METHODS AND COMPOSITIONS FOR TREATING CANCER USING CHRNA6 INHIBITORS

20220033490 · 2022-02-03

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention provides methods for treating cancer using a6*nAChR inhibitors, such as a6*nAChR inhibitory antibodies, among others. The invention also features compositions containing a6*nAChR inhibitors, methods of diagnosing patients with a6*nAChR-associated cancer, and methods of predicting the response of cancer in a subject to treatment with a6*nAChR inhibitors.

    Claims

    1-123. (canceled)

    124. A method comprising administering to a subject an α6-containing nicotinic acetylcholine receptor (α6*nAChR) inhibitor, wherein the subject has a tumor comprising tumor infiltrating regulatory T cells (Tregs) that express α6*nAChR.

    125. The method of claim 124, wherein the α6*nAChR inhibitor is administered in an amount effective to reduce Treg-mediated immunosuppression of CD8+ T cell activity.

    126. The method of claim 124, wherein the α6*nAChR inhibitor is administered in an amount effective to increase CD8+ T cell activation by at least 1.1 fold, relative to a control.

    127. The method of claim 124, wherein the α6*nAChR inhibitor is administered in an amount effective to increase CD8+ T cell secretion of IFNγ by at least 1.1 fold, relative to a control.

    128. The method of claim 124, wherein the tumor is a cancer.

    129. The method of claim 128, wherein the cancer is a colorectal cancer.

    130. The method of claim 128, wherein the cancer is a non-small cell lung cancer.

    131. The method of claim 124, wherein the α6*nAChR inhibitor is a small molecule.

    132. The method of claim 124, wherein the α6*nAChR inhibitor is α-conotoxin PIA.

    133. The method of claim 124, wherein the α6*nAChR inhibitor is an antibody that specifically binds to α6*nAChR.

    134. The method of claim 124, wherein the α6*nAChR inhibitor is a programmable nuclease.

    135. The method of claim 134, wherein the programmable nuclease an RNA-guided nuclease.

    136. The method of claim 135, wherein the RNA-guided nuclease is Cas9.

    137. The method of claim 124, wherein the α6*nAChR inhibitor is administered locally.

    138. A method comprising administering to a subject an α6*nAChR inhibitor, wherein the subject has a cancer comprising tumor infiltrating Tregs that express α6*nAChR, and wherein the α6*nAChR inhibitor is administered in an amount effective to increase CD8+ T cell secretion of IFNγ by at least 1.1 fold, relative to a control.

    139. The method of claim 138, wherein the α6*nAChR inhibitor is a small molecule, an antibody, or a programmable nuclease.

    140. The method of claim 138, wherein the cancer is a colorectal cancer or a non-small cell lung cancer.

    141. A method comprising contacting a tumor comprising tumor infiltrating Tregs that express α6*nAChR with an α6*nAChR inhibitor in an amount effective to increase CD8+ T cell activation by at least 1.1 fold, relative to a control.

    142. The method of claim 141, wherein the α6*nAChR inhibitor is a small molecule, an antibody, or a programmable nuclease.

    143. The method of claim 141, wherein the cancer is a colorectal cancer or a non-small cell lung cancer.

    Description

    DETAILED DESCRIPTION

    [0156] Described herein are compositions and methods for the treatment of cancer in a subject (e.g., a mammalian subject, such as a human) by administering α6*nAChR inhibitors. α6*nAChR inhibitors include α6*nAChR-inhibitory antibodies, small molecule α6*nAChR antagonists, and neurotoxins, such as alpha conotoxin. These methods and compositions provide new mechanistic approaches for treating cancer.

    nAChRα6

    [0157] Cholinergic receptor nicotinic alpha 6 subunit (nAChRα6, Entrez Gene 8973) is the alpha-6 subunit of the nicotinic acetylcholine receptor (nAChR). The nicotinic acetylcholine receptor is made up of five subunits, arranged symmetrically around a central pore. There are various assemblies of receptors, either homomeric (all one type of subunit) or heteromeric (at least one a and one β) combinations of twelve different nicotinic receptor subunits: α1-α10, β1-β4, delta, gamma, and epsilon. The subunits are categorized by sequence homology into four families. nAChRα6 is a member of family III subtype 1, along with nAChRα2, nAChRα3, and nAChRα4. After binding acetylcholine, the nAChR responds by an extensive change in conformation that affects all subunits and leads to the opening of an ion-conducting channel across the plasma membrane.

    [0158] nAChRα6 subunits are known to be included in nAChRβ2-subunit containing nAChRs, and nicotinic acetylcholine receptors containing α6 and β2 subunits are thought to play a role in nicotine addiction. nAChRs containing α6 and β2 subunits are enriched in the dorsal and ventral striatum of the brain and are also expressed by retinal ganglion cells and in catacholaminergic and retinal projection regions of the brain. Within the brain, α6 and β2-containing nAChRs have also been found to include β3, and α4 subunits, and the two major α6 and β2-subunit containing nAChRs expressed in the brain are thought to be α4α6β2β3nAChRs and α6β2β3nAChRs.

    [0159] The present invention relates to the discovery that nAChRα6 is highly and specifically expressed by regulatory T cells (Tregs). These findings indicate that inhibition of α6*nAChRs can be used as a therapeutic strategy for treating cancer by engaging the immune system. Indeed, inhibition of α6*nAChRs leads to an increase in IFNγ+CD8+ T cells. These data also suggest that patients with overexpression of nAChRα6 are at increased risk of developing cancer and would benefit from specific treatments, such as treatment with the compositions and methods described herein.

    α6*nAChR inhibitors

    [0160] α6*nAChR inhibitors described herein can reduce or inhibit α6*nAChR activation, function, or expression in order to treat cancer. α6*nAChR inhibitors may binding to an α6*nAChR and inhibit or reduce channel opening, disrupt or reduce acetylcholine binding, or disrupt the formation of the pentameric receptor (e.g., disrupt the interaction of nAChRα6 with other nAChR subunits).

    [0161] In some embodiments, the α6*nAChR inhibitor is an inhibitory RNA (e.g., siRNA, shRNA, or miRNA) directed to nAChRα6 (e.g., to the CHRNA6 gene). In some embodiments, the α6*nAChR inhibitor is an inhibitory RNA (e.g., siRNA, shRNA, or miRNA) directed to a gene encoding a subunit in an α6*nAChR other than nAChRα6 (e.g., the CHRNA4, CHRNB2, or CHRNB3 gene).

    [0162] In some embodiments, the α6*nAChR inhibitor is a nuclease (e.g., TALEN, ZFN, or Cas, e.g., Cas9) directed to the CHRNA6 gene. In some embodiments, the nuclease is directed to CHRNA6 by a guide RNA (gRNA). In some embodiments, the gRNA has a nucleic acid sequence with at least 85% sequence identity (e.g., at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the nucleic acid sequence of any one of SEQ ID NOs: 1-3. In some embodiments, the α6*nAChR inhibitor is a nuclease (e.g., TALEN, ZFN, or Cas, e.g., Cas9) directed to a gene encoding a subunit in an α6*nAChR other than nAChRα6 (e.g., the CHRNA4, CHRNB2, or CHRNB3 gene).

    [0163] In some embodiments, the α6*nAChR inhibitor is an antibody or an antigen binding fragment thereof that binds to an α6*nAChR and reduces or inhibits α6*nAChR function or activation. These antibodies may bind directly to nAChRα6 or to nAChRα6 and/or other nAChR subunits that are known to be expressed in α6*nAChRs, such as nAChRβ2. α6*nAChR inhibitory antibodies include antibodies having one or more of the following functional properties: prevent or reduce nAChRα6 binding to other nAChR subunits, reduce or inhibit the formation of a multimeric nicotinic acetylcholine receptor (e.g., an α6*nAChR), do not have agonistic activity (e.g., do not activate α6*nAChR), induce antibody-dependent cell killing of the cell expressing nAChRα6 (e.g., antibody-dependent cell killing by natural killer (NK) cells, monocytes, macrophages, neutrophils, dendritic cells, or eosinophils), induce phagocytosis of the cell expressing nAChRα6 (e.g., macrophage phagocytosis of the immune cell), induce opsonization of the cell expressing nAChRα6, or induce downregulation of nAChRα6 on the cell surface (e.g., hyper-crosslink or cluster the receptor to induce internalization and degradation, e.g., the antibody is a polyvalent antibody), antagonize an α6*nAChR (e.g., prevent or reduce α6*nAChR activation), bind to an extracellular region of an α6*nAChR, bind to one or more residues of nAChRα6 involved in interaction with other nAChR subunits, reduces or inhibits channel opening, reduces α6*nAChR activation, or binds to or blocks one or more of residues of α6*nAChR involved in acetylcholine binding.

    [0164] Antibodies having one or more of these functional properties are routinely screened and selected once the desired functional property is identified herein (e.g., by screening of phage display or other antibody libraries).

    [0165] In some embodiments, the α6*nAChR inhibitor is a small molecule inhibitor (e.g., antagonist) listed in Table 1. In some embodiments, the α6*nAChR inhibitor is CHEMBL3104238 or CHEMBL3107687.

    [0166] Neurotransmission Blockers

    [0167] In some embodiments, the α6*nAChR inhibitor is a neurotransmission blocker. Neurotransmission blockers decrease or block neurotransmission by decreasing neurotransmitter synthesis or release, increasing neurotransmitter reuptake or degradation, decreasing neurotransmitter receptor activity and/or disrupting the pre or postsynaptic machinery. In some embodiments, the neurotransmission blocker is a neurotoxin that prevents or reduces acetylcholine release from neurons (e.g., prevents or reduces neurotransmission). In some embodiments, the neurotoxin is a neurotoxin listed in Table 11. In some embodiments, the neurotoxin is alpha-conotoxin or a peptide derived thereof (e.g., alpha-conotoxin PIA).

    TABLE-US-00001 TABLE 1 SMALL MOLECULE α6*nAChR INHIBITORS Receptor Inhibitors α6*nAChR antagonists CHEMBL3107687, CHEMBL2024094, CHEMBL2409625, CHEMBL2409627, CHEMBL2409631, CHEMBL3104238, CHEMBL406906, bPiDDB, bisindolylmaleimide II, catestatin, chlorisondamine diiodide, PAMP-20, tubocurarine, 2,2,6,6-tetramethylpiperidin-4-yl heptanoate (TPMH), [00001]embedded image (Crooks et al., Adv. Pharmacol. 69:513-551, 2014)

    [0168] Agent Modalities

    [0169] A α6*nAChR inhibitor can be selected from a number of different modalities. An α6*nAChR inhibitor can be a nucleic acid molecule (e.g., DNA molecule or RNA molecule, e.g., mRNA or inhibitory RNA molecule (e.g., siRNA, shRNA, or miRNA), or a hybrid DNA-RNA molecule), a small molecule (e.g., a small molecule α6*nAChR inhibitor (e.g., an antagonist), a nuclease, or a polypeptide (e.g., an antibody molecule, e.g., an antibody or antigen binding fragment thereof). An α6*nAChR inhibitor can also be a viral vector expressing an α6*nAChR inhibitor (e.g., a neurotoxin) or a cell infected with a viral vector. Any of these modalities can be an α6*nAChR inhibitor directed to target (e.g., to reduce or inhibit) α6*nAChR function, nAChRα6 expression, α6*nAChR binding to acetylcholine, or α6*nAChR activation.

    [0170] The nucleic acid molecule, small molecule, peptide, polypeptide, or antibody molecule can be modified. For example, the modification can be a chemical modification, e.g., conjugation to a marker, e.g., fluorescent marker or a radioactive marker. In other examples, the modification can include conjugation to a molecule that enhances the stability or half-life of the α6*nAChR inhibitor (e.g., an Fc domain of an antibody or serum albumin, e.g., human serum albumin). The modification can also include conjugation to an antibody to target the agent to a particular cell or tissue. Additionally, the modification can be a chemical modification, packaging modification (e.g., packaging within a nanoparticle or microparticle), or targeting modification to prevent the agent from crossing the blood brain barrier.

    [0171] Small Molecules

    [0172] Numerous small molecule inhibitors useful in the methods of the invention are described herein and additional small molecule α6*nAChR inhibitors useful as therapies for cancer can also be identified through screening based on their ability to reduce or inhibit α6*nAChR function or signaling. Small molecules include, but are not limited to, small peptides, peptidomimetics (e.g., peptoids), amino acids, amino acid analogs, synthetic polynucleotides, polynucleotide analogs, nucleotides, nucleotide analogs, organic and inorganic compounds (including heterorganic and organometallic compounds) generally having a molecular weight less than about 5,000 grams per mole, e.g., organic or inorganic compounds having a molecular weight less than about 2,000 grams per mole, e.g., organic or inorganic compounds having a molecular weight less than about 1,000 grams per mole, e.g., organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds.

    [0173] In some embodiments, the α6*nAChR inhibitor (e.g., antagonist) is CHEMBL3104238, CHEMBL3107687, or a small molecule α6*nAChR inhibitor (e.g., antagonist) listed in Table 1. A pharmaceutical composition including the α6*nAChR inhibitor can be formulated for treatment of a cancer described herein. In some embodiments, a pharmaceutical composition that includes the α6*nAChR inhibitor is formulated for local administration, e.g., to the affected site in a subject.

    [0174] Antibodies

    [0175] The α6*nAChR inhibitor can be an antibody or antigen binding fragment thereof. For example, an α6*nAChR inhibitor described herein is an antibody that reduces or blocks the activation and/or function of α6*nAChR through binding to nAChRα6 or an nAChR subunit that forms a receptor with nAChRα6 to disrupt receptor formation, reduce or inhibit acetylcholine binding, or reduce or inhibit channel opening.

    [0176] The making and use of therapeutic antibodies against a target antigen (e.g., α6*nAChR, e.g., nAChRα6) is known in the art. See, for example, the references cited herein above, as well as Zhiqiang An (Editor), Therapeutic Monoclonal Antibodies: From Bench to Clinic. 1st Edition. Wiley 2009, and also Greenfield (Ed.), Antibodies: A Laboratory Manual. (Second edition) Cold Spring Harbor Laboratory Press 2013, for methods of making recombinant antibodies, including antibody engineering, use of degenerate oligonucleotides, 5′-RACE, phage display, and mutagenesis; antibody testing and characterization; antibody pharmacokinetics and pharmacodynamics; antibody purification and storage; and screening and labeling techniques.

    [0177] Inhibitory RNA

    [0178] In some embodiments, the α6*nAChR inhibitor is an inhibitory RNA molecule, e.g., that acts by way of the RNA interference (RNAi) pathway. An inhibitory RNA molecule can decrease the expression level (e.g., protein level or mRNA level) of nAChRα6. For example, an inhibitory RNA molecule includes a short interfering RNA, short hairpin RNA, and/or a microRNA that targets full-length α6*nAChR. A siRNA is a double-stranded RNA molecule that typically has a length of about 19-25 base pairs. A shRNA is a RNA molecule including a hairpin turn that decreases expression of target genes via RNAi. shRNAs can be delivered to cells in the form of plasmids, e.g., viral or bacterial vectors, e.g., by transfection, electroporation, or transduction). A microRNA is a non-coding RNA molecule that typically has a length of about 22 nucleotides. MiRNAs bind to target sites on mRNA molecules and silence the mRNA, e.g., by causing cleavage of the mRNA, destabilization of the mRNA, or inhibition of translation of the mRNA. In embodiments, the inhibitory RNA molecule decreases the level and/or activity of a negative regulator of function or a positive regulator of function. In other embodiments, the inhibitory RNA molecule decreases the level and/or activity of an inhibitor of a positive regulator of function.

    [0179] An inhibitory RNA molecule can be modified, e.g., to contain modified nucleotides, e.g., 2′-fluoro, 2′-o-methyl, 2′-deoxy, unlocked nucleic acid, 2′-hydroxy, phosphorothioate, 2′-thiouridine, 4′-thiouridine, 2′-deoxyuridine. Without being bound by theory, it is believed that certain modification can increase nuclease resistance and/or serum stability, or decrease immunogenicity.

    [0180] In some embodiments, the inhibitory RNA molecule decreases the level and/or activity or function of α6*nAChR. In embodiments, the inhibitory RNA molecule inhibits expression of nAChRα6. In other embodiments, the inhibitory RNA molecule increases degradation of α6*nAChR, and/or decreases the stability (i.e., half-life) of α6*nAChR. The inhibitory RNA molecule can be chemically synthesized or transcribed in vitro.

    [0181] The making and use of inhibitory therapeutic agents based on non-coding RNA such as ribozymes, RNAse P, siRNAs, and miRNAs are also known in the art, for example, as described in Sioud, RNA Therapeutics: Function, Design, and Delivery (Methods in Molecular Biology). Humana Press 2010.

    [0182] Gene Editing

    [0183] In some embodiments, the α6*nAChR inhibitor is a component of a gene editing system. For example, the α6*nAChR inhibitor introduces an alteration (e.g., insertion, deletion (e.g., knockout), translocation, inversion, single point mutation, or other mutation) in a gene encoding a subunit of an α6*nAChR (e.g., the CHRNA6 gene). Exemplary gene editing systems include the zinc finger nucleases (ZFNs), Transcription Activator-Like Effector-based Nucleases (TALEN), and the clustered regulatory interspaced short palindromic repeat (CRISPR) system. ZFNs, TALENs, and CRISPR-based methods are described, e.g., in Gaj et al. Trends Biotechnol. 31.7(2013):397-405.

    [0184] CRISPR refers to a set of (or system including a set of) clustered regularly interspaced short palindromic repeats. A CRISPR system refers to a system derived from CRISPR and Cas (a CRISPR-associated protein) or other nuclease that can be used to silence or mutate a gene described herein. The CRISPR system is a naturally occurring system found in bacterial and archaeal genomes. The CRISPR locus is made up of alternating repeat and spacer sequences. In naturally-occurring CRISPR systems, the spacers are typically sequences that are foreign to the bacterium (e.g., plasmid or phage sequences). The CRISPR system has been modified for use in gene editing (e.g., changing, silencing, and/or enhancing certain genes) in eukaryotes. See, e.g., Wiedenheft et al., Nature 482: 331, 2012. For example, such modification of the system includes introducing into a eukaryotic cell a plasmid containing a specifically-designed CRISPR and one or more appropriate Cas proteins. The CRISPR locus is transcribed into RNA and processed by Cas proteins into small RNAs that contain a repeat sequence flanked by a spacer. The RNAs serve as guides to direct Cas proteins to silence specific DNA/RNA sequences, depending on the spacer sequence. See, e.g., Horvath et al., Science 327: 167, 2010; Makarova et al., Biology Direct 1:7, 2006; Pennisi, Science 341: 833, 2013. In some examples, the CRISPR system includes the Cas9 protein, a nuclease that cuts on both strands of the DNA. See, e.g., Id.

    [0185] In some embodiments, in a CRISPR system for use described herein, e.g., in accordance with one or more methods described herein, the spacers of the CRISPR are derived from a target gene sequence, e.g., from an α6*nAChR subunit sequence (e.g., the CHRNA6 gene).

    [0186] In some embodiments, the α6*nAChR inhibitor includes a guide RNA (gRNA) for use in a clustered regulatory interspaced short palindromic repeat (CRISPR) system for gene editing. In embodiments, the α6*nAChR inhibitor contains a zinc finger nuclease (ZFN), or an mRNA encoding a ZFN, that targets (e.g., cleaves) a nucleic acid sequence (e.g., DNA sequence) of subunit of an α6*nAChR (e.g., the CHRNA6 gene). In embodiments, the α6*nAChR inhibitor contains a TALEN, or an mRNA encoding a TALEN, that targets (e.g., cleaves) a nucleic acid sequence (e.g., DNA sequence) of a subunit of an α6*nAChR (e.g., the CHRNA6 gene).

    [0187] For example, the gRNA can be used in a CRISPR system to engineer an alteration in a gene (e.g., CHRNA6). In other examples, the ZFN and/or TALEN can be used to engineer an alteration in a gene (e.g., CHRNA6). Exemplary alterations include insertions, deletions (e.g., knockouts), translocations, inversions, single point mutations, or other mutations. The alteration can be introduced in the gene in a cell, e.g., in vitro, ex vivo, or in vivo. In some embodiments, the alteration decreases the level and/or activity of (e.g., knocks down or knocks out) an α6*nAChR, e.g., the alteration is a negative regulator of function. In yet another example, the alteration corrects a defect (e.g., a mutation causing a defect), in an α6*nAChR.

    [0188] In certain embodiments, the CRISPR system is used to edit (e.g., to add or delete a base pair) a target gene, e.g., a subunit of an α6*nAChR (e.g., the CHRNA6 gene). In other embodiments, the CRISPR system is used to introduce a premature stop codon, e.g., thereby decreasing the expression of a target gene. In yet other embodiments, the CRISPR system is used to turn off a target gene in a reversible manner, e.g., similarly to RNA interference. In embodiments, the CRISPR system is used to direct Cas to a promoter of a target gene, e.g., a gene encoding a subunit of an α6*nAChR (e.g., the CHRNA6 gene), thereby blocking an RNA polymerase sterically.

    [0189] In some embodiments, a CRISPR system can be generated to edit a gene encoding a subunit of an α6*nAChR (e.g., the CHRNA6 gene) using technology described in, e.g., U.S. Publication No. 20140068797; Cong, Science 339: 819, 2013; Tsai, Nature Biotechnol., 32:569, 2014; and U.S. Pat. Nos. 8,871,445; 8,865,406; 8,795,965; 8,771,945; and 8,697,359.

    [0190] In some embodiments, the CRISPR interference (CRISPRi) technique can be used for transcriptional repression of specific genes, e.g., the gene encoding a subunit of α6*nAChR (e.g., the CHRNA6 gene). In CRISPRi, an engineered Cas9 protein (e.g., nuclease-null dCas9, or dCas9 fusion protein, e.g., dCas9-KRAB or dCas9-SID4X fusion) can pair with a sequence specific guide RNA (sgRNA). The Cas9-gRNA complex can block RNA polymerase, thereby interfering with transcription elongation. The complex can also block transcription initiation by interfering with transcription factor binding. The CRISPRi method is specific with minimal off-target effects and is multiplexable, e.g., can simultaneously repress more than one gene (e.g., using multiple gRNAs). Also, the CRISPRi method permits reversible gene repression.

