LINKER ELEMENT AND METHOD OF USING SAME TO CONSTRUCT SEQUENCING LIBRARY

Abstract

Provided is a linker element and a method of using the linker element to construct a sequencing library, wherein the linker element consists of a linker A and a linker B, the linker A is obtained through the complementary pairing of a long nucleic acid strand and a short nucleic acid strand, the 5′ end of the long strand has a phosphoric acid modification, and the 3′ end of the short strand has an enclosed modification, with enzyme sites in the short strand; and the linker B is a nucleic acid single strand, and the 3′ end thereof can be in a complementary pairing with the 5′ end of the long strand of the linker A. Using the linker element of the present invention for constructing a sequencing library ensures the linking directionality of the linkers while solving the problems of fragment interlinking, linker self-linking and low linking efficiency, and reducing the purification reaction between steps, shortening the linking time and reducing costs.

Claims

1. A linker element consisting of a linker A and a linker B, wherein the linker A is generated from the complementary pairing of a long strand of nucleic acid and a short strand of nucleic acid, wherein the long strand has a phosphate modification at the 5′end and the short strand has a blocking modification at the 3′ end, and has an enzyme active site in the short strand; and the linker B is a single-stranded nucleic acid, and the 3′ end thereof can be complementary to the 5′end of the long strand of the linker A but the rest part cannot be complementary to the linker A.

2. The linker element according to claim 1, wherein the long strand of linker A has a length of 40-48 bp and the short strand of linker A has a length of 9-14 bp.

3-6. (canceled)

7. A method for constructing a sequencing library, which uses the linker element according to claim 1.

8. The method for constructing a sequencing library according to claim 7, comprising the steps of: 1) fragmenting a DNA to be tested; 2) dephosphorylating and blunt-end repairing the DNA fragments obtained in step 1); 3) linker ligations: linker A ligation: the linker A is added to both ends of the DNA fragments obtained in Step 2) by a ligation reaction; enzyme treatment and phosphorylation: depending on the enzyme active site in the short strand of the A linker, the DNA fragments ligated with the linker A are treated with the corresponding enzyme, and the unlinked 5′ends of the fragments are phosphorylated; linker B ligation: through a ligation reaction, the linker B is added to both ends of the DNA fragments ligated with the linker A; 4) amplification of DNA fragments: polymerase chain reaction is carried out using the DNA fragments obtained in step 3) as a template and using single-stranded nucleic acids C and D, which are complementary to the long strand of the linker A and the nucleic acid strand of the linker B, as primers; 5) hybridization capture: the product obtained in step 4) is captured by hybridizing with an oligonucleotide probe and in the enrichment step of the hybridization product, a separation marker is introduced at the 5′end of one strand of the double-stranded nucleic acid and a phosphate group modification is introduced at the 5′ end of the other strand; 6) separation and cyclization of single-stranded nucleic acids: the product obtained in step 5) is separated by utilizing the separation marker to obtain another nucleic acid single strand without the separation marker; and a single strand circular nucleic acid product is obtained by cyclizing the obtained nucleic acid single strand, that is the sequencing library.

9. (canceled)

10. The method for constructing a sequencing library according to claim 8, wherein in step 2), the dephosphorylation is carried out by using shrimp alkaline phosphatase.

11. The method for constructing a sequencing library according to claim 8, wherein in step 5), the oligonucleotide probe is a library of oligonucleotide probes.

12-15. (canceled)

16. A sequencing library construction kit comprising the linker element according to claim 1.

17. The kit according to claim 16, further comprising a dephosphorylase; a DNA polymerase; a User enzyme; and a phosphorylase.

18. The kit according to claim 17, wherein the dephosphorylase is an alkaline phosphatase.

19. The kit according to claim 17, wherein the dephosphorylase is a shrimp alkaline phosphatase.

20. The kit according to claim 17, wherein the DNA polymerase is a T4 DNA polymerase.

21. The kit according to claim 17, wherein the phosphorylase is a polynucleotide kinase.

22. The linker element according to claim 1, wherein in the linker B, the length complementary to the long strand of the linker A is 6-12 bp, and the length not complementary to the long strand of the linker A is 9-15 bp.

23. The linker element according to claim 1, wherein the blocking modification is a dideoxy blocking modification.

24. The linker element according to claim 1, wherein the linker B has a tag sequence.

25. The method for constructing a sequencing library according to claim 8, wherein in step 2), the blunt-end repair is performed by using T4 DNA polymerase.

