Malaria transmission blocking vaccine

Abstract

It is an object of the present invention to provide a transmission-blocking vaccine using an immunogenic protein which is specifically expressed in the oocyst stage of malaria parasites or a peptide fragment thereof, and an oral transmission-blocking vaccine capable of immunizing various animals involved in the malaria infectious cycle with such a vaccine. The present invention relates to a malaria transmission-blocking vaccine for oral administration containing an immunogenic protein derived from malaria parasite which is specifically expressed in the oocyst stage of malaria parasites or a peptide fragment thereof, and a method of blocking the transmission of malaria using the same.

Claims

1. A method of blocking the transmission of malaria comprising administering a malaria transmission-blocking vaccine to a domestic or wild animal, wherein the malaria transmission-blocking vaccine comprises an immunogenic protein of a malaria parasite specifically expressed in the oocyst stage of the malaria parasite or a peptide fragment of the immunogenic protein, wherein the immunogenic protein is: an isolated protein consisting of the amino acid sequence of SEQ ID NO: 1; or an isolated protein consisting of the amino acid sequence of SEQ ID NO: 2; and wherein the peptide fragment consists of the amino acid sequence of SEQ ID NO: 3 and/or one or more of SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6.

2. The method according to claim 1, wherein the administration is oral administration.

3. The method according to claim 1, wherein the malaria transmission-blocking vaccine is a transformant plant expressing the immunogenic protein or the peptide fragment thereof, wherein the transformant plant is a strawberry plant.

4. The method according to claim 1, wherein the malaria transmission-blocking vaccine is an edible tissue of a transformant plant expressing the immunogenic protein or the peptide fragment thereof, wherein the edible tissue is strawberry fruit.

5. The method according to claim 3, wherein the transformant expresses a DNA encoding the protein consisting of the amino acid sequence of SEQ ID NO: 1 or the peptide fragment thereof; or the protein consisting of the amino acid sequence of SEQ ID NO: 2 or the peptide fragment thereof.

6. The method according to claim 5, wherein the expressed DNA is: a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 7 or SEQ ID NO: 8; or a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 shows the results of fluorescent antibody staining for anti-PbCap93-1 and anti-PbCap494-1 antibody against oocysts.

(2) FIG. 2 shows the inhibition of oocyst formation by passive immunization using rabbit antibody (anti-PbCap494-1 antibody) obtained by immunization with polypeptide PbCap494-1.

(3) FIG. 3 shows the inhibition of oocyst formation by passive immunization using mixed rabbit antibodies with anti-PbCap494-2,3 antibody and anti-PbCap494-1 antibody. Anti-PbCap494-2,3 antibody was obtained by immunization with combined peptide of two regions PbCap494-2 and PbCap494-3.

(4) FIG. 4 shows inhibition of oocyst formation by passive immunization using rabbit antibodies obtained by immunization with polypeptides PbCap93-1.

(5) FIG. 5 shows inhibition of oocyst formation by passive immunization using non-immunized rabbit antibodies.

(6) FIG. 6 shows plant expression constructs incorporating DNAs encoding polypeptides PbCap93-1.

(7) FIG. 7 is an electrophoretic diagram confirming the introduction of DNAs encoding polypeptides PbCap93-1 in transformed strawberry strains by genomic PCR.

(8) FIG. 8 shows the increase in antibody titer following administration of an oral vaccine utilizing transformed strawberries.

EMBODIMENTS FOR CARRYING OUT INVENTION

(9) In one embodiment of the present invention, the malaria transmission-blocking vaccine of the present invention comprises an immunogenic protein derived from the malaria parasite or a peptide fragment thereof which is specifically expressed in the oocyst stage of the malaria parasite. Here, as long as the peptide fragment has immunogenicity, there is no particular limitation on the type or number of amino acids constituting the peptide fragment, and for example, it includes an oligopeptide consisting of about 10 amino acids and a peptide consisting of 20 or more amino acids. In this specification, unless otherwise specified, a peptide consisting of two or more amino acids is referred to as a polypeptide.

(10) In one embodiment, the immunogenic protein from the malaria parasite is a protein PbCap93 or protein PbCap494 from the malaria parasite (Plasmodium berghei), or an immunogenic protein consisting of various proteins from the malaria parasite corresponding thereto, or an amino acid sequence having 90% or more, preferably 95% or more identity to their amino acid sequence.

