Stable Fc binding protein, method for producing said protein, and antibody adsorbent in which said protein is used

Abstract

The present invention addresses the problem of providing FcRn having improved stability with respect to heat and acids, a method for producing said FcRn, an antibody adsorbent in which said FcRn is used, and an antibody isolation method in which said adsorbent is used. The above problem is solved by substituting an amino acid residue at a specific position in an extracellular region of a human FcRn α chain and/or a β2 microglobulin region of a human FcRn β chain by another specific amino acid.

Claims

1. An Fc binding protein, comprising the amino acid residues consisting of the sequence set forth in any one of SEQ ID NOs: 5 to 7.

2. A polynucleotide encoding the Fc binding protein according to claim 1.

3. An expression vector comprising the polynucleotide according to claim 2.

4. A transformant obtained by transforming an isolated host cell with the expression vector according to claim 3.

5. The transformant according to claim 4, wherein the host cell is Escherichia coli.

6. A method for producing an Fc binding protein, comprising: (A) expressing the Fc binding protein by culturing the transformant according to claim 4; and (B) recovering the expressed Fc binding protein from a culture product.

7. An adsorbent obtained by immobilizing the Fc binding protein according to claim 1 to an insoluble carrier.

8. A method for separating an antibody, comprising bringing the adsorbent according to claim 7 into contact with a solution containing the antibody.

9. A method for producing an Fc binding protein, comprising: (A) expressing the Fc binding protein by culturing the transformant according to claim 5; and (B) recovering the expressed Fc binding protein from a culture product.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a schematic structural diagram of an α-chain of a human FcRn. Numeral in the FIG. indicates the amino acid sequence number set forth in SEQ ID NO: 1. In the figure, S indicates a signal sequence, EC indicates an extracellular region, TM indicated a transmembrane region, and C indicates an intracellular region.

(2) FIG. 2 is a schematic structural diagram of a 0-chain of the human FcRn. Numeral in the figure indicates the amino acid sequence number set forth in SEQ ID NO: 2. In the figure, S indicates a signal sequence and B2M indicates a (32 microglobulin.

(3) FIG. 3 is a diagram illustrating a binding property of the human FcRn to the human IgG expressed with a transformant obtained in Example 1.

(4) FIG. 4 is a diagram illustrating a separation pattern of a monoclonal antibody which is separated using an Fc binding protein-immobilizing and separating resin in Example 14.

EXAMPLES

(5) Hereinafter, Examples will be provided to explain the present invention in more detail, but the present invention is not limited to the Examples.

Example 1 Preparation of a Human FcRn Expression Vector (E. coli-Type Codon)

(6) (1) A codon was transformed from a human-type into an E. coli-type using a DNAworks method (Nucleic Acids Res., 30, e43, 2002) based on the amino acid sequence from the 24th alanine to the 297th serine of the amino acid sequence of the α-chain of the human FcRn set forth in SEQ ID NO: 1, and the amino acid sequence from the 21st isoleucine to the 119th methionine of the amino acid sequence of the β-chain of the human FcRn composed of the amino acid sequence set forth in SEQ ID NO: 2, and a nucleotide sequence which encodes a GS linker was inserted between the transformed nucleotide sequences to design the nucleotide sequence set forth in SEQ ID NO: 4.

(7) (2) A polynucleotide composed of a sequence in which a NcoI recognition sequence (CCATGG) was added to the 5′-terminal side and a HindIII recognition sequence (AAGCTT) was added to the 3′-terminal side of the designed nucleotide sequence (SEQ ID NO: 4) was artificially synthesized.

(8) (3) After the polynucleotide synthesized in (2) was digested with restriction enzymes NcoI and HindIII, the resultant was ligated to an expression vector pETMalE (Japanese Unexamined Patent Publication (Kokai) No. 2011-206046) which had been previously digested with the restriction enzyme NcoI and HindIII, and E. coli BL21 (DE3) strain was transformed using the resulting ligation product.

(9) (4) After the resulting transformant was cultured in a LB medium containing 50 μg/mL of kanamycin, a QIAprep Spin Miniprep kit (manufactured by Qiagen N. V.) was used to extract the expression vector pET-eFcRn of a human FcRn which is a wild-type Fc binding protein.

(10) (5) Of the expression vector pET-eFcRn prepared in (4), a cycle sequence reaction of a polynucleotide encoding the FcRn and a surrounding region thereof are performed using a Big Dye Terminator Cycle Sequencing FS read Reaction kit (manufactured by ThermoFisher Scientific) based on α chain terminator method, and the nucleotide sequence was analyzed using a full-automatic DNA sequencer ABI Prism 3700 DNA analyzer (manufactured by ThermoFisher Scientific). In the analysis, an oligonucleotide set forth in SEQ ID NO: 8 (5′-TAATACGACTCACTATAGGG-3′) or SEQ ID NO: 9 (5′-TATGCTAGTTATTGCTCAG-3′) was used as a primer for sequencing.

(11) The amino acid sequence of the polypeptide expressed with an expression vector pET-eFcRn is shown in SEQ ID NO: 10 and the sequence of the polynucleotide encoding the polypeptide is shown in SEQ ID NO: 11, respectively. In SEQ ID NO: 10, a region from the first methionine (Met) to the 26th alanine (Ala) is a MalE signal peptide, a region from the 27th lysine (Lys) to the 33rd glycine (Gly) is a linker sequence, a region from the 34th isoleucine (Ile) to the 132nd methionine (Met) is a β2 microglobulin region of the human FcRn β chain (a region from the 21st to the 119th in SEQ ID NO: 2), a region from the 133rd glycine (Gly) to the 157th serine (Ser) is a GS linker sequence, a region from the 158th alanine (Ala) to the 431st serine (Ser) is an extracellular region of the human FcRn α chain (a region from the 24th to the 297th in SEQ ID NO: 1), and a region from the 432nd to the 437th histidine (His) is a tag sequence.

Example 2 Measurement of Antibody Binding Activity of Human FcRn

(12) (1) The E. coli BL21 (DE3) strain transformed with the expression vector pET-eFcRn, obtained in Example 1 was inoculated in 4 mL of 2YT liquid medium (peptone, 16 g/L; yeast extract, 10 g/L; sodium chloride, 5 g/L) containing 50 μg/mL of kanamycin, and subsequently a shaking culture was performed aerobically at 37° C. overnight to perform the pre-culture.

(13) (2) The pre-cultured solution (1) (150 μL) was inoculated in 15 mL of 2YT liquid medium to which 50 μg/mL of kanamycin had been added, and a shaking culture was performed aerobically at 37° C.

(14) (3) One hundred and fifty minutes after the beginning of the culture, IPTG was added to the concentration of 0 mM/0.1 mM, and a shaking culture was performed at 20° C. for 4 hours.

(15) (4) After the culture was completed, the bacterial cells were harvested by centrifugation, and a protein extract in a soluble fraction was prepared using an ultrasonic generator (manufactured by TOMY SEIKO CO., LTD.).