26. The method for constructing a sequencing library according to claim 8, wherein in step 5), the separation marker is a biotin modification.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0052] FIG. 1 illustrates a sequencing library construction scheme of the present invention; 1 represents a disrupted DNA fragment, 2 represents a dephosphorylated, terminal-repaired fragment (each terminal is a hydroxyl group), 3 represents the long and short strands of the linker A, 4 represents the single strand of the linker B, and 5 represents a library construction final product of nucleic acid single strand loop.

[0053] FIG. 2 illustrates the conventional linker ligation method of Complete Genomics; 1 represents the treatment step between the ligations of linker A′ and B′; 2 represents three steps related to linker B′ ligation.

DETAILED DESCRIPTION

[0054] In order to facilitate understanding of the present invention, the present invention is exemplified as follows. It should be apparent to those skilled in the art that the described examples are merely to assist in understanding the present invention and should not be construed as limiting the invention thereto in any way.

Example 1 Construction of a Sequencing Library of the Present Invention

[0055] 1. Disruption of genomic DNA: There are many ways for genomic DNA disruption, such as physical ultrasound or enzymatic reaction, either of which has very mature schemes on the market. The present example employs a physical ultrasonic disruption method.

[0056] A Teflon line and 1 μg of genomic DNA were added into a 96-well PCR plate in turn, and then TE buffer solution or enzyme-free water was added to make up 80 μl. The plate was sealed and placed on an E220 ultrasonic disruption instrument. The conditions for disruption were set as follows:

TABLE-US-00001 Filling coefficient 20% Severe degree  5 Pulse coefficient 200 Disruption time 60 s, 5 times

[0057] 2. Recovery of disrupted fragments: magnetic beads purification method or gel recovery method can be used. Magnetic bead purification method was used in this example.

[0058] 80 μl of Ampure XP magnetic beads were added into the disrupted DNA, and then mixed well and placed for 7-15 min; then the mixture was put into a magnetic frame, and the supernatant was collected and added 40 μl of Ampure XP beads, and then mixed well and placed for 7-15 min; then the mixture was put into the magnetic frame, then the supernatant was removed, and the magnetic beads were washed twice with 75% ethanol; after drying, the beads was added 50 μl of TE buffer solution or enzyme-free water, and then mixed well and placed for 7-15 min to dissolve the recovered product.

[0059] 3. Dephosphorylation reaction: a system was prepared according the following table using the recovered products of the previous step:

TABLE-US-00002 10x NEB Buffer 2 2.4 μl Shrimp alkaline 2.4 μl phosphatase (1 U/ul) Total 4.8 μl

[0060] 4.8 μl of reaction system was added to the recovered product of the previous step, mixed, and a reaction was carried out under the conditions listed in the following table. The reaction product was used directly for the next step.

TABLE-US-00003 37° C. 45 min 65° C. 10 min

[0061] 4. End repairing of fragments: a system was prepared according to the following table:

TABLE-US-00004 Enzyme-free water  4.9 μl 10x NEB Buffer 2 0.72 μl 0.1M adenosine 0.32 μl triphosphate 25 mM 0.32 μl deoxyribonucleoside triphosphate Bovine serum albumin 0.16 μl T4 deoxyribonucleic acid  0.8 μl polymerase (3 U/ul) Total  7.2 μl

[0062] After mixing, the system was added to the product of the previous step, mixed well and incubated at 12° C. for 20 min Purification was performed with 90 μl of Ampure XP magnetic beads and 18 μl of TE buffer solution was used to dissolve the recovered product. (There are many ways to purify the reaction product, such as magnetic bead method, column purification method, gel recovery method, etc. All the methods can be used interchangeably. The present example was purified by a magnetic bead method unless otherwise specified.)

[0063] 5. Linker A ligation: The linker-related sequences used in this scheme were as follows (in the sequence, from left to right is the 5′ end to the 3′ end, the group inside “II” is terminal-modified group, “phos” represents phosphorylation, “dd” represents dideoxy, and “bio” represents biotin):

[0064] Long strand of the linker A:

TABLE-US-00005 /Phos/GTCTCCAGTCTCAACTGCCTGAAGCCCGATCGAGCTTGTCT  (i.e., SEQ ID NO: 1);

[0065] Short strand of the linker A:

TABLE-US-00006 GACUGGAGAC/ddC/ (i.e., SEQ ID NO: 2);

[0066] The ligation buffer 1 used in this scheme was formulated as follows:

TABLE-US-00007 Tris (hydroxymethyl) 150 mM aminomethane-hydrochloric acid (pH 7.8) Polyethylene glycol 8000 15% Magnesium chloride  30 mM Ribonucleoside triphosphate  3 mM

[0067] A system was prepared as follows:

TABLE-US-00008 Enzyme-free water 11 μl Linker A (100 uM) 1 μl Ligation buffer 1 13 μl T4 DNA ligase (fast) (600 U/[mu] 1 μl 1) (enzymatics, L6030-HC-L) Total 21.5 μl

[0068] The above system and the previous product were mixed and reacted according to the following table:

TABLE-US-00009 25° C. 20 min 65° C. 10 min

[0069] 6. Phosphorylation and uracil removal: a system was prepared according to the following table:

TABLE-US-00010 User enzyme (1000 U/ml) 0.5 μl Polynucleotide kinase 0.5 μl (10 U/uL) Total   1 μl

[0070] The above system was added to the product of step 5, mixed well and placed at 37° C. for 15 min.

[0071] Purification was performed by using 60 μl of Ampure XP magnetic beads, and 62.5 μl of enzyme-free water or TE buffer solution was used for recovery.

[0072] 7. Linker B ligation:

[0073] The sequence of linker B was as follows:

TABLE-US-00011 TCCTAAGACCGCACTGGAGAC (i.e., SEQ ID NO: 3)

[0074] A system was prepared as follows:

TABLE-US-00012 Ligation buffer 1 33 μl T4 DNA ligase (fast) (600 U/ 1 μl [mu] 1) (enzymatics, L6030-HC-L) Linker B (100 uM) 1.67 μl Total 37 μl

[0075] The above system was added to the recovered product in step 6 and mixed well and reacted for 20 min at 20° C.

[0076] Purification was performed by using 120 μl of Ampure XP magnetic beads, and 45 μl of TE buffer solution was used to dissolve the recovered product.

[0077] 8. Polymerase chain reaction:

[0078] The sequence of primer C was as follows:

TABLE-US-00013 /phos/AGACAAGCTCGATCGGGCTTC (i.e., SEQ ID NO: 4)

[0079] The sequence of primer D was as follows:

TABLE-US-00014 TCCTAAGACCGCACTGGAGAC (i.e., SEQ ID NO: 5)

[0080] A system was prepared as follows:

TABLE-US-00015 enzyme-free water 45 μl 10x PfuTurbo Cx buffer 100 μl (Agilent, 01.Agilent.600414) PfuTurbo Cx hot-start nucleic 2 μl acid polymerase (2.5 U/ul) (Agilent, 01.Agilent.600414) 20 uM primer C 4.0 μl 20 uM primer D 4.0 μl Total volumn 155.0 μl

[0081] The recovered product in the previous step was added to the above system, mixed well, and then reacted according to the conditions listed in the following table:

TABLE-US-00016 95° C.  3 min 95° C. 30 s 56° C. 30 s 72° C. 90 s Steps 2-4 were repeated for 7 times 68° C.  7 min

[0082] After completion of the reaction, 240 μl of Ampure XP magnetic beads were used for purification, and 25 μl of enzyme-free water was used to dissolve the recovered product.

[0083] 9. Hybridization capture: 500 ng-1 μg of reaction product of the previous step was concentrated and evaporated, and then added to the following system 1 to dissolve:

TABLE-US-00017 Blocking Sequence 1:  GAAGCCCGATCGAGCTTGTCT (i.e., SEQ ID NO: 6) Blocking sequence 2:  GTCTCCAGTC (i.e., SEQ ID NO: 7) Blocking Sequence 3:  GTCTCCAGTGCGGTCTTAGGA (i.e., SEQ ID NO: 8)

TABLE-US-00018 Enzyme-free water 3.4 μl SureSelect Block # 1 2.5 μl (Agilent) SureSelect Block # 2 2.5 μl (Agilent) Blocking sequence 1 0.3 μl Blocking sequence 2 0.3 μl Blocking sequence 3 0.3 μl Total volume 9.3 μl

[0084] The mixed reaction system 1 was allowed to react at 95° C. for 5 minutes and kept at 65° C.

[0085] System 2 was prepared as follows:

TABLE-US-00019 SureSelect Hyb # 1 8.3 μl (Agilent) SureSelect Hyb # 2 0.3 μl (Agilent) SureSelect Hyb # 3 3.3 μl (Agilent) SureSelect Hyb # 4 4.3 μl (Agilent) Total volume 16.3 μl 

[0086] System 2 was added to System 1 and kept at 65° C.