(11) The immunogenic protein includes (1) a protein PbCap93 consisting of the amino acid sequence set forth in SEQ ID NO: 1, (2) a protein consisting of an amino acid sequence having 90% or more, preferably 95% or more identity to the amino acid sequence set forth in SEQ ID NO: 1 and having immunogenicity, (3) a protein PbCap494 consisting of the amino acid sequence set forth in SEQ ID NO: 2, and (4) a protein consisting of an amino acid sequence having 90% or more, preferably 95% or more identity to the amino acid sequence set forth in SEQ ID NO: 2 and having immunogenicity.

(12) In one embodiment, the immunogenic polypeptides may be peptide fragments of protein PbCap93 or peptide fragments of protein PbCap494. Furthermore, peptide fragments of proteins derived from various malaria parasites corresponding to protein PbCap93 or protein PbCap494 may be used.

(13) An immunogenic polypeptide of the present invention is: (a1) a polypeptide PbCap93-1 consisting of the amino acid sequence set forth in SEQ ID NO: 3; (a2) a polypeptide consisting of an amino acid sequence having 90% or more, preferably 95% or more identity to the amino acid sequence set forth in SEQ ID NO: 3, and having immunogenicity; (b1) a polypeptide PbCap494-1 consisting of the amino acid sequence set forth in SEQ ID NO: 4; (b2) a polypeptide consisting of an amino acid sequence having 90% or more, preferably 95% or more identity to the amino acid sequence set forth in SEQ ID NO: 4, and having immunogenicity; (c1) a polypeptide PbCap494-2 consisting of the amino acid sequence set forth in SEQ ID NO: 5; (c2) a polypeptide consisting of an amino acid sequence having 90% or more, preferably 95% or more identity to the amino acid sequence set forth in SEQ ID NO: 5, and having immunogenicity; (d1) a polypeptide PbCap494-3 consisting of the amino acid sequence set forth in SEQ ID NO: 6; (d2) a polypeptide consisting of 90 Preferably, a polypeptide comprising an amino acid sequence having 95% or more identity, and having immunogenicity is included.

(14) In one embodiment of the present invention, there is a malaria transmission-blocking vaccine comprising an immunogenic protein comprising at least one of the polypeptides of (a1)-(d2) above. An immunogenic protein comprising at least one of the polypeptides (a1) to (d2) includes a protein PbCap93 comprising the amino acid sequence set forth in SEQ ID NO: 1; a protein PbCap494 comprising the amino acid sequence set forth in SEQ ID NO: 2; and a protein comprising an amino acid sequence having 90% or more and preferably 95% or more identity with the amino acid sequence mentioned above, and having immunogenicity.

(15) Further, the immunogenic polypeptide of the present invention includes a polypeptide consisting of the above (a1) to (d2) as a building block and such building blocks are repeated regularly, for example, (a1)-(a2)-(a1)-(a2)- . . . -(a1)-(a2), (a1)-(b1)-(c1)-(d1)- . . . -(c1)-(d1) and so on, or, such building blocks are repeated irregularly, for example, (a1)-(b2)-(b1)-(b2)- . . . -(a2)-(a2), or (a2)-(b1)-(c1)-(b2)- . . . -(d2)-(b2) and so on.

(16) When the building block is repeatedly included, the number of repetitions is not particularly limited.

(17) The vaccine of the present invention may be for oral administration.

(18) The present invention may also, in one embodiment, be a malaria transmission-blocking vaccine for oral administration comprising an immunogenic polypeptide derived from malaria parasites specifically expressed in the oocyst stage of the malaria parasite.

(19) In the present invention, the “malaria transmission-blocking vaccine” may be any vaccine that prevents the transmission of malaria. For example, it may be a vaccine containing an antigen which is expressed in the malaria parasite at a stage of development in the body of a mosquito vector of the malaria parasite.

(20) The malaria to be prevented from transmission by the vaccine of the present invention is not particularly limited as long as it is mediated by the malaria parasite which specifically expresses the immunogenic protein in the oocyst stage. For example, not only falciparum malaria (Plasmodium falciparum), vivax malaria (Plasmodium vivax), quartan malaria (Plasmodium malariae), simian malaria (Plasmodium knowlesi), rodent malaria (Plasmodium berghei), etc. can be prevented from malaria transmission mediated by known malaria parasites. In particular, transmission of malaria mediated by malaria parasites expressing a protein corresponding to protein PbCap93 or protein PbCap494 of rodent malaria parasite (Plasmodium berghei) can be suitably prevented.

