seventh central stretch of nucleotides and a second terminal stretch of nucleotides, whereby (i) the first terminal stretch of nucleotides comprises a nucleotide sequence which is selected from the group comprising GURCUGC, GKSYGC, KBBSC and BNGC, (ii) the first central stretch of nucleotides comprises a nucleotide sequence of GKMGU, (iii) the second central stretch of nucleotides comprises a nucleotide sequence of KRRAR, (iv) the third central stretch of nucleotides comprises a nucleotide sequence of ACKMC, (v) the fourth central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising CURYGA, CUWAUGA, CWRMGACW and UGCCAGUG, (vi) the fifth central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising GGY and CWGC, (vii) the sixth central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising YAGA, CKAAU and CCUUUAU, (viii) the seventh central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising GCYR and GCWG, and (ix) the second terminal stretch of nucleotides comprises a nucleotide sequence selected from the group comprising GCAGCAC, GCRSMC, GSVVM and GCNV, (c) whereby the type 4 MCP-1 binding nucleic acid molecule comprises in 5′->3′ direction a first terminal stretch of nucleotides, a central stretch of nucleotides and a second terminal stretch of nucleotides, whereby (i) the first terminal stretch of nucleotides comprises a nucleotide sequence selected from the group comprising AGCGUGDU, GCGCGAG, CSKSUU, GUGUU, and UGUU; (ii) the central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising AGNDRDGBKGGURGYARGUAAAG, AGGUGGGUGGUAGUAAGUAAAG and CAGGUGGGUGGUAGAAUGUAAAGA, and (iii) the second terminal stretch of nucleotides comprises a nucleotide sequence selected from the group comprising GNCASGCU, CUCGCGUC, GRSMSG, GRCAC, and GGCA, (d) whereby the type 1A MCP-1 binding nucleic acid molecule comprises in 5′->3′ direction a first terminal stretch of nucleotides, a first central stretch of nucleotides, a second central stretch of nucleotides, a third central stretch of nucleotides, a fourth central stretch of nucleotides, a fifth central stretch of nucleotides and a second terminal stretch of nucleotides, whereby (i) the first terminal stretch of nucleotides comprises a nucleotide sequence of AGCRUG, (ii) the first central stretch of nucleotides comprises a nucleotide sequence of CCCGGW, (iii) the second central stretch of nucleotides comprises a nucleotide sequence of GUR, (iv) the third central stretch of nucleotides comprises a nucleotide sequence of RYA, (v) the fourth central stretch of nucleotides comprises a nucleotide sequence of GGGGGRCGCGAYC (vi) the fifth central stretch of nucleotides comprises a nucleotide sequence of UGCAAUAAUG or URYAWUUG, and (vii) the second terminal stretch of nucleotides comprises a nucleotide sequence of CRYGCU, (e) whereby the type 1B MCP-1 binding nucleic acid molecule comprises in 5′->3′ direction a first terminal stretch of nucleotides, a first central stretch of nucleotides, a second central stretch of nucleotides, a third central stretch of nucleotides, a fourth central stretch of nucleotides, a fifth central stretch of nucleotides and a second terminal stretch of nucleotides, whereby (i) the a first terminal stretch of nucleotides comprises a nucleotide sequence of AGYRUG, (ii) the first central stretch of nucleotides comprises a nucleotide sequence of CCAGCU or CCAGY, (iii) the second central stretch of nucleotides comprises a nucleotide sequence of GUG, (iv) the third central stretch of nucleotides, comprises a nucleotide sequence of AUG, (v) the fourth central stretch of nucleotides comprises a nucleotide sequence of GGGGGGCGCGACC, (vi) the fifth central stretch of nucleotides comprises a nucleotide sequence of CAUUUUA or CAUUUA, and (vii) the second terminal stretch of nucleotides comprises a nucleotide sequence of CAYRCU, and (f) whereby the type 5 MCP-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NOs:87 to 115.
48.-53. (canceled)
54. The antagonist of claim 1, wherein the antagonist comprises a nucleic acid.
55. The antagonist of claim 1, wherein the antagonist is a protein.
56.-62. (canceled)
63. A method for the treatment of a disease, wherein the method comprises administering to a subject an antagonist of claim 1, wherein the subject is suffering from proteinuria.
64.-65. (canceled)
66. A method for in situ improvement of glomerular filtration of kidney in a subject, wherein the method comprises administering to the subject an antagonist as defined in claim 1, wherein the subject is suffering from proteinuria.