[0087] System 3 was prepared as follows:

TABLE-US-00020 Enzyme-free water 1 μl SureSelect RNase Block 1 μl (Agilent) SureSelect Oligo Capture 5 μl Library Total volume 7 μl

[0088] System 3 was added to the system 1 and 2, and reacted at 65° C. for 20-24 h.

[0089] After completion of the reaction, streptavidin-coated magnetic beads were used for binding, and the beads were dissolved in 50 ul of enzyme-free water after completion of the binding.

[0090] The following reaction system was prepared:

[0091] The sequence of primer D with biotin-modification was as follows:

TABLE-US-00021 /bio/TCCTAAGACCGCACTGGAGAC (i.e., SEQ ID NO: 9)

TABLE-US-00022 Enzyme-free water 40 μl 10x PfuTurbo Cx buffer 100.0 μl (Agilen, 01.Agilent.600414) PfuTurbo Cx Hot Start 2 μl Nucleic Acid Polymerase (2.5 U/ul) (Agilent, 01.Agilent.600414) 20 uM primer C 4 μl 20 uM primer D 4 μl (biotin-modification) Total volumn 150 μl

[0092] The dissolved magnetic beads were added to the reaction system, mixed, and reacted according to the following table:

TABLE-US-00023 95° C.  3 min 95° C. 30 s 56° C. 30 s 72° C. 90 s 68° C.  7 min

[0093] After completion of the reaction, 240 μl of Ampure XP beads were used for purification. 80 μl of TE buffer solution or enzyme-free water was used for dissolving the recovered product.

[0094] 10. Separation of the single-stranded nucleic acids: Streptavidin-coated beads were used to bind the biotin-containing target fragments obtained in Step 9. The single-stranded nucleic acids with no magnetic beads bound were separated by using 78 μl of 0.1 M sodium hydroxide, and the separated product was neutralized by the addition of an acidic buffer. The total volume of the neutralized product was 112 μl.

[0095] 11. Cyclization of the single-strand nucleic acids: The following reaction system 1 was prepared: wherein the nucleic acid single strand E has a corresponding complementary sequence for ligating to both ends of the single strand. The sequence of single strand E was as follows:

TABLE-US-00024 TCGAGCTTGTCTTCCTAAGACCGC (i.e., SEQ ID NO: 10)

TABLE-US-00025 Enzyme-free water 43 μl Nucleic acid single strand E 20 μl Total 63 μl

[0096] Reaction system 1 was added to the single strand product of step 10 and mixed.

[0097] Preparation of reaction system 2:

TABLE-US-00026 Enzyme-free water 153.3 μl 10× TA buffer 35 μl (epicenter) 100 mM Adenosine triphosphate 3.5 μl T4 DNA Ligase (fast) 1.2 μl (600 U/ul) (enzymatics, L6030-HC-L) Total 175 μl

[0098] The reaction system 2 was added to the reaction system 1, mixed, and incubated at 37° C. for 1.5 h.

[0099] 12. Treatment by Exonuclease 1 and Exonuclease 3:

[0100] Preparation of the following reaction buffer:

TABLE-US-00027 Enzyme-free water 1.5 μl 10× TA buffer 3.7 μl (Epicentre) Exonuclease 1 (20 U/ul) (NEB 11.1 μl  Company, M0293S) Exonuclease 3 (100 U/ul) 7.4 μl (NEB Company, M0206S) Total 23.7 μl 

[0101] 23.7 μl of the reaction buffer was added to 350 μl of the reaction product from Step 11, mixed well and incubated at 37° C. for 30 min.

[0102] 15.4 μl of 500 mM ethylenediaminetetraacetic acid was added and mixed well. 800 μl of Ampure XP magnetic beads were used for purification and 40-80 μl of enzyme-free water/TE buffer was used for dissolving.

[0103] The concentrations and total amounts of the final products of the present example were as follows:

TABLE-US-00028 Total concentration amount (ng/μl) (ng) Product 1 0.40 16 Product 2 0.42 16.8 Product 3 0.48 19.2

[0104] Applicant declares that the present invention describes the detailed process equipment and process flow of the present invention by way of the above-described embodiments, however, the present invention is not limited to the detailed process equipment and process flow described above, that is to say, it does not imply that the present invention must rely on the above-described detailed process equipment and process flow. It should be apparent to those skilled in the art that any modification of the invention, equivalents of the ingredients of the product of the present invention, the addition of auxiliary ingredients, selection of specific modes, etc., fall within the disclosed scope and protective scope of the present invention.