(21) The malaria parasites have a predetermined stage of development in the body of Anopheles mosquitoes. In other words, malaria parasites invade Anopheles mosquitoes by blood-sucking action, and are transformed into male and female reproductive bodies in the digestive tract of the mosquitoes, becoming zygotes in both sexes, and differentiating from orchinates into oocysts.

(22) The polypeptide may be synthesized according to conventional methods, and may be obtained, for example, by culturing transformed host cells, expressing the target DNA incorporated in the expression vector, and purifying the protein. For example, host cells are destroyed by ultrasonic treatment, homogenizer treatment, high pressure compaction treatment, and the like to obtain an extract, and the extract can be separated and purified by combining methods such as solvent extraction, salting-out, desalting, organic solvent precipitation, ultrafiltration, ion-exchange, hydrophobic interaction, HPLC, gel filtration and affinity chromatography, electrophoresis, isoelectric focusing, and the like.

(23) The host cells used for transformation can be, for example, microorganisms of the genera Escherichia and Bacillus as prokaryotes, yeasts of the genera Saccharomyces, Schizosaccharomyces and Pichia as eukaryotes, mammalian cells such as Chinese hamster ovary (CHO) cells of human fetal kidney cells, baculovirus-sensitive insect cells and insect bodies.

(24) When the vaccine of the present invention is to be used orally, for example, it may be prepared by the usual method of the formulation according to the method described in the “General Rules for Formulations of the Japanese Pharmacopoeia, 15th revision” and suitable for oral use. The dosage form can include capsules, granules, pills, powders, tablets, and the like, and various additives, for example, excipients, binders, disintegrants, coating agents, and the like, may be formulated depending on the dosage form for oral use. Oral dietary modifiers are also not limited to only artificially formulated compositions, but include, for example, food ingredients such as vegetables and fruits such as leaves, roots and fruits, food ingredients, processed end products such as foods and beverages, as well as various compositions used for foods, and represent concepts that encompass anything that is about to be eaten or fed.

(25) The vaccines of the present invention may contain transformants that express immunogenic polypeptides derived from the malaria parasite. The transformant is not particularly limited as long as it has no problem in feeding and the polypeptide is expressed by transformation and can be orally immunized. For example, transformants of microorganisms conventionally used in foods such as natto bacteria, lactic acid bacteria, acetic acid bacteria, yeast and basidiomycetes, and transformed animals highly expressing the aforementioned polypeptides may be used, but transformed plants such as rice, wheat, barley, maize, strawberry, tomato, potato, lettuce, soybean and azuki are preferable because it is to be used especially orally and possible to avoid the risk of contamination of pathogens (viruses, fungi, bacteria, parasites, and the like) infectious to animals.

(26) Preferably, the transformant has an edible tissue. Such edible tissues include, for example, basidiomycete fruits (mushrooms), plant fruits (e.g., strawberries, tomatoes), roots (radishes, potatoes), leaves (cabbage, lettuce), seeds (rice, barley, wheat, corn, and other cereals, and soybeans, azuki, and the like). Among them, an edible tissue to be eaten raw is preferable because immunogenicity is not deactivated by cooking such as heating and such tissue is easy to eat or feed.

(27) Methods of making transformants are not particularly limited and can be produced by generally well known methods. For example, transformation methods suitable for a variety of subjects can be used, such as methods utilizing calcium-based competencies (mainly bacteria), vectors such as phage and plasmids (mainly bacteria), protoplast-PEG methods (mainly filamentous fungi), lithium methods (mainly yeast), electroporation methods, particle gun methods, Agrobacterium methods (plants).

(28) The transformants which can be used in the present vaccines are introduced so that DNA encoding an immunogenic protein derived from malaria parasites which is specifically expressed in the oocyst stage of malaria parasites or a peptide fragment thereof, in particular, DNA encoding a protein PbCap93 or a peptide fragment thereof, DNA encoding a protein PbCap494 or a peptide fragment thereof, or the like can be expressed.