67. (canceled)
68. A method for in situ repair of kidney in a subject, wherein the method comprises administering to the subject an antagonist as defined in claim 1, wherein the subject is suffering from proteinuria.
69.-76. (canceled)
Description
[0218] The present invention is further illustrated by the figures, examples and the sequence listing from which further features, embodiments and advantages may be taken, wherein
[0219]
[0220]
[0221]
[0222]
[0223]
[0224]
[0225]
[0226]
[0227]
[0228]
[0229]
[0230]
[0231]
[0232]
[0233]
[0234]
EXAMPLES
[0235] In the following the terms ‘nucleic acid’ and ‘nucleic acid molecule’ are used herein in a synonymous manner if not indicated to the contrary. Moreover, the terms ‘stretch’ and ‘stretch of nucleotide’ are used herein in a synonymous manner if not indicated to the contrary. In the following the terms ‘MCP-1’ and ‘CCL2’ are used herein in a synonymous manner if not indicated to the contrary.
Example 1: Nucleic Acid Molecules that Bind Human MCP-1/CCL2
[0236]
[0237] For definition of nucleotide sequence motifs, the IUPAC abbreviations for ambiguous nucleotides is used:
TABLE-US-00002 S strong G or C; W weak A or U; R purine G or A; Y pyrimidine C or U; K keto G or U; M imino A or C; B not A C or U or G; D not C A or G or U; H not G A or C or U; V not U A or C or G; N all A or G or C or U
[0238] If not indicated to the contrary, any nucleic acid sequence or sequence of stretches and boxes, respectively, is indicated in the 5′.fwdarw.3′ direction.
[0239] The nucleic acid molecules were characterized on the aptamer level, i.e. as D-nucleic acid molecules, using direct and competitive pull-down assays with biotinylated human
Type 1A MCP-1 Binding Nucleic Acid Molecules
[0240] As depicted in and
are the 5′- and 3′ terminal stretches of nucleotides (also referred to as first terminal stretch of nucleotides and second stretch of nucleotides) that can hybridize with each other. However, such hybridization is not necessarily given in the molecule as actually present under physiological conditions. Boxes B2, B3, B4,
and box B6 are flanked by box
and box
.
[0241] The sequences of the defined boxes may be different between the MCP-1 binding nucleic acids of Type 1A which influences the binding affinity to MCP-1. Based on binding analysis of the different MCP-1 binding nucleic acids summarized as Type 1A MCP-1 binding nucleic acids, the boxes , B2, B3, B4,
B6 and
and their nucleotide sequences as described in the following are individually and more preferably in their entirety essential for binding to MCP-1: [0242] boxes
and
are the first and the second terminal stretch of nucleotides (also referred to as 5′ and 3′ terminal stretch of nucleotides), whereby both stretches of nucleotides can hybridize with each other; where
is
, preferably
; and whereby
is
, preferably
; [0243] box B2 is the first central stretch of nucleotides, which is CCCGGW, preferably CCCGGU; [0244] box B3 is the second central stretch of nucleotides, which is GUR, preferably GUG; [0245] box B4 is the third central stretch of nucleotides, which is RYA, preferably GUA; [0246] box
is the fourth central stretch of nucleotides, which is
; preferably
; [0247] box B6 is the fifth central stretch of nucleotides, which is UGCAAUAAUG or URYAWUUG, preferably UACAUUUG.
[0248] As depicted in , B2, B3, B4,
B6 and
.
Type 1B MCP-1 Binding Nucleic Acid Molecules
[0249] As depicted in and
are the 5′- and 3′ terminal stretches of nucleotides (also referred to as first terminal stretch of nucleotides and second stretch of nucleotides) that can hybridize with each other and boxes B2, B3, B4,
and box B6 are flanked by box
and box
. However, such hybridization is not necessarily given in the molecule as actually present under physiological conditions.
[0250] The sequences of the defined boxes may be different between the MCP-1 binding nucleic acids of Type 1B which influences the binding affinity to MCP-1. Based on binding analysis of the different MCP-1 binding nucleic acids summarized as Type 1B MCP-1 binding nucleic acids, the boxes , B2, B3, B4,
B6 and
and their nucleotide sequences as described in the following are individually and more preferably in their entirety essential for binding to MCP-1: [0251] boxes
and
are the first and the second terminal stretch of nucleotides (also referred to as 5′ and 3′ terminal stretch of nucleotides), whereby both stretches of nucleotides can hybridize with each other, where
is
, preferably
; and where
is
, preferably
; [0252] box B2 is the first central stretch of nucleotides, which is CCAGCU or CCAGY, preferably CCAGU; [0253] box B3 is the second central stretch of nucleotides, which is GUG; [0254] box B4 is the third central stretch of nucleotides, which is AUG; [0255] box
is the fourth central stretch of nucleotides, which is
; [0256] box B6 is the fifth central stretch of nucleotides, which is CAUUUUA or CAUUUA, preferably CAUUUUA.