    [0191] In some embodiments, CRISPR-mediated gene activation (CRISPRa) can be used for transcriptional activation, e.g., of one or more genes described herein, e.g., a gene that inhibits α6*nAChR (e.g., the CHRNA6 gene). In the CRISPRa technique, dCas9 fusion proteins recruit transcriptional activators. For example, dCas9 can be used to recruit polypeptides (e.g., activation domains) such as VP64 or the p65 activation domain (p65D) and used with sgRNA (e.g., a single sgRNA or multiple sgRNAs), to activate a gene or genes, e.g., endogenous gene(s). Multiple activators can be recruited by using multiple sgRNAs—this can increase activation efficiency. A variety of activation domains and single or multiple activation domains can be used. In addition to engineering dCas9 to recruit activators, sgRNAs can also be engineered to recruit activators. For example, RNA aptamers can be incorporated into a sgRNA to recruit proteins (e.g., activation domains) such as VP64. In some examples, the synergistic activation mediator (SAM) system can be used for transcriptional activation. In SAM, MS2 aptamers are added to the sgRNA. MS2 recruits the MS2 coat protein (MCP) fused to p65AD and heat shock factor 1 (HSF1). The CRISPRi and CRISPRa techniques are described in greater detail, e.g., in Dominguez et al., Nat. Rev. Mol. Cell Biol. 17:5, 2016, incorporated herein by reference.

    [0192] Viral Vectors

    [0193] The α6*nAChR inhibitor can be delivered by a viral vector (e.g., a viral vector expressing an α6*nAChR inhibitor, e.g., a neurotoxin, such as alpha-conotoxin, an inhibitory RNA, or a DNA molecule encoding a gRNA). Viral vectors can be used to express a neurotoxin or a fragment thereof. A viral vector may be administered to a cell or to a subject (e.g., a human subject or animal model) to reduce expression or activity of α6*nAChR. Viral vectors can also be used to express a neurotoxin from Table 11 (e.g., alpha-conotoxin) or a peptide derived thereof. A viral vector expressing a neurotoxin from Table 11 can be administered to a cell or to a subject (e.g., a human subject or animal model) to decrease or block neurotransmission. Viral vectors can be directly administered (e.g., injected) to an immune cell-infiltrated tumor to treat cancer.

    [0194] Viral genomes provide a rich source of vectors that can be used for the efficient delivery of exogenous genes into a mammalian cell. Viral genomes are particularly useful vectors for gene delivery because the polynucleotides contained within such genomes are typically incorporated into the nuclear genome of a mammalian cell by generalized or specialized transduction. These processes occur as part of the natural viral replication cycle, and do not require added proteins or reagents in order to induce gene integration. Examples of viral vectors include a retrovirus (e.g., Retroviridae family viral vector), adenovirus (e.g., Ad5, Ad26, Ad34, Ad35, and Ad48), parvovirus (e.g., adeno-associated viruses), coronavirus, negative strand RNA viruses such as orthomyxovirus (e.g., influenza virus), rhabdovirus (e.g., rabies and vesicular stomatitis virus), paramyxovirus (e.g., measles and Sendai), positive strand RNA viruses, such as picornavirus and alphavirus, and double stranded DNA viruses including adenovirus, herpesvirus (e.g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus, replication deficient herpes virus), and poxvirus (e.g., vaccinia, modified vaccinia Ankara (MVA), fowlpox and canarypox). Other viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, human papilloma virus, human foamy virus, and hepatitis virus, for example. Examples of retroviruses include: avian leukosis-sarcoma, avian C-type viruses, mammalian C-type, B-type viruses, D-type viruses, oncoretroviruses, HTLV-BLV group, lentivirus, alpharetrovirus, gammaretrovirus, spumavirus (Coffin, J. M., Retroviridae: The viruses and their replication, Virology (Third Edition) Lippincott-Raven, Philadelphia, 1996). Other examples include murine leukemia viruses, murine sarcoma viruses, mouse mammary tumor virus, bovine leukemia virus, feline leukemia virus, feline sarcoma virus, avian leukemia virus, human T-cell leukemia virus, baboon endogenous virus, Gibbon ape leukemia virus, Mason Pfizer monkey virus, simian immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus and lentiviruses. Other examples of vectors are described, for example, in U.S. Pat. No. 5,801,030, the teachings of which are incorporated herein by reference.

    [0195] Cell-Based Therapies

    [0196] A α6*nAChR inhibitor described herein can be administered to a cell in vitro (e.g., an immune cell, e.g., a Treg), which can subsequently be administered to a subject (e.g., a human subject or animal model). The α6*nAChR inhibitor can be administered to the cell to effect an immune response (e.g., activation, polarization, antigen presentation, cytokine production, migration, proliferation, or differentiation) as described herein. Once the immune response is elicited, the cell can be administered to a subject (e.g., injected) to treat cancer. The immune cell can be locally administered (e.g., injected into a tumor, tumor microenvironment, site of metastasis, lymph node, spleen, secondary lymphoid organ, or tertiary lymphoid organ).

    [0197] A α6*nAChR inhibitor can also be administered to a cell in vitro (e.g., an immune cell, e.g., a Treg) to alter gene or protein expression in the cell. The α6*nAChR inhibitor can decrease the expression of an α6*nAChR in an immune cell. The α6*nAChR inhibitor can be a polypeptide or nucleic acid (e.g., mRNA or inhibitory RNA) described above. The α6*nAChR inhibitor can be an exogenous gene encoded by a plasmid that is introduced into the cell using standard methods (e.g., calcium phosphate precipitation, electroporation, microinjection, infection, lipofection, impalefection, laserfection, or magnetofection). The α6*nAChR inhibitor can be a viral vector (e.g., a viral vector expressing an α6*nAChR inhibitor) that is introduced to the cell using standard transduction methods. The plasmid or vector can also contain a reporter construct (e.g., a fluorescent reporter) that can be used to confirm expression of the transgene by the immune cell. After the immune cell has been contacted with an α6*nAChR inhibitor to decrease gene expression, the cell can be administered to a subject (e.g., injected) to treat cancer. The immune cell can be locally administered (e.g., injected into a tumor, tumor microenvironment, site of metastasis, lymph node, spleen, secondary lymphoid organ, or tertiary lymphoid organ).

    [0198] The cell can be administered to a subject immediately after being contacted with an α6*nAChR inhibitor (e.g., within 5, 10, 15, 30, 45, or 60 minutes of being contacted with an α6*nAChR inhibitor), or 6 hours, 12 hours, 24 hours, 2 days, 3, days, 4 days, 5, days, 6 days, 7 days or more after being contacted with an α6*nAChR inhibitor. The method can include an additional step of evaluating the immune cell for an immune cell activity (e.g., activation, polarization, antigen presentation, cytokine production, migration, proliferation, or differentiation) or modulation of gene expression after contact with an α6*nAChR inhibitor and before administration to a subject.

    Blood Brain Barrier Permeability

    [0199] In some embodiments, the α6*nAChR inhibitors for use in the present invention are agents that are not capable of crossing, or that do not cross, the blood brain barrier (BBB) of a mammal, e.g., an experimental rodent (e.g., mouse or rat), dog, pig, non-human primate, or a human. The BBB is a highly selective semipermeable membrane barrier that separates the circulating blood from the brain extracellular fluid (e.g., cerebrospinal fluid) in the central nervous system (CNS). The BBB is made up of high-density endothelial cells, which are connected by tight junctions. These cells prevent most molecular compounds in the bloodstream (e.g., large molecules and hydrophilic molecules) from entering the brain. Water, some gases (e.g., oxygen and carbon dioxide), and lipid-soluble molecules (e.g., hydrophobic molecules, such as steroid hormones) can cross the BBB by passive diffusion. Molecules that are needed for neural function, such as glucose and amino acids, are actively transported across the BBB.

    [0200] A number of approaches can be used to render an agent BBB impermeable. These methods include modifications to increase an agent's size, polarity, or flexibility or reduce its lipophilicity, targeting approaches to direct an agent to another part of the body and away from the brain, and packaging approaches to deliver an agent in a form that does not freely diffuse across the BBB. These approaches can be used to render a BBB permeable α6*nAChR inhibitor impermeable, and they can also be used to improve the properties (e.g., cell-specific targeting) of an α6*nAChR inhibitor that does not cross the BBB. The methods that can be used to render an agent BBB impermeable are discussed in greater detail herein below.

    [0201] Formulation of BBB-Impermeable Agents for Enhanced Cell Targeting

    [0202] One approach that can be used to render an α6*nAChR inhibitor BBB impermeable is to conjugate the agent to a targeting moiety that directs it somewhere other than the brain. The targeting moiety can be an antibody for a receptor expressed by the target cell (e.g., N-Acetylgalactosamine for liver transport; DGCR2, GBF1, GPR44 or SerpinB10 for pancreas transport; Secretoglobin, family 1A, member 1 for lung transport). The targeting moiety can also be a ligand of any receptor or other molecular identifier expressed on the target cell in the periphery. These targeting moieties can direct the α6*nAChR inhibitor of interest to its corresponding target cell, and can also prevent BBB crossing by directing the agent away from the BBB and increasing the size of the α6*nAChR inhibitor via conjugation of the targeting moiety.

    [0203] α6*nAChR inhibitors can also be rendered BBB impermeable through formulation in a particulate delivery system (e.g., a nanoparticle, liposome, or microparticle), such that the agent is not freely diffusible in blood and cannot cross the BBB. The particulate formulation used can be chosen based on the desired localization of the α6*nAChR inhibitor (e.g., a tumor, lymph node, lymphoid organ, or site of inflammation), as particles of different sizes accumulate in different locations. For example, nanoparticles with a diameter of 45 nm or less enter the lymph node, while 100 nm nanoparticles exhibit poor lymph node trafficking. Some examples of the link between particle size and localization in vivo are described in Reddy et al., J Controlled Release 112:26 2006, and Reddy et al., Nature Biotechnology 25:1159 2007. α6*nAChR inhibitors can be tested after the addition of a targeting moiety or after formulation in a particulate delivery system to determine whether or not they cross the BBB. Models for assessing BBB permeability include in vitro models (e.g., monolayer models, co-culture models, dynamic models, multi-fluidic models, isolated brain microvessels), in vivo models, and computational models as described in He et al., Stroke 45:2514 2014; Bickel, NeuroRx 2:15 2005; and Wang et al., Int J Pharm 288:349 2005. An α6*nAChR inhibitor that exhibits BBB impermeability can be used in the methods described herein.

    [0204] Modification of Existing Compounds to Render them BBB Impermeable

    [0205] There are multiple parameters that have been empirically derived in the field of medicinal chemistry to predict whether a compound will cross the BBB. The most common numeric value for describing permeability across the BBB is the log BB, defined as the logarithmic ratio of the concentration of a compound in the brain and in the blood. Empirical rules of thumb have been developed to predict BBB permeability, including rules regarding molecular size, polar surface area, sum of oxygen and nitrogen atoms, lipophilicity (e.g., partition coefficient between apolar solvent and water), “lipoaffinity”, molecular flexibility, and number of rotable bonds (summarized in Muehlbacher et al., J Comput Aided Mol Des. 25: 1095 2011; and Geldenhuys et al., Ther Deliv. 6: 961 2015). Some preferred limits on various parameters for BBB permeability are listed in Table 1 of Ghose et al., ACS Chem Neurosci. 3: 50 2012, which is incorporated herein by reference. Based on the parameters shown in the table, one of skill in the art could modify an existing α6*nAChR inhibitor to render it BBB impermeable.

    [0206] One method of modifying an α6*nAChR inhibitor to prevent BBB crossing is to add a molecular adduct that does not affect the target binding specificity, kinetics, or thermodynamics of the agent. Molecular adducts that can be used to render an agent BBB impermeable include polyethylene glycol (PEG), a carbohydrate monomer or polymer, a dendrimer, a polypeptide, a charged ion, a hydrophilic group, deuterium, and fluorine. α6*nAChR inhibitors can be tested after the addition of one or more molecular adducts or after any other properties are altered to determine whether or not they cross the BBB. Models for assessing BBB permeability include in vitro models (e.g., monolayer models, co-culture models, dynamic models, multi-fluidic models, isolated brain microvessels), in vivo models, and computational models as described in He et al., Stroke 45:2514 2014; Bickel, NeuroRx 2:15 2005; and Wang et al., Int J Pharm 288:349 2005. An α6*nAChR inhibitor that exhibits BBB impermeability can be used in the methods described herein.

    [0207] Screening for or Development of BBB Impermeable Agents

    [0208] Another option for developing BBB impermeable agents is to find or develop new agents that do not cross the BBB. One method for finding new BBB impermeable agents is to screen for compounds that are BBB impermeable. Compound screening can be performed using in vitro models (e.g., monolayer models, co-culture models, dynamic models, multi-fluidic models, isolated brain microvessels), in vivo models, and computational models, as described in He et al., Stroke 45:2514 2014; Bickel, NeuroRx 2:15 2005; Wang et al., Int J Pharm 288:349 2005, and Czupalla et al., Methods Mol Biol 1135:415 2014. For example, the ability of a molecule to cross the blood brain barrier can be determined in vitro using a transwell BBB assay in which microvascular endothelial cells and pericytes are co-cultured separated by a thin macroporous membrane, see e.g., Naik et al., J Pharm Sci 101:1337 2012 and Hanada et al., Int J Mol Sci 15:1812 2014; or in vivo by tracking the brain uptake of the target molecule by histology or radio-detection. Compounds would be deemed appropriate for use as α6*nAChR inhibitors in the methods described herein if they do not display BBB permeability in the aforementioned models.

    Modulation of Immune Cells

    [0209] The methods described herein can be used to modulate an immune response in a subject or cell by administering to a subject or cell an α6*nAChR inhibitor in a dose (e.g., an effective amount) and for a time sufficient to modulate the immune response. These methods can be used to treat a subject in need of modulating an immune response, e.g., a subject with cancer. One way to modulate an immune response is to modulate an immune cell activity. This modulation can occur in vivo (e.g., in a human subject or animal model) or in vitro (e.g., in acutely isolated or cultured cells, such as human cells from a patient, repository, or cell line, or rodent cells). The types of cells that can be modulated include T cells (e.g., peripheral T cells, cytotoxic T cells/CD8+ T cells, T helper cells/CD4+ T cells, memory T cells, regulatory T cells/Tregs, natural killer T cells/NKTs, mucosal associated invariant T cells, and gamma delta T cells), B cells (e.g., memory B cells, plasmablasts, plasma cells, follicular B cells/B-2 cells, marginal zone B cells, B-1 cells, regulatory B cells/Bregs), dendritic cells (e.g., myeloid DCs/conventional DCs, plasmacytoid DCs, or follicular DCs), granulocytes (e.g., eosinophils, mast cells, neutrophils, and basophils), monocytes, macrophages (e.g., peripheral macrophages, tissue resident macrophages, or tumor-resident macrophages), myeloid-derived suppressor cells, NK cells, innate lymphoid cells (ILC1, ILC2, ILC3), thymocytes, and megakaryocytes.

    [0210] The immune cell activities that can be modulated by administering to a subject or contacting a cell with an effective amount of an α6*nAChR inhibitor described herein include activation (e.g., macrophage, T cell, NK cell, ILC, B cell, dendritic cell, neutrophil, eosinophil, or basophil activation), phagocytosis (e.g., macrophage, neutrophil, monocyte, mast cell, B cell, eosinophil, or dendritic cell phagocytosis), antibody-dependent cellular phagocytosis (e.g., ADCP by monocytes, macrophages, neutrophils, or dendritic cells), antibody-dependent cellular cytotoxicity (e.g., ADCC by NK cells, ILCs, monocytes, macrophages, neutrophils, eosinophils, dendritic cells, or T cells), polarization (e.g., macrophage polarization toward an M1 or M2 phenotype or T cell polarization), proliferation (e.g., proliferation of B cells, T cells, monocytes, macrophages, dendritic cells, NK cells, ILCs, mast cells, neutrophils, eosinophils, or basophils), lymph node homing (e.g., lymph node homing of T cells, B cells, dendritic cells, or macrophages), lymph node egress (e.g., lymph node egress of T cells, B cells, dendritic cells, or macrophages), recruitment (e.g., recruitment of B cells, T cells, monocytes, macrophages, dendritic cells, NK cells, ILCs, mast cells, neutrophils, eosinophils, or basophils), migration (e.g., migration of B cells, T cells, monocytes, macrophages, dendritic cells, NK cells, ILCs, mast cells, neutrophils, eosinophils, or basophils), differentiation (e.g., regulatory T cell differentiation), immune cell cytokine production, antigen presentation (e.g., dendritic cell, macrophage, and B cell antigen presentation), maturation (e.g., dendritic cell maturation), and degranulation (e.g., mast cell, NK cell, ILC, cytotoxic T cell, neutrophil, eosinophil, or basophil degranulation). Innervation of lymph nodes or lymphoid organs, development of high endothelial venules (HEVs), and development of ectopic or tertiary lymphoid organs (TLOs) can also be modulated using the methods described herein. Modulation can increase or decrease these activities, depending on the α6*nAChR inhibitor used to contact the cell or treat a subject.

    [0211] In some embodiments, an effective amount of an α6*nAChR inhibitor is an amount sufficient to modulate (e.g., increase or decrease) one or more (e.g., 2 or more, 3 or more, 4 or more) of the following immune cell activities in the subject or cell: T cell polarization; T cell activation; dendritic cell activation; neutrophil activation; eosinophil activation; basophil activation; T cell proliferation; B cell proliferation; T cell proliferation; monocyte proliferation; macrophage proliferation; dendritic cell proliferation; NK cell proliferation; ILC proliferation; mast cell proliferation; neutrophil proliferation; eosinophil proliferation; basophil proliferation; cytotoxic T cell activation; circulating monocytes; peripheral blood hematopoietic stem cells; macrophage polarization; macrophage phagocytosis; macrophage ADCP, neutrophil phagocytosis; monocyte phagocytosis; mast cell phagocytosis; B cell phagocytosis; eosinophil phagocytosis; dendritic cell phagocytosis; macrophage activation; antigen presentation (e.g., dendritic cell, macrophage, and B cell antigen presentation); antigen presenting cell migration (e.g., dendritic cell, macrophage, and B cell migration); lymph node immune cell homing and cell egress (e.g., lymph node homing and egress of T cells, B cells, dendritic cells, or macrophages); NK cell activation; NK cell ADCC, mast cell degranulation; NK cell degranulation; ILC activation; ILC ADCC, ILC degranulation; cytotoxic T cell degranulation; neutrophil degranulation; eosinophil degranulation; basophil degranulation; neutrophil recruitment; eosinophil recruitment; NKT cell activation; B cell activation; regulatory T cell differentiation; dendritic cell maturation; development of HEVs; development of TLOs; or lymph node or secondary lymphoid organ innervation. In certain embodiments, the immune response (e.g., an immune cell activity listed herein) is increased or decreased in the subject or cell at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 100%, 150%, 200%, 300%, 400%, 500% or more, compared to before the administration. In certain embodiments, the immune response is increased or decreased in the subject or cell between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%, between 50-200%, between 100%-500%.

    [0212] After an α6*nAChR inhibitor is administered to treat a patient or contact a cell, a readout can be used to assess the effect on immune cell activity. Immune cell activity can be assessed by measuring a cytokine or marker associated with a particular immune cell type, as listed in Table 2 (e.g., performing an assay listed in Table 2 for the cytokine or marker). In certain embodiments, the parameter is increased or decreased in the subject at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 100%, 150%, 200%, 300%, 400%, 500% or more, compared to before the administration. In certain embodiments, the parameter is increased or decreased in the subject between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%, between 50-200%, between 100%-500%. An α6*nAChR inhibitor can be administered at a dose (e.g., an effective amount) and for a time sufficient to modulate an immune cell activity described herein below.

    [0213] After an α6*nAChR inhibitor is administered to treat a patient or contact a cell, a readout can be used to assess the effect on immune cell migration. Immune cell migration can be assessed by measuring the number of immune cells in a location of interest (e.g., tumor, tumor microenvironment, site of metastasis, lymph node, spleen, secondary lymphoid organ, or tertiary lymphoid organ). Immune cell migration can also be assessed by measuring a chemokine, receptor, or marker associated with immune cell migration, as listed in Tables 3 and 4. In certain embodiments, the parameter is increased or decreased in the subject at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 100%, 150%, 200%, 300%, 400%, 500% or more, compared to before the administration. In certain embodiments, the parameter is increased or decreased in the subject between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%, between 50-200%, between 100%-500%. An α6*nAChR inhibitor can be administered at a dose (e.g., an effective amount) and for a time sufficient to modulate an immune cell migration as described herein below.

    [0214] A α6*nAChR inhibitor described herein can affect immune cell migration. Immune cell migration between peripheral tissues, the blood, and the lymphatic system as well as lymphoid organs is essential for the orchestration of productive innate and adaptive immune responses. Immune cell migration is largely regulated by trafficking molecules including integrins, immunoglobulin cell-adhesion molecules (IgSF CAMs), cadherins, selectins, and a family of small cytokines called chemokines (Table 3). Cell adhesion molecules and chemokines regulate immune cell migration by both inducing extravasation from the circulation into peripheral tissues and acting as guidance cues within peripheral tissues themselves. For extravasation to occur, chemokines must act in concert with multiple trafficking molecules including C-type lectins (L-, P-, and E-selectin), multiple integrins, and cell adhesion molecules (ICAM-1, VCAM-1 and MAdCAM-1) to enable a multi-step cascade of immune cell capturing, rolling, arrest, and transmigration via the blood endothelial barrier (Table 4). Some trafficking molecules are constitutively expressed and manage the migration of immune cells during homeostasis, while others are specifically upregulated by inflammatory processes such as autoimmunity and cancer.

    [0215] The expression of trafficking molecules important for extravasation is mainly regulated on specialized blood vessels called HEVs, which are the entry portals from the circulation into the periphery and are usually present in secondary lymphoid organs (SLOs) and chronically inflamed tissue. Chronically inflamed tissues often develop lymphoid-like structures called TLOs that contain structures resembling SLOs including HEVs, lymphoid stromal cells, and confined compartments of T and B lymphocytes. As they can act as major gateways for immune cell migration into peripheral tissues, TLOs have been shown to be important in the pathogenesis of autoimmune disorders and cancer.

    [0216] Once within peripheral tissues, four modes of immune cell migration have been observed: 1) chemokinesis: migration driven by soluble chemokines, without concentration gradients to provide directional bias, 2) haptokinesis: migration along surfaces presenting immobilized ligands such as chemokines or integrins, without concentration gradients to provide directional bias, 3) chemotaxis: directional migration driven by concentration gradients of soluble chemokines, and 4) haptotaxis: directional migration along surfaces presenting gradients of immobilized ligands such as chemokines or integrins. The response of immune cells to trafficking molecules present on the endothelium depends on the composition, expression, and/or functional activity of their cognate receptors, which in turn depends on activation state and immune cell subtype.

    [0217] Innate immune cells generally migrate toward inflammation-induced trafficking molecules in the periphery. In contrast, naïve T and B cells constantly re-circulate between the blood and secondary lymphoid organs to screen for their cognate antigen presented by activated dendritic cells (DCs) or fibroblastic reticular cells (FRCs), respectively. If activated by recognition of their cognate antigen and appropriate co-stimulation within SLOs, both cell types undergo a series of complex maturation steps, including differentiation and proliferation, ultimately leading to effector and memory immune cell phenotypes. To reach their peripheral target sites, certain effector and memory T and B cell subsets egress from SLOs to the blood circulation via efferent lymphatics. In order to do so, they migrate toward a Sphingosine-1-phosphate (S1P) gradient sensed using their Sphingosine-1-phosphate receptor 1 (S1P.sub.1 or S1PR1). For successful egress into efferent lymphatics, immune cells need to overcome SLO retention signals through the CCR7/CCL21 axis or through CD69-mediated downregulation of S1P.sub.1.