(29) In one embodiment, the present invention provides that the expressed DNA is,

(30) (a1) DNA consisting of the base sequence set forth in SEQ ID NO: 7 (DNA encoding protein PbCap93); or DNA consisting of the base sequence set forth in SEQ ID NO: 8 (DNA encoding protein PbCap494);

(31) (b1) DNA that hybridizes under stringent conditions to a DNA consisting of a nucleotide sequence complementary to the DNA consisting of the nucleotide sequence described in (a1), and that encodes a protein having immunogenicity;

(32) (a2) DNA consisting of the base sequence set forth in SEQ ID NO: 9 (DNA encoding a polypeptide PbCap93-1), DNA consisting of the base sequence set forth in SEQ ID NO: 10 (DNA encoding a polypeptide PbCap494-1), DNA consisting of the base sequence set forth in SEQ ID NO: 11 (DNA encoding a polypeptide PbCap494-2), or DNA consisting of the base sequence set forth in SEQ ID NO: 12 (DNA encoding a polypeptide PbCap494-3); or
(b2) DNA that hybridizes under stringent conditions to a DNA consisting of a nucleotide sequence complementary to the DNA consisting of the nucleotide sequence described in (a2), and that encodes a peptide having immunogenicity.

(33) The present invention relates, in one aspect, to transformants expressing immunogenic polypeptides derived from malaria parasites.

(34) The transformant of the present invention is a transformant that can be used in the vaccines of the present invention described above, and, for example, a protein PbCap93 having the amino acid sequence set forth in SEQ ID NO: 1 or a peptide fragment thereof; or a DNA encoding a protein PbCap494 having the amino acid sequence set forth in SEQ ID NO: 2 or a peptide fragment thereof is introduced so as to be expressible.

(35) In one embodiment of the invention, the transformants are those that

(36) (a1) DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 7 or 8;

(37) (b1) DNA encoding a protein that hybridizes under stringent conditions to a DNA consisting of a nucleotide sequence complementary to the DNA consisting of the nucleotide sequence described in

(38) (a1), and has immunogenicity;

(39) (a2) DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 9, 10, 11 or 12; or

(40) (b2) DNA that hybridizes under stringent conditions with a DNA consisting of a nucleotide sequence complementary to the DNA consisting of the nucleotide sequence described in (a2), and that encodes an immunogenic peptide fragment;

(41) is introduced so as to be expressible.

(42) The term “stringent conditions” as used herein refers to conditions under which specific hybrids are formed and non-specific hybrids are not formed. Such conditions are understood by those skilled in the art and include, for example, conditions in which nucleic acids having a high degree of homology, such as 99.5% or more, hybridize to each other, but DNA having a lower degree of homology does not hybridize to each other.

(43) The present invention relates, in one aspect, to a method of preventing the transmission of malaria, wherein the method comprises, for example, administering to a domestic or wild animal a malaria transmission inhibiting vaccine of the present invention.

(44) Administration to domestic or wild animals in the present invention may be parenteral, but oral administration is preferred. Parenteral administration includes administration by injection, transdermal, transmucosal, nasal or pulmonary administration. Oral administration may be accomplished, for example, by feeding the edible tissue of the transformants to domestic or wild animals. Feeding includes not only feeding the livestock in the breeding environment, but also sprinkling the edible tissue into the wild environment so that the wild animal can feed.

(45) As used herein, immunogenicity refers to the property of inducing an immune response. Such properties include, for example, antigenicity that triggers a biological reaction that produces antibodies by immunization, and properties that modulate immune-related substances such as cytokines and inflammatory factors.

(46) The vaccine of the present invention may contain an adjuvant, for example, an aluminum hydroxide gel, an aluminum phosphate gel, a mixture of a vegetable or mineral fat and a surfactant, or the like. The amount of the adjuvant is not particularly limited as long as it can be immunostimulated in accordance with the characteristics of each adjuvant.

(47) The vaccine of the present invention can be used as a normal vaccine, for example, it can be administered multiple times to obtain a booster effect. It can also be used for boosters after administration of other vaccines. For example, a booster effect can be obtained by orally administering to an individual who has previously been administered a vaccine of the same kind or different kind as the vaccine of the present invention. Pre-administered vaccines are not particularly limited in dosage form and may be administered by injection, transdermal, transmucosal, nasal or pulmonary administration, or orally.

(48) In the following, the method according to the present invention will be explained in more detail on the basis of examples and test examples, but the present invention is not limited thereto.