[0257] As depicted in , B2, B3, B4,
B6 and
.
Type 2 MCP-1 Binding Nucleic Acid Molecules
[0258] As depicted in and
are the 5′- and 3′ terminal stretches of nucleotides (also referred to as first terminal stretch of nucleotides and second stretch of nucleotides) that can hybridize with each other and box B2 is the central sequence element. However, such hybridization is not necessarily given in the molecule as actually present under physiological conditions.
[0259] The sequences of the defined boxes may be different between the MCP-1 binding nucleic acids of Type 3 which influences the binding affinity to MCP-1. Based on binding analysis of the different MCP-1 binding nucleic acids summarized as Type 2 MCP-1 binding nucleic acids, the boxes , B2, and
and their nucleotide sequences as described in the following are individually and more preferably in their entirety essential for binding to MCP-1: [0260] boxes
and
are the first and the second terminal stretch of nucleotides (also referred to as 5′ and 3′ terminal stretch of nucleotides), whereby both stretches of nucleotides can hybridize with each other, whereby
is
and
is
, or
is
and
is
, or
is
and
is
or
; preferably
is
and
is
; [0261] box B2 is the central stretch of nucleotides, CSUCCCUCACCGGUGCAAGUGAAGCCGYGGCUC, preferably CGUCCCUCACCGGUGCAAGUGAAGCCGUGGCUC.
[0262] As depicted in , B2, and
.
[0263] For nucleic acid molecule 180-D1-036, a dissociation constant (K.sub.D) of 890±65 pM at room temperature and of 146±13 pM at 37° C. was determined (protocol, see Example 3). The respective Spiegelmer 180-D1-036 exhibited an inhibitory concentration (IC.sub.50) of ca. 0.5 nM in an in vitro chemotaxis assay (protocol, see Example 4). For the PEGylated derivatives of Spiegelmer 180-D1-036, 180-D1-036-3′PEG and 180-D1-036-5′PEG, an IC.sub.50s of <1 nM in the chemotaxis assay was determined (protocol, see Example 4), whereas in the cell culture experiments as Spiegelmer 180-D1-036-5′PEG Spiegelmer NOX-E36 was used. Spiegelmer NOX-E36 (also referred to as emapticap pegol) is a specific variant of Spiegelmer 180-D1-036-5′PEG comprising a 40 kDa-PEG that is linked by specific linker to its nucleotide sequence (see Table 1; SEQ ID NO. 228).
Type 3 MCP-1 Binding Nucleic Acid Molecules
[0264] As depicted in and
as well as boxes B2A and B2B as well as boxes B5A and B5B bear the ability to hybridize with each other. However, such hybridization is not necessarily given in the molecule as actually present under physiological conditions. Between these potentially hybridized sequence elements, non-hybridizing nucleotides are located, defined as box B3, box B4 and box
.
[0265] The sequences of the defined boxes may be different between the MCP-1 binding nucleic acids of Type 3 which influences the binding affinity to MCP-1. Based on binding analysis of the different MCP-1 binding nucleic acids summarized as Type 3 MCP-1 binding nucleic acids, the boxes , B2A, B3, B2B, B4, B5A,
, B5B,
and their nucleotide sequences as described in the following are individually and more preferably in their entirety essential for binding to MCP-1: [0266] boxes
and
are the first and the second terminal stretch of nucleotides (also referred to as 5′ and 3′ terminal stretch of nucleotides), whereby both stretches of nucleotides can hybridize with each other, whereby
is
and
is
; preferably
is
and
is
;
or is
and
is
; preferably
is
and
is
;
or is
and
is
; preferably
is
and
is
;
or is
and
is
; preferably
is
and
is
; most preferably
is
and
is
; [0267] boxes B2A and B2B are the first and the third central stretch of nucleotides, whereby both stretches of nucleotides can hybridize with each other, whereby B2A is GKMGU and B2B is ACKMC; preferably B2A is GUAGU and B2B is ACUAC; [0268] box B3 is the second central stretch of nucleotides, which is KRRAR, preferably UAAAA or GAGAA; [0269] box B4 is the fourth central stretch of nucleotides, which is CURYGA or CUWAUGA or CWRMGACW or UGCCAGUG, preferably CAGCGACU or CAACGACU; [0270] B5A and B5B are the fifth and the seventh central stretch of nucleotides, whereby both stretches can hybridize with each other, B5A is GGY and B5B is GCYR whereas GCY can hybridize with the nucleotides of B5A; or B5A is CWGC and B5B is GCWG; preferably B5A is GGC and B5B is GCCG; [0271] box
is the sixth central stretch of nucleotides, which is:
or
or
, preferably
.