(16) (5) The antibody avidity of the human FcRn contained in the protein extract prepared in (4) was measured using the ELISA method shown below.

(17) (5-1) A gamma globulin preparation (manufactured by The Chemo-Sero-Therapeutic Research Institute) which is a human antibody was immobilized to wells of a 96-well microplate at 10 μg/well (at 4° C. for 18 hours). After completion of the immobilization, blocking was performed using a phosphate buffer (pH 6.0) containing 2% (w/v) of SKIM MILK (manufactured by Becton, Dickinson and Company) and 150 mM sodium chloride.

(18) (5-2) After washing with a washing buffer (a phosphate buffer (pH 6.0) containing 150 mM sodium chloride), the solution containing the human FcRn prepared in (4) was reacted with an immobilized gamma globulin (at 30° C. for 1 hour).

(19) (5-3) After completion of the reaction, Anti-6His antibody (manufactured by Bethyl Laboratories, Inc.) which had been washed with the washing buffer and diluted with a blocking solution to 100 ng/mL was added at 100 μL/well.

(20) (5-4) After reacted at 30° C. for 1 hour and washed with the washing buffer, TMB Peroxidase Substrate (manufactured by Kirkegaard and Perry Laboratories, Inc.) was added at 50 μL/well. The coloring was stopped by adding 1M phosphoric acid at 50 μL/well, and the absorbance at 450 nm was measured with a microplate reader (manufactured by Tecan Trading AG).

(21) A diagram summarizing the relation of the absorbance (450 nm) corresponding to an antibody avidity when a solution containing the human FcRn prepared in (4) was added is shown as FIG. 3. In FIG. 3, pETMalE is the one obtained by similarly culturing and extracting a plasmid without an FcRn gene inserted therein (a negative control). Since the absorbance is increased when the FcRn is inserted compared to the case where the FcRn gene is not inserted, it is recognized that the human FcRn is expressed in an active state.

Example 3 Introduction of Mutation into Fc Binding Protein and Preparation of Library

(22) A mutation was randomly introduced by an error-prone PCR into a polynucleotide encoding the Fc binding protein of the Fc binding protein expression vector pET-eFcRn prepared in Example 1.

(23) (1) The error-prone PCR was performed using as a template the pET-eFcRn prepared in Example 1. After the reaction solution having the composition shown in Table 2 was prepared,

(24) the error-prone PCR was performed by performing heat treatment of the reaction solution at 95° C. for 2 minutes, followed by 35 cycles of reaction, each cycle including a first step at 95° C. for 30 seconds, a second step at 60° C. for 30 seconds, and a third step at 72° C. for 90 seconds, and finally performing heat treating at 72° C. for 7 minutes. The mutation is well introduced in the polynucleotide encoding the Fc binding protein by the error-prone PCR, and an average introduction ratio of the mutation was 0.2%.

(25) TABLE-US-00002 TABLE 2 Composition Concentration/Volume Template DNA (pET-eFcRn) 0.1 ng/μL 10 μM PCR primer (SEQ ID NO: 8) 4 μL 10 μM PCR primer (SEQ ID NO: 9) 4 μL 25 mM MgCl.sub.2 12 μL 10 mM dATP 2 μL 10 mM dGTP 2 μL 10 mM dCTP 12 μL 10 mM dTTP 8 μL 10 mM MnCl.sub.2 0.5 μL 10 × Ex Taq Buffer (manufactured by 10 μL Takara Bio Inc.) GoTaq polymerase (manufactured by 1 μL Promega Corporation) H.sub.2O up to 100 μL

(26) (2) After purification of the PCR product obtained in (1), the resultant was digested with restriction enzymes NcoI and HindIII, and ligated to the expression vector pETMalE (Japanese Unexamined Patent Publication (Kokai) No. 2011-206046) which had been previously digested with the same restriction enzyme.

(27) (3) After completion of the ligation reaction, the reaction solution was introduced by the electroporation method into the E. coli BL21 (DE3) strain, and after cultured (at 37° C. for 18 hours) in a LB plate medium containing 50 μg/mL of kanamycin, the colony formed on the plate was referred to as a random mutant library.

Example 4 Screening of Thermally Stabilized Fc Binding Protein

(28) (1) The random mutant library (transformant) prepared in Example 3 was inoculated in 2YT liquid medium (peptone 16 g/L, yeast extract 10 g/L, sodium chloride 5 g/L) (200 μL) containing 50 μg/mL of kanamycin and a shaking culture was performed at 30° C. overnight using a 96-well deep well plate.

(29) (2) After cultured, 5 μL of the culture solution was subcultured in 500 μL of 2YT liquid medium containing 0.05 mM IPTG (isopropyl-β-D-thiogalactopyranoside), 0.3% (w/v) of glycine, and 50 μg/mL of kanamycin, and a shaking culture was further performed at 20° C. overnight using a 96-well deep well plate.

(30) (3) After cultured, the culture supernatant obtained by centrifugal procedure was diluted twice with 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride. The diluted solution was heat treated at 40° C. for 10 minutes.

(31) (4) The antibody avidity of the Fc binding protein with heat treatment (3) and the antibody avidity of the Fc binding protein without heat treatment (3) were measured by the ELISA method described in Example 2 (5), and the remaining activity was calculated by dividing the antibody avidity of the Fc binding protein with heat treatment by the antibody avidity of the Fc binding protein without heat treatment.

(32) (5) About 2700 strains of transformant were evaluated by the method of (4), from which was selected a transformant which expressing the Fc binding protein having an enhanced heat stability compared to a wild-type (without amino acid substitution) Fc binding protein. The selected transformant was cultured, and an expression vector was prepared using a QIAprep Spin Miniprep kit (manufactured by Qiagen N. V.).

(33) (6) The sequence of the polynucleotide region which encodes the Fc binding protein inserted into the obtained expression vector was analyzed for the nucleotide sequence by the method similar to that described in Example 1 (5), and the mutation site of the amino acid was identified.

(34) The position of the amino acid substitution and the remaining activity (%) after heat treatment with respect to the wild-type (without amino acid substitution) Fc binding protein of the Fc binding protein which the transformant selected in (5) expressed are summarized and shown in Table 3. In the amino acid sequence set forth in SEQ ID NO: 3, the Fc binding protein in which at least any one of the following amino acid substitutions is generated is said to have enhanced heat stability compared to the wild-type Fc binding protein: Phe24Ile (this expression indicates that the 24th phenylalanine is substituted with isoleucine in SEQ ID NO: 3, the same applies hereafter), Phe24Tyr, Gly114Asp, Gly117Ser, Gly123Ser, Gly123Asp, Cys174Arg, Asn181Asp, Val183Asp, Lys199Glu, Asn228Asp, Asn275Asp, Phe283Tyr, Arg295Leu, Arg309Cys, Leu322His, Thr323Ala, Phe329Ser, Gln335Leu, Ser365Cys, Leu366Pro, Tyr376His, Leu385His, Leu389His.