    [0218] Finally, certain immune cell subsets, for example mature dendritic cells (DCs) and memory T cells, migrate from peripheral tissues into SLOs via afferent lymphatics. To exit from peripheral tissues and enter afferent lymphatics, immune cells again largely depend on the CCR7/CCL21 and S1P.sub.1/S1P axis. Specifically, immune cells need to overcome retention signals delivered via the CCR7/CCL21 axis, and migrate toward an S1P gradient established by the lymphatic endothelial cells using S1P.sub.1. The selective action of trafficking molecules on distinct immune cell subsets as well as the distinct spatial and temporal expression patterns of both the ligands and receptors are crucial for the fine-tuning of immune responses during homeostasis and disease.

    [0219] Aberrant immune cell migration is observed in multiple immune-related pathologies. Immune cell adhesion deficiencies, caused by molecular defects in integrin expression, fucosylation of selectin ligands, or inside-out activation of integrins on leukocytes and platelets, lead to impaired immune cell migration into peripheral tissues. This results in leukocytosis and in increased susceptibility to recurrent bacterial and fungal infections, which can be difficult to treat and potentially life-threatening. Alternatively, exaggerated migration of specific immune cell subsets into specific peripheral tissues is associated with a multitude of pathologies. For example, excessive neutrophil accumulation in peripheral tissues contributes to the development of ischemia-reperfusion injury, such as that observed during acute myocardial infarction, stroke, shock and acute respiratory distress syndrome. Excessive Th1 inflammation characterized by tissue infiltration of interferon-gamma secreting effector T cells and activated macrophages is associated with atherosclerosis, allograft rejection, hepatitis, and multiple autoimmune diseases including multiple sclerosis, rheumatoid arthritis, psoriasis, Crohn's disease, type 1 diabetes and lupus erythematodes. Excessive Th2 inflammation characterized by tissue infiltration of IL-4, IL-5, and IL-13 secreting Th2 cells, eosinophils and mast cells is associated with asthma, food allergies and atopic dermatitis.

    [0220] In the context of tumor biology, the balance between effector immune cell infiltrates eliminating tumor cells and suppressive immune cell infiltrates protecting tumor cells is critical in determining the net outcome of tumor development, namely elimination, equilibrium, or escape. The main anti-tumor immune cell subsets are NK cells, γδ T cells, Th1 CD4+ and cytotoxic CD8+ T cells (CTLs), mature dendritic cells (mDCs), and inflammatory macrophages (often referred to as M1 macrophages). The main pro-tumor immune cell subsets are suppressive tumor-associated macrophages (TAM, often referred to as M2 macrophages), myeloid-derived suppressor cells (MDSC), regulatory T cells (Treg), and immature dendritic cells (iDCs). While effector immune cells subsets are generally attracted to migrate into the tumor microenvironment via CXCR3 and its ligands CXCL9, CXCL10 and CXCL11, suppressive immune cell subsets depend on multiple sets of chemokine and chemokine receptors, including CCR2/CCL2, CCR5/CCL5, CXCR1/CXCL8 (IL8), CXCR2/CXCL5, and CXCR4/CXCL12. Accordingly, the upregulation of CXCL9 and CXCL10 within the tumor generally correlates with good prognosis, and upregulation of suppressive chemokines correlates with bad prognosis of cancer patients.

    [0221] Specific chemokine pathways not only increase the infiltration of immunosuppressive immune cell subsets, but also promote tumor angiogenesis and metastasis and are thus interesting targets for the development of anti-cancer therapies. Inducing T cell migration into tumors might be especially beneficial in the context of cancer immunotherapy, as a T-cell inflamed microenvironment correlates with good response to these types of interventions.

    [0222] Finally, tumor-draining lymph nodes (tdLNs) are essential gateways for the induction of adaptive immune responses against tumor cells. However, even though tdLNs are exposed to antigens shed by the upstream tumor cells, they often contain more immunosuppressive cytokines and cells than a non-involved lymph node. This is because a multitude of immunosuppressive molecules are secreted by the upstream tumor microenvironment, thus influencing the immune status of the downstream lymph node. Therefore, strategies that could alter immune cell migration into the tumor-draining lymph node could shift the balance between suppressive and effector immune cells in favor of the latter, thus unleashing potent anti-tumor immune responses.

    [0223] In some embodiments, an α6*nAChR inhibitor described herein decreases one or more of Treg migration, Treg proliferation, Treg recruitment, Treg tumor homing, Treg activation, Treg polarization, Treg cytokine production (e.g., Treg production of anti-inflammatory cytokines, e.g., Treg production of IL-10 and/or TGFβ), Treg α6*nAChR activity, or Treg nAChRα6 expression (e.g., gene or protein expression). In some embodiments, an α6*nAChR inhibitor described herein increases Treg tumor egress.

    [0224] In some embodiments, the effect of the α6*nAChR inhibitor on Tregs has a secondary effect on pro-inflammatory immune cells, such as CD8+ T cells, CD4+ T cells, NK cells, macrophages and dendritic cells. In some embodiments, the effect of the α6*nAChR inhibitor on Tregs leads to an increase in pro-inflammatory immune cell migration, proliferation, recruitment, tumor homing, activation, polarization, cytokine production, (e.g., production of pro-inflammatory cytokines, such as IFNγ), ADCC, or ADCP. In some embodiments, the effect of the α6*nAChR inhibitor on Tregs leads to a decrease in pro-inflammatory immune cell tumor egress.

    [0225] Immune Effects

    [0226] A variety of in vitro and in vivo assays can be used to determine how an α6*nAChR inhibitor affects an immune cell activity. The effect of an α6*nAChR inhibitor on T cell polarization in a subject can be assessed by evaluation of cell surface markers on T cells obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and T cells from the sample evaluated for one or more (e.g., 2, 3, or 4 or more) Th1-specific markers: T-bet, IL-12R, STAT4, or chemokine receptors CCR5, CXCR6, and CXCR3; or Th2-specific markers: CCR3, CXCR4, or IL-4Ra. T cell polarization can also be assessed using the same methods in an in vivo animal model. This assay can also be performed by adding an α6*nAChR inhibitor to T cells in vitro (e.g., T cells obtained from a subject, animal model, repository, or commercial source) and measuring the aforementioned markers to evaluate T cell polarization. These markers can be assessed using flow cytometry, immunohistochemistry, in situ hybridization, and other assays that allow for measurement of cellular markers. Comparing results from before and after administration of an α6*nAChR inhibitor can be used to determine its effect.

    [0227] The effect of an α6*nAChR inhibitor on T cell activation in a subject can be assessed by evaluation of cellular markers on T cells obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and T cells from the sample evaluated for one or more (e.g., 2, 3, 4 or more) activation markers: CD25, CD71, CD26, CD27, CD28, CD30, CD154, CD40L, CD134, CD69, CD62L or CD44. T cell activation can also be assessed using the same methods in an in vivo animal model. This assay can also be performed by adding an α6*nAChR inhibitor to T cells in vitro (e.g., T cells obtained from a subject, animal model, repository, or commercial source) and measuring the aforementioned markers to evaluate T cell activation. Similar approaches can be used to assess the effect of an α6*nAChR inhibitor on activation of other immune cells, such as eosinophils (markers: CD35, CD11b, CD66, CD69 and CD81), dendritic cells (makers: IL-8, MHC class II, CD40, CD80, CD83, and CD86), basophils (CD63, CD13, CD4, and CD203c), and neutrophils (CD11b, CD35, CD66b and CD63). These markers can be assessed using flow cytometry, immunohistochemistry, in situ hybridization, and other assays that allow for measurement of cellular markers. Comparing results from before and after administration of an α6*nAChR inhibitor can be used to determine its effect.

    [0228] The effect of an α6*nAChR inhibitor on immune cell activation can also be assessed through measurement of secreted cytokines and chemokines. An activated immune cell (e.g., T cell, B cell, macrophage, monocyte, dendritic cell, eosinophil, basophil, mast cell, NK cell, or neutrophil) can produce pro-inflammatory cytokines and chemokines (e.g., IL-1β, IL-5, IL-6, IL-8, IL-10, IL-12, IL-13, IL-18, TNFα, and IFN-γ). Activation can be assessed by measuring cytokine levels in a blood sample, lymph node biopsy, or tissue sample from a human subject or animal model, with higher levels of pro-inflammatory cytokines following treatment with an α6*nAChR inhibitor indicating increased activation, and lower levels indicating decreased activation. Activation can also be assessed in vitro by measuring cytokines secreted into the media by cultured cells. Cytokines can be measured using ELISA, western blot analysis, and other approaches for quantifying secreted proteins. Comparing results from before and after administration of an α6*nAChR inhibitor can be used to determine its effect.

    [0229] The effect of an α6*nAChR inhibitor on T cell proliferation in a subject can be assessed by evaluation of markers of proliferation in T cells obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and T cells from the sample evaluated for Ki67 marker expression. T cell proliferation can also be assessed using the same methods in an in vivo animal model. This assay can also be performed by adding an α6*nAChR inhibitor to T cells in vitro (e.g., T cells obtained from a subject, animal model, repository, or commercial source) and measuring Ki67 to evaluate T cell proliferation. Assessing whether an α6*nAChR inhibitor induces T cell proliferation can also be performed by in vivo (e.g., in a human subject or animal model) by collecting blood samples before and after α6*nAChR inhibitor administration and comparing T cell numbers, and in vitro by quantifying T cell numbers before and after contacting T cells with an α6*nAChR inhibitor. These approaches can also be used to measure the effect of an α6*nAChR inhibitor on proliferation of any immune cell (e.g., B cells, T cells, macrophages, monocytes, dendritic cells, NK cells, mast cells, eosinophils, basophils, and neutrophils). Ki67 can be assessed using flow cytometry, immunohistochemistry, in situ hybridization, and other assays that allow for measurement of nuclear markers. Comparing results from before and after administration of an α6*nAChR inhibitor can be used to determine its effect.

    [0230] The effect of an α6*nAChR inhibitor on cytotoxic T cell activation in a subject can be assessed by evaluation of T cell granule markers in T cells obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and T cells from the sample evaluated for granzyme or perforin expression. Cytotoxic T cell activation can also be assessed using the same methods in an in vivo animal model. This assay can also be performed by adding an α6*nAChR inhibitor to cytotoxic T cells in vitro (e.g., cytotoxic T cells obtained from a subject, animal model, repository, or commercial source) and measuring the aforementioned markers to evaluate T cell proliferation. These markers can be detected in the media from cytotoxic T cell cultures. Techniques including ELISA, western blot analysis can be used to detect granzyme and perforin in conditioned media, flow cytometry, immunohistochemistry, in situ hybridization, and other assays can detect intracellular granzyme and perforin and their synthesis. Comparing results from before and after administration of an α6*nAChR inhibitor can be used to determine its effect.

    [0231] The effect of an α6*nAChR inhibitor on circulating monocytes in a subject can be assessed by evaluation of cell surface markers on primary blood mononuclear cells obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and monocytes from the sample evaluated for CD14 and/or CD16 expression. Circulating monocytes can also be assessed using the same methods in an in vivo animal model. This assay can be performed by taking a blood sample before treatment with an α6*nAChR inhibitor and comparing it to a blood sample taken after treatment. CD14 and CD16 can be detected using flow cytometry, immunohistochemistry, western blot analysis, or any other technique that can measure cell surface protein levels. Comparing results from before and after administration of an α6*nAChR inhibitor can be used to determine its effect. This assay can be used to detect the number of monocytes in the bloodstream or to determine whether monocytes have adopted a CD14+/CD16+ phenotype, which indicates a pro-inflammatory function.

    [0232] The effect of an α6*nAChR inhibitor on peripheral blood hematopoietic stem cells in a subject can be assessed by evaluation of cell surface markers on primary blood mononuclear cells obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and stem cells from the sample evaluated for one or more (2, 3 or 4 or more) specific markers: CD34, c-kit, Sca-1, or Thy1.1. Peripheral blood hematopoietic stem cells can also be assessed using the same methods in an in vivo animal model. This assay can be performed by taking a blood sample before treatment with an α6*nAChR inhibitor and comparing it to a blood sample taken after treatment. The aforementioned markers can be detected using flow cytometry, immunohistochemistry, western blot analysis, or any other technique that can measure cell surface protein levels. Comparing results from before and after administration of an α6*nAChR inhibitor can be used to determine its effect. This assay can be used to detect the number of stem cells mobilized into the bloodstream or to determine whether treatment induces differentiation into a particular hematopoietic lineage (e.g., decreased CD34 and increased GPA indicates differentiation into red blood cells, decreased CD34 and increased CD14 indicates differentiation into monocytes, decreased CD34 and increased CD11 b or CD68 indicates differentiation into macrophages, decreased CD34 and increased CD42b indicates differentiation into platelets, decreased CD34 and increased CD3 indicates differentiation into T cells, decreased CD34 and increased CD19 indicates differentiation into B cells, decreased CD34 and increased CD25 or CD69 indicates differentiation into activated T cells, decreased CD34 and increased CD1c, CD83, CD141, CD209, or MHC II indicates differentiation into dendritic cells, decreased CD34 and increased CD56 indicates differentiation into NK cells, decreased CD34 and increased CD15 indicates differentiation into neutrophils, decreased CD34 and increased 2D7 antigen, CD123, or CD203c indicates differentiation into basophils, and decreased CD34 and increased CD193, EMR1, or Siglec-8 indicates differentiation into eosinophils.

    [0233] The effect of an α6*nAChR inhibitor on macrophage polarization in a subject can be assessed by evaluation of cellular markers in macrophages cells obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and macrophages from the sample evaluated for one of more (2, 3 or 4 or more) specific markers. Markers for M1 polarization include IL-12, TNF, IL-1β, IL-6, IL-23, MARCO, MHC-II, CD86, iNOS, CXCL9, and CXCL10. Markers for M2 polarized macrophages include IL-10, IL1-RA, TGFβ, MR, CD163, DC-SIGN, Dectin-1, HO-1, arginase (Arg-1), CCL17, CCL22 and CCL24. Macrophage polarization can also be assessed using the same methods in an in vivo animal model. This assay can also be performed on cultured macrophages obtained from a subject, an animal model, repository, or commercial source to determine how contacting a macrophage with an α6*nAChR inhibitor affects polarization. The aforementioned markers can be evaluated by comparing measurements obtained before and after administration of an α6*nAChR inhibitor to a subject, animal model, or cultured cell. Surface markers or intracellular proteins (e.g., MHC-11, CD86, iNOS, CD163, Dectin-1, HO-1, Arg-1, etc.) can be measured using flow cytometry, immunohistochemistry, in situ hybridization, or western blot analysis, and secreted proteins (e.g., IL-12, TNF, IL-1β, IL-10, TGFβ, IL1-RA, chemokines CXC8, CXC9, CCL17, CCL22, and CCL24, etc.) can be measured using the same methods or by ELISA or western blot analysis of culture media or blood samples. Comparing results from before and after administration of an α6*nAChR inhibitor can be used to determine its effect.

    [0234] The effect of an α6*nAChR inhibitor on macrophage phagocytosis in a subject can be assessed by culturing macrophages obtained from the subject with fluorescent beads. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and macrophages from the sample evaluated for engulfment of fluorescent beads. This assay can also be performed on cultured macrophages obtained from an animal model, repository, or commercial source to determine how contacting a macrophage with an α6*nAChR inhibitor affects phagocytosis. The same phagocytosis assay can be used to evaluate the effect of an α6*nAChR inhibitor on phagocytosis in other immune cells (e.g., neutrophils, monocytes, mast cells, B cells, eosinophils, or dendritic cells). Comparing results from before and after administration of an α6*nAChR inhibitor can be used to determine its effect on phagocytosis.

    [0235] In some embodiments, phagocytosis is ADCP. ADCP can be assessed using similar methods to those described above by incubating immune cells (e.g., macrophages, neutrophils, monocytes, mast cells, B cells, eosinophils, or dendritic cells) isolated from a blood sample, lymph node biopsy, or tissue sample with fluorescent beads coated with IgG antibodies. In some embodiments, immune cells are incubated with a target cell line that has been pre-coated with antibodies to a surface antigen expressed by the target cell line. ADCP can be evaluated by measuring fluorescence inside the immune cell or quantifying the number of beads or cells engulfed. This assay can also be performed on cultured immune cells obtained from an animal model, repository, or commercial source to determine how contacting an immune cell with an α6*nAChR inhibitor affects ADCP. The ability of an immune cell to perform ADCP can also be evaluated by assessing expression of certain Fc receptors (e.g., FcγRIIa, FcγRIIIa, and FcγRI). Fc receptor expression can be assessed using flow cytometry, immunohistochemistry, in situ hybridization, or other assays that allow for measurement of cell surface markers. Comparing phagocytosis or Fc receptor expression before and after administration of an α6*nAChR inhibitor can be used to determine its effect on ACDP.

    [0236] The effect of an α6*nAChR inhibitor on macrophage activation in a subject can be assessed by evaluation of cell surface markers on macrophages cells obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and macrophages from the sample evaluated for one or more (e.g., 1, 2, 3 or 4 or more) specific markers: F4/80, HLA molecules (e.g., MHC-II), CD80, CD68, CD11b, or CD86. Macrophage activation can also be assessed using the same methods in an in vivo animal model. This assay can also be performed by adding an α6*nAChR inhibitor to macrophages in vitro (e.g., macrophages obtained from a subject, animal model, repository, or commercial source) and measuring the aforementioned markers to evaluate macrophage activation. These markers can be assessed using flow cytometry, immunohistochemistry, in situ hybridization, and other assays that allow for measurement of cell surface markers. As mentioned above, macrophage activation can also be evaluated based on cytokine production (e.g., pro-inflammatory cytokine production) as measured by ELISA and western blot analysis. Comparing results from before and after administration of an α6*nAChR inhibitor can be used to determine its effect.

    [0237] The effect of an α6*nAChR inhibitor on antigen presentation in a subject can be assessed by evaluation of cell surface markers on antigen presenting cells (e.g., dendritic cells, macrophages, and B cells) obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and antigen presenting cells (e.g., dendritic cells, macrophages, and B cells) from the sample evaluated for one or more (e.g., 2, 3 or 4 or more) specific markers: CD11c, CD11b, HLA molecules (e.g., MHC-II), CD40, B7, IL-2, CD80 or CD86. Antigen presentation can also be assessed using the same methods in an in vivo animal model. This assay can also be performed by adding an α6*nAChR inhibitor to antigen presenting cells (e.g., dendritic cells) in vitro (e.g., antigen presenting cells obtained from a subject, animal model, repository, or commercial source) and measuring the aforementioned markers to evaluate antigen presentation. These markers can be assessed using flow cytometry, immunohistochemistry, in situ hybridization, and other assays that allow for measurement of cell surface markers. Comparing results from before and after administration of an α6*nAChR inhibitor can be used to determine its effect.

    [0238] The effect of an α6*nAChR inhibitor on antigen presenting cell migration in a subject can be assessed by evaluation of cell surface markers on antigen presenting cells (e.g., dendritic cells, B cells, and macrophages) obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and antigen presenting cells (e.g., dendritic cells, B cells, and macrophages) from the sample evaluated for CCR7 expression. Antigen presenting cell migration can also be assessed using the same methods in an in vivo animal model. This assay can also be performed by adding an α6*nAChR inhibitor to antigen presenting cells (e.g., dendritic cells, B cells, and macrophages) in vitro (e.g., antigen presenting cells obtained from a subject, animal model, repository, or commercial source) and measuring CCR7 to evaluate antigen presenting cell migration. CCR7 can be assessed using flow cytometry, immunohistochemistry, in situ hybridization, and other assays that allow for measurement of cell surface markers. Comparing results from before and after administration of an α6*nAChR inhibitor can be used to determine its effect.

    [0239] The effect of an α6*nAChR inhibitor on lymph node immune cell homing and cell egress in a subject can be assessed by evaluation of cell surface markers on T or B cells obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and T or B cells from the sample evaluated for one or more specific markers: CCR7 or S1PR1. Lymph node immune cell homing and cell egress can also be assessed using the same methods in an in vivo animal model. This assay can also be performed by adding an α6*nAChR inhibitor to T or B cells in vitro (e.g., T or B cells obtained from a subject, animal model, repository, or commercial source) and measuring the aforementioned markers to evaluate T or B cell lymph node homing. These markers can also be used to assess lymph node homing and cell egress of dendritic cells and macrophages. CCR7 and S1PR1 can be assessed using flow cytometry, immunohistochemistry, in situ hybridization, and other assays that allow for measurement of cell surface markers. If using an animal model, lymph nodes or sites of inflammation can be imaged in vivo (e.g., using a mouse that expresses fluorescently labeled T or B cells) or after biopsy to determine whether T or B cell numbers change as a result of administration of an α6*nAChR inhibitor. Comparing results from before and after administration of an α6*nAChR inhibitor can be used to determine its effect.

    [0240] In some embodiments, an α6*nAChR inhibitor increases homing or decreases egress of naïve T cells into or out of secondary lymphoid organs prior to antigen challenge (e.g., prior to administration of a vaccine) to generate a better antigen-specific response. In some embodiments, an α6*nAChR inhibitor decreases homing or increases egress of inflammatory immune cells (e.g., neutrophils) into or out of peripheral tissues during injury to prevent conditions such as ischemia-reperfusion disorders.

    [0241] The effect of an α6*nAChR inhibitor on NK cell activation in a subject can be assessed by evaluation of cell surface markers on NK cells obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and NK cells from the sample evaluated for one or more (e.g., 2, 3 or 4 or more) specific markers: CD117, NKp46, CD94, CD56, CD16, KIR, CD69, HLA-DR, CD38, KLRG1, and TIA-1. NK cell activation can also be assessed using the same methods in an in vivo animal model. This assay can also be performed by adding an α6*nAChR inhibitor to NK cells in vitro (e.g., NK cells obtained from a subject, animal model, repository, or commercial source) and measuring the aforementioned markers to evaluate NK cell activation. The effect of an α6*nAChR inhibitor can be determined by comparing results from before and after α6*nAChR inhibitor administration.