[0272] As depicted in , B2A, B3, B2B, B4, B5A,
, B5B and
.
Type 4 MCP-1 Binding Nucleic Acids
[0273] As depicted in and
are the 5′- and 3′ terminal stretches (also referred to as first terminal stretch of nucleotides and second stretch of nucleotides) that can hybridize with each other and box B2 is the central sequence element.
[0274] The sequences of the defined boxes may differ among the MCP-1 binding nucleic acids of Type 4 which influences the binding affinity to MCP-1. Based on binding analysis of the different MCP-1 binding nucleic acids summarized as Type 4 MCP-1 binding nucleic acids, the boxes , B2, and
and their nucleotide sequences as described in the following are individually and more preferably in their entirety essential for binding to MCP-1: [0275] boxes
and
the first and the second terminal stretch of nucleotides (also referred to as 5′ and 3′ terminal stretch of nucleotides), whereby both stretches can hybridize with each other, whereby
is
and
is
or
is
and
is
; or
is
and
is
; or
is
and
is
; or
is
and
is
; preferably
is
and
is
; mostly preferred B1A is
and
is
; and [0276] box B2 is the central stretch of nucleotides, which is AGNDRDGBKGGURGYARGUAAAG or AGGUGGGUGGUAGUAAGUAAAG or CAGGUGGGUGGUAGAAUGUAAAGA, preferably AGGUGGGUGGUAGUAAGUAAAG.
[0277] As depicted in , B2, and
.
Other MCP-1 Binding Nucleic Acid Molecules
[0278] Additionally, the 29 other MCP-1 binding nucleic acids shown in
[0279] It is to be understood that any of the sequences shown in
Example 2: Synthesis and Derivatization of Aptamers and Spiegelmers
Small Scale Synthesis
[0280] Aptamers (D-RNA nucleic acids) and Spiegelmers (L-RNA nucleic acids) were produced by solid-phase synthesis with an ABI 394 synthesizer (Applied Biosystems, Foster City, Calif., USA) using 2′TBDMS RNA phosphoramidite chemistry (Damha and Ogilvie, 1993). rA(N-Bz)-, rC(Ac)-, rG(N-ibu)-, and rU-phosphoramidites in the D- and L-configuration were purchased from ChemGenes, Wilmington, Mass. Aptamers and Spiegelmers were purified by gel electrophoresis.
Large Scale Synthesis Plus Modification
[0281] Spiegelmers were produced by solid-phase synthesis with an ÄktaPilot100 synthesizer (Amersham Biosciences; General Electric Healthcare, Freiburg) using 2′TBDMS RNA phosphoramidite chemistry (Damha and Ogilvie, 1993).
PEGylation of Spiegelmers
[0282] In order to prolong the Spiegelmer's plasma residence time in vivo, the Spiegelmers were covalently coupled to a 40 kDa polyethylene glycol (PEG) moiety at the 3′-end or 5′-end.
[0283] For PEGylation (for technical details of the method for PEGylation see European patent application EP 1 306 382), the purified 5′-amino or 3′-amino modified Spiegelmer was dissolved in a mixture of H.sub.2O (2.5 ml), DMF (5 ml), and buffer A (5 ml; prepared by mixing citric acid.H.sub.2O [7 g], boric acid [3.54 g], phosphoric acid [2.26 ml], and 1 M NaOH [343 ml] and adding water to a final volume of 1 l; pH=8.4 was adjusted with 1 M HCl).
[0284] The pH of the Spiegelmer solution was brought to 8.4 with 1 M NaOH. Then, 40 kDa PEG-NHS ester (Jenkem Technology, Allen, Tex., USA) was added at 37° C. every 30 min in six portions of 0.25 equivalents until a maximal yield of 75 to 85% was reached. The pH of the reaction mixture was kept at 8-8.5 with 1 M NaOH during addition of the PEG-NHS ester.