(35) Among the amino acid substitutions, substitution of Phe24Ile and Phe24Tyr correspond to substitution at the 42th amino acids in SEQ ID NO: 2, substitution of Cys174Arg corresponds to substitution in the 71st amino acid residues in SEQ ID NO: 1, substitution of Asn181Asp corresponds to substitution at the 78th amino acid residues in SEQ ID NO: 1, substitution of Val183Asp corresponds to substitution at the 80th amino acid residues in SEQ ID NO: 1, substitution of Lys199Glu corresponds to substitution at the 96th amino acid residues in SEQ ID NO: 1, substitution of Asn228Asp corresponds to substitution at the 125th amino acid residues in SEQ ID NO: 1, substitution of Asn275Asp corresponds to substitution at the 172th amino acid residues in SEQ ID NO: 1, substitution of Phe283Tyr corresponds to substitution at the 180th amino acid residues in SEQ ID NO: 1, substitution of Arg295Leu corresponds to substitution at the 192th amino acid residues in SEQ ID NO: 1, substitution of Arg309Cys corresponds to substitution at the 206th amino acid residues in SEQ ID NO: 1, substitution of Leu322His corresponds to substitution at the 219th amino acid residues in SEQ ID NO: 1, substitution of Thr323Ala corresponds to substitution at the 220th amino acid residues in SEQ ID NO: 1, substitution of Phe329Ser corresponds to substitution at 226th amino acid residues in SEQ ID NO: 1, substitution of Gln335Leu corresponds to substitution at the 232nd amino acid residues in SEQ ID NO: 1, substitution of Ser365Cys corresponds to substitution at the 262nd amino acid residues in SEQ ID NO: 1, substitution of Leu366Pro corresponds to substitution at the 263rd amino acid residues in SEQ ID NO: 1, substitution of Tyr376His corresponds to substitution at the 273rd amino acid residues in SEQ ID NO: 1, substitution of Leu385His corresponds to substitution at the 282nd amino acid residues in SEQ ID NO: 1, substitution of Leu389His corresponds to substitution at the 286th amino acid residues in SEQ ID NO: 1.

(36) TABLE-US-00003 TABLE 3 Amino Acid Remaining Activity Amino Acid Remaining Activity Substitution (%) Substitution (%) Phe24Ile 37.1 Phe283Tyr 37.1 Phe24Tyr 40.1 Arg295Leu 96.2 Gly114Asp 35.6 Arg309Cys 39.9 Gly117Ser 34.4 Leu322His 40.1 G1y123Ser 28.0 Thr323Ala 35.6 Gly123Asp 40.0 Phe329Ser 37.1 Cys174Arg 96.2 Gln335Leu 96.2 Asn181Asp 96.3 Ser365Cys 35.6 Val183Asp 36.4 Leu366Pro 34.4 Lys199Glu 40.1 Tyr376His 40.1 Asn228Asp 37.1 Leu385His 28.1 Asn275Asp 28.1 Leu389His 40.1 Wild-type 27.1

(37) Among the Fc binding proteins having amino acid substitution shown in Table 3, the Fc binding protein in which the amino acid substitution of Asn181Asp having the highest remaining activity is generated was named as FcRn_m1, and an expression vector which contained a polynucleotide encoding the FcRn_m1 was named as pET-FcRn_m1. The amino acid sequence of FcRn_m1 is shown in SEQ ID NO: 12, and the sequence of the polynucleotide encoding the FcRn_m1 is shown in SEQ ID NO: 13.

Example 5 Production of Amino Acid Substituted Fc Binding Protein

(38) Further enhancement of stability was contemplated by accumulating the amino acid substitution involved in the enhancement of heat stability of the Fc binding protein which had been found in Example 4. The accumulation of substituted amino acids was performed mainly using PCR to prepare three types of Fc binding proteins shown in the following (a) to (c):

(39) (a) FcRn_m2 obtained by further performing amino acid substitution of Cys174Arg with respect to FcRn_m1

(40) (b) FcRn_m3 obtained by further performing amino acid substitution of Arg295Leu with respect to FcRn_m2

(41) (c) FcRn_m4 obtained by further performing amino acid substitution of Gln335Leu with respect to FcRn_m3.

(42) Hereafter, a method for producing each Fc binding protein will be explained in detail.

(43) (a) FcRn_m2

(44) Among the amino acid substitutions involved in the enhancement of heat stability which had been found in Example 4, Cys174Arg and Asn181Asp were selected, and their substitutions were accumulated in a wild-type Fc binding protein to produce an FcRn_m2. Specifically, the FcRn_m2 was produced by introducing a mutation generating Cys174Arg into a polynucleotide encoding the FcRn_m1.

(45) (a-1) The pET-FcRn_m1 obtained in Example 4 was used as a template to perform PCR. As a primer in the PCR, an oligonucleotide composed of sequences set forth in SEQ ID NO: 8 and SEQ ID NO: 14 (5′-CACGCACCGCGTGGTTCTGC-3′) was used. PCR was performed by preparing the reaction solution having the composition shown in Table 4, and subsequently performing heat treatment of the reaction solution at 98° C. for 5 minutes, followed by 30 cycles of reaction, each cycle including a first step at 98° C. for 10 seconds, a second step at 55° C. for 5 seconds, and a third step at 72° C. for 1 minute, and finally performing heat treatment at 72° C. for 7 minutes. The agarose gel electrophoresis of the amplified PCR product was performed, and the product was purified from the gel using a QIAquick Gel Extraction kit (manufactured by Qiagen N. V.). The purified PCR product was referred to as m2F.

(46) TABLE-US-00004 TABLE 4 Composition Concentration/Volume Template DNA 2 μL 10 μM Forward primer 1 μL 10 μM Reverse primer 1 μL 5 × PrimeSTAR buffer (manufactured by 4 μL Takara Bio Inc.) 2.5 mM dNTPs 2 μL 2.5 U/μL PrimeSTAR HS (manufactured by 0.5 μL Takara Bio Inc.) H.sub.2O up to 20 μL

(47) (a-2) The procedures in (a-1) was repeated except that the pET-FcRn_m1 obtained in Example 4 was used as a template, and an oligonucleotide composed of sequences set forth in SEQ ID NO: 9 and SEQ ID NO: 15 (5′-GCAGAACCACGCGGTGCGTG-3′) was used as a PCR primer. The purified PCR product was referred to as m2R.

(48) (a-3) Two types of PCR products obtained in (a-1), and (a-2) (m2F, m2R) were mixed to prepare a reaction solution having the composition shown in Table 5. The reaction solution was heat treated at 98° C. for 5 minutes, and then PCR was performed including 5 cycles of reaction, each cycle including a first step at 98° C. for 10 seconds, a second step at 55° C. for 5 seconds, and a third step at 72° C. for 1 minute, to obtain a PCR product m2p in which m2F and m2R were linked.