    [0242] In some embodiments, activated NK cells have increased lytic function or are cytotoxic (e.g., capable of performing ADCC). The effect of an α6*nAChR inhibitor on ADCC can be assessed by incubating immune cells capable of ADCC (e.g., NK cells, monocytes, macrophages, neutrophils, eosinophils, dendritic cells, or T cells) with a target cell line that has been pre-coated with antibodies to a surface antigen expressed by the target cell line. ADCC can be assessed by measuring the number of surviving target cells with a fluorescent viability stain or by measuring the secretion of cytolytic granules (e.g., perforin, granzymes, or other cytolytic proteins released from immune cells). Immune cells can be collected from a blood sample, lymph node biopsy, or tissue sample from a human subject or animal model treated with an α6*nAChR inhibitor. This assay can also be performed by adding an α6*nAChR inhibitor to immune cells in vitro (e.g., immune cells obtained from a subject, animal model, repository, or commercial source). The effect of an α6*nAChR inhibitor on ADCC can be determined by comparing results from before and after α6*nAChR inhibitor administration.

    [0243] The effect of an α6*nAChR inhibitor on mast cell degranulation in a subject can be assessed by evaluation of markers in mast cells obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and mast cells from the sample evaluated for one or more (e.g., 1, 2, 3 or 4 or more) specific markers: IgE, histamine, IL-4, TNFα, CD300a, tryptase, or MMP9. Mast cell degranulation can also be assessed using the same methods in an in vivo animal model. This assay can also be performed by adding an α6*nAChR inhibitor to mast cells in vitro (e.g., mast cells obtained from a subject, animal model, repository, or commercial source) and measuring the aforementioned markers to evaluate mast cell degranulation. Some of these markers (e.g., histamine, TNFα, and IL-4) can be detected by measuring levels in the mast cell culture medium after mast cells are contacted with an α6*nAChR inhibitor. The effect of an α6*nAChR inhibitor can be determined by comparing results from before and after α6*nAChR inhibitor administration. This approach can also be used to evaluate the effect of an α6*nAChR inhibitor on degranulation by other cells, such as neutrophils (markers: CD11 b, CD13, CD18, CD45, CD15, CD66b IL-1β, IL-8, and IL-6), eosinophils (markers: major basic protein (MBP), eosinophil cationic protein (ECP), eosinophil peroxidase (EPX), eosinophil-derived neurotoxin (EDN)), basophils (markers: histamine, heparin, chondroitin, elastase, lysophospholipase, and LTD-4), NK cells (markers: LAMP-1, perforin, and granzymes), and cytotoxic T cells (markers: LAMP-1, perforin, and granzymes). Markers can be detected using flow cytometry, immunohistochemistry, ELISA, western blot analysis, or in situ hybridization.

    [0244] The effect of an α6*nAChR inhibitor on neutrophil recruitment in a subject can be assessed by evaluation of cell surface markers on neutrophils obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and neutrophils from the sample evaluated for one or more (e.g., 1, 2, 3 or 4 or more) specific markers: CD11 b, CD14, CD114, CD177, CD354, or CD66. To determine whether neutrophils are being recruited to a specific site (e.g., a tumor), the same markers can be measured in a tumor biopsy. Neutrophil recruitment can also be assessed using the same methods in an in vivo animal model. This assay can also be performed by adding an α6*nAChR inhibitor to neutrophils in vitro (e.g., neutrophils obtained from a subject, animal model, repository, or commercial source) and measuring the aforementioned markers to evaluate neutrophil recruitment. These markers can be assessed using flow cytometry, immunohistochemistry, in situ hybridization, and other assays that allow for measurement of cell surface markers. The effect of an α6*nAChR inhibitor can be determined by comparing results from before and after α6*nAChR inhibitor administration.

    [0245] The effect of an α6*nAChR inhibitor on eosinophil recruitment in a subject can be assessed by evaluation of cell surface markers on eosinophil obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and eosinophils from the sample evaluated for one or more (e.g., 1, 2, 3 or 4 or more) specific markers: CD15, IL-3R, CD38, CD106, CD294 or CD85G. To determine whether eosinophils are being recruited to a specific site (e.g., a tumor), the same markers can be measured in a tumor biopsy. Eosinophil recruitment can also be assessed using the same methods in an in vivo animal model. This assay can also be performed by adding an α6*nAChR inhibitor to eosinophils in vitro (e.g., eosinophils obtained from a subject, animal model, repository, or commercial source) and measuring the aforementioned markers to evaluate eosinophil recruitment. These markers can be assessed using flow cytometry, immunohistochemistry, in situ hybridization, and other assays that allow for measurement of cell surface markers. The effect of an α6*nAChR inhibitor can be determined by comparing results from before and after α6*nAChR inhibitor administration.

    [0246] The effect of an α6*nAChR inhibitor on NKT cell activation in a subject can be assessed by evaluation of cell surface markers on NKT cells obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and NKT cells from the sample evaluated for one or more specific markers: CD272 or CD352. Activated NKT cells produce IFN-γ, IL-4, GM-CSF, IL-2, IL-13, IL-17, IL-21 and TNFα. NKT cell activation can also be assessed using the same methods in an in vivo animal model. This assay can also be performed by adding an α6*nAChR inhibitor to NKT cells in vitro (e.g., NKT cells obtained from a subject, animal model, repository, or commercial source) and measuring the aforementioned markers to evaluate NKT cell activation. Cell surface markers CD272 and CD352 can be assessed using flow cytometry, immunohistochemistry, in situ hybridization, and other assays that allow for measurement of cell surface markers. The secreted proteins can be detected in blood samples or cell culture media using ELISA, western blot analysis, or other methods for detecting proteins in solution. The effect of an α6*nAChR inhibitor can be determined by comparing results from before and after α6*nAChR inhibitor administration.

    [0247] The effects of an α6*nAChR inhibitor on B cell activation in a subject can be assessed by evaluation of cell surface markers on B cells obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and B cells from the sample evaluated for one or more (e.g., 2, 3 or 4 or more) specific markers: CD19, CD20, CD40, CD80, CD86, CD69, IgM, IgD, IgG, IgE, or IgA. B cell activation can also be assessed using the same methods in an in vivo animal model. This assay can also be performed by adding an α6*nAChR inhibitor to B cells in vitro (e.g., B cells obtained from a subject, animal model, repository, or commercial source) and measuring the aforementioned markers to evaluate B cell activation. These markers can be assessed using flow cytometry, immunohistochemistry, in situ hybridization, and other assays that allow for measurement of cell surface markers. The effect of an α6*nAChR inhibitor can be determined by comparing results from before and after α6*nAChR inhibitor administration.

    [0248] The effect of an α6*nAChR inhibitor on regulatory T cell differentiation in a subject can be assessed by evaluation of markers in regulatory T cells obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and regulatory T cells from the sample evaluated for one or more (e.g., 1, 2, 3, 4 or more) specific markers: CD4, CD25, or FoxP3. Regulatory T cell differentiation can also be assessed using the same methods in an in vivo animal model. This assay can also be performed by adding an α6*nAChR inhibitor to regulatory T cells in vitro (e.g., regulatory T cells obtained from a subject, animal model, repository, or commercial source) and measuring the aforementioned markers to evaluate regulatory T cell differentiation. These markers can be assessed using flow cytometry, immunohistochemistry, in situ hybridization, and other assays that allow for measurement of cellular markers. The effect of an α6*nAChR inhibitor can be determined by comparing results from before and after α6*nAChR inhibitor administration.

    [0249] The effect of an α6*nAChR inhibitor on innervation of a lymph node or secondary lymphoid organ can be assessed by evaluation of neuronal markers in a lymph node or secondary lymphoid organ biopsy sample obtained from a human subject or animal model. A biopsy can be collected from the subject and evaluated for one or more (e.g., 1, 2, 3, 4, or 4 or more) neuronal markers selected from: Neurofilament, synapsin, synaptotagmin, or neuron specific enolase. Lymph node innervation can also be assessed using electrophysiological approaches (e.g., recording neuronal activity in a lymph node or secondary lymphoid organ in a human subject or animal model). The effect of an α6*nAChR inhibitor can be determined by comparing results from before and after α6*nAChR inhibitor administration.

    [0250] The α6*nAChR inhibitor can also reduce the number of nerve fibers in the affected tissue or reduce the activity of peripheral nerve fibers in the affected tissue. For example, the method includes administering to the subject (e.g., a human subject or animal model) an α6*nAChR inhibitor in an amount and for a time sufficient to reduce the number of nerve fibers in the affected tissue or reduce the activity of peripheral nerve fibers in the affected tissue. The affected tissue can be a lymph node, a lymphoid organ, a tumor, a tumor micro-environment, or the bone marrow niche. The number of nerve fibers in the affected tissue or the activity of peripheral nerve fibers in the affected tissue can be decreased in the subject at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, compared to before the administration. The number of nerve fibers in the affected tissue or the activity of peripheral nerve fibers in the affected tissue can be decreased in the subject between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%.

    [0251] The α6*nAChR inhibitor can also increase the number of nerve fibers in the affected tissue or increase the activity of peripheral nerve fibers in the affected tissue. For example, the method includes administering to the subject (e.g., a human subject or animal model) an α6*nAChR inhibitor in an amount and for a time sufficient to increase the number of nerve fibers in the affected tissue or increase the activity of peripheral nerve fibers in the affected tissue. The affected tissue can be a lymph node, a lymphoid organ, a tumor, a tumor micro-environment, or the bone marrow niche. The number of nerve fibers in the affected tissue or the activity of peripheral nerve fibers in the affected tissue can be increased in the subject at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80% or more, compared to before the administration. The number of nerve fibers in the affected tissue or the activity of peripheral nerve fibers in the affected tissue can be increased in the subject between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%.

    [0252] The nerve fibers that are modulated can be part of the peripheral nervous system, e.g., a somatic nerve, an autonomic nerve, a sensory nerve, a cranial nerve, an optic nerve, an olfactory nerve, a sympathetic nerve, a parasympathetic nerve, a chemoreceptor, a photoreceptor, a mechanoreceptor, a thermoreceptor, a nociceptor, an efferent nerve fiber, or an afferent nerve fiber.

    [0253] The effect of an α6*nAChR inhibitor on immune cell cytokine production can be assessed by evaluation of cellular markers in an immune cell sample obtained from a human subject or animal model. A blood sample, lymph node biopsy, or tissue sample can be collected for the subject and evaluated for one or more (e.g., 1, 2, 3, 4, or 4 or more) cytokine markers selected from: pro-inflammatory cytokines (e.g., IL-1β, IL-5, IL-6, IL-8, IL-10, IL-12, IL-13, IL-18, TNFα, IFNγ, GMCSF), pro-survival cytokines (e.g., IL-2, IL-4, IL-6, IL-7, and IL-15) and anti-inflammatory cytokines (e.g., IL-4, IL-10, IL-11, IL-13, IFNα, and TGFβ). Some cytokines can function as both pro- and anti-inflammatory cytokines depending on context or indication (e.g., IL-4 is often categorized as an anti-inflammatory cytokine, but plays a pro-inflammatory role in mounting an allergic or anti-parasitic immune response). Cytokines can be also detected in the culture media of immune cells contacted with an α6*nAChR inhibitor. Cytokines can be detected using ELISA, western blot analysis, or other methods for detecting protein levels in solution. The effect of an α6*nAChR inhibitor can be determined by comparing results from before and after α6*nAChR inhibitor administration.

    [0254] In some embodiments, an α6*nAChR inhibitor decreases or prevents the development of TLOs to decrease local inflammation in autoimmune diseases. TLOs are highly similar to SLOs and exhibit T and B cell compartmentalization, APCs such as DCs and follicular DCs, stromal cells, and a highly organized vascular system of high endothelial venules. In some embodiments, an α6*nAChR inhibitor decreases or prevents the development of HEVs within tertiary lymphoid organs to decrease local inflammation in autoimmune diseases. HEVs can be detected using the monoclonal antibody MECA-79.

    [0255] In some embodiments, an α6*nAChR inhibitor modulates dendritic cell maturation (e.g., activation). Dendritic cell maturation can be increased to promote their migration from peripheral tissues into secondary lymphoid organs to improve T cell activation in the draining lymph node (e.g., to increase vaccine efficacy or to increase priming of an anti-tumor immune response). Dendritic cell maturation can be decreased to decrease their migration from peripheral tissues into secondary lymphoid organs to inhibit T cell activation in the draining lymph node (e.g., to improve outcomes in organ transplantation or to reduce the severity of or treat autoimmune diseases).

    [0256] The effect of an α6*nAChR inhibitor on immune cell recruitment or migration to a tumor can be assessed by evaluation of cellular markers on immune cells obtained from a human subject or animal model. A blood sample or tumor biopsy can be collected from a human subject or animal model and T cells, B cells, dendritic cells, or macrophages can be evaluated for marker CCR7. Immune cell recruitment to a tumor can also be assessed by taking a tumor biopsy before and after administration of an α6*nAChR inhibitor to a human subject or animal model and quantifying the number of immune cells in the tumor. Immune cells can be identified based on the markers described above and others listed in Table 2. A bulk gene expression signature can also be deconvolved into signatures indicative of specific immune cell types using published algorithms, such as the CIBERSORT algorithm described in Gentles et al, Nature Medicine 21:938 2015. Mouse models of cancer that express fluorescent reporters in immune cells can also be used for live imaging-based approaches to evaluate the effect of an α6*nAChR inhibitor on immune cell migration or recruitment to a tumor. Immune cell recruitment or migration to a tumor can also be assessed by adding an α6*nAChR inhibitor to immune cells in vitro (e.g., immune cells obtained from a subject, animal model, repository, or commercial source) and measuring CCR7 to evaluate immune cell migration or recruitment. The effect of an α6*nAChR inhibitor can be determined by comparing results from before and after α6*nAChR inhibitor administration.

    [0257] In some embodiments, an α6*nAChR inhibitor increases homing or decreases egress of naïve T cells into or out of secondary lymphoid organs prior to inducing immunogenic tumor cell death to generate a better anti-tumor response (e.g., prior to radio- or chemotherapy). In some embodiments, an α6*nAChR inhibitor increases homing or decreases egress of immune cells into or out of the tumor microenvironment to turn a “cold tumor” into a “hot tumor” prior to immunotherapy. In some embodiments, an α6*nAChR inhibitor increases homing or decreases egress of effector immune cell subsets into or out of the tumor microenvironment to promote anti-tumor immunity. In some embodiments, an α6*nAChR inhibitor decreases homing or increases egress of immunosuppressive immune subsets into or out of the tumor microenvironment to promote anti-tumor immunity. In some embodiments, an α6*nAChR inhibitor induces or increases the development of HEVs within the tumor microenvironment to increase TIL recruitment. HEVs can be detected using the monoclonal antibody MECA-79. In some embodiments, the α6*nAChR inhibitor induces or increases the development of TLOs within the tumor microenvironment to increase TIL recruitment. TLOs can be recognized by their similarity to SLOs, as they exhibit T and B cell compartmentalization, APCs such as DCs and follicular DCs, stromal cells, and a highly organized vascular system of HEVs.

    [0258] The effect of an α6*nAChR inhibitor on NK cell lytic function can be assessed by evaluation of cellular markers on NK cells obtained from a human subject or animal model. A blood sample or tumor biopsy can be collected from a human subject or animal model and NK cells can be evaluated for one or more (e.g., 1, 2, 3 or more) of the markers: CD95L, CSD154, and CD253. NK cell lytic function can also be assessed using the same methods in an in vivo animal model. This assay can also be performed by adding an α6*nAChR inhibitor to NK cells in vitro (e.g., NK cells obtained from a subject, animal model, repository, or commercial source) and measuring the aforementioned markers to evaluate NK cell activation. These markers can be assessed using flow cytometry, immunohistochemistry, in situ hybridization, and other assays that allow for measurement of cell surface markers. The effect of an α6*nAChR inhibitor can be determined by comparing results from before and after α6*nAChR inhibitor administration.

    [0259] Table 2 lists additional markers and relevant assays that may be used to assess the level, function and/or activity of immune cells in the methods described herein.

    TABLE-US-00002 TABLE 2 ASSESSMENT OF IMMUNE CELL PHENOTYPES ASSOCIATED IMMUNE CELL CYTOKINES MARKER ASSAYS Th1 helper IFN-γ CD4 ELISPOT IL-2 CD94 In situ hybridization IL-12 CD119 Immunohistochemistry IL-18 (IFNγ R1) Limiting dilution Analysis IL-27 CD183 Single-cell PCR TNFα (CXCR3) In vivo capture assay TNFβ/LTα CD186 ELISA (CXCR6) Flow cytometry CD191 (CCR1) CD195 (CCR5) CD212 (IL- 12Rβ1&2) CD254 (RANKL) CD278 (ICOS) IL-18R MRP1 NOTCH3 TCR TIM3 Th2 helper IL-4 CD4 ELISPOT IL-2 CD30 In situ hybridization IL-6 CD119 Immunohistochemistry IL-33 (IFNγ R1) Limiting dilution IL-17E CD184 Analysis (IL-25) (CXCR4) Single-cell PCR IL-31 CD185 In vivo capture IL-3 (CXCR5) assay IL-10 CD193 ELISA IL-13 (CCR3) Flow cytometry CD194 (CCR4) CD197 (CCR7) CD278 (ICOS) CD294 (CRTh2) CDw198 (CCR8) IL-17RB IL-33Rα (ST2) NOTCH1 NOTCH2 TCR TIM1 Th17 helper TGFβ1 CD4 ELISPOT IL-1β CD27 In situ hybridization IL-6 CD62L Immunohistochemis IL-21 CD127 try IL-23 (IL-7R) Limiting dilution IL-17A CD161 Analysis IL-17F CD184 Single-cell PCR IL-22 (CXCR4) In vivo capture IL-26 CD194 assay GM-CSF (CCR4) ELISA MIP-3α CD196 Flow cytometry TNFα (CCR6) CD197 (CCR7) CD212b1 (IL-12Rβ1) CD213a1 (IL-13Rα1) CD278 (ICOS) IL-1R1 IL-21R IL-23R Treg TGFβ1 CD4 ELISPOT IL-2 CD25 In situ hybridization IL-10 CD39 Immunohistochemistry IL-35 CD73 Limiting dilution CD45RO Analysis CD121a Single-cell PCR (IL-1R1) In vivo capture CD121b assay (IL-1R2) ELISA CD127low Flow cytometry CD134 (OX40) CD137 (4-1BB) CD152 (CTLA-4) CD357 (GITR/AITR) Foxp3 FR4(m) GARP (activated) Helios LAP/TGFβ (activated) TIGIT Dendritic cell GM-CSF CD1a ELISPOT IFNγ CD8 In situ hybridization IL-4 CD11c Immunohistochemistry GM-CSF CD80 Limiting dilution IFNα CD83 Analysis IL-1α CD85 (ILT) family Single-cell PCR IL-1β CD86 In vivo capture IL-6 CD141 (h) assay IL-8 CD169 ELISA IL-10 CD172 Flow cytometry IL-12 CD184 (CXCR4) IL-15 CD197 (CCR7) IL-18 CD205 IL-23 CD206 IL-27 CD207 IP-10 CD209 M-CSF CD215 (IL-15R) RANTES (CCL5) CD282 (TLR2) TGFβ CD284 (TLR4) TNFα CD286 (TLR6) Clec Family Macrophages/ FLT3 Ligand CD11b ELISPOT Monocytes GM-CSF CD14 (mono) In situ hybridization M-CSF CD16 Immunohistochemistry CXCL9 CD32 Limiting dilution CXCL10 CD68 Analysis CXCL11 CD85a (ILT5) Single-cell PCR G-CSF CD163 In vivo capture GM-CSF CD169 assay IFNβ CD195 (CCR5) ELISA IL-1α CD204 Flow cytometry IL-1β CD206 IL-6 CD282 (TLR2) IL-8 CD284 (TLR4) IL-10 CD286 (TLR6) IL-12p40 & p70 CD354 (Trem-1) IL-18 Clec Family IL-23 F4/80 (m) IL-27 HLA-DR M-CSF MIP-2α (CXCL2) RANTES (CCL5) TNFα Natural Killer Cell IL-2 CD16 ELISPOT IL-12 CD25 In situ hybridization IL-15/IL-15R CD49b Immunohistochemistry IL-18 CD56 (h) Limiting dilution Granzyme B CD94 Analysis IL-17A CD158 family (KIR) Single-cell PCR IL-22 (h) In vivo capture MIP-1α (CCL3) CD181 (CXCR1) assay MIP-1β (CCL4) CD183 (CXCR3) ELISA Perforin CD184 (CXCR4) Flow cytometry RANTES (CCL5) CD186 (CXCR6) TNFα CD192 (activated) CD195 (CCR5) CD197 (CCR7) CD212 (IL-12R) CD244 CD314 (NKG2D) CX3CR1 Eomes KLRG1 Ly49 family (m) NK1.1 NKG2A NKp30, NKp42 NKp44(h) NKp46 T-bet Innate Lymphoid IFN-γ CD335 (NKp46) ELISPOT Cell 1 (ILC1) TNF CD336 (NKp44) In situ hybridization CD94 Immunohistochemistry CD56 (NCAM) Limiting dilution CD103 Analysis T-bet Single-cell PCR In vivo capture assay ELISA Flow cytometry Innate Lymphoid Areg CD127 ELISPOT Cell 2 (ILC2) IL-5 CRTH2 In situ hybridization IL-13 ST2 (IL-33R) Immunohistochemistry RORα Limiting dilution GATA3 Analysis Single-cell PCR In vivo capture assay ELISA Flow cytometry Innate Lymphoid CCL3 CD127 ELISPOT Cell 3 (ILC3) LTs CD117 (c-kit) In situ hybridization IL-22 CD335 (NKp46) Immunohistochemistry IL-17 CD336 (NKp44) Limiting dilution IFN-γ IL-23R Analysis RORγt Single-cell PCR In vivo capture assay ELISA Flow cytometry Activated B Antibodies CD19 Flow cytometry cell/Plasma cells IgM CD25 IgG CD30 IgD IgM IgE CD19 IgA IgG CD27 CD38 CD78 CD138 CD319