[0285] The reaction mixture was blended with 4 ml urea solution (8 M), and 4 ml buffer B (0.1 M triethylammonium acetate in H.sub.2O) and heated to 95° C. for 15 min. The PEGylated Spiegelmer was then purified by RP-HPLC with Source 15RPC medium (Amersham), using an acetonitrile gradient (buffer B; buffer C: 0.1 M triethylammonium acetate in acetonitrile). Excess PEG eluted at 5% buffer C, PEGylated Spiegelmer at 10-15% buffer C. Product fractions with a purity of >95% (as assessed by HPLC) were combined and mixed with 40 ml 3 M NaOAc. The PEGylated Spiegelmer was desalted by tangential-flow filtration (5 K regenerated cellulose membrane, Millipore, Bedford Mass.).
Example 3: Determination of Binding Constants (Pull-Down Assay)
Direct Pull-Down Assay
[0286] The affinity of aptamers to
Competitive Pull-Down Assay
[0287] In order to compare different
Example 4: Analysis of the Inhibition of MCP-1 Induced Chemotaxis by MCP-1-Binding Spiegelmers
[0288] THP-1 cells grown as described above were centrifuged, washed once in HBH (HBSS, containing 1 mg/ml bovine serum albumin and 20 mM HEPES) and resuspended at 3×10.sup.6 cells/ml. 100 μl of this suspension were added to Transwell inserts with 5 μm pores (Corning, #3421). In the lower compartments MCP-1 was preincubated together with Spiegelmers in various concentrations in 600 μl HBH at 37° C. for 20 to 30 min prior to addition of cells. Cells were allowed to migrate at 37° C. for 3 hours. Thereafter the inserts were removed and 60 μl of 440 μM resazurin (Sigma) in phosphate buffered saline was added to the lower compartments. After incubation at 37° C. for 2.5 hours, fluorescence was measured at an excitation wavelength of 544 nm and an emission wavelength of 590 nm in a Fluostar Optima multidetection plate reader (BMG).
Determination of Half-Maximal Effective Concentration (EC.SUB.50.) for Human MCP-1
[0289] After 3 hours migration of THP-1 cells towards various human MCP-1 concentrations, a dose-response curve for human MCP-1 was obtained, indicating a maximal effective concentration of about 1 nM and reduced activation at higher concentrations. For the further experiments on inhibition of chemotaxis by Spiegelmers a MCP-1 concentration of 0.5 nM was used.
Determination of Half-Maximal Effective Concentration (EC.SUB.50.) for Murine MCP-1
[0290] After 3 hours migration of THP-1 cells towards various murine MCP-1 concentrations, a dose-response curve for murine MCP-1 was obtained, indicating a maximal effective concentration of about 1-3 nM and reduced activation at higher concentrations. For the further experiments on inhibition of chemotaxis by Spiegelmers a murine MCP-1 concentration of 0.5 nM was used.
Example 5: Binding Analysis by Surface Plasmon Resonance Measurement
[0291] The Biacore 2000 instrument (Biacore AB, Uppsala, Sweden) was used to analyze binding of Spiegelmers to the protein human MCP-1. When coupling of human MCP-1 was to be achieved via amine groups, human MCP-1 was dialyzed against water for 1-2 h (Millipore VSWP mixed cellulose esters; pore size, 0.025 μM) to remove interfering amines. CM4 sensor chips (Biacore AB, Uppsala, Sweden) were activated before protein coupling by a 35-μl injection of a 1:1 dilution of 0.4 M NHS and 0.1 M EDC at a flow of 5 μl/min. Human MCP-1 was then injected in concentrations of 0.1-1.5 μg/ml at a flow of 2 μl/min until the instrument's response was in the range of 1000-2000 RU (relative units). Unreacted NHS esters were deactivated by injection of 35 μl ethanolamine hydrochloride solution (pH 8.5) at a flow of 5 μl/min. The sensor chip was primed twice with binding buffer and equilibrated at 10 μl/min for 1-2 hours until the baseline appeared stable. For all proteins, kinetic parameters and dissociation constants were evaluated by a series of Spiegelmer injections at concentrations of 1000, 500, 250, 125, 62.5, 31.25, and 0 nM in selection buffer (Tris-HCl, 20 mM; NaCl, 137 mM; KCl, 5 mM; CaCl.sub.2, 1 mM; MgCl.sub.2, 1 mM; Tween20, 0.1% [w/v]; pH 7.4). In all experiments, the analysis was performed at 37° C. using the Kinject command defining an association time of 180 and a dissociation time of 360 seconds at a flow of 10 μl/min. Data analysis and calculation of dissociation constants (K.sub.D) was done with the BIAevaluation 3.0 software (BIACORE AB, Uppsala, Sweden) using the Langmuir 1:1 stochiometric fitting algorithm.