(49) TABLE-US-00005 TABLE 5 Composition Concentration/Volume PCR Product 1 μL each 2.5 U/μL PrimeSTAR HS (manufactured by 0.5 μL Takara Bio Inc.) 5 × PrimeSTAR buffer (manufactured by 4 μL Takara Bio Inc.) 2.5 mM dNTPs 2 μL H.sub.2O up to 20 μL

(50) (a-4) PCR was performed using the PCR product m2p obtained in (a-3) as a template and an oligonucleotide composed of sequences set forth in SEQ ID NO: 8 and SEQ ID NO: 9 as a PCR primer. PCR was performed by preparing the reaction solution having the composition shown in Table 6, and subsequently performing heat treatment of the reaction solution at 98° C. for 5 minutes, followed by 30 cycles of reaction, each cycle including a first step at 98° C. for 10 seconds, a second step at 55° C. for 5 seconds, and a third step at 72° C. for 1 minute. In this way, a polynucleotide encoding FcRn_m2 was prepared which is FcRn_m1 having one amino acid substitution introduced therein.

(51) TABLE-US-00006 TABLE 6 Composition Concentration/Volume PCR Product 2 μL 10 μM Forward primer 2 μL 10 μM Reverse primer 2 μL 5 × PrimeSTAR buffer (manufactured by 10 μL Takara Bio Inc.) 2.5 mM dNTPs 4 μL 2.5 U/μL PrimeSTAR HS (manufactured by 1 μL Takara Bio Inc.) H.sub.2O up to 50 μL

(52) (a-5) After the polynucleotide obtained in (a-4) was purified, it was digested with restriction enzymes NcoI and HindIII, ligated to the expression vector pETMalE (Japanese Unexamined Patent Publication (Kokai) No. 2011-206046) which had been previously digested with the restriction enzyme NcoI and HindIII, and used to transform E. coli BL21 (DE3) strain.

(53) (a-6) The resulting transformant was cultured in a LB medium added with 50 μg/mL of kanamycin. A plasmid was extracted from the harvested bacterial cells (transformant) to obtain the plasmid pET-FcRn_m2 containing a polynucleotide encoding FcRn_m2, a polypeptide which is obtained by providing two amino acid substitution with respect to a wild-type Fc binding protein.

(54) (a-7) Analysis of the nucleotide sequence of the pET-FcRn_m2 was performed in the same manner as in Example 1 (5).

(55) The amino acid sequence of the produced FcRn_m2 is shown in SEQ ID NO: 16, and the sequence of the polynucleotide encoding the FcRn_m2 is shown in SEQ ID NO: 17.

(56) (b) FcRn_m3

(57) Among the amino acid substitutions involved in the enhancement of heat stability of the Fc binding protein, which had been found in Example 4, Cys174Arg, Asn181Asp and Arg295Leu were selected, and the FcRn_m3 was produced which was obtained by accumulating their substitutions in a wild-type Fc binding protein. Specifically, FcRn_m3 was prepared by introducing a mutation generating Arg295Leu into a polynucleotide encoding the FcRn_m2.

(58) (b-1) PCR product m3F was obtained in the same manner as in (a-1) except that the pET-FcRn_m2 was used as a template and an oligonucleotide composed of sequences set forth in SEQ ID NO: 8 and SEQ ID NO: 18 (5′-CACGACCAAGTTCGAGATGTTC-3′) was used as a primer.

(59) (b-2) PCR product m3R was obtained in the same manner as in (a-2) except that the pET-FcRn_m2 was used as a template and an oligonucleotide composed of sequences set forth in SEQ ID NO: 9 and SEQ ID NO: 19 (5′-GAACATCTCGAACTTGGTCGTG-3′) was used as a primer.

(60) (b-3) After mixing two PCR products obtained from (b-1) and (b-2) (m3F, m3R), PCR was performed in the same manner as in (a-3) to link m3F and m3R. The resulting PCR product was referred to as m3p.

(61) (b-4) PCR was performed in the same manner as in (a-4) using the PCR product m3p obtained in (b-3) as a template and an oligonucleotide composed of sequences set forth in SEQ ID NO: 8 and SEQ ID NO: 9 as a PCR primer. In this way, a polynucleotide encoding FcRn_m3 was prepared.

(62) (b-5) After the polynucleotide obtained in (b-4) was purified, it was digested with restriction enzymes NcoI and HindIII, ligated to the expression vector pETMalE (Japanese Unexamined Patent Publication (Kokai) No. 2011-206046) which had been previously digested with the restriction enzyme NcoI and HindIII, and used to transform E. coli BL21 (DE3) strain.

(63) (b-6) The resulting transformant was cultured in a LB medium added with 50 μg/mL of kanamycin. A plasmid was extracted from the harvested bacterial cells (transformant) to obtain the plasmid pET-FcRn_m3 containing a polynucleotide encoding FcRn_m3, a polypeptide which is obtained by providing three amino acid substitutions with respect to a wild-type Fc binding protein.

(64) (b-7) Analysis of the nucleotide sequence of the pET-FcRn_m3 was performed in the same manner as in Example 1 (5).

(65) The amino acid sequence of the produced FcRn_m3 is shown in SEQ ID NO: 20, and the sequence of the polynucleotide encoding the FcRn_m3 is shown in SEQ ID NO: 21.

(66) (c) FcRn_m4

(67) Among the amino acid substitutions involved in the enhancement of stability of Fc binding protein, which had been found in Example 4, Cys174Arg, Asn181Asp, Arg295Leu and Gln335Leu were selected, and their substitutions were accumulated in wild-type Fc binding protein to produce the FcRn_m4. Specifically, FcRn_m4 was prepared by introducing a mutation generating Gln335Leu into the polynucleotide encoding FcRn_m3 produced in (b).

(68) (c-1) PCR was performed in the same manner as in (a-1) using pET-FcRn_m3 obtained in (b) as a template and an oligonucleotide composed of sequences set forth in SEQ ID NO: 8 and SEQ ID NO: 22 (5′-GCGCAGCAGGAGTTCTGGAGG-3′) as a PCR primer. The purified PCR product was referred to as m4F.

(69) (c-2) PCR was performed in the same manner as in (a-2) except that the pET-FcRn_m3 produced in (b) was used as a template and an oligonucleotide composed of sequences set forth in SEQ ID NO: 9 and SEQ ID NO: 23 (5′-CCTCCAGAACTCCTGCTGCGC-3′) was used as a PCR primer. The purified PCR product was referred to as m4R.

(70) (c-3) After mixing two PCR products obtained in (c-1) and (c-2) (m4F, m4R), PCR was performed in the same manner as in (a-3) to link m4F and m4R. The resulting PCR product was referred to as m4p.

(71) (c-4) PCR was performed in the same manner as in (a-4) using the PCR product m4p obtained in (c-3) as a template and an oligonucleotide composed of sequences set forth in SEQ ID NO: 8 and SEQ ID NO: 9 as a PCR primer. In this way, a polynucleotide encoding FcRn_m4 was prepared.