    TABLE-US-00003 TABLE 3 EXAMPLES OF HUMAN CHEMOKINES Alternate Human Systematic Human human receptor(s) and Known name gene names Expression their expression functions C Family XCL1 XCL1 Lymphotactin, activated CD8+ T XCR1: cross-presenting migration and SCM-1 alpha, cells and other drendritic cells activation of ATAC MHCI restricted T lymphocytes, cells NK cells XCL2 XCL2 SCM-1 beta expressed in XCR1: cross-presenting migration and activated T cells drendritic cells activation of lymphocytes, NK cells CX3C Family CX3CL1 CX3CL1 Fractalkine, brain, heart, lung, CX3CR1: lymphocytes, migration and Neurotactin, kidney, skeletal monocytes adhesion of ABCD-3 muscle and testis. lymphocytes Up-regulated in and monocytes endothelial cells and microglia by inflammation CC Family CCL1 CCL1 I-309 activated T cells CCR8: natural killer migration of cells, monocytes and monocytes, NK lymphocytes cells, immature DARC: erytrocytes, B cells and endothelial and epithelial DCs cells CCL2 CCL2 MCP-1, monocytes, CCR2: monocytes migration of MCAF, HC11 macrophages and CCR4: lymphocytes monocytes and dendritic cells, CCR11: unkown basophils activated NK cells D6: lymphocytes, lymphatic endothelial cells, macrophages DARC: erytrocytes, endothelial and epithelial cells CCL3 CCL3 MIP-1 alpha, T cells, B cells, and CCR1: lymphocytes, adhesion of LD78 alpha, monocytes after monocytes, airway lymphocytes GOS19, antigen or mitogen smooth muscle cells Pat464 stimulation CCR4: lymphocytes CCR5: T cells, macrophages, dendritic cells, eosinophils and microglia D6: lymphocytes, lymphatic endothelial cells, macrophages CCL3L1 CCL3L1 LD78 beta Unknown CCR1: lymphocytes, migration of monocytes, airway lymphocytes smooth muscle cells and monocytes CCR3: eosinophils, basophils, Th2 cells, CD34+ hematopoetic progenitors, keratinocytes, mast cells CCR5: T cells, macrophages, dendritic cells, eosinophils and microglia D6: lymphocytes, lymphatic endothelial cells, macrophages CCL3L3 CCL3L3 LD78 beta Unknown CCR1: lymphocytes, migration of monocytes, airway lymphocytes smooth muscle cells and monocytes CCR3: eosinophils, basophils, Th2 cells, CD34+ hematopoetic progenitors, keratinocytes, mast cells CCR5: T cells, macrophages, dendritic cells, eosinophils and microglia CCL4 CCL4 MIP-1 beta, macrophages, CCR1: lymphocytes, migration and AT744.1, dendritic cells monocytes, airway adhesion of ACT-2, G-26, smooth muscle cells lymphocytes, HC21, H400, CCR5: T cells, regulatory T MAD-5, LAG- macrophages, dendritic cells, NK cells, 1 cells, eosinophils and monocyrtes microglia CCR8: natural killer cells, monocytes and lymphocytes D6: lymphocytes, lymphatic endothelial cells, macrophages CCL4L1 CCL4L1 AT744.2 macrophages, CCR1: lymphocytes, CCR1 and dendritic cells monocytes, airway CCR5 smooth muscle cells expressing CCR5: T cells, cells macrophages, dendritic cells, eosinophils and microglia CCL4L2 CCL4L2 macrophages, CCR1: lymphocytes, CCR1 and dendritic cells monocytes, airway CCR5 smooth muscle cells expressing CCR5: T cells, cells macrophages, dendritic cells, eosinophils and microglia CCL5 CCL5 RANTES T cells, CCR1: lymphocytes, migration of macrophages, monocytes, airway monocytes, platelets, synovial smooth muscle cells memory T fibroblasts, tubular CCR3: eosinophils, helper cells and epithelium, certain basophils, Th2 cells, eosinophils, types of tumor cells CD34+ hematopoetic causes the progenitors, release of keratinocytes, mast cells histamine from CCR4: lymphocytes basophils and CCR5: T cells, activates macrophages, dendritic eosinophils cells, eosinophils and microglia D6: lymphocytes, lymphatic endothelial cells, macrophages DARC: erytrocytes, endothelial and epithelial cells CCL7 CCL7 MCP-3 macrophages, CCR1: lymphocytes, migration of certain types of monocytes, airway monocytes, tumor cells smooth muscle cells activation of CCR2: monocytes macrophages CCR3: eosinophils, basophils, Th2 cells, CD34+ hematopoetic progenitors, keratinocytes, mast cells D6: lymphocytes, lymphatic endothelial cells, macrophages DARC: erytrocytes, endothelial and epithelial cells CCL8 CCL8 MCP-2, HC14 fibroblasts, CCR1: lymphocytes, migration of endothelial cells monocytes, airway monocytes, smooth muscle cells lymphocytes, CCR2: monocytes basophils and CCR3: eosinophils, eosinophils basophils, Th2 cells, CD34+ hematopoetic progenitors, keratinocytes, mast cells CCR5: T cells, macrophages, dendritic cells, eosinophils and microglia CCR11: unkown D6: lymphocytes, lymphatic endothelial cells, macrophages DARC: erytrocytes, endothelial and epithelial cells CCL11 CCL11 Eotaxin lung epithelial cells, CCR3: eosinophils, migration and pleural mesothelial basophils, Th2 cells, activation of cells, bronchial CD34+ hematopoetic inflammatory airway epithelial progenitors, leukocytes, cells, smooth keratinocytes, mast cells particularly muscle cells CCR5: T cells, eosinophils macrophages, dendritic cells, eosinophils and microglia D6: lymphocytes, lymphatic endothelial cells, macrophages DARC: erytrocytes, endothelial and epithelial cells CCL12 stromal cells in lung CCR2: monocytes migration and and secondary activation of lymphoid organs monocytes CCL13 CCL13 MCP-4, CK synovial fibroblasts, CCR1: lymphocytes, migration of beta 10, chondrocytes monocytes, airway eosinophils, NCC-1 smooth muscle cells monocytes and CCR2: monocytes T lymphocytes CCR3: eosinophils, basophils, Th2 cells, CD34+ hematopoetic progenitors, keratinocytes, mast cells CCR5: T cells, macrophages, dendritic cells, eosinophils and microglia CCR11: unkown D6: lymphocytes, lymphatic endothelial cells, macrophages DARC: erytrocytes, endothelial and epithelial cells CCL14 CCL14 HCC-1, spleen, bone CCR1: lymphocytes, activation of MCIF, CK marrow, liver, monocytes, airway monocytes beta 1, NCC- muscle and gut smooth muscle cells 2 CCR3: eosinophils, basophils, Th2 cells, CD34+ hematopoetic progenitors, keratinocytes, mast cells CCR5: T cells, macrophages, dendritic cells, eosinophils and microglia D6: lymphocytes, lymphatic endothelial cells, macrophages DARC: erytrocytes, endothelial and epithelial cells CCL15 CCL15 MIP-1 delta, airway smooth CCR1: lymphocytes, migration of LKN-1, HCC- muscle cells, lung monocytes, airway monocytes and 2, MIP-5, leukocytes, alveolar smooth muscle cells eosinophils, NCC-3 macrophages, CCR3: eosinophils, proliferation of basophils basophils, Th2 cells, CD34 myeloid CD34+ hematopoetic progenitor cells progenitors, keratinocytes, mast cells CCL16 CCL16 HCC-4, LEC, liver, thymus, and CCR1: lymphocytes, migration of ILINCK, spleen monocytes, airway lymphocytes NCC-4, LMC, smooth muscle cells and monocytes CK beta 12 CCR2: monocytes CCR5: T cells, macrophages, dendritic cells, eosinophils and microglia CCR8: natural killer cells, monocytes and lymphocytes DARC: erytrocytes, endothelial and epithelial cells H4: bone marrow, eosinophils, T-cells, dendritic cells, monocytes, mast cells, neutrophil CCL17 CCL17 TARC, constitutively CCR4: lymphocytes Migration and ABCD-2 expressed in CCR8: natural killer activation of T thymus, dendritic cells, monocytes and cells cells, keratinocytes lymphocytes D6: lymphocytes, lymphatic endothelial cells, macrophages DARC: erytrocytes, endothelial and epithelial cells CCL18 CCL18 PARC, DC- dendritic cells, CCR8: natural killer migration of CK1, AMAC- monocytes, and cells, monocytes and naive and 1, CK beta 7, macrophages lymphocytes regulatory MIP-4 PITPNM3: breast cancer lymphocytes, cells dendritic cells DARC: erytrocytes, endothelial and epithelial cells CCL19 CCL19 MlP-3 beta, fibroblastic reticular CCR7: lymphocytes migration of ELC, Exodus- cells, dendritic cells (mainly naive and naive and 3, CK beta 11 memory), mature memory dendritic cells lymphocytes CCR11: unkown and mature CCRL2: neutrophils, dendritic cells monocytes CCL20 CCL20 MIP-3 alpha, epidermis CCR6: immature migration of LARC, (keratinocytes), dendritic cells and lymphocytes, Exodus-1, lymphocytes memory T cells DCs and ST38, CK neutrophils beta 4 CCL21 CCL21 6Ckine, Stromal cells, CCR7: lymphocytes migration of Exodus-2, lymphatic (mainly naive and lymphocytes SLC, TCA-4, endothelial cells, memory), mature homing to CK beta 9 fibroblastic reticular dendritic cells secondary cells, dendritic cells CCR11: unkown lymphoid organs, induces integrin- mediated lymphocyte adhesion CCL22 CCL22 MDC Macrophages CCR4: lymphocytes migration of NK D6: lymphocytes, cells, lymphatic endothelial chronically cells, macrophages activated T cells, monocytes and DCs CCL23 CCL23 MPIF-1, CK Monocytes CCR1: lymphocytes, migration of beta 8, CK monocytes monocytes, beta 8-1, FPRL-1: monocytes, resting T cells MIP-3 mast cells and neutrophils CCL24 CCL24 Eotaxin-2, lung tissue CCR3: eosinophils, migration of MPIF-2, CK basophils, Th2 cells, basophils beta 6 CD34+ hematopoetic progenitors, keratinocytes, mast cells CCL25 CCL25 TECK, CK thymic dendritic cells CCR9: T lymphocytes of migration of beta 15 and mucosal small intestine dendritic cells, epithelial cells thymocytes and activated macrophages CCL26 CCL26 Eotaxin-3, heart, lung and CCR3: eosinophils, migration of MIP-4 alpha, ovary and in basophils, Th2 cells, eosinophils and IMAC, TSC-1 endothelial cells CD34+ hematopoetic basophils stimulated with IL4 progenitors, keratinocytes, mast cells CX3CR1: lymphocytes, monocytes CCL27 CCL27 CTACK, ILC, Keratinocytes CCR10: melanocytes, migration of PESKY, plasma cells and skin- memory T cells ESKINE homing T cells CCL28 CCL28 MEC columnar epithelial CCR3: eosinophils, migration of cells in the gut, lung, basophils, Th2 T cells, lymphocytes breast and the CD34+ hematopoetic and eosinophils salivary glands progenitors, keratinocytes, mast cells CCR10: melanocytes, plasma cells and skin- homing T cells CXC Family CXCL1 CXCL1 GRO alpha, mammary, CXCR2 (IL8RB): migration of MGSA, fibroblasts, neutrophils neutrophils GRO1, NAP- mammary epithelial DARC: erytrocytes, 3 cells, endothelial endothelial and epithelial cells, activated, cells monocytes, macrophages and neutrophils CXCL2 CXCL2 GRO beta, monocytes, CXCR2 (IL8RB): migration and MIP-2 alpha, macrophages neutrophils activation of GRO2 DARC: erytrocytes, neutrophils, endothelial and epithelial basophils, cells hematopoietic stem cells CXCL3 CXCL3 GRO gamma, smooth muscle CXCR2 (IL8RB): migration and MIP-2 beta, cells, epithelial cells neutrophils activation of GRO3 DARC: erytrocytes, neutrophils endothelial and epithelial cells CXCL4 PF4 PF4 activated platelets, CXCR3 (CD183b):T migration of megakaryocytes, cells, NK cells neutrophils and leukocytes, CXCR3-B: T cells, NK fibroblasts, endothelial cells cells inhibiting DARC: erytrocytes, endothelial cell endothelial and epithelial proliferation cells and chemotaxis CXCL4L1 PF4V1 PF4V1 smooth muscle CXCR3 (CD183b): T inhibiting cells, T cells, and cells, NK cells endothelial cell platelets CXCR3-B: T cells, NK proliferation cells and chemotaxis CXCL5 CXCL5 ENA-78 fibroblasts, epithelial CXCR2 (IL8RB): migration and cells, eosinophils neutrophils activation of DARC: erytrocytes, neutrophils endothelial and epithelial cells CXCL6 CXCL6 GCP-2 fibroblasts, epithelial CXCR1 (IL8RA): migration of cells neutrophils neutrophils CXCR2 (IL8RB): neutrophils DARC: erytrocytes, endothelial and epithelial cells CXCL7 PPBP NAP-2, activated platelets CXCR1 (IL8RA): migration of CTAPIII, neutrophils neutrophils beta-TG CXCR2 (IL8RB): neutrophils CXCL8 IL8 IL-8, NAP-1, macrophages, CXCR1 (IL8RA): migration of MDNCF, epithelial cells, neutrophils neutrophils, GCP-1 airway smooth CXCR2 (IL8RB): basophils, and muscle cells, neutrophils T-cells, and endothelial cells DARC: erytrocytes, angiogenic endothelial and epithelial factor cells CXCL9 CXCL9 MIG, CRG-10 monocytes, CXCR3 (CD183b): T migration of macrophages and cells, NK cells Th1 endothelial cells CXCR3-B: T cells, NK lymphocytes, cells angiogenic DARC: erytrocytes, factor endothelial and epithelial cells CXCL10 CXCL10 IP-10 neutrophils, CXCR3 (CD183b):T migration of hepatocytes, cells, NK cells CD4+ T cells endothelial cells and CXCR3-B: T cells, NK keratinocytes cells DARC: erytrocytes, endothelial and epithelial cells CXCL11 CXCL11 I-TAC, beta- peripheral blood CXCR3 (CD183b): T migration of R1, H174, IP- leukocytes, cells, NK cells interleukin- 9 pancreas and liver CXCR7 (ACKR3): tumor activated T astrocytes and at cells and tumor- cells but not moderate levels in associated blood unstimulated T thymus, spleen and endothelium cells, lung DARC: erytrocytes, neutrophils or endothelial and epithelial monocytes. cells CXCL12 CXCL12 SDF-1, PBSF ubiquitously CXCR4: brain, heart, migration of expressed in many lymphocytes, HSCs, lymphocytes tissues and cell blood endothelial cells and types and umbilical cord hepatopoietic endothelial cell stem cells, CXCR7 (ACKR3): tumor angiogenic cells and tumor- factor associated blood endothelium CXCL13 CXCL13 BCA-1, BLC follicles of the CXCR3 (CD183b): T migration of B spleen, lymph cells, NK cells cells nodes, and Peyer's CXCR5: Burkitt's patches lymphoma, lymph node follicules, spleen DARC: erytrocytes, endothelial and epithelial cells CXCL14 CXCL14 BRAK, BMAC Fibroblasts unknown migration of monocytes, NK cells, DCs CXCL16 CXCL16 SR-PSOX DCs CXCR6: T cells migration of several subsets of T cells and NKT cells CXCL17 CXCL17 DMC, VCC-1 Lung and tumor unknown migration of tissue DCs and monocytes

    TABLE-US-00004 TABLE 4 EXAMPLES OF HUMAN IMMUNE CELL TRAFFICKING MOLECULES Trafficking molecule Trafficking expressing or Function in the extravasation molecule presenting cells Leukocyte ligand cascade P-selectin Blood endothelial cell PSGL-1, L-selectin, Tethering/Rolling during CD44 extravasation cascade E-selectin Blood endothelial cell Glycoprotein, Tethering/Rolling during glycolipid, PSGL-1 extravasation cascade PNAd Blood endothelial cell L-selectin Tethering/Rolling during extravasation cascade MAdCAM Blood endothelial cell L-selectin, integrins Tethering/Rolling, arrest during extravasation cascade VCAM-1 Blood endothelial cell Integrins (e.g. VLA- Tethering/Rolling, arrest during 4) extravasation cascade Chemokines Blood endothelial cell GPCRs Integrin activation, allowing binding of cell adhesion molecules and arrest ICAM-1 Blood endothelial cell Integrins (e.g. LFA- Arrest during extravasation cascade 1, Mac-1) ICAM-2 Blood endothelial cell Integrins (e.g. LFA- Arrest during extravasation cascade 1, Mac-1) PECAM1 Blood endothelial cell Integrins (e.g. alpha Transmigration (CD31) v beta 3), PECAM1 JAM-A/-B/-C Blood endothelial cell Integrins (e.g. LFA- Transmigration 1, Mac-1, VLA-4) ESAM Blood endothelial cell unknown Transmigration CD99 Blood endothelial cell CD99 Transmigration CD99L2 Blood endothelial cell possibly CD99L Transmigration VE-cadherin Blood endothelial cell None Transmigration PVR Blood endothelial cell DNAM1 Transmigration S1P Lymphatic S1P receptor 1 Entry into afferent and efferent endothelial cell (S1P1) lymphatics (in peripheral or SLOs respectively)

    [0260] Cancer

    [0261] The methods described herein can be used to treat cancer in a subject by administering to the subject an effective amount of an α6*nAChR inhibitor, e.g., an α6*nAChR inhibitor described herein. The method may include administering locally (e.g., intratumorally) to the subject an α6*nAChR inhibitor described herein in a dose (e.g., effective amount) and for a time sufficient to treat the cancer.

    [0262] The methods described herein can also be used to potentiate or increase an immune response in a subject in need thereof, e.g., an anti-tumor immune response. For example, the subject has cancer, such as a cancer described herein. The methods described herein can also include a step of selecting a subject in need of potentiating an immune response, e.g., selecting a subject who has cancer or is at risk of developing cancer.

    [0263] The α6*nAChR inhibitor may inhibit proliferation or disrupt the function of non-neural cells that promote cancer growth that are associated with the cancer, e.g., the method includes administering to the subject an effective amount of an α6*nAChR inhibitor for a time sufficient to inhibit proliferation or disrupt the function of non-neural cells that promote cancer growth that are associated with the cancer. Non-neural cells that promote cancer growth that are associated with the cancer include malignant cancer cells, malignant cancer cells in necrotic and hypoxic areas, M2 macrophages, tumor associated macrophages, T regulatory cells, myeloid derived suppressor cells, adipocytes, B10 cells, Breg cells, endothelial cells, cancer associated fibroblasts, fibroblasts, mesenchymal stem cells, red blood cells, or extracellular matrix. The proliferation of non-neural cells that promote cancer growth that are associated with the cancer may be decreased in the subject at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, compared to before the administration. The proliferation of non-neural cells that promote cancer growth that are associated with the cancer can be decreased in the subject between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%.

    [0264] The α6*nAChR inhibitor may promote proliferation or enhance the function of non-neural cells that disrupt cancer growth that are associated with the cancer, e.g., the method includes administering to the subject an effective amount of an α6*nAChR inhibitor for a time sufficient to promote proliferation or enhance the function of non-neural cells that disrupt cancer growth that are associated with the cancer. Non-neural cells that disrupt cancer growth that are associated with the cancer include Natural Killer cells, Natural Killer T cells, M1 macrophages, TH1 helper cells, TH2 helper cells, CD8 cytotoxic T cells, TH17 cells, tumor associated neutrophils, terminally differentiated myeloid dendritic cells, T lymphocytes, B lymphocytes, lymphatic endothelial cells, pericytes, dendritic cells, mesenchymal stem cells, red blood cells, or extracellular matrix. The proliferation of non-neural cells that disrupt cancer growth that are associated with the cancer may be increased in the subject at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, compared to before the administration. The proliferation of non-neural cells that disrupt cancer growth that are associated with the cancer can be increased in the subject between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%.

    [0265] The α6*nAChR inhibitor can be administered in an amount sufficient to treat cancer. For example, the stroma associated with the tumor, e.g., fibroblasts, is disrupted such that an essential function, e.g., the production of matrix metalloproteases, is altered to inhibit tumor survival or promote tumor control.

    [0266] The α6*nAChR inhibitor can have one or more of the following activities: (a) inhibits an immune checkpoint, (b) activates anti-tumor immune response, (c) activate tumor-specific T cells from draining lymph nodes, and/or (d) stimulates a neoantigen-specific immune response. The activity can be modulated as appropriate in the subject (e.g., a human subject or animal model) at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, compared to before the administration. The activity can be modulated as appropriate in the subject between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%.

    [0267] The α6*nAChR inhibitor can treat cancer by increasing cancer cell death in a subject (e.g., a human subject or animal model) or in a cancer cell culture (e.g., a culture generated from a patient tumor sample, a cancer cell line, or a repository of patient samples). an α6*nAChR inhibitor can increase cancer cell death by at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more compared to before administration to a subject or cancer cell culture. an α6*nAChR inhibitor can increase cancer cell death in a subject or cancer cell culture between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%.

    [0268] The α6*nAChR inhibitor can also act to inhibit cancer cell growth, proliferation, metastasis, migration, or invasion, e.g., the method includes administering to the subject (e.g., a human subject or animal model) or a cancer cell culture (e.g., a culture generated from a patient tumor sample, a cancer cell line, or a repository of patient samples) an α6*nAChR inhibitor in an amount (e.g., an effective amount) and for a time sufficient to inhibit cancer cell growth, proliferation, metastasis, migration, or invasion. Cancer cell growth, proliferation, metastasis, migration, or invasion can be decreased in the subject or cancer cell culture at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, compared to before the administration Cancer cell growth, proliferation, metastasis, migration, or invasion can be decreased in the subject or cancer cell culture between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%.

    [0269] The α6*nAChR inhibitor can inhibit cancer cell invasion or metastasis along a nerve, e.g., the method includes administering to the subject (e.g., a human subject or animal model) an α6*nAChR inhibitor in an amount (e.g., an effective amount) and for a time sufficient to inhibit cancer cell invasion or metastasis along a nerve. The α6*nAChR inhibitor can decrease cancer cell invasion or metastasis along a nerve in the subject at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, compared to before the administration. The α6*nAChR inhibitor can decrease cancer cell invasion or metastasis along a nerve in the subject between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%.

    [0270] The α6*nAChR inhibitor can also reduce the number of nerve fibers in the affected tissue or reduce the activity of peripheral nerve fibers in the affected tissue. For example, the method includes administering to the subject (e.g., a human subject or animal model) an α6*nAChR inhibitor in an amount (e.g., an effective amount) and for a time sufficient to reduce the number of nerve fibers in the affected tissue or reduce the activity of peripheral nerve fibers in the affected tissue. The affected tissue can be a tumor, a tumor micro-environment, lymph node, a lymphoid organ, or the bone marrow niche. The number of nerve fibers in the affected tissue or the activity of peripheral nerve fibers in the affected tissue can be decreased in the subject at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, compared to before the administration. The number of nerve fibers in the affected tissue or the activity of peripheral nerve fibers in the affected tissue can be decreased in the subject between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%.

    [0271] The nerve fibers that are modulated can be part of the peripheral nervous system, e.g., a somatic nerve, an autonomic nerve, a sensory nerve, a cranial nerve, an optic nerve, an olfactory nerve, a sympathetic nerve, a parasympathetic nerve, a chemoreceptor, a photoreceptor, a mechanoreceptor, a thermoreceptor, a nociceptor, an efferent nerve fiber, or an afferent nerve fiber.