Example 6: First Results of a Phase IIa Study for Characterizing the Effects of CCL2 Inhibition with NOX-E36 in Patients with Type 2 Diabetes Mellitus and Albuminuria
[0292] This study was a prospective, multi-center, randomized, double-blind, placebo-controlled, parallel group phase IIa study with multiple subcutaneous administrations in patients with type 2 diabetes mellitus and albuminuria who were receiving standard of care to control hypertension (ACEis and ARBs), hyperglycemia (oral antidiabetics and/or insulin) and dyslipidemia. The study consisted of (i) a screening period of up to 30 days duration, to ensure that the subject is stable on his/her concomitant therapy and life style, (ii) a treatment period of 12 weeks duration with twice a week injections of the study drug NOX-E36 (0.5 mg/kg) and regular examinations and blood samplings, and (iii) a treatment-free follow-up period of 12 weeks with a final visit and a full examination of the subject status.
[0293] Study drug NOX-E36 is an L-nucleic acid comprising a nucleotide sequence of SEQ ID NO: 228 and a 40 kDa PEG moiety attached to the 5′ end of the nucleotide sequence.
Main Inclusion Criteria
[0294] The Main inclusion criteria were as follows: [0295] Type 2 diabetes mellitus according to American Diabetes Association (ADA) definition [0296] HbA1c between 6.0% and 10.5%, inclusive [0297] ACR>100 mg/g calculated 3 times in first morning void urine, at least 2 of the measurements >100 mg/g [0298] Patients on stable (unchanged medication for at least 3 months) treatment to control hypertension, hyperglycemia and (if applicable) dyslipidemia [0299] Stable treatment with angiotensin-converting enzyme inhibitors (ACEis) or Angiotensin II receptor blockers (ARBs), i.e. renin-angiotensin system (RAS) blockade
Main Exclusion Criteria
[0300] The main exclusion criteria were as follows: [0301] Type 1 diabetes mellitus [0302] eGFR ≦25 mL/min/1.73 m.sup.2 [0303] Recent cardiovascular events (3 months) [0304] Uncontrolled hypertension (upper limits 180/110 mmHg) [0305] Dialysis and/or acute kidney injury within 3 months before screening [0306] Significant edema, infectious diseases, leg ulcers [0307] Severe concurrent disease which, in the judgment of the investigator, would interfere significantly with the assessments of safety and efficacy during this study [0308] In the judgment of the clinical investigator, clinically significant abnormal laboratory values at the screening visit [0309] Use of thiazolidinedione class drugs, immune suppressants, steroid therapy (except for topical use or inhalation), chronic use of non-steroidal anti-inflammatory drug (NSAIDs), cyclooxygenase type 2 (COX-2) inhibitors, two or more diuretic drugs and/or aliskiren
Efficacy Evaluation
[0310] Efficacy evaluation was as follows:
[0311] The clinical response of study drug to CCL2 inhibition in patients with type 2 diabetes and albuminuria was assessed by means of the following parameters: [0312] ACR (albumine/creatinin ratio) calculated in first morning void urine [0313] HbA1c [0314] hsCRP in serum [0315] Further urine and serum/plasma markers of glycemic disorders, systemic inflammation, renal and liver disease and cardiovascular function [0316] Homeostasis Model of Insulin Resistance (HOMA-IR) [0317] Flow cytometric determination of CCR2 positive leukocyte subsets in peripheral blood [0318] Changes in blood pressure as marker of cardiovascular function
Safety Evaluation:
[0319] Safety evaluation was as follows [0320] Adverse events (AE) [0321] Physical examination [0322] Vital signs [0323] 12-lead electrocardiogram (ECG) [0324] Safety laboratory [0325] Immunogenicity assessment [0326] eGFR calculated on basis of serum creatinine level by the CKD-EPI formula and calculated by serum cystatin C
[0327] The results of the study are summarized in
Description of ACR Results as Shown in FIGS. 8 and 9:
[0328] The ACR response during treatment and the follow up period of 3 months for 51 patients showed a low volatility and a steady decrease from day 29 until the end of treatment which is ongoing until day 141 (−39%) after which a slight re-increase at day 169 is suggestive of a fading treatment effect (−36%). In contrast to that, the high volatility of the placebo group was maintained throughout the follow-up period until day 169.