(72) (c-5) After the polynucleotide obtained in (c-4) was purified, it was digested with restriction enzymes NcoI and HindIII, ligated to the expression vector pETMalE (Japanese Unexamined Patent Publication (Kokai) No. 2011-206046) which had been previously digested with the restriction enzyme NcoI and HindIII, and used to transform E. coli BL21 (DE3) strain.

(73) (c-6) The resulting transformant was cultured in a LB medium added with 50 μg/mL of kanamycin. A plasmid was extracted from the harvested bacterial cells (transformant) to obtain the plasmid pET-FcRn_m4 containing a polynucleotide encoding FcRn_m4, a polypeptide which is obtained by providing four amino acid substitutions with respect a wild-type Fc binding protein.

(74) (c-7) Analysis of the nucleotide sequence of pET-FcRn_m4 was performed in the same manner as in Example 1 (5).

(75) The amino acid sequence of the produced FcRn_m4 is shown in SEQ ID NO: 5, and the sequence of the polynucleotide encoding FcRn_m4 is shown in SEQ ID NO: 24.

Example 6 Introduction of Mutation into FcRn_m4 and Preparation of Library

(76) Mutation was randomly introduced into a polynucleotide portion encoding FcRn_m4 produced in Example 5(c) by the error-prone PCR.

(77) (1) The error prone PCR was performed using the expression vector pET-FcRnm4 produced in Example 5(c) as a template. The error-prone PCR was performed by preparing the reaction solution having the composition shown in Table 2 except that pET-FcRn_m4 was used as a template, and subsequently performing heat treatment of the reaction solution at 95° C. for 2 minutes, followed by 35 cycles of reaction, each cycle including a first step at 95° C. for 30 seconds, a second step at 60° C. for 30 seconds, and a third step at 72° C. for 90 seconds, and finally performing heat treatment at 72° C. for 7 minutes. This reaction favorably introduced mutation into the polynucleotide encoding the Fc binding protein.

(78) (2) After purification of the PCR product obtained in (1), the resultant was digested with restriction enzymes NcoI and HindIII, and ligated to the expression vector pETMalE (Japanese Unexamined Patent Publication (Kokai) No. 2011-206046) which had been previously digested with the same restriction enzyme.

(79) (3) After the ligation reaction was completed, the reaction solution was introduced in E. coli BL21 (DE3) strain by an electroporation method, cultured in a LB plate medium containing 50 μg/mL of kanamycin, and the colony formed on the plate was referred to as a random mutation library.

Example 7 Screening of Heat Stabilized Fc Binding Protein

(80) (1) The random mutation library produced in Example 6 was screened in the same manner as in Examples 4(1) to (5) except that the heat treatment was performed under the conditions at 45° C. for 10 minutes, and thus an expression vector encoding the Fc binding protein having an enhanced stability was obtained.

(81) (2) The sequence of the polynucleotide region encoding the Fc binding protein inserted in the obtained expression vector was analyzed for the nucleotide sequence by the method described in Example 1 (5) to identify the mutation site of the amino acid.

(82) The position of the amino acid substitution of the Fc binding protein expressed by the transformant selected in (1) with respect to FcRn_m4 and the remaining activity (%) after heat treatment are summarized and shown in Table 7. Among the amino acid sequences set forth in SEQ ID NO: 3, an Fc binding protein having at least any one of the following amino acid substitution in the amino acid residues is considered to have enhanced heat stability compared to FcRn_m4: Arg14His, Lys50Glu, Tyr69His, Gly107Asp, Gly125Asp, Ser126Asn, Asn165Thr, Gln182His, Lys206Glu, Ser230Pro, Gly254Asp, Lys276Glu, Gly296Asp, Asn299Asp, Leu336Pro, Gly358Ser, Ser364Pro, Lys369Glu, Lys369Arg, Ser370Pro and Lys398Glu.

(83) Among the amino acid substitutions, substitution of Arg14His corresponds to substitution at the 32nd amino acid residues in SEQ ID NO: 2, substitution of Lys50Glu corresponds to substitution at the 68th amino acid residues in SEQ ID NO: 2, substitution of Tyr69His corresponds to substitution at the 87th amino acid residues in SEQ ID NO: 2, substitution of Asn165Thr corresponds to substitution at the 62th amino acid residues in SEQ ID NO: 1, substitution of Gln182His corresponds to substitution at the 79th amino acid residues in SEQ ID NO: 1, substitution of Lys206Glu corresponds to substitution at the 103th amino acid residues in SEQ ID NO: 1, substitution of Ser230Pro corresponds to substitution at the 127th amino acid residues in SEQ ID NO: 1, substitution of Gly254Asp corresponds to substitution at the 151th amino acid residues in SEQ ID NO: 1, substitution of Lys276Glu corresponds to substitution at the 173th amino acid residues in SEQ ID NO: 1, substitution of Gly296Asp corresponds to substitution at the 193th amino acid residues in SEQ ID NO: 1, substitution of Asn299Asp corresponds to substitution at the in 196th amino acid residues in SEQ ID NO: 1, substitution of Leu336Pro corresponds to substitution at the 233rd amino acid residues in SEQ ID NO: 1, substitution of Gly358Ser corresponds to substitution at the 255th amino acid residues in SEQ ID NO: 1, substitution of Ser364Pro corresponds to substitution at the 261st amino acid residues in SEQ ID NO: 1, substitution of Lys369Glu and Lys369Arg corresponds to substitution at the 266th amino acid residues in SEQ ID NO: 1, substitution of Ser370Pro corresponds to substitution at the 267th amino acid residues in SEQ ID NO: 1, substitution of Lys398Glu corresponds to substitution at the 295th amino acid residues in SEQ ID NO: 1.

(84) TABLE-US-00007 TABLE 7 Amino Acid Remaining Activity Amino Acid Remaining Activity Substitution (%) Substitution (%) Arg14His 34.3 Lys276Glu 27.1 Lys50Glu 29.0 Gly296Asp 31.0 Tyr69His 26.9 Asn299Asp 78.1 GIy107Asp 31.1 Leu336Pro 31.8 Gly125Asp 31.8 Gly358Ser 35.7 Ser126Asn 35.7 Ser364Pro 26.9 Asn165Thr 34.3 Lys369Glu 29.1 Gln182His 32.7 Lys369Arg 34.3 Lys206Glu 32.6 Ser370Pro 31.0 Ser230Pro 31.0 Lys398Glu 78.1 Gly254Asp 78.2 FcRn_m4 12.9

(85) Among the Fc binding proteins obtained from FcRn_m4 by amino acid substitution shown in Table 7, the Fc binding protein in which the amino acid substitution of Gly254Asp is generated was named as FcRn_m5, and an expression vector which contained a polynucleotide encoding FcRn_m5 was named as pET-FcRn_m5. The amino acid sequence of FcRn_m5 is shown in SEQ ID NO: 25, and the sequence of the polynucleotide encoding the FcRn_m5 is shown in SEQ ID NO: 26.