    [0272] Cancer Types

    [0273] In the methods described herein, the cancer or neoplasm may be any solid or liquid cancer and includes benign or malignant tumors, and hyperplasias, including gastrointestinal cancer (such as non-metastatic or metastatic colorectal cancer, pancreatic cancer, gastric cancer, esophageal cancer, hepatocellular cancer, cholangiocellular cancer, oral cancer, lip cancer); urogenital cancer (such as hormone sensitive or hormone refractory prostate cancer, renal cell cancer, bladder cancer, penile cancer); gynecological cancer (such as ovarian cancer, cervical cancer, endometrial cancer); lung cancer (such as small-cell lung cancer and non-small-cell lung cancer); head and neck cancer (e.g., head and neck squamous cell cancer); CNS cancer including malignant glioma, astrocytomas, retinoblastomas and brain metastases; malignant mesothelioma; non-metastatic or metastatic breast cancer (e.g., hormone refractory metastatic breast cancer); skin cancer (such as malignant melanoma, basal and squamous cell skin cancers, Merkel Cell Carcinoma, lymphoma of the skin, Kaposi Sarcoma); thyroid cancer; bone and soft tissue sarcoma; and hematologic neoplasias (such as multiple myeloma, acute myelogenous leukemia, chronic myelogenous leukemia, myelodysplastic syndrome, acute lymphoblastic leukemia, Hodgkin's lymphoma).

    [0274] Additional cancers that can be treated according to the methods described herein include breast cancer, lung cancer, stomach cancer, colon cancer, liver cancer, renal cancer, colorectal cancer, prostate cancer, pancreatic cancer, cervical cancer, anal cancer, vulvar cancer, penile cancer, vaginal cancer, testicular cancer, pelvic cancer, thyroid cancer, uterine cancer, rectal cancer, brain cancer, head and neck cancer, esophageal cancer, bronchus cancer, gallbladder cancer, ovarian cancer, bladder cancer, oral cancer, oropharyngeal cancer, larynx cancer, biliary tract cancer, skin cancer, a cancer of the central nervous system, a cancer of the respiratory system, and a cancer of the urinary system. Examples of breast cancers include, but are not limited to, triple-negative breast cancer, triple-positive breast cancer, HER2-negative breast cancer, HER2-positive breast cancer, estrogen receptor-positive breast cancer, estrogen receptor-negative breast cancer, progesterone receptor-positive breast cancer, progesterone receptor-negative breast cancer, ductal carcinoma in situ (DCIS), invasive ductal carcinoma, invasive lobular carcinoma, inflammatory breast cancer, Paget disease of the nipple, and phyllodes tumor.

    [0275] Other cancers that can be treated according to the methods described herein include leukemia (e.g., B-cell leukemia, T-cell leukemia, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphocytic (lymphoblastic) leukemia (ALL), chronic lymphocytic leukemia (CLL), and erythroleukemia), sarcoma (e.g., angiosarcoma, chondrosarcoma, Ewing's sarcoma, fibrosarcoma, gastrointestinal stromal tumor, leiomyosarcoma, liposarcoma, malignant peripheral nerve sheath tumor, malignant fibrous cytoma, osteosarcoma, pleomorphic sarcoma, rhabdomyosarcoma, synovial sarcoma, vascular sarcoma, Kaposi's sarcoma, dermatofibrosarcoma, epithelioid sarcoma, leyomyosarcoma, and neurofibrosarcoma), carcinoma (e.g., basal cell carcinoma, large cell carcinoma, small cell carcinoma, non-small cell lung carcinoma, renal carcinoma, hepatocarcinoma, gastric carcinoma, choriocarcinoma, adenocarcinoma, hepatocellular carcinoma, giant (or oat) cell carcinoma, squamous cell carcinoma, adenosquamous carcinoma, anaplastmic carcinoma, adrenocortical carcinoma, cholangiocarcinoma, Merkel cell carcinoma, ductal carcinoma in situ (DCIS), and invasive ductal carcinoma), blastoma (e.g., hepatoblastoma, medulloblastoma, nephroblastoma, neuroblastoma, pancreatoblastoma, pleuropulmonary blastoma, retinoblastoma, and glioblastoma multiforme), lymphoma (e.g., Hodgkin's lymphoma, non-Hodgkin's lymphoma, and Burkitt lymphoma), myeloma (e.g., multiple myeloma, plasmacytoma, localized myeloma, and extramedullary myeloma), melanoma (e.g., superficial spreading melanoma, nodular melanoma, lentigno maligna melanoma, acral lentiginous melanoma, and amelanotic melanoma), neuroma (e.g., ganglioneuroma, Pacinian neuroma, and acoustic neuroma), glioma (e.g., astrocytoma, oligoastrocytoma, ependymoma, brainstem glioma, optic nerve glioma, and oligoastrocytoma), pheochromocytoma, meningioma, malignant mesothelioma, and virally induced cancer.

    [0276] In some embodiments, the cancer is a paraneoplastic cancer (e.g., a cancer that causes a paraneoplastic syndrome). Paraneoplastic syndromes are rare disorders that are triggered by an altered immune system response to a neoplasm, and are mediated by humoral factors such as hormones, cytokines, or auto-antibodies produced by the tumor. Symptoms of paraneoplastic syndrome may be endocrine, neuromuscular, or musculoskeletal, cardiovascular, cutaneous, hematologic, gastrointestinal, renal, or neurological. Paraneoplastic syndromes commonly present with lung, breast, and ovarian cancer and cancer of the lymphatic system (e.g., lymphoma). Paraneoplastic neurological disorders are disorders that affect the central or peripheral nervous system, and can include symptoms such as ataxia (difficulty with walking and balance), dizziness, nystagmus (rapid uncontrolled eye movements), difficulty swallowing, loss of muscle tone, loss of fine motor coordination, slurred speech memory loss, vision problems, sleep disturbances, dementia, seizures, or sensory loss in the limbs. Breast, ovarian, and lung cancers are most commonly associated with paraneoplastic neurological disorders. Other common types of paraneoplastic syndromes include paraneoplastic cerebellar degeneration, paraneoplastic pemphigus, paraneoplastic autonomic neuropathy, paraneoplastic encephalomyelitis, and cancer-associated autoimmune retinopathy.

    [0277] Endocrine paraneoplastic syndromes include Cushing syndrome (caused by ectopic ACTH), which is most commonly caused by small cell lung cancer, pancreatic carcinoma, neural tumors, or thymoma; SIADH (caused by antidiuretic hormone), which is most commonly caused by small cell lung cancer and CNS malignancies; hypercalcemia (caused by PTHrp, TGFα, TNF, or IL-1), which is most commonly caused by lung cancer, breast carcinoma, renal and bladder carcinoma, multiple myeloma, adult T cell leukemia/lymphoma, ovarian carcinoma, and squamous cell carcinoma (e.g., lung, head, neck, or esophagus carcinoma); hyperglycemia (caused by insulin insulin-like substance, or “big” IGF-II), which is most commonly caused by fibrosarcoma, mesenchymal sarcomas, insulinoma, and hepatocellular carcinoma; carcinoid syndrome (caused by serotonin or bradykinin), which is most commonly caused by bronchial adenoma, pancreatic carcinoma, and gastric carcinoma; and hyperaldosteronism (caused by aldosterone), which is most commonly caused by adrenal adenoma/Conn's syndrome, non-Hodgkin's lymphoma, ovarian carcinoma, and pulmonary cancer.

    [0278] Neurological paraneoplastic syndromes include Lambert-Eaton myasthenic syndrome (LEMS), which is most commonly caused by small cell lung cancer; paraneoplastic cerebellar degeneration, which is most commonly caused by lung cancer, ovarian cancer, breast carcinoma, and Hodgkin's lymphoma; encephalomyelitis; limbic encephalitis, which is most commonly caused by small cell lung carcinoma; myasthenia gravis, which is most commonly caused by thymoma; brainstem encephalitis; opsoclonus myoclonus ataxia (caused by autoimmune reaction against Nova-1), which is most commonly caused by breast carcinoma, ovarian carcinoma, small cell lung carcinoma, and neuroblastoma; anti-NMDA receptor encephalitis (caused by autoimmune reaction against NMDAR subunits), which is most commonly caused by teratoma; and polymyositis, which is most commonly caused by lung cancer, bladder cancer, and non-Hodgkin's lymphoma. Mucotaneous paraneoplastic syndromes include acanthosis nigricans, which is most commonly caused by gastric carcinoma, lung carcinoma, and uterine carcinoma; dermatomyositis, which is most commonly caused by bronchogenic carcinoma, breast carcinoma, ovarian cancer, pancreatic cancer, stomach cancer, colorectal cancer, and Non-Hodgkin's lymphoma; Leser-Trelat sign; necrolytic migratory erythema, which is most commonly caused by glucoganoma; Sweet's syndrome; florid cutaneous papillomatosis; pyoderma gangrenosum; and acquired generalized hypertrichosis.

    [0279] Hematological syndromes include granulocytosis (caused by G-CSF); polycythemia (caused by erythropoietin), which is commonly caused by renal carcinoma, cerebellar hemangioma, and heptatocellular carcinoma; Trousseau sign (caused by mucins), which is commonly caused by pancreatic carcinoma and bronchogenic carcinoma; nonbacterial thrombotic endocarditis, which is caused by advanced cancers; and anemia, which is most commonly caused by thymic neoplasms. Other paraneoplastic syndromes include membranous glomerular nephritis; neoplastic fever; Staffer syndrome, which is caused by renal cell carcinoma; and tumor-induced osteomalacia (caused by FGF23), which is caused by hemangiopericytoma and phosphaturic mesenchymal tumor.

    [0280] In some embodiments, a subject is identified as having cancer after presenting with symptoms of a paraneoplastic syndrome. A common symptom of paraneoplastic syndrome is fever. Auto-antibodies directed against nervous system proteins are also frequently observed in patients with paraneoplastic syndromes, including anti-Hu, anti-Yo, anti-Ri, anti-amphiphysin, anti-CV2, anti-Ma2, anti-recoverin, anti-transducin, anti-carbonic anhydrase II, anti-arrestin, anti-GCAP1, anti-GCAP2, anti-HSP27, anti-Rab6A, and anti-PNR. Other symptoms that can be used to identify a patient with paraneoplastic cancer include ataxia, dizziness, nystagmus, difficulty swallowing, loss of muscle tone, loss of fine motor coordination, slurred speech memory loss, vision loss, sleep disturbances, dementia, seizures, dysgeusia, cachexia, anemia, itching, or sensory loss in the limbs. In some embodiments, a patient presents with symptoms of paraneoplastic syndrome and is then identified as having cancer based on imaging tests (e.g., CT, MRI, or PET scans).

    [0281] The cancer may be innervated, metastatic, non-metastatic cancer, or benign (e.g., a benign tumor). The cancer may be a primary tumor or a metastasized tumor.

    [0282] In some embodiments, the cancer is an α6*nAChR-associated cancer (e.g., a cancer associated with expression of α6*nAChR in immune cells, e.g., Tregs).

    [0283] In some embodiments, the cancer is an immune cell-infiltrated cancer (e.g., a Treg infiltrated cancer). The immune cell-infiltrated cancer may be a “hot tumor” that contains T cells and expresses neoantigens. Cancers that are commonly considered “hot” include bladder cancer, head and neck cancer, kidney cancer, liver cancer, melanoma, non-small cell lung cancer, and microsatellite instability high cancer. The immune cell-infiltrated cancer may be a “cold tumor” that contains or is associated with suppressive immune cells, such as myeloid-derived suppressor cells and/or Tregs. Cancers that are immunologically “cold” typically do not respond to immunotherapy and include ovarian, prostate, and pancreatic cancer. A cancer in a subject can be identified as an immune cell-infiltrated cancer based on a biopsy, which can be evaluated for expression of immune cell markers (e.g., a marker listed in Table 2 and/or a marker described in Danaher et al., J Immunother Cancer 5:18, 2017) using standard methods, such as immunohistochemistry, flow cytometry, and expression profiling (e.g., RNAseq, microarray analysis, or a cancer immune profiling gene expression panel). In some embodiments, the cancer is a cancer that is treated with immunotherapy (e.g., melanoma, non-small cell lung cancer, kidney cancer, renal cell carcinoma, bladder cancer, head and neck cancer, Hodgkin's lymphoma, leukemia, urothelial carcinoma, gastric cancer, microsatellite instability-high cancer, colorectal cancer, or hepatocellular carcinoma). In some embodiments, the cancer is a cancer for which immunotherapy is not effective (e.g., a cancer that cannot be treated using immunotherapy, a cancer that did not respond to treatment with immunotherapy, or a cancer that only partially responded to treatment with immunotherapy).

    [0284] Subjects who can be treated with the methods disclosed herein include subjects who have had one or more tumors resected, received chemotherapy or other pharmacological treatment for the cancer, received radiation therapy, and/or received other therapy for the cancer. Subjects who can be treated with the methods disclosed herein include subjects who do not respond to immunotherapy. Subjects who have not previously been treated for cancer can also be treated with the methods disclosed herein.

    [0285] Combination Therapies

    [0286] A α6*nAChR inhibitor described herein can be administered in combination with a second therapeutic agent for treatment of cancer. In some embodiments, the second therapeutic agent is selected based on tumor type, tumor tissue of origin, tumor stage, or mutations in genes expressed by the tumor.

    [0287] Checkpoint Inhibitors

    [0288] One type of agent that can be administered in combination with an α6*nAChR inhibitor described herein is a checkpoint inhibitor. Checkpoint inhibitors can be broken down into at least 4 major categories: i) agents such as antibodies that block an inhibitory pathway directly on T cells or natural killer (NK) cells (e.g., PD-1 targeting antibodies such as nivolumab and pembrolizumab, antibodies targeting TIM-3, and antibodies targeting LAG-3, 2B4, CD160, A2aR, BTLA, CGEN-15049, or KIR), ii) agents such as antibodies that activate stimulatory pathways directly on T cells or NK cells (e.g., antibodies targeting OX40, GITR, or 4-1 BB), iii) agents such as antibodies that block a suppressive pathway on immune cells or rely on antibody-dependent cellular cytotoxicity to deplete suppressive populations of immune cells (e.g., CTLA-4 targeting antibodies such as ipilimumab, antibodies targeting VISTA, and antibodies targeting PD-L2, Gr1, or Ly6G), and iv) agents such as antibodies that block a suppressive pathway directly on cancer cells or that rely on antibody-dependent cellular cytotoxicity to enhance cytotoxicity to cancer cells (e.g., rituximab, antibodies targeting PD-L1, and antibodies targeting B7-H3, B7-H4, Gal-9, or MUC1). Such agents described herein can be designed and produced, e.g., by conventional methods known in the art (e.g., Templeton, Gene and Cell Therapy, 2015; Green and Sambrook, Molecular Cloning, 2012).

    [0289] Chemotherapy

    [0290] A second type of therapeutic agent that can be administered in combination with an α6*nAChR inhibitor described herein is a chemotherapeutic agent (e.g., a cytotoxic agent or other chemical compound useful in the treatment of cancer). These include alkylating agents, antimetabolites, folic acid analogs, pyrimidine analogs, purine analogs and related inhibitors, vinca alkaloids, epipodopyyllotoxins, antibiotics, L-asparaginase, topoisomerase inhibitors, interferons, platinum coordination complexes, anthracenedione substituted urea, methyl hydrazine derivatives, adrenocortical suppressant, adrenocorticosteroides, progestins, estrogens, antiestrogen, androgens, antiandrogen, and gonadotropin-releasing hormone analog. Also included is 5-fluorouracil (5-FU), leucovorin (LV), irenotecan, oxaliplatin, capecitabine, paclitaxel and doxetaxel. Non-limiting examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gammall and calicheamicin omegall; dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antibiotic chromophores), aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elfomithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; razoxane; rhizoxin; sizofuran; spirogermanium; tenuazonic acid; triaziquone; 2,2′,2″-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside (“Ara-C”); cyclophosphamide; thiotepa; taxoids, e.g., paclitaxel; chloranbucil; gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum coordination complexes such as cisplatin, oxaliplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (e.g., CPT-11); topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO); retinoids such as retinoic acid; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above. Two or more chemotherapeutic agents can be used in a cocktail to be administered in combination with the first therapeutic agent described herein. Suitable dosing regimens of combination chemotherapies are known in the art.

    [0291] Biologic Cancer Agents

    [0292] Another type of therapeutic agent that can be administered in combination with an α6*nAChR inhibitor described herein is a therapeutic agent that is a biologic such a cytokine (e.g., interferon or an interleukin (e.g., IL-2)) used in cancer treatment. In other embodiments the biologic is an anti-angiogenic agent, such as an anti-VEGF agent, e.g., bevacizumab. In some embodiments the biologic is an immunoglobulin-based biologic, e.g., a monoclonal antibody (e.g., a humanized antibody, a fully human antibody, an Fc fusion protein or a functional fragment thereof) that agonizes a target to stimulate an anti-cancer response, or antagonizes an antigen important for cancer. Such agents include Rituximab; Daclizumab; Basiliximab; Palivizumab; Infliximab; Trastuzumab; Gemtuzumab ozogamicin; Alemtuzumab; Ibritumomab tiuxetan; Adalimumab; Omalizumab; Tositumomab-I-131; Efalizumab; Cetuximab; Bevacizumab; Natalizumab; Tocilizumab; Panitumumab; Ranibizumab; Eculizumab; Certolizumab pegol; Golimumab; Canakinumab; Ustekinumab; Ofatumumab; Denosumab; Motavizumab; Raxibacumab; Belimumab; Ipilimumab; Brentuximab Vedotin; Pertuzumab; Ado-trastuzumab emtansine; and Obinutuzumab. Also included are antibody-drug conjugates. Examples of biologic cancer agents that can be used in combination with α6*nAChR inhibitors described herein are shown in Table 5 below.

    TABLE-US-00005 TABLE 5 APPROVED CANCER ANTIBODIES Antibody Company Antigen Indication ado-trastuzumab Genentech HER2 Metastatic breast cancer emtansine alemtuzumab Genzyme CD52 B-cell chronic lymphocytic leukemia atezolizumab Genentech PD-L1 Urothelial carcinoma Metastatic non-small cell lung cancer avelumab EMD Serono PD-L1 Metastatic Merkel cell carcinoma bevacizumab Genentech VEGF Metastatic colorectal cancer blinatumomab Amgen CD19 Precursor B-cell acute lymphoblastic leukemia brentuximab Seattle Genetics CD30 Hodgkin lymphoma vedotin Anaplastic large-cell lymphoma cetuximab ImClone Systems EGFR Metastatic colorectal carcinoma daratumumab Janssen Biotech CD38 Multiple myeloma dinutuximab United Therapeutics GD2 Pediatric high-risk neuroblastoma durvalumab AstraZeneca PD-L1 Urothelial carcinoma elotuzumab Bristol-Myers SLAMF7 Multiple myeloma Squibb ibritumomab Spectrum CD20 Relapsed or refractory low-grade, tiuxetan Pharmaceuticals follicular, or transformed B-cell non- Hodgkin's lymphoma ipilimumab Bristol-Myers CTLA-4 Metastatic melanoma Squibb necitumumab Eli Lilly EGFR Metastatic squamous non-small cell lung carcinoma nivolumab Bristol-Myers PD-1 Metastatic melanoma Squibb Metastatic squamous non-small cell lung carcinoma obinutuzumab Genentech CD20 Chronic lymphocytic leukemia ofatumumab Glaxo Grp CD20 Chronic lymphocytic leukemia olaratumab Eli Lilly PDGFRA Soft tissue sarcoma panitumumab Amgen EGFR Metastatic colorectal cancer pembrolizumab Merck PD-1 Metastatic melanoma pertuzumab Genentech HER2 Metastatic breast cancer ramucirumab Eli Lilly VEGFR2 Gastric cancer rituximab Genentech CD20 B-cell non-Hodgkin's lymphoma trastuzumab Genentech HER2 Metastatic breast cancer

    [0293] Cancer-Specific Agents

    [0294] In some embodiments, the therapeutic agents administered with the α6*nAChR inhibitors described herein are cancer-specific. Cancer-specific agents are agents that have been shown to be particularly effective against certain types of cancer. Cancer-specific agents that can be administered with the α6*nAChR inhibitors described herein are listed in Table 6 below.

    TABLE-US-00006 TABLE 6 CANCER-SPECIFIC AGENTS Cancer type Agents Pancreatic Chemotherapeutics (Paclitaxel Albumin-stabilized Nanoparticle Formulation, cancer Erlotinib Hydrochloride, Everolimus, Fluorouracil Injection, Gemcitabine Hydrochloride, Irinotecan Hydrochloride Liposome, Mitomycin C, Sunitinib Malate, Folfirinox, Gemcitabine-Cisplatin, Gemcitabine-Oxaliplatin, Off, Lanreotide Acetate, Abraxane, Gemcitabine, Irinotecan, 5-FU, Oxaliplatin) Melanoma Checkpoint inhibitors (pembro, ipi, nivolumab, durvalumab), BRaf inhibitors (vemurafenib, debrafenib), MEK inhibitors, CDK4 inhibitors (ribociclib) Renal cell Checkpoint inhibitors (pembro, ipi, nivolumab, durvalumab), mTOR inhibitors carcinoma (everolimus), bevacizumab Lung cancer Checkpoint inhibitors (pembro, ipi, nivolumab, durvalumab), EGFR inhibitors (erlotinib, gefitinib, cetuximab) Esophageal Chemotherapeutic agents (5FU, docetaxel), trastuzumab cancer Ovarian cancer Chemotherapeutics (taxanes, cisplatin) Uterine cancer Chemotherapeutics (taxanes, cisplatin) Head and Neck Checkpoint inhibitors (pembro, ipi, nivolumab, durvalumab), EGFR inhibitors cancer (erlotinib, gefitinib, cetuximab) Mesothelioma Chemotherapeutics (pemetrexed, cisplatin)

    [0295] Non-Drug Therapies

    [0296] Another type of agent that can be administered in combination with an α6*nAChR inhibitor is a therapeutic agent that is a non-drug treatment. For example, the second therapeutic agent is radiation therapy, cryotherapy, hyperthermia and/or surgical excision of tumor tissue.

    [0297] CAR-T Therapy

    [0298] Another therapy that can be employed in combination with the methods and compositions described herein is chimeric antigen receptor (CAR)-T therapy, or therapy with lymphocytes, such as autologous or allogeneic T cells, that have been modified to express a chimeric antigen receptor (CAR) that recognizes specific cancer antigens. Commonly, CARs contain a single chain fragment variable (scFv) region of an antibody or a binding domain specific for a tumor associated antigen (TAA) coupled via hinge and transmembrane regions to cytoplasmic domains of T cell signaling molecules. The most common lymphocyte activation moieties include a T cell costimulatory domain (e.g., CD28 and/or CD137) in tandem with a T cell effector function triggering (e.g. CD3) moiety. CARs have the ability to redirect T cell reactivity and specifity toward a selected target in a non-MHC restricted manner, exploiting the antigen-binding properties of monoclonal antibodies. The non-MHC restricted antigen recognition gives CAR-T cells the ability to bypass a major mechanism of tumor escape.