EXAMPLES

(49) (a) Selection of Candidate Genes for Expressed Proteins in the Oocyst Stage

(50) Using ‘Identify Genes based on P. b. life cycle MassSpec.Evidence(hypertext transfer protocol plasmodb.org/a/showQuestion.d o?questionFullName=GeneQuestions.GenesByProteomicsProf ile)’ of Plasmo DB (hypertext transfer protocol plasmodb.org/plasmo/), 14 genes with transmembrane regions were selected out of 65 genes expressed only in the oocyst stage, and 5 genes including PBCAP93 and PBCAP494 which are novel proteins were selected as candidates. The peptides described in Table 1 were conjugated to KLH using the maleimide method and immunized to Japanese white rabbits each. Antibody production was performed using the antibody production services of eurofins operon Corporation.

(51) TABLE-US-00001 TABLE 1 Candidate Genes and Tested Amino Acid Regions Peptide name Gene ID Amino acid region PbCap93-1 PBANKA_090520 379-392aa PbCap494-1 PBANKA_102510 926-939aa PbCap494-2 PBANKA_102510 1789-1802aa PbCap494-3 PBANKA_102510 3103-3116aa
(b) E. coli Expression of PbCap93-1

(52) Constructs in which DNAs encoding the respective amino acid regions listed in Table 1 were repeated 12 times were produced and expressed in the pCold III vector system (TAKARA).

(53) The PCR-amplified fragments obtained using the primers described below were each treated with a plasmid vector digested with restriction enzymes (Nde I/Pst I) and then introduced into a plasmid, and the plasmid was used to obtain an E. coli BL21 (Agilent Technologies Cat. 230245) transformed strain for expression.

(54) TABLE-US-00002 FW Primer: (SEQ ID NO: 13) 5′-GAATTCCATATGATGATTTCCCATAACCACAACGACCAT-3′ RV Primer: (SEQ ID NO: 14) 5′-GAACTGCAGTCAAAGTTCATCCTTATGATGATGGTGGTG-3′

(55) Subsequently, the transformed E. coli strain in which the plasmid was inserted was inoculated into 10 ml of LB medium containing 100 μg/ml of ampicillin, shaken and cultured at 30° C. overnight. E. coli cells containing plasmids were inoculated into LB medium containing 100 μg/ml of ampicillin (200 ml×2), shaken and cultured at 37° C., cooled to 15° C. immediately when the OD 600 of the culture medium reached 0.4 to 0.5, and left for 30 minutes. IPTG was added to a final concentration of 1.0 mM and the mixture was shaken at 15° C. overnight.

(56) (c) Purification of Expressed Proteins

(57) Escherichia coli (400 ml) after induction of IPTG expression is harvested, B/W Buffer is added, and crushed by supersonic crushing. After that, the mixture was centrifuged (9800×g, 10 min), the supernatant was mixed into 4 ml (Bed Volume) of Ni-NTA Agarose (QIAGEN Cat. 1018240) and adsorbed overnight at 4° C. using a shaker. After overnight adsorption, the supernatant was centrifuged (2000×g, 2 minutes) and discarded, and the Ni-NTA Agarose was centrifuged and washed with B/W Buffer (2000×g, 2 minutes×2 times). POLY-PREP® Chromatography Columns (BIO RAD Cat. 731-1550) was filled with Ni-NTA Agarose and washed with B/W Buffer (4×10 ml). The attached Elution Buffer1 {tilde over ( )}5 was sequentially passed through a POLY-PREP® Chromatography Columns in 5 ml portions, and the fractions were collected.

(58) (d) ELISA of Expressed Proteins to Determine Titers

(59) Purified expressed protein dissolved in PBS was added to 96 well plates and immobilized overnight at 4° C. After blocking, 100 μl of anti-PbCap93-1 antibodies were added and reacted at 4° C. for 2 hours. After washing with PBS, peroxidase conjugated anti-rabbit IgG was added, reacted at 4° C. for 2 hours, and after washing and colorizing, the absorbance was measured to confirm the antibody titer of the antibody produced in (a).

(60) (e) Confirmation of the Peptide Antibody Recognition of the Proteins Expressed in the Oocyst Stage