[0329] The observed persistence of the ACR response following cessation of treatment is very encouraging and has the potential to be a strong differentiating factor of compounds such as NOX-E36 from other compounds. This prolonged effect cannot be due to the persistence of NOX-E36 in the body for such long time as elimination of the compound had been shown on day 113 to pharmacologically irrelevant levels. As the effect was clearly maintained beyond the time of pharmacological exposure, it is suggestive of induction of a structural effect in the kidney.
Description of HbA1c Results as Shown in FIGS. 10 and 11:
[0330] The HbA1c response during treatment and a follow-up period of 1 month for 51 patients showed a constant decrease followed by a slight further improvement resulting in an effect of −0.54% (abs.) on day 113. In contrast to that, the placebo group showed a time course with transient decrease during treatment and a rebound starting at day 57 resulting in an effect of +1.1% (abs.) at day 113.
Example 7: Final Results of a Phase IIa Study for Characterizing the Effects of CCL2 Inhibition with NOX-E36 in Patients with Type 2 Diabetes Mellitus and Albuminuria
[0331] A total of 75 patients were enrolled in the phase IIa study described in Example 6. This example is related to the final results obtained from said phase IIa study, whereby for the primary efficacy analysis, patients with major protocol violations, treatment with dual RAS blockade and concomitant haematuria and leukocyturia were excluded.
[0332] NOX-E36 was safe and well tolerated with a few mild local injection site reactions as the only relevant treatment-related adverse events. Plasma concentrations reached pharmacologically relevant levels of 358±106 nM (
[0333] The time course of ACR during and after dosing is illustrated in
[0334] No relevant difference in blood pressure or eGFR was seen between the treatment groups throughout the study.
[0335] A relevant decrease of HbA1c was observed at day 85 (−0.32% and +0.06% absolute change from baseline for NOX-E36 and placebo; P=0.096), which was maintained after cessation of treatment and became statistically significant (P=0.036) four weeks after the last dose (
[0336] “ns” as indicated in
[0337] From the results presented in both Examples 6 and 7 it is evident that prolonged treatment with NOX-E36 is safe and well tolerated and reduces urinary albumin excretion as well as HbA1c in type 2 diabetics with albuminuria. Said results also provide experimental evidence of a sustained effect on albuminuria even after cessation of treatment which indicates that important pathophysiological mechanisms of diabetic nephropathy are influenced. This distinguishes NOX-E36 from existing therapeutic strategies and indicates the disease-modifying potential of the drug. Furthermore and in contrast to approved drugs and other novel approaches in this indication, the effect of NOX-E36 on urinary albumin excretion is not associated with changes of blood pressure or eGFR.
REFERENCES
[0338] The complete bibliographic data of the documents recited herein the disclosure of which is incorporated by reference is, if not indicated to the contrary, as follows. [0339] ADA (2012) Standards of medical care in diabetes—2012. Diabetes Care 35 Suppl 1: S11-63 [0340] Altschul S F, Gish W, Miller W, Myers E W, Lipman D J (1990), Basic local alignment search tool. J Mol Biol. 215(3):403-10. [0341] Altschul S F, Madden T L, Schaffer A A, Zhang J, Zhang Z, Miller W, Lipman D J (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. September 1; 25(17):3389-402. [0342] Brown Z, Gerritsen M E, Carley W W, Strieter R M, Kunkel S L, Westwick J (1994) Chemokine gene expression and secretion by cytokine-activated human microvascular endothelial cells. Differential regulation of monocyte chemoattractant protein-1 and interleukin-8 in response to interferon-gamma. Am J Pathol 145(4): 913-921 [0343] Damha M J and Ogilvie K K, Methods in Molecular Biology, Vol. 