Example 8 Preparation of Improved Fc Binding Protein

(86) Further enhancement of stability was contemplated by accumulating the amino acid substitutions involved in enhancement of heat stability of the Fc binding protein which had been found in Example 7. Accumulation of the substituted amino acids was performed mainly using PCR, and two types of Fc binding proteins shown in the following (a) to (b) were produced: (a) FcRn_m6 which was obtained by additional amino acid substitution of Asn299Asp to FcRn_m5; (b) FcRn_m7 which was obtained by additional amino acid substitution of Lys398Glu to FcRn_m6.

(87) A method for preparing each of Fc binding proteins will be hereinafter explained in detail.

(88) A method for producing each of the improved Fc binding proteins will be hereinafter explained in detail.

(89) (a) FcRn_m6

(90) Among the amino acid substitutions involved in the enhancement of heat stability which had been found in Example 7, Gly254Asp and Asn299Asp were selected, and FcRn_m6 was produced in which their substitutions were accumulated in FcRn_m4 (Example 5). Specifically, FcRn_m6 was prepared by introducing a mutation generating Asn299Asp into a polynucleotide encoding FcRn_m5.

(91) (a-1) The pET-FcRn_m5 obtained in Example 7 was used as a template to perform PCR. As a primer in the PCR, an oligonucleotide composed of sequences set forth in SEQ ID NO: 8 and SEQ ID NO: 27 (5′-CCTTCCATTCGAGGTCACCACGACCAAGTT-3′) was used. PCR was performed by preparing the reaction solution having the composition shown in Table 5, and subsequently performing heat treatment of the reaction solution at 98° C. for 5 minutes, followed by 30 cycles of reaction, each cycle including a first step at 98° C. for 10 seconds, a second step at 55° C. for 5 seconds, and a third step at 72° C. for 1 minute, and finally performing heat treatment at 72° C. for 5 minutes. The agarose gel electrophoresis of the amplified PCR product was performed, and the product was purified from the gel using a QIAquick Gel Extraction kit (manufactured by Qiagen N. V.). The purified PCR product was referred to as m6F.

(92) (a-2) The procedure in (a-1) was repeated except that the pET-FcRn_m5 obtained in Example 7 was used as a template and an oligonucleotide composed of sequences set forth in SEQ ID NO: 28 (5′-AACTTGGTCGTGGTGACCTCGAATGGAAGG-3′) and SEQ ID NO: 9 was used as a PCR primer. The purified PCR product was referred to as m6R.

(93) (a-3) Two types of PCR products obtained in (a-1) and (a-2) (m6F, m6R) were mixed to prepare a reaction solution having the composition shown in Table 6. PCR was performed including performing heat treatment of the reaction solution at 98° C. for 5 minutes, followed by 5 cycles of reaction, each cycle including a first step at 98° C. for 10 seconds, a second step at 55° C. for 5 seconds, and a third step at 72° C. for 1 minute, to obtain a PCR product m6p in which m6F and m6R were linked.

(94) (a-4) PCR was performed using the PCR product m6p obtained in (a-3) as a template and an oligonucleotide composed of sequences set forth in SEQ ID NO: 8 and SEQ ID NO: 9 as a PCR primer. PCR was performed by preparing the reaction solution having the composition shown in Table 7, and subsequently performing heat treatment of the reaction solution at 98° C. for 5 minutes, followed by 30 cycles of reaction, each cycle including a first step at 98° C. for 10 seconds, a second step at 55° C. for 5 seconds, and a third step at 72° C. for 1 minute. In this way, a polynucleotide encoding FcRn_m6 was prepared which is FcRn_m5 having one amino acid substitution introduced therein.

(95) (a-5) The polynucleotide obtained in (a-4) was digested with restriction enzymes NcoI and HindIII, ligated to the expression vector pETMalE (Japanese Unexamined Patent Publication (Kokai) No. 2011-206046) previously digested with the restriction enzyme NcoI and HindIII, and the ligated product was used to transform E. coli BL21 (DE3) strain.

(96) (a-6) The resulting transformant was cultured in a LB medium added with 50 μg/mL of kanamycin. A plasmid was extracted from the harvested bacterial cells (transformant) to obtain the plasmid pET-FcRn_m6 containing a polynucleotide encoding FcRn_m6, a polypeptide which has one amino acid substitution compared to FcRn_m5 (six amino acid substitutions compared to a wild-type Fc binding protein.

(97) (a-7) Analysis of the nucleotide sequence of pET-FcRn_m6 was performed in the same manner as in Example 1 (5).

(98) The amino acid sequence of the produced FcRn_m6 is shown in SEQ ID NO: 29, and the sequence of the polynucleotide encoding the FcRn_m6 is shown in SEQ ID NO: 30.

(99) (b) FcRn_m7

(100) Among the amino acid substitutions involved in the enhancement of heat stability which had been found in Example 7, Gly254Asp, Asn299Asp and Lys398Glu were selected, and FcRn_m7 was produced in which their substitutions were accumulated in FcRn_m4 (Example 5). Specifically, FcRn_m7 was prepared by introducing a mutation generating Lys398Glu into a polynucleotide encoding FcRn_m6.

(101) (b-1) PCR was performed in the same manner as in (a-1) using pET-FcRn_m6 produced in (a) as a template and an oligonucleotide composed of sequences set forth in SEQ ID NO: 8 and SEQ ID NO: 31 (5′-ATGAGAAGATTCGGCAGGGGATT-3′) as a PCR primer. The purified PCR product was referred to as m7F.

(102) (b-2) PCR was performed in the same manner as in (a-1) except that the pET-FcR8 produced in (a) was used as a template and an oligonucleotide composed of sequences set forth in SEQ ID NO: 9 and SEQ ID NO: 32 (5′-AATCCCCTGCCGAATCTTCTCAT-3′) was used as a PCR primer. The purified PCR product was referred to as m7R.

(103) (b-3) After mixing two PCR products obtained from (b-1) and (b-2) (m7F, m7R), PCR was performed in the same manner as in (a-3) to link m7F and m7R. The resulting PCR product was referred to as m7p.

(104) (b-4) PCR was performed in the same manner as in (a-4) using the PCR product m7p obtained in (b-3) as a template and an oligonucleotide composed of sequences set forth in SEQ ID NO: 8 and SEQ ID NO: 9 as a PCR primer. In this way, a polynucleotide encoding FcRn_m7 was produced.

(105) (b-5) After the polynucleotide obtained in (b-4) was purified, it was digested with restriction enzymes NcoI and HindIII, ligated to the expression vector pETMalE (Japanese Unexamined Patent Publication (Kokai) No. 2011-206046) which had been previously digested with the restriction enzyme NcoI and HindIII, and used to transform E. coli BL21 (DE3) strain.

(106) (b-6) The resulting transformant was cultured in a LB medium added with 50 μg/mL of kanamycin. A plasmid was extracted from the harvested bacterial cells (transformant) to obtain the plasmid pET-FcRn_m7 containing a polynucleotide encoding FcRn_m7, a polypeptide which has two amino acid substitutions compared to FcRn_m5 (seven amino acid substitutions compared to a wild-type Fc binding protein).