(61) The midgut of A. gambiae (Keele strain) 15 days after P. berghei infection by blood-sucking was smeared and air-dried on a glass slide and then fixed with methanol. After air-drying, the smeared midgut was surrounded by Liquid Blocker (Daido Sangyo, Japan), and one drop of Image-iT (trademark) FX Signal Enhancer (Invitrogen USA) was dropped, and left to stand at 37° C. for 30 minutes. After washing with PBS, rabbit sera containing anti-PbCap93-1 and anti-PbCap494-1 antibody as the primary antibody were reacted at 4° C. for 2 hours, washed 2 or 3 times with PBS, and ALEXA FLUOR™ 488 anti-rabbit IgG (Molecular Probes, USA) (1:800-fold diluted) as the secondary antibody was reacted at 4° C. for 1 hour, and washed 2 or 3 times with PBS. In addition, anti-PbCap380 rabbit sera (1:1000-fold dilution) as a primary antibody was reacted for 1 hour at 4 degrees, washed 2 or 3 times with PBS, and ALEXA FLUOR™ 568_anti-rabbit IgG (Molecular Probes, USA) (1:800-fold dilution) as a secondary antibody was reacted for 1 hour at 4° C. and washed 2 or 3 times with PBS. Nuclei were stained by adding Hoechest 33258 (Polysciences, USA) to secondary antibodies at a final concentration of 5 μg/ml. One drop of FLUOROMOUNT/PLUS™ SAMPLE (Diagnostic Bio System, USA) was dropped on a glass slide, covered with a coverslip, and observed under a fluorescent microscope, and the results are shown in FIG. 2. It was revealed that these antibodies recognize oocysts and that PbCap93 and PbCap494 are located on the outer side of the oocyst walls.

(62) (f) Inhibition of Oocyst Formation by Passive Immunization

(63) PbCap494-1˜3

(64) Plasmodium berghei (1×10.sup.6) was administrated intravenously(tail vein) to Balb/c mice. The mosquitoes (Anopheles stephensi) used were divided into two boxes before (pre) and after (Post) serum administration, and 100 mosquitoes (including both sexes) were prepared for each box. When the erythrocyte infestation (parasitemia) rate (infected erythrocytes/total erythrocytes) was around 10%, mosquitoes were fed for 10 minutes (pre-infected mosquitoes). Then, anti-PbCap494 rabbit antibodies (anti-PbCap494-1 antibody and anti-PbCap494-2,3 antibody) by immunization with the PbCap494-1 peptide and the peptide combining the two regions of PbCap494-2 and p3 were administered in the tail vein to the malaria-infected mice. Mosquitoes were fed for 10 minutes (Post infected mosquitoes) 5 minutes after administration in the tail veins. Pre-infected mosquitoes and Post infected mosquitoes were dissected (30 or more animals) 15 days after the infection by blood-sucking, and the numbers of oocysts formed in the middle intestine of mosquitoes were counted and compared. Results of administration in the tail vein of 10 μg/mouse and 200 μg/mouse of PbCap494-1 antibodies are shown in FIG. 2. The number of oocysts was significantly decreased at both 10 μg and 200 μg doses, and the number of oocysts tended to decrease more at higher antibody levels. FIG. 3 shows the results of administering 200 mice per 100 μg each of anti-PbCap494-1 antibody and anti-PbCap494-2,3 antibody. The number of oocysts was significantly decreased in the treated group.

(65) PbCap93-1

(66) Plasmodium berghei (1×10.sup.7) was administered intraperitoneally(tail vein) to Balb/c mice. The mosquitoes (Anopheles stephensi) used were divided into two boxes before (pre) and after (Post) serum administration, and 100 mosquitoes (including both sexes) were prepared for each box. When the rate of erythrocyte infestation (parasitemia) rate (infected erythrocytes/total erythrocytes) of the above mice was around 10%, mosquitoes were fed for 10 minutes (pre-infected mosquitoes). Subsequently, anti-PbCap93-1 rabbit sera were administered in the tail vein to malaria-infected mice (100 μl). Mosquitoes are fed for 10 minutes (Post infected mosquitoes) 5 minutes after administration in the tail veins. Seven days after feeding, preinfected mosquitoes and Post infected mosquitoes were dissected (30 or more) and the numbers of oocysts formed in the middle intestine of mosquitoes were counted and compared. The results are shown in FIG. 4. The number of oocysts was significantly decreased in the treated group.

(67) The results of the same administration of the control rabbit antibody are shown in FIG. 5. No treatment-related decrease in the number of oocysts was observed.

(68) (g) Generation of Antigen-Expressing Strawberries Preparation of Vectors for Plant Expression

(69) A construct for plant expression for PbCap93-1 is shown in FIG. 6. The abbreviations in FIG. 6 are: CaMV P35S 836 bp: transcription promoting factor, Ω:TMV omega sequence, pRI 201 AN DNA(TAKARA) AN sequence substituted with Ω sequence, SP of Tobacco PR1: tobacco PR1 signal peptide sequence; Pb ANKA 090520/12rpt:Pbcap93 epitope sequence; Thsp 250 bp: Arabidopsis HSP gene-derived terminator sequence; His tag: histidine tag; KDEL: ER retention signal; FW Primer: forward primer; RV Primer: reverse primer. The above-mentioned pRI 201 AN DNA was commercialized by TAKARA in response to the provision of technology and samples from the National University Institute of Advanced Science and Technology, Nara University.