20 Protocols for oligonucleotides and analogs, ed. S. Agrawal, p. 81-114, Humana Press Inc. (1993) [0344] Dawson J, Miltz W, Mir A K, Wiessner C (2003) Targeting monocyte chemoattractant protein-1 signalling in disease. Expert Opin Ther Targets 7(1): 35-48 [0345] Giunti S, Barutta F, Perin P C, Gruden G (2010) Targeting the MCP-1/CCR2 System in diabetic kidney disease. Curr Vasc Pharmacol 8(6): 849-860 [0346] Kahn B B (1998) Type 2 diabetes: when insulin secretion fails to compensate for insulin resistance. Cell 92(5): 593-596 [0347] Klussmann S. (2006). “The Aptamer Handbook—Functional Oligonucleotides and their Applications.” Edited by S. Klussmann. WILEY-VCH, Weinheim, Germany, ISBN 3-527-31059-2 [0348] Kusser W (2000). J Biotechnol 74:27-38 [0349] Levey A S, Stevens L A, Schmid C H, Zhang Y L, Castro A F, 3rd, Feldman H I, Kusek J W, Eggers P, Van Lente F, Greene T, Coresh J (2009) A new equation to estimate glomerular filtration rate. Ann Intern Med 150(9): 604-612 [0350] Mayr F B, Spiel A O, Leitner J M, Firbas C, Schnee J, Hilbert J, Derendorf H, Jilma B (2009) Influence of the duffy antigen on pharmacokinetics and pharmacodynamics of recombinant monocyte chemoattractant protein (MCP-1, CCL-2) in vivo. Int J Immunopathol Pharmacol 22(3): 615-625 [0351] McGinnis S, Madden T L (2004). BLAST: at the core of a powerful and diverse set of sequence analysis tools. Nucleic Acids Res. 32 (Web Server issue):W20-5. [0352] Mora C, Navarro J F (2004) Inflammation and pathogenesis of diabetic nephropathy. Metabolism 53(2): 265-266; author reply 266-267 [0353] Mora C, Navarro J F (2005) The role of inflammation as a pathogenic factor in the development of renal disease in diabetes. Curr Diab Rep 5(6): 399-401 [0354] Needleman & Wunsch (1970), A general method applicable to the search for similarities in the amino acid sequence of two proteins. J Mol Biol. 48(3):443-53. [0355] Ota T (2013) Chemokine systems link obesity to insulin resistance. Diabetes Metab J 37(3): 165-172 [0356] Pearson & Lipman (1988), Improved tools for biological sequence comparison. Proc. Nat'l. Acad. Sci. USA 85: 2444 [0357] Rollins B J, Pober J S (1991) Interleukin-4 induces the synthesis and secretion of MCP-1/JE by human endothelial cells. Am J Pathol 138(6): 1315-1319 [0358] Saraheimo M, Teppo A M, Forsblom C, Fagerudd J, Groop P H (2003) Diabetic nephropathy is associated with low-grade inflammation in Type 1 diabetic patients. Diabetologia 46(10): 1402-1407 [0359] Shoelson S E, Lee J, Goldfine A B (2006) Inflammation and insulin resistance. J Clin Invest 116(7): 1793-1801 [0360] Smith & Waterman (1981), Adv. Appl. Math. 2: 482 [0361] Struyf S, Van Collie E, Paemen L, Put W, Lenaerts J P, Proost P, Opdenakker G, Van Damme J (1998) Synergistic induction of MCP-1 and -2 by IL-1beta and interferons in fibroblasts and epithelial cells. J Leukoc Biol 63(3): 364-372 [0362] Tsou C L, Peters W, Si Y, Slaymaker S, Aslanian A M, Weisberg S P, Mack M, Charo I F (2007) Critical roles for CCR2 and MCP-3 in monocyte mobilization from bone marrow and recruitment to inflammatory sites. J Clin Invest 117(4): 902-909 [0363] Tsuboi N, Yoshikai Y, Matsuo S, Kikuchi T, Iwami K, Nagai Y, Takeuchi O, Akira S, Matsuguchi T (2002) Roles of toll-like receptors in C—C chemokine production by renal tubular epithelial cells. J Immunol 169(4): 2026-2033 [0364] Venkatesan N, Kim S J, Kim B H (2003) Novel phosphoramidite building blocks in synthesis and applications toward modified oligonucleotides. Curr Med Chem 10(19): 1973-1991 [0365] Wincott F, DiRenzo A, Shaffer C, Grimm S, Tracz D, Workman C, Sweedler D, Gonzalez C, Scaringe S, and Usman N (1995). Synthesis, deprotection, analysis and purification of RNA and ribosomes. Nucleic Acids Res. 23:2677-2684.
[0366] The features of the present invention disclosed in the specification, the claims and/or the drawings may both separately and in any combination thereof be material for realizing the invention in various forms thereof.