(107) (b-7) Analysis of the nucleotide sequence of the pET-FcRn_m7 was performed in the same manner as in Example 1 (5).

(108) The amino acid sequence of the produced FcRn_m7 is shown in SEQ ID NO: 6, and the sequence of the polynucleotide encoding the FcRn_m7 is shown in SEQ ID NO: 33.

Example 9 Introduction of Mutation into FcRn_m7 and Production of Library

(109) Mutation was randomly introduced into a polynucleotide portion encoding the FcRn_m7 produced in Example 8(b) by the error-prone PCR.

(110) (1) The error prone PCR was performed using the expression vector pET-FcRn_m7 produced in Example 8(b) as a template. The error-prone PCR was performed by preparing the reaction solution having the composition shown in Table 2 except that pET-FcRn_m7 was used as a template, and subsequently performing heat treatment of the reaction solution at 95° C. for 2 minutes, followed by 35 cycles of reaction, each cycle including a first step at 95° C. for 30 seconds, a second step at 60° C. for 30 seconds, and a third step at 72° C. for 90 seconds, and finally performing heat treatment at 72° C. for 7 minutes. This reaction favorably introduced mutation into the polynucleotide encoding the Fc binding protein.

(111) (2) The PCR product obtained in (1) was purified, then digested with restriction enzymes NcoI and HindIII, and ligated to the expression vector pETMalE (Japanese Unexamined Patent Publication (Kokai) No. 2011-206046) which had been previously digested with the same restriction enzyme.

(112) (3) After the ligation reaction was completed, the reaction solution was introduced in E. coli BL21 (DE3) strain by an electroporation method, cultured in a LB plate medium containing 50 μg/mL of kanamycin, and the colony formed on the plate was referred to as a random mutation library.

Example 10 Screening of Heat Stabilized Fc Binding Protein

(113) (1) The random mutation library produced in Example 9 was screened in the same manner as in Examples 4 (1) to (5) except that the heat treatment was performed under the conditions at 52° C. for 30 minutes, and an expression vector encoding the Fc binding protein having an improved stability was obtained.

(114) (2) The sequence of the polynucleotide region encoding the Fc binding protein inserted in the obtained expression vector was analyzed for the nucleotide sequence by the method described in Example 1 (5) to identify the mutation site of the amino acid.

(115) The position of the amino acid substitution of the Fc binding protein expressed by the transformant selected in (1) with respect to the FcRn_m7 and the remaining activity (%) after heat treatment are summarized and shown in Table 8. Among the amino acid sequences set forth in SEQ ID NO: 3, an Fc binding protein having at least any one of the following amino acid substitution in the amino acid residues is considered to have enhanced heat stability compared to FcRn_m7: Val152Ala, Asn275Asp, Arg313Cys, and Ser359Pro.

(116) Among the amino acid substitutions, substitution of Val152Ala corresponds to substitution at the 49th amino acid residues in SEQ ID NO: 1, substitution of Asn275Asp corresponds to substitution at the 172nd amino acid residues in SEQ ID NO: 1, substitution of Arg313Cys corresponds to substitution at the 210th amino acid residues in SEQ ID NO: 1, and substitution of Ser359Pro corresponds to substitution at the 256th amino acid residues in SEQ ID NO: 1.

(117) TABLE-US-00008 TABLE 8 Amino Acid Remaining Activity Substitution (%) Val152Ala 65.7 Asn275Asp 62.4 Arg313Cys 51.2 Ser359Pro 54.9 FcRn_m7 36.6

(118) Among the Fc binding proteins obtained from FcRn_m7 by amino acid substitution shown in Table 8, the Fc binding protein in which the amino acid substitution of Val152Ala is generated was named as FcRn_m8, and an expression vector which contained a polynucleotide encoding the FcRn_m8 was named as pET-FcRn_m8. The amino acid sequence of FcRn_m8 is shown in SEQ ID NO: 7, and the sequence of the polynucleotide encoding the FcRn_m8 is shown in SEQ ID NO: 34.

Example 11 Evaluation of Stability with Respect to Acid of Fc Binding Protein

(119) (1) Transformants expressing wild-type FcRn (SEQ ID NO: 3), FcRn_m4 (SEQ ID NO: 5), FcRn_m7 (SEQ ID NO: 6), and FcRn_m8 (SEQ ID NO: 7) were inoculated in 3 mL of 2YT liquid medium containing 50 μg/mL of kanamycin, and an aerobic shaking culture was performed at 37° C. overnight to perform pre-culture.

(120) (2) The pre-cultured solution 200 μL was inoculated to 20 mL of 2YT liquid medium (peptone 16 g/L, yeast extract 10 g/L, sodium chloride, 5 g/L) added with 50 μg/mL of kanamycin and an aerobic shaking culture was performed at 37° C.

(121) (3) One and half hours after the beginning of the culture, the culture temperature was changed to 20° C., and a shaking culture was performed for 30 minutes. After that, IPTG was added to the final concentration of 0.01 mM, and subsequently an aerobic shaking culture was performed at 20° C. overnight.

(122) (4) After completion of the culture, the bacteria were harvested by centrifugation, and a protein extract was prepared using BugBuster Protein extraction kit (manufactured by Takara Bio Inc.).

(123) (5) The antibody avidity of the wild-type FcRn, FcRn_m4, FcRn_m7, and FcRn_m8 in the protein extract prepared in (4) was measured using ELISA described in Example 2 (5). At that time, a calibration curve was created using a commercially available heterodimer of an FcRn and a β2 microglobulin (manufactured by Cosmo Bio Co., Ltd.: CI01), and the concentration was measured.

(124) (6) Each of the Fc binding protein was diluted with pure water so that its concentration became 30 μg/mL, and 100 μL of the diluted solution and 200 μL of 0.1 M glycine-HCl buffer (pH 3.0) were mixed and stood still at 30° C. for 15 minutes.

(125) (7) The antibody avidity of the protein after acid treatment with a glycine-HCl buffer (pH 3.0) and the antibody avidity of the protein without the acid treatment were measured using ELISA described in Example 2 (5). Subsequently, the antibody avidity with the acid treatment was divided by the antibody avidity without acid treatment to calculate the remaining activity.

(126) The results are shown in Table 9. The presently evaluated Fc binding protein with amino acid substitution (FcRn_m4, FcRn_m7 and FcRn_m8) had higher remaining activity compared to the wild-type FcRn. Accordingly, it was confirmed that the improved Fc binding protein had enhanced stability with respect to acid compared to the wild-type.