(70) Plasmid Construction Methods

(71) Using IN-FUSION® HD PCR Cloning Kit(TAKARA), Genes ware amplified by PCR with the primers described below, introduced into vectors linearized with Nde I and Sac I digestion, and the HB101 was transformed, and plasmids were recovered.

(72) TABLE-US-00003 FW Primer: (SEQ ID NO: 15) ttctacaactacacatATGGGATTCGTGCTTTTCTCTC RV Primer: (SEQ ID NO: 16) cttcatcttcataagagctcTCAAAGTTCATCCTTATG
The lower case portion of the primer is a base sequence derived from a vector.
Transformation of Strawberry

(73) Transformation mediated by Agrobacterium was carried out using the Agrobacterium strain into which above-mentioned plasmid was introduced.

(74) Genomic PCR was performed using the specific FW Primer (forward primer) and RV Primer (reverse primer) set at both ends of the gene described below. The extraction of genomic DNAs was carried out according to a protocol using nucleic acid extraction kits MAGEXTRACTOR™-Plant Genome-(TOYOBO) and nucleic acid purification systems MAGEXTRACTOR™MFX-6100 TOYOBO). PCR products were detected by electrophoresis on a 1.5% TBE agarose gel, FIG. 7.

(75) TABLE-US-00004 FW Primer: (SEQ ID NO: 17) CTCTCACTCTTGCAGGGCTATTTCCCATAACCAC RV Primer: (SEQ ID NO: 18) cttcatcttcataagagctcTCAAAGTTCATCCTTATG
The lower case portion of the primer is a base sequence derived from a vector.
(f) Immunological Evaluation of Oral Vaccines Using Transformed Strawberries

(76) 10 μg of PbCap93 were mixed with adjuvant (TITER MAX® Gold Funakoshi) (antigens:adjuvant=1:1), and Balb/c mice were immunized with 10 μg/100 μl/animal of the mixture by intramuscular injection. These mice were boosted by oral administration (approximately 0.1-0.15 g/dose of lyophilized transformed strawberry powder) on Days 2, 16, 20, and 24 after the primary immunization. Similarly, booster immunizations were performed by intramuscular injection on Days 2 and 28 after the primary immunization. On Days pre-administration, 11, 15, 25, and 41, mice were bled and the titers of the obtained sera against PbCap93-1 were determined by ELISA. In mice boosted with transformed strawberries, an increase in antibody titer was observed after Day 25. The results are shown in FIG. 8.

(77) The sequence numbers and sequences described herein are shown in Table 2.

(78) TABLE-US-00005 TABLE 2 SEQ ID NO. and Sequences SEQ ID NO. Sequence SEQ ID NO: 1 Full-length amino acid sequence of PbCap93 SEQ ID NO: 2 Full-length amino acid sequence of PbCap494 SEQ ID NO: 3 Amino acid sequence of PbCap93-1 SEQ ID NO: 4 Amino acid sequence of PbCap494-1 SEQ ID NO: 5 Amino acid sequence of PbCap494-2 SEQ ID NO: 6 Amino acid sequence of PbCap494-3 SEQ ID NO: 7 Full-length DNA sequence of PbCap93 SEQ ID NO: 8 Full-length DNA sequence of PbCap494 SEQ ID NO: 9 DNA sequence of PbCap93-1 SEQ ID NO: 10 DNA sequence of PbCap494-1 SEQ ID NO: 11 DNA sequence of PbCap494-2 SEQ ID NO: 12 DNA sequence of PbCap494-3 SEQ ID NO: 13 FW primer for PbCap93-1 transformed E. coli SEQ ID NO: 14 RV primer for PbCap93-1 transformed E. coli SEQ ID NO: 15 FW primer for PbCap93-1 plasmid SEQ ID NO: 16 RV primer for PbCap93-1 plasmid SEQ ID NO: 17 FW primer for PbCap93-1 transformed strawberry SEQ ID NO: 18 RV primer for PbCap93-1 transformed strawberry