    [0299] Neurotransmission Modulators

    [0300] In some embodiments, the α6*nAChR inhibitor is administered in combination with a neurotransmission modulator (e.g., an agent that increases or decreases neurotransmission). A neurotransmission modulator can be used to modulate neural activity in a cancer or tumor that is innervated by nerves or to modulate immune cells that express neurotransmitter receptors. For example, in some embodiments, the neurotransmission modulator is a neurotransmitter or neurotransmitter receptor listed in Table 7 or 8, or an agonist or antagonist listed in Tables 9A-9J for a corresponding neurotransmitter pathway member. In some embodiments, the neurotransmission modulator is a neurotransmission modulator listed in Table 10. Neurotransmission modulators that increase neurotransmission include neurotransmitters and neurotransmitter receptors listed in Tables 7 and 8 and analogs thereof, and neurotransmitter agonists (e.g., small molecules that agonize a neurotransmitter receptor listed in Table 7). Exemplary agonists are listed in Tables 9A-9J. In some embodiments, neurotransmission is increased via administration, local delivery, or stabilization of neurotransmitters (e.g., ligands listed in Tables 7 or 8). Neurotransmission modulators that increase neurotransmission also include agents that increase neurotransmitter synthesis or release (e.g., agents that increase the activity of a biosynthetic protein encoded by a gene in Table 7 via stabilization, overexpression, or upregulation, or agents that increase the activity of a synaptic or vesicular protein via stabilization, overexpression, or upregulation), prevent neurotransmitter reuptake or degradation (e.g., agents that block or antagonize transporters that remove neurotransmitter from the synaptic cleft), increase neurotransmitter receptor activity (e.g., agents that increase the activity of a signaling protein encoded by a gene in Table 7 via stabilization, overexpression, agonism, or upregulation, or agents that upregulate, agonize, or stabilize a neurotransmitter receptor listed in Table 7), increase neurotransmitter receptor synthesis or membrane insertion, decrease neurotransmitter degradation, and regulate neurotransmitter receptor conformation (e.g., agents that bind to a receptor and keep it in an “open” or “primed” conformation). In some embodiments, the neurotransmitter receptor is a channel, the activity of which can be increased by agonizing, opening, stabilizing, or overexpressing the channel. Neurotransmission modulators can increase neurotransmission by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or more. Exemplary neurotransmission modulators are listed in Table 10.

    [0301] Neurotransmission modulators that decrease neurotransmission include neurotransmitter antagonists (e.g., small molecules that antagonize a neurotransmitter receptor listed in Table 7). Exemplary antagonists are listed in Tables 9A-9J. Neurotransmission modulators that decrease neurotransmission also include agents that decrease neurotransmitter synthesis or release (e.g., agents that decrease the activity of a biosynthetic protein encoded by a gene in Table 8 via inhibition or downregulation, or agents that decrease the activity of a synaptic or vesicular protein via blocking, disrupting, downregulating, or antagonizing the protein), increase neurotransmitter reuptake or degradation (e.g., agents that agonize, open, or stabilize transporters that remove neurotransmitter from the synaptic cleft), decrease neurotransmitter receptor activity (e.g., agents that decrease the activity of a signaling protein encoded by a gene in Table 7 or via blocking or antagonizing the protein, or agents that block, antagonize, or downregulate a neurotransmitter receptor listed in Table 7), decrease neurotransmitter receptor synthesis or membrane insertion, increase neurotransmitter degradation, regulate neurotransmitter receptor conformation (e.g., agents that bind to a receptor and keep it in a “closed” or “inactive” conformation), and disrupt the pre- or postsynaptic machinery (e.g., agents that block or disrupt a structural protein, or agents that block, disrupt, downregulate, or antagonize a synaptic or vesicular protein). In some embodiments, the neurotransmitter receptor is a channel (e.g., a ligand or voltage gated ion channel), the activity of which can be decreased by blockade, antagonism, or inverse agonism of the channel. Neurotransmission modulators that decrease neurotransmission further include agents that sequester, block, antagonize, or degrade a neurotransmitter listed in Tables 7 or 8. Neurotransmission modulators that decrease or block neurotransmission include antibodies that bind to or block the function of neurotransmitters, neurotransmitter receptor antagonists, and toxins that disrupt synaptic release. Neurotransmission modulators can decrease neurotransmission by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or more. Neurotransmission modulator can be administered in any of the modalities described herein (e.g., antibody, small molecule, nucleic acid, polypeptide, or viral vector).

    TABLE-US-00007 TABLE 7 NEUROTRANSMITTER GENES & PATHWAYS Accession Entrez Gene Pathway Type Number Gene ID ABAT Neurotransmitter Biosynthesis P80404 18 ACHE Neurotransmitter Biosynthesis P22303 43 ADORA2A Neurotransmitter Receptor P29274 135 ADORA2B Neurotransmitter Receptor P29275 136 Adra1a Adrenergic/ Receptor P35348 148 Neurotransmitter Adra1b Adrenergic/ Receptor P35368 147 Neurotransmitter Adra1d Adrenergic/ Receptor P25100 146 Neurotransmitter Adra2a Adrenergic/ Receptor P08913 150 Neurotransmitter Adra2b Adrenergic/ Receptor P18089 151 Neurotransmitter Adra2c Adrenergic/ Receptor P18825 152 Neurotransmitter Adrb1 Adrenergic/ Receptor P08588 153 Neurotransmitter Adrb2 Adrenergic/ Receptor P07550 154 Neurotransmitter Adrb3 Adrenergic/ Receptor P13945 155 Neurotransmitter Adrbk1 Adrenergic Kinase P25098 156 Adrbk2 Adrenergic Kinase P35626 157 BACE1 Neurotransmitter Biosynthesis P56817 23621 BCHE Neurotransmitter Biosynthesis P06276 590 BRS3 Neuromodulator Receptor P32247 P32247 C6orf89 Neuromodulator Receptor Q6UWU4 221477 CHAT Neurotransmitter Biosynthesis P28329 1103 CHRFAM7A Neurotransmitter Receptor Q494W8 89832 Chrm1 Cholinergic/ Receptor P11229 1128 Neurotransmitter Chrm2 Cholinergic/ Receptor P08172 1129 Neurotransmitter Chrm3 Cholinergic/ Receptor P20309 1131 Neurotransmitter Chrm4 Cholinergic/ Receptor P08173 1132 Neurotransmitter Chrm5 Cholinergic/ Receptor P08912 1133 Neurotransmitter Chrna1 Cholinergic/ Receptor P02708 1134 Neurotransmitter Chrna10 Cholinergic/ Receptor Q9GZZ6 57053 Neurotransmitter Chrna2 Cholinergic/ Receptor Q15822 1135 Neurotransmitter Chrna3 Cholinergic/ Receptor P32297 1136 Neurotransmitter Chrna4 Cholinergic/ Receptor P43681 1137 Neurotransmitter Chrna5 Cholinergic/ Receptor P30532 1138 Neurotransmitter Chrna7 Cholinergic/ Receptor P36544 1139 Neurotransmitter Chrna9 Cholinergic/ Receptor Q9UGM1 55584 Neurotransmitter Chrnb1 Cholinergic/ Receptor P11230 1140 Neurotransmitter Chrnb2 Cholinergic/ Receptor P17787 1141 Neurotransmitter Chrnb3 Cholinergic/ Receptor Q05901 1142 Neurotransmitter Chrnb4 Cholinergic/ Receptor P30926 1143 Neurotransmitter Chrnd Cholinergic/ Receptor Q07001 1144 Neurotransmitter Chrne Cholinergic/ Receptor Q04844 1145 Neurotransmitter Chrng Cholinergic/ Receptor P07510 1146 Neurotransmitter CNR1 Cannabinoid/ Receptor P21554 1268 Neurotransmitter CNR2 Cannabinoid/ Receptor P34972 1269 Neurotransmitter CNRIP1 Neurotransmitter Receptor Q96F85 25927 COMT Neurotransmitter Biosynthesis P21964 1312 CPA4 Neurotransmitter Biosynthesis Q9UI42 51200 CPE Neuropeptide/ Biosynthesis P16870 1363 Neurotransmitter CREM Neurotransmitter Signaling Q03060 1390 DAGLA Neurotransmitter Biosynthesis Q9Y4D2 747 (Cannabinoid) DAGLB Neurotransmitter Biosynthesis Q8NCG7 221955 (Cannabinoid) DBH Neurotransmitter Biosynthesis P09172 1621 DDC Neurotransmitter Biosynthesis P20711 1644 DGKI Neurotransmitter Biosynthesis O75912 9162 DOPO Dopaminergic Receptor P09172 1621 DPP4 Neurotransmitter Biosynthesis P27487 1803 Drd1 Dopaminergic/ Receptor P21728 1812 Neurotransmitter Drd2 Dopaminergic/ Receptor P14416 1813 Neurotransmitter Drd3 Dopaminergic/ Receptor P35462 1814 Neurotransmitter Drd4 Dopaminergic/ Receptor P21917 1815 Neurotransmitter Drd5 Dopaminergic/ Receptor P21918 1816 Neurotransmitter ECEL1 Neurotransmitter Biosynthesis O95672 9427 FAAH Neurotransmitter Biosynthesis O00519 2166 FNTA Neurotransmitter Signaling P49354 2339 GABARAP Neurotransmitter Receptor O95166 11337 GABARAPL1 Amine Receptor Q9H0R8 23710 Neuromodulator GABARAPL2 Amine Receptor P60520 11345 Neuromodulator GABBR1 Neurotransmitter Receptor Q9UBS5 2550 GABBR2 Amine Receptor O75899 9568 Neuromodulator GABRA1 Neurotransmitter Receptor P14867 2554 GABRA2 Neurotransmitter Receptor P47869 2555 GABRA3 Neurotransmitter Receptor P34903 2556 GABRA4 Neurotransmitter Receptor P48169 2557 GABRA5 Neurotransmitter Receptor P31644 2558 GABRA6 Neurotransmitter Receptor Q16445 2559 GABRB1 Neurotransmitter Receptor P18505 2560 GABRB2 Neurotransmitter Receptor P47870 2561 GABRB3 Neurotransmitter Receptor P28472 2562 GABRD Neurotransmitter Receptor O14764 2563 GABRE Neurotransmitter Receptor P78334 2564 GABRG1 Neurotransmitter Receptor Q8N1C3 2565 GABRG2 Neurotransmitter Receptor P18507 2566 GABRG3 Neurotransmitter Receptor Q99928 2567 GABRP Neurotransmitter Receptor O00591 2568 GABRQ Neurotransmitter Receptor Q9UN88 55879 GABRR1 Neurotransmitter Receptor P24046 2569 GABRR2 Neurotransmitter Receptor P28476 2570 GABRR3 Neurotransmitter Receptor A8MPY1 200959 GAD1 Neurotransmitter Biosynthesis Q99259 2571 GAD2 Neurotransmitter Biosynthesis Q05329 2572 GCHFR Neurotransmitter Biosynthesis P30047 2644 GLRA1 Neurotransmitter Receptor P23415 2741 GLRA2 Neurotransmitter Receptor P23416 2742 GLRA3 Neurotransmitter Receptor O75311 8001 GLRA4 Neurotransmitter Receptor Q5JXX5 441509 GLRB Neurotransmitter Receptor P48167 2743 GLS Neurotransmitter Biosynthesis O94925 2744 GLS2 Neurotransmitter Biosynthesis Q9UI32 27165 GluA1 (GluR1) Amine Receptor P42261 2890 Neuromodulator GluK1 (GluR5) Amine Receptor P39086 2897 Neuromodulator GLUL Neurotransmitter Biosynthesis P15104 2752 GluN1(NR1) Amine Receptor Q05586 2902 Neuromodulator GNMT Neurotransmitter Biosynthesis Q14749 27232 GPER1 Neurotransmitter Receptor Q99527 2852 GPR1 Neurotransmitter Receptor P46091 2825 GPR139 Neurotransmitter Receptor Q6DWJ6 124274 GPR143 Neurotransmitter Receptor P51810 4935 GPR149 Neurotransmitter Receptor Q86SP6 344758 GPR18 Neurotransmitter Receptor Q14330 2841 GPR21 Neurotransmitter Receptor Q99679 2844 GPR26 Neurotransmitter Receptor Q8NDV2 2849 GPR3 Neurotransmitter Receptor P46089 2827 GPR35 Neurotransmitter Receptor Q9HC97 2859 GPR52 Neurotransmitter Receptor Q9Y2T5 9293 GPR55 Neurotransmitter Receptor Q9Y2T6 9290 GPR78 Neurotransmitter Receptor Q96P69 27201 GPR83 Neurotransmitter Receptor Q9NYM4 10888 GPR84 Neurotransmitter Receptor Q9NQS5 53831 GPRASP1 Neurotransmitter Receptor Q5JY77 9737 GPR50 Amine Receptor Q13585 9248 Neuromodulator GRIA1 Neurotransmitter Receptor P42261 2890 GRIA2 Neurotransmitter Receptor P42262 2891 GRIA3 Neurotransmitter Receptor P42263 2892 GRIA4 Neurotransmitter Receptor P48058 2893 GRID1 Neurotransmitter Receptor Q9ULK0 2894 GRID2 Neurotransmitter Receptor O43424 2895 GRIK1 Neurotransmitter Receptor P39086 2897 GRIK2 Neurotransmitter Receptor Q13002 2898 GRIK3 Neurotransmitter Receptor Q13003 2899 GRIK4 Neurotransmitter Receptor Q16099 2900 GRIK5 Neurotransmitter Receptor Q16478 2901 GRIN1 Neurotransmitter Receptor Q05586 2902 GRIN2A Neurotransmitter Receptor Q12879 2903 GRIN2B Neurotransmitter Receptor Q13224 2904 GRIN2C Neurotransmitter Receptor Q14957 2905 GRIN2D Neurotransmitter Receptor O15399 2906 GRIN3A Neurotransmitter Receptor Q8TCU5 116443 GRIN3B Neurotransmitter Receptor O60391 116444 GRK2 Neurotransmitter Receptor P25098 156 GRK3 Neurotransmitter Receptor P35626 157 GRM1 Neurotransmitter Receptor Q13255 2911 GRM2 Neurotransmitter Receptor Q14416 2912 GRM3 Neurotransmitter Receptor Q14832 2913 GRM4 Neurotransmitter Receptor Q14833 2914 GRM5 Neurotransmitter Receptor P41594 2915 GRM6 Neurotransmitter Receptor O15303 2916 GRM7 Neurotransmitter Receptor Q14831 2917 GRM8 Neurotransmitter Receptor O00222 2918 HNMT Neurotransmitter Biosynthesis P50135 3176 HOMER1 Neurotransmitter Receptor Q86YM7 9456 HRH1 Neurotransmitter Receptor P35367 3269 HRH2 Neurotransmitter Receptor P25021 3274 HRH3 Neurotransmitter Receptor Q9Y5N1 11255 HRH4 Neurotransmitter Receptor Q9H3N8 59340 Htr1a Neurotransmitter Receptor P08908 3350 Htr1b Neurotransmitter Receptor P28222 3351 Htr1c Neurotransmitter Receptor P28335 Htr1d Neurotransmitter Receptor P28221 3352 Htr1e Neurotransmitter Receptor P28566 3354 Htr1f Neurotransmitter Receptor P30939 3355 Htr2a Neurotransmitter Receptor P28223 3356 Htr2b Neurotransmitter Receptor P41595 3357 Htr2c Neurotransmitter Receptor P28335 3358 Htr3a Neurotransmitter Receptor P46098 3359 Htr3b Neurotransmitter Receptor O95264 9177 Htr3c Neurotransmitter Receptor Q8WXA8 170572 Htr3d Neurotransmitter Receptor Q70Z44 200909 HTR3E Neurotransmitter Receptor A5X5Y0 285242 Htr4 Neurotransmitter Receptor Q13639 3360 Htr5a Neurotransmitter Receptor P47898 3361 Htr5b Neurotransmitter Receptor P35365 79247 HTR5BP Neurotransmitter Receptor 645694 Htr6 Neurotransmitter Receptor P50406 3362 Htr7 Neurotransmitter Receptor P32305 3363 ITPR1 Neurotransmitter Signaling Q14643 3708 ITPR2 Neurotransmitter Signaling Q14571 3709 ITPR3 Neurotransmitter Signaling Q14573 3710 LYNX1 Neurotransmitter Receptor Q9BZG9 66004 MAOA Neurotransmitter Biosynthesis P21397 4128 MAOB Neurotransmitter Biosynthesis P27338 4129 NAMPT Neurotransmitter Biosynthesis P43490 10135 NISCH Neurotransmitter Receptor Q9Y2I1 11188 NOS1 Neurotransmitter Biosynthesis P29475 4842 NPTN Neurotransmitter Receptor Q9Y639 27020 P2RX1 Neurotransmitter Receptor P51575 5023 P2RX2 Neurotransmitter Receptor Q9UBL9 22953 P2RX3 Neurotransmitter Receptor P56373 5024 P2RX4 Neurotransmitter Receptor Q99571 5025 P2RX5 Neurotransmitter Receptor Q93086 5026 P2RX6 Neurotransmitter Receptor O15547 9127 P2RX7 Neurotransmitter Receptor Q99572 5027 P2RY11 Neurotransmitter Receptor Q96G91 5032 PAH Neurotransmitter Biosynthesis P00439 5053 PC Neurotransmitter Biosynthesis P11498 5091 PDE1B Neurotransmitter Signaling Q01064 5153 PDE4A Neurotransmitter Signaling P27815 5141 PDE4D Neurotransmitter Signaling Q08499 5144 PHOX2A Neurotransmitter Biosynthesis O14813 401 PHOX2B Neurotransmitter Biosynthesis Q99453 8929 PIK3CA Neurotransmitter Signaling P42336 5290 PIK3CB Neurotransmitter Signaling P42338 5291 PIK3CG Neurotransmitter Signaling P48736 5294 PLCB1 Neurotransmitter Signaling Q9NQ66 23236 PLCB2 Neurotransmitter Signaling Q00722 5330 PLCB3 Neurotransmitter Signaling Q01970 5331 PLCB4 Neurotransmitter Signaling Q15147 5332 PLCD1 Neurotransmitter Signaling P51178 5333 PLCE1 Neurotransmitter Signaling Q9P212 51196 PLCG1 Neurotransmitter Signaling P19174 5335 PLCL1 Neurotransmitter Signaling Q15111 5334 PLCL2 Neurotransmitter Signaling Q9UPR0 23228 PPP1CB Neurotransmitter Signaling P62140 5500 PPP1CC Neurotransmitter Signaling P36873 5501 PRIMA1 Neurotransmitter Biosynthesis Q86XR5 145270 PRKACG Neurotransmitter Signaling P22612 5568 PRKAR2B Neurotransmitter Signaling P31323 5577 PRKCG Neurotransmitter Signaling P05129 5582 PRKX Neurotransmitter Signaling P51817 5613 RIC3 Neurotransmitter Receptor Q7Z5B4 79608 SHANK3 Neurotransmitter Signaling Q9BYB0 85358 SLC6A1 Amine Transferase P30531 6529 Neuromodulator SLC6A13 Amine Transferase Q9NSD5 6540 Neuromodulator Slc6a4 Serotonin Transporter P31645 6532 SNX13 Neurotransmitter Signaling Q9Y5W8 23161 TAAR1 Amine Receptor Q96RJ0 134864 Neuromodulator TAAR2 Amine Receptor Q9P1P5 9287 Neuromodulator TAAR5 Neurotransmitter Receptor O14804 9038 TH Neurotransmitter Biosynthesis P07101 7054 TPH1 Neurotransmitter Biosynthesis P17752 7166 TPH2 Neurotransmitter Biosynthesis Q8IWU9 121278 TRHDE Neurotransmitter Biosynthesis Q9UKU6 29953

    TABLE-US-00008 TABLE 8 NEUROTRANSMITTERS Ligand Pathway Type 2-Arachidonoylglycerol Endocannabinoid Ligand 2-Arachidonyl glyceryl ether Endocannabinoid Ligand 3-methoxytyramine Amines Ligand Acetylcholine Amino Acids Ligand Adenosine Purine Ligand Adenosine triphosphate Purine Ligand Agmatine Amino Acids Ligand Anandamide Endocannabinoid Ligand Aspartate Amino Acids Ligand Carbon monoxide Gas Ligand D-serine Amino Acids Ligand Dopamine Monoamines Ligand Dynorphin Opioids Ligand Endorphin Opioids Ligand Enkephalin Opioids Ligand Epinephrine Monoamines Ligand Gamma-aminobutyric acid Amino Acids Ligand Glutamate Amino Acids Ligand Glycine Amino Acids Ligand Histamine Monoamines Ligand N-Acetylaspartylglutamate Neuropeptides Ligand N-Arachidonoyl dopamine Endocannabinoid Ligand N-methylphenethylamine Amines Ligand N-methyltryptamine Amines Ligand Nitric oxide Gas Ligand Norepinephrine Monoamines Ligand Octopamine Amines Ligand Phenethylamine Amines Ligand Serotonin Monoamines Ligand Synephrine Amines Ligand Tryptamine Amines Ligand Tyramine Amines Ligand Virodhamine Endocannabinoid Ligand