(127) TABLE-US-00009 TABLE 9 Fc Binding Protein Remaining Activity Name SEQ ID NO: [%] FcRn_m4 5 69.7 FcRn_m7 6 80.2 FcRn_m8 7 81.4 Wild-type FcRn 3 27.2

Example 12 Production of FcRn_m7 (FcRn_m7Cys) Added with Cysteine Tag

(128) (1) PCR was performed using the pET-FcRn_m7 produced in Example 8(b) as a template. As the primer in the PCR, an oligonucleotide composed of sequences set forth in SEQ ID NO: 8 and SEQ ID NO: 35 (5′-CCCAAGCTTATCCGCAGGTATCGTTGCGGCACCCAGAAGATTCGGCAGGGGATTCG AGC-3′) was used. PCR was performed by preparing the reaction solution having the composition shown in Table 4, and then performing heat treatment of the reaction solution at 98° C. for 5 minutes, followed by 30 cycles of reaction, each cycle including a first step at 98° C. for 10 seconds, a second step at 55° C. for 5 seconds, and a third step at 72° C. for 1 minute.

(129) (2) The polynucleotide obtained in (1) was purified, and after digested with restriction enzymes NcoI and HindIII, ligated to the expression vector pETMalE (Japanese Unexamined Patent Publication (Kokai) No. 2011-206046) which had been previously ligated with the restriction enzyme NcoI and HindIII, and the E. coli BL21(DE3) strain was transformed using the ligation product.

(130) (3) The obtained transformant was cultured in a LB medium containing 50 μg/mL of kanamycin, then an expression vector pET-FcRn_m7Cys was extracted using QIAprep Spin Miniprep kit (manufactured by Qiagen N. V.).

(131) (4) The nucleotide sequence analysis of the pET-FcRn_m7Cys was performed in the same manner as in Example 1 (5). The amino acid sequence of the polypeptide expressed by the expression vector pET-FcRn_m7Cys and the sequence of a polynucleotide encoding the polypeptide are shown in SEQ ID NO: 36 and SEQ ID NO: 37, respectively.

Example 13 Preparation of FcRn_m7Cys

(132) (1) The transformant expressing the FcRn_m7Cys prepared in Example 12 was inoculated in 400 mL of 2YT liquid medium (peptone 16 g/L, yeast extract 10 g/L, sodium chloride, 5 g/L) containing 50 μg/mL of kanamycin charged in a 2 L baffle flask, and pre-cultured by an aerobic shaking culture at 37° C. overnight.

(133) (2) To 1.8 L of a liquid medium containing 10 g/L of glucose, 20 g/L of yeast extract, 3 g/L of trisodium phosphate dodecahydrate, 9 g/L of disodium hydrogen phosphate dodecahydrate, 1 g/L of ammonium chloride, and 50 mg/L of kanamycin sulfate was inoculated 180 mL of the culture solution of (1), and main culture was performed using a 3 L fermenter (manufactured by Biott Corporation). Under the conditions set to: temperature, 30° C.; pH, 6.9 to 7.1; aeration, 1 VVM; dissolved oxygen concentration, 30% saturated concentration, the main culture was started. The pH was controlled using 50% (w/v) phosphoric acid as an acid and 14% (w/v) aqueous ammonia as an alkali, and dissolved oxygen was controlled by varying the stirring speed, and agitation rotation was set from the minimum value of 500 rpm to the maximum value of 1000 rpm. After the culture was started, when the glucose concentration was not able to be measured, a feeding medium (glucose, 248.9 g/L; yeast extract, 83.3 g/L; magnesium sulfate heptahydrate, 7.2 g/L) was added while controlling by the dissolved oxygen (DO).

(134) (3) When the absorbance at 600 run (OD 600 nm) reached about 150, which was a rough standard of an amount of the bacterial cells, the culture temperature was decreased to 25° C., and after confirmed to reach the set temperature, IPTG was added to the final concentration of 0.5 mM, and subsequently the culture was continued at 25° C.

(135) (4) Forty-eight hours after the beginning of the culture, the culture was stopped, and the culture solution was centrifuged at 4° C., 8000 rpm for 20 minutes to harvest the bacterial cells.

(136) (5) The harvested bacterial cells was suspended in 20 mM Tris-HCl buffer (pH 7.0) to 5 mL/1 g-bacterial cells, and the bacterial cells were disrupted using an ultrasonic generator (Insonator 201M (Trade name), manufactured by KUBOTA Corporation Co., Ltd.) at 4° C. for about 10 minutes at an output of about 150 W. The bacterial cell disrupt was centrifuged twice at 4° C. for 20 minutes at 8000 rpm to harvest the supernatant.

(137) (6) The supernatant obtained in (5) was applied to a XK26/20 column (manufactured by GE Healthcare) filled with 90 mL of IgG Sepharose (Manufactured by GE Healthcare) which had been previously equilibrated with 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride. After washed with a buffer used for equilibration, the resultant was eluted with 0.1M glycine-HCl buffer (pH 3.0). As for eluate, 1M Tris-HCl buffer (pH 8.0) was added in an amount ¼ of the eluted amount to restore pH to around neutral.

(138) The purification provided about 10 mg of high-purity FcRn_m7Cys.

Example 14 Production of FcRn_m7Cys Immobilize Gel and Separation of Antibody

(139) (1) A hydroxyl group on the surface of 2 mL of hydrophilic vinyl polymer for a separating resin (manufactured by Tosoh Corporation: Toyopearl) was activated with an iodoacetyl group, and then reacted with 4 mg of the FcRn_m7Cys prepared in Example 13 to obtain FcRn_m7Cys immobilize gel.

(140) (2) The FcRn_m7Cys immobilize gel prepared in (1) 0.5 mL was filled in a stainless-steel column of φ 4.6 mm×75 mm.

(141) (3) A column filled with FcRn_m7Cys immobilize gel was connected to a HPLC apparatus, and equilibrated with 50 mM phosphate buffer (pH 5.8) containing 150 mM sodium chloride.

(142) (4) The monoclonal antibody (rituximab: manufactured by Zenyaku Kogyo Company, Limited, Rituxan, trastuzumab and bevacizumab) (0.01 mL) which was diluted to 0.5 mg/mL with 50 mM phosphate buffer (pH 5.8) containing 150 mM sodium chloride was applied at a flow rate of 0.6 mL/min.

(143) (5) After washing with the equilibrated buffer which was 50 mM phosphate buffer (pH 5.8) containing 150 mM sodium chloride for 10 minutes while keeping the flow rate at 0.6 mL/min, the adsorbed monoclonal antibody was eluted by pH gradient elution by pH gradient elution with 50 mM phosphate buffer (pH 8.0) containing 150 mM sodium chloride (with such a gradient that 50 mM phosphate buffer (pH 8.0) containing 150 mM sodium chloride became 100% in 30 minutes).

(144) The results (elution patterns) are shown as FIG. 4. Since the extent of the interaction with FcRn_m7 varied depending on the type of the antibody, an elution peak had different shape for each antibody.

(145) Although the present invention has been described in detail and with reference to particular embodiments, it will be apparent to those skilled in the art that various changes and modifications can be made without departing from the spirit and scope of the invention.

(146) The specification, sequence lists, claims, drawings and abstract of Japanese Unexamined Patent Publication (Kokai) No. 2017-086808 filed on Apr. 26, 2017 are incorporated herein in their entirety by reference.