    TABLE-US-00009 TABLE 9A AGONISTS AND ANTAGONIST AGENTS Gene Agonist Antagonist Adrb2 NCX 950 Alprenolol Accession Bitolterol Carvedilol Number: Isoetarine Desipramine P07550 Norepinephrine Nadolol Phenylpropanolamine Levobunolol Dipivefrin Metipranolol Epinephrine Bevantolol Orciprenaline Oxprenolol Dobutamine Nebivolol Ritodrine Asenapine Terbutaline Bupranolol Salmeterol Penbutolol Formoterol Celiprolol Salbutamol Pindolol Isoprenaline Acebutolol Arbutamine Bopindolol Arformoterol Fenoterol Pirbuterol Ephedra Procaterol Clenbuterol Bambuterol Indacaterol Droxidopa Olodaterol Vilanterol Pseudoephedrine Cabergoline Mirtazepine Adra1d Midodrine Dapiprazole Accession Norepinephrine Amitriptyline Number: Clonidine Alfuzosin P25100 Oxymetazoline Promazine Pergolide Prazosin Bromocriptine Imipramine Droxidopa Nortriptyline Xylometazoline Doxazosin Ergotamine Nicardipine Cirazoline Dronedarone Cabergoline Tamsulosin Methoxamine Propiomazine Epinephrine Phenoxybenzamine Carvedilol Doxepin Terazosin Quetiapine Methotrimeprazine Silodosin Adrb1 Isoetarine Esmolol Accession Norepinephrine Betaxolol Number: Phenylpropanolamine Metoprolol P08588 Epinephrine Atenolol Dobutamine Timolol Salbutamol Sotalol Isoprenaline Propranolol Arbutamine Labetalol Fenoterol Bisoprolol Pirbuterol Alprenolol Ephedra Amiodarone Clenbuterol Carvedilol Droxidopa Nadolol Pseudoephedrine Levobunolol Carteolol Metipranolol Cabergoline Bevantolol Mirtazapine Practolol Loxapine Oxprenolol Vortioxetine Celiprolol Desipramine Nebivolol Asenapine Bupranolol Penbutolol Pindolol Acebutolol Bopindolol Cartelol Adrb3 SR 58611 Bopindolol Accession Norepinephrine Propranolol Number: Epinephrine Bupranolol P13945 Isoprenaline Arbutamine Fenoterol Ephedra Clenbuterol Droxidopa Mirabegron Adrbk1 ATP Alprenolol Accession Carbachol Heparin Number: Dopamine P25098 Isoproterenol Morphine DAMGO histamine Acetylcholine Etorphine NMDA Dopamine Adrbk2 Isoproterenol Propranolol Accession DAMGO Number: ATP P26819 Chrm3 cgmp MT3 Accession ATP Hexocyclium Number: Cevimeline Himbacine P20309 arecoline Biperiden oxotremorine-M lithocholylcholine NNC 11-1314 AFDX384 xanomeline 4-DAMP oxotremorine hexahydrodifenidol pentylthio-TZTP VU0255035 arecaidine propargyl ester N-methyl scopolamine NNC 11-1607 Darifenacin furmethide Thiethylperazine NNC 11-1585 methoctramine Acetylcholine silahexocyclium methylfurmethide Strychnine Bethanechol MT7 Carbachol Heparin Succinylcholine Olanzapine ALKS 27 Pirenzepine itopride Clidinium methacholine Ipratropium Meperidine Propantheline Cinnarizine Dicyclomine Trimipramine Darifenacin Tiotropium Atropine Scopolamine Amitriptyline Doxepin Lidocaine Nortriptyline Tropicamide Metixene Homatropine Methylbromide Solifenacin Glycopyrrolate Propiomazine Diphemanil Methylsulfate Promethazine Diphenidol Pancuronium Ziprasidone Quetiapine Imipramine Clozapine Cyproheptadine Aripiprazole Nicardipine Amoxapine Loxapine Promazine Oxyphencyclimine Anisotropine Methylbromide Tridihexethyl Chlorpromazine Ketamine Cyclosporin A Paroxetine Benzquinamide Tolterodine Oxybutynin Alcuronium WIN 62,577 Tramadol Chlorprothixene Aclidinium Methotrimeprazine Umeclidinium Cryptenamine Mepenzolate Maprotiline Brompheniramine Isopropamide Trihexyphenidyl Ipratropium bromide Hyoscyamine Procyclidine Pipecuronium Fesoterodine Disopyramide Desipramine Mivacurium Chrna3 Nicotine A-867744 Accession Varenicline NS1738 Number: Acetylcholine Hexamethonium P32297 Ethanol Mecamylamine Cytisine Dextromethorphan Levamisole Pentolinium Galantamine Levomethadyl Acetate Bupropion Chrna9 Nicotine Hexamethonium Accession Galantamine Mecamylamine Number: Ethanol Tetraethylammonium Q9UGM1 Muscarine ATG003 Strychnine Lobeline RPI-78M Chrnb1 Galantamine Accession Number: P11230 Chrnb4 Nicotine Atropine Accession Varenicline Oxybutynin Number: PNU-120596 Pentolinium P30926 Ethanol Dextromethorphan Galantamine Chrng Galantamine Accession Number: P07510 Adcyap1 Nicotine Atropine Accession CGMP PPADS Number: Apomorphine Onapristone P18509 Suramin Muscarine Nifedipine Haloperidol ATP Astressin Dihydrotestosterone Melatonin Maxadilan Scopolamine Dexamethasone Tetrodotoxin Acetylcholine Apamin Histamine Hexamethonium Carbachol Indomethacin NMDA Propranolol Dopamine Bumetanide Isoproterenol Progesterone Salbutamol Charybdotoxin Morphine Prazosin Clonidine Nimodipine 2,6-Diamino-Hexanoic Acid Amide CYSLTR1 Salbutamol Montelukast Accession Dexamethasone Zafirlukast Number: Arachidonic acid Cinalukast Q9Y271 Histamine Pranlukast Nedocromil Theophylline Indomethacin Zileuton Iralukast Pobilukast Sulukast Verlukast LTB4R LTB U75302 Accession ATP CP105696 Number: Dexamethasone CP-195543 Q15722 cholesterol Etalocib 20-hydroxy-LTB< SC-41930 12R-HETE LY255283 arachidonic acid Zafirlukast ONO-4057 RO5101576 BILL 260 PENK Dopamine Naltrexone Accession kainate Naloxone Number: NMDA Progesterone P01210 DAMGO Morphine Htr2c Apomorphine Melatonin Accession Bifeprunox SB 224289 Number: Tramadol LY334362 P28335 AL-37350A FR260010 5-MeO-DMT Sulpiride BW723C86 Thiethylperazine CGS-12066 cyamemazine DOI Mesulergine 5-CT SB 221284 YM348 Zotepine LSD Metergoline xanomeline methiothepin WAY-163909 Spiperone Dopamine SB 215505 LY344864 Tiospirone VER-3323 SB 228357 TFMPP Pizotifen 8-OH-DPAT SB 206553 MK-212 SB 204741 NMDA SDZ SER-082 org 12962 Ritanserin 5-MeOT SB 242084 RU 24969 S33084 Acetylcholine Roxindole QUINPIROLE RS-127445 quipazine Terguride tryptamine EGIS-7625 Ro 60-0175 SB 243213 Oxymetazoline RS-102221 Ergotamine Olanzapine Cabergoline Aripiprazole Lorcaserin Agomelatine Pergolide Ziprasidone Methylergonovine Quetiapine Renzapride Sarpogrelate Pramipexole Perphenazine GR-127935 Thioridazine BRL-15572 Sertindole ipsapirone Loxapine SB 216641 Methysergide SL65.0155 Risperidone S 16924 Asenapine Bromocriptine Mianserin Lisuride Clozapine Tegaserod Trifluoperazine Epicept NP-1 Trazodone dapoxetine Doxepin Dexfenfluramine Nortriptyline 3,4- Chlorprothixene Methylenedioxymethamphetamine Ropinirole Minaprine Maprotiline Propiomazine Desipramine Mirtazapine Amoxapine Yohimbine Cyproheptadine Imipramine Amitriptyline Promazine Chlorpromazine Ketamine Propranolol Fluoxetine Ketanserin Mesulergine AC-90179 Ergoloid mesylate 2 Methotrimeprazine Paliperidone Clomipramine Trimipramine Captodiame Nefazodone GABA Receptor Bamaluzole bicuculline Accession GABA Metrazol Numbers Gabamide Flumazenil (Q9UBS5, O95166, GABOB Thiothixine O75899, P28472, Gaboxadol Bupropion P18507, P47870, Ibotenic acid Caffeine P47869, O14764) Isoguvacine Isonipecotic acid Muscimol Phenibut Picamilon Progabide Quisqualamine SL 75102 Thiomuscimol Alcohols (e.g., ethanol, isopropanol) Avermectins (e.g., ivermectin) Barbiturates (e.g., phenobarbital) Benzodiazepines Bromides (e.g., potassium bromide Carbamates (e.g., meprobamate, carisoprodol) Chloralose Chlormezanone Clomethiazole Dihydroergolines (e.g., ergoloid (dihydroergotoxine)) Etazepine Etifoxine Imidazoles (e.g., etomidate) Kavalactones (found in kava) Loreclezole Neuroactive steroids (e.g., allopregnanolone, ganaxolone) Nonbenzodiazepines (e.g., zaleplon, zolpidem, zopiclone, eszopiclone) Petrichloral Phenols (e.g., propofol) Piperidinediones (e.g., glutethimide, methyprylon) Propanidid Pyrazolopyridines (e.g., etazolate) Quinazolinones (e.g., methaqualone) Skullcap constituents Stiripentol Sulfonylalkanes (e.g., sulfonmethane, tetronal, trional) Valerian constituents (e.g., valeric acid, valerenic acid) Volatiles/gases (e.g., chloral hydrate, chloroform, diethyl ether, sevoflurane) Glutamate 3,5-dihydroxyphenylglycine APICA Receptor eglumegad EGLU Accession Biphenylindanone A LY-341,495 Number: DCG-IV (P42261, P39086, L-AP4 P39086, Q13585, P42261, P42262, P42263, P48058, P39086, Q13002, Q13003, Q13003, Q16478, Q12879, Q14957, Q13224, Q14957, O15399, Q8TCU5, O60391) CNR1/CNR2 N-Arachidonoylethanolamine SR 141716A Accession 2-Arachidonoyl-glycerol LY-320135 Number: 2-Arachidonoyl-glycerylether AM251 (P21554, P34972) N-Arachidonoyl-dopamine AM281 O-Arachidonoyl-ethanolamine SR 144528 N-Arachidonoylethanolamine AM630 2-Arachidonoyl-glycerol 2-Arachidonoyl-glycerylether N-Arachidonoyl-dopamine O-Arachidonoyl-ethanolamine Δ-9-THC CP-55,940 R(+)-WIN 55,212-2 HU-210 Levonantradol Nabilone Methanandamide ACEA O-1812 Δ9-THC CP-55,940 R(+)-WIN 55,212-2 HU-210 Levonantradol Nabilone Methanandamide JWH-015 JWH-133

    TABLE-US-00010 TABLE 9B ADRENERGIC AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist Non-selective adrenaline (epinephrine), carvedilol, arotinolol, and labetalol noradrenaline (norepinephrine), isoprenaline (isoproterenol), dopamine, caffeine, nicotine, tyramine, methylphenidate, ephedrine and pseudophedrine. α1 selective (ADRA1A, phenylephrine, methoxamine, acepromazine, alfuzosin, doxazosin, ADRA1B, ADRA1D) midodrine, cirazoline, labetalol, phenoxybenzamine, xylometazoline, metaraminol KW3902, phentolamine, prazosin, chloroehtylclonidine, oxymetazoline tamsulosin, terazosin, tolazoline, trazodone, amitriptyline, silodosin, clomipramine, doxepin, trimipramine, typical and atypical antipsychotics, and antihistamines, such as hyroxyzine α2 selective (ADRA2A, α-methyl dopa, clonidine, phentolamine, phenoxybenzamine, ADRA2B, ADRA2C) brimonidine, agmatine, yohimbine, idazoxan, atipamezole, dexmedetomidine, mirtazapine, tolazoline, trazodone, medetomidine, romifidine and typical and atypical chloroethylclonidine, antipsychotics detomidine, lofexidine, xylazine, tizanidine, guanfacine, and amitraz β1 selective (ADRB1) Dobutamine metroprolol, atenolol, acebutolol, bisoprolol, betaxolol, levobetaxolol, esmolol, celiprolol, carteolol, landiolol, oxprenolol, propanolol, practolol, penbutolol, timolol, labetalol, nebivolol, levobunolol, nadolol, pindolol, sotalol, metipranolol, tertatolol, vortioxene β2 selective (ADRB2) salbutamol, albuterol, bitolterol butaxamine, acebutolol, timolol, mesylate, levabuterol, ritodrine, propanolol, levobunolol, carteolol, metaproterenol, terbutaline, labetalol, pindolol, oxprenolol, salmeterol, formoterol, and pirbuterol nadolol, metipranolol, penbutolol, tertatolol, sotalol β3 selective (ADRB3) L-796568, amibegron, solabegron, SR 59230A, arotinolol mirabegron

    TABLE-US-00011 TABLE 9C DOPAMINE AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist Non-selective pramipexole, ropinirole, rotigotine, haloperidol, paliperidone, clozapine, apomorphine, propylnorapomorphine, risperidone, olanzapine, quetiapine, bromocriptine, cabergoline, ciladopa, ziprasidone, metoclopramide, dihydrexidine, dinapsoline, droperidol, domperidone, doxamthrine, epicriptine, lisuride, amoxapine, clomipramine, pergolide, piribedil, quinagolide, trimipramine, choline, melatonin, roxindole, dopamine acepromazine, amisulpride, asenapine, azaperone, benperidol, bromopride, butaclamol, chlorpromazine, clebopride, chlorprothixene, clopenthixol, clocapramine, eticlopride, flupenthixol, fluphenazine, fluspirilene, hydroxyzine, itopride, iodobenzamide, levomepromazine, levosulpiride, loxapine, mesoridazine, metopimazine, mosapramine, nafadotride, nemonapride, penfluridol, perazine, perphenazine, pimozide, prochlorperazine, promazine, pipotiazine, raclopride, remoxipride, spiperone, spiroxatrine, stepholidine, sulpiride, sultopride, tetrahydropalmatine, thiethylperazine, thioridazine, thiothixene, tiapride, trifluoperazine, trifluperidol, triflupromazine, thioproperazine, taractan, zotepine, zuclopenthixol, ziprasidone, ANP- 010, NGD-94-4 D1 (DRD1) Fenoldopam, A-86929, dihydrexidine, SCH-23,390, SKF-83,959, dinapsoline, dinoxyline, doxanthrine, Ecopipam, Clebopride, Flupenthixol, SKF-81297, SKF-82958, SKF-38393, Zuclopenthixol, Taractan, PSYRX- G-BR-APB, dopexamine 101, LuAF-35700, GLC-756, ADX10061, Zicronapine D2 (DRD2) Cabergoline, pergolide, quinelorane, Chloroethylnorapomorphine, sumanirole, talipexole, piribedil, desmethoxyfallypride, domperidone, quinpirole, quinelorane, dinoxyline, eticlopride, fallypride, hydroxyzine, dopexamine itopride, L-741,626, SV 293, yohimbine, raclopride, sulpiride, paliperidone, penfluridol, quetiapine, lurasidone, risperidone, olanzapine, blonanserin, perphenazine, metoclopramide, trifluoperazine, clebopride, levosulpiride, flupenthixol, haloperidol, thioridazine, alizapride, amisulpride, asenapine, bromopride, bromperidol, clozapine, fluphenazine, perphanazine, loxapine, nemonapride, pericyazine, pipamperone, prochlorperazine, thioproperazine, thiethylperazine, tiapride, ziprasidone, zuclopenthixol, taractan, fluanisone, melperone, molindone, remoxipride, sultopride, ALKS 3831, APD-403, ONC201, pridopidine, DSP-1200, NG-101, TAK-906, ADN-1184, ADN-2013, AG-0098, DDD-016, IRL-626, KP303, ONC-206, PF-4363467, PGW-5, CG-209, ABT-925, AC90222, ACP-005, ADN-2157, CB030006, CLR-136, Egis-11150, Iloperidone, JNJ-37822681, DLP- 115, AZ-001, S-33138, SLV-314, Y- 931, YKP1358, YK-P1447, APD405, CP-903397, ocaperidone, zicronapine, TPN-902 D3 (DRD3) Piribedil, quinpirole, captodiame, Domperidone, FAUC 365, compound R, R-16, FAUC 54, FAUC nafadotride, raclopride, PNU-99,194, 73, PD-128,907, PF-219,061, PF- SB-277011-A, sulpiride, risperidone, 592,379, CJ-1037, FAUC 460, FAUC YQA14, U99194, SR 21502, 346, cariprazine levosulpiride, amisulpride, nemonapride, ziprasidone, taractan, sultopride, APD-403, F17464, ONC201, NG-101, TAK-906, ONC- 206, PF-4363467, ABT-127, ABT- 614, GSK-598809, GSK-618334, S- 14297, S-33138, YKP1358, YK- P1447 D4 (DRD4) WAY-100635, A-412,997, ABT-724, A-381393, FAUC 213, L-745,870, L- ABT-670, FAUC 316, PD-168, 077, 570,667, ML-398, fananserin, CP-226,269 clozapine, PNB-05, SPI-376, SPI- 392, Lu-35-138, NGD-94-1 D5 (DRD5) Dihydrexidine, rotigotine, SKF-83,959, SCH 23390 fenoldopam, Partial aplindore, brexpiprazole, aripiprazole, CY-208,243, pardoprunox, phencyclidine, and salvinorin A

    TABLE-US-00012 TABLE 9D GABA AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist GABA.sub.A barbiturates (e.g., allobarbital, bicuculline, gabazine, hydrastine, amobarbital, aprobarbital, alphenal, pitrazepin, sinomenine, tutin, barbital, brallobarbital, thiocolchicoside, metrazol, securinine, phenobarbital, secobarbital, gabazine thiopental), bamaluzole, GABA, GABOB, gaboxadol, ibotenic acid, isoguvacine, isonipecotic acid, muscimol, phenibut, picamilon, progabide, quisqualamine, SL 75102, thiomuscimol, positive allosteric modulators (PAMs) (e.g., alcohols, such as ethanol and isopropanol; avermectins, such as ivermectin; benzodiazepines, such as diazepam, alprazolam, chlordiazepoxide, clonazepam, flunitrazepam, lorazepam, midazolam, oxazepam, prazepam, brotizolam, triazolam, estazolam, lormetazepam, nitrazepam, temazepam, flurazepam, clorazepate halazepam, prazepam, nimetazapem, adinazolam, and climazolam; bromides, such as potassium bromide; carbamates, such as meprobamate and carisoprodol; chloralose; chlormezanone; chlomethiazole; dihydroergolines, such as ergoloid; etazepine; etifoxine; imidazoles, such as etomidate; imidazopyridines, such as alpidem and necopdiem; kavalactones; loreclezole; neuroactive steroids, such as allogregnanolone, pregnanolone, dihydrodeoxycorticosterone, tetrahydrodeoxycortisosterone, androstenol, androsterone, etiocholanolone, 3α-androstanediol, 5α, 5β, or 3α-dihydroprogesterone, and ganaxolone; nonbenzodiazepines, such as zalepon, zolpidem, zopiclone, and eszopiclone; petrichloral; phenols, such as propofol; piperidinediones, such as glutethimide and methyprylon; propanidid; pyrazolopyridines, such as etazolate; pyrazolopyrimidines, such as divapion and fasiplon; cyclopyrrolones, sush as pagoclone and suproclone; β-cabolines, such as abecarnil and geodecarnil; quinazolinones, such as methaqualone; Scutellaria constituents; stiripentol; sulfonylalkanes, such as sulfonomethane, teronal, and trional; Valerian constituents, such as valeric acid and valerenic acid; and gases, such as chloral hydrate, chloroform, homotaurine, diethyl ether, and sevoflurane. GABA.sub.B 1,4-butanediol, baclofen, GABA, CGP-35348, homotaurine, phaclofen, Gabamide, GABOB, gamma- saclofen, and SCH-50911 butyrolactone, gamma- hydroxybutyric acid, gamma- hyrdoxyvaleric acid, gamma- valerolactone, isovaline, lesogaberan, phenibut, picamilon, progabide, homotaurine, SL-75102, tolgabide GABA.sub.A-ρ CACA, CAMP, GABA, GABOB, N4- gabazine, gaboxadol, isonipecotic chloroacetylcytosine arabinoside, acid, SKF-97,541, and (1,2,5,6- picamilon, progabide, tolgabide, and Tetrahydropyridin-4- neuroactive steroids, such as yl)methylphosphinic acid allopregnanolone, THDOC, and alphaxolone

    TABLE-US-00013 TABLE 9E MUSCARINC AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist Chrm1 AF102B, AF150(S), AF267B, atropine, dicycloverine, hyoscyamine, acetylcholine, carbachol, ipratropium, mamba toxin muscarinic cevimeline, muscarine, toxin 7 (MT7), olanzapine, oxybutynin, oxotremorine, pilocarpine, pirenzepine, telenzepine, and vedaclidine, 77-LH-28-1, CDD- tolterodine 0097, McN-A-343, L689,660, and xanomeline Chrm2 acetylcholine, methacholine, iper-8- atropine, dicycloverine, naph, berbine, and hyoscyamine, otenzepad, AQRA-741, (2S,2′R,3′S,5′R)-1-methyl-2-(2- AFDX-384, thorazine, methyl-1,3-oxathiolan-5- diphenhydramine, dimenhydrinate, yl)pyrrolidine 3-sulfoxide methyl ipratropium, oxybutynin, pirenzepine, iodide methoctramine, tripitramine, gallamine, and tolterodine Chrm3 acetylcholine, bethanechol, atropine, dicycloverine, hyoscyamine, carbachol, L689, 660, alcidium bromide, 4-DAMP, oxotremorine, pilocarpine, darifenacin, DAU-5884, HL-031,120, aceclidine, arecoline, and ipratropium, J-104,129, oxybutynin, cevimeline tiotropium, zamifenacin, and tolterodine Chrm4 acetylcholine, carbachol, and AFDX-384, dicycloverine, himbacine, oxotremorine), and Chrm5 agonists mamba toxin 3, PD-102,807, PD- (e.g., acetylcholine, milameline, 0298029, and tropicamide sabcomeline Chrm5 acetylcholine, milameline, VU-0488130, xanomeline sabcomeline Non-selective scopolamine, hydroxyzine, doxylamine, dicyclomine, flavoxate, cyclopentolate, atropine methonitrate, trihexyphenidyl/benzhexol, solifenacin, benzatropine, mebeverine, and procyclidine

    TABLE-US-00014 TABLE 9F SEROTONIN AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist 5-HT.sub.1A azapirones, such as alnespirone, pindolol, tertatolol, alprenolol, AV-965, binosperone, buspirone, BMY-7,378, cyanopindolol, dotarizine, enilospirone, etapirone, geprione, flopropione, GR-46,611, ipsaprione, revospirone, zalospirone, iodocyanopindolol, isamoltane, perospirone, tiosperone, lecozotan, mefway, methiothepin, umespirone, and tandospirone; 8- methysergide, MPPF, NAN-190, OH-DPAT, befiradol, F-15,599, oxprenolol, pindobind, propanolol, lesopitron, MKC-242, LY-283,284, risperidone, robalzotan, SB-649,915, osemozotan, repinotan, U-92,016-A, SDZ-216,525, spiperone, spiramide, RU-24969, 2C-B, 2C-E, 2C-T-2, spiroxatrine, UH-301, WAY-100,135, aripiprazole, asenapine, bacoside, WAY-100,635, and xylamidine befiradol, brexpiprazole, bufotenin, cannabidiol, and fibanserin 5-HT.sub.1B triptans, such as sumatriptan, methiothepin, yohimbine, metergoline, rizatriptan, eletriptan, donitripatn, aripiprazole, isamoltane, AR- almotriptan, frovatriptan, avitriptan, A000002, SB-216,641, SB-224,289, zolmitriptan, and naratriptan; GR-127,935, SB-236,057 ergotamine, 5- carboxamidotryptamine, CGS- 12066A, CP-93,129, CP-94,253, CP- 122,288, CP-135,807, RU-24969, vortioxetine, ziprasidone, and asenapine 5-HT.sub.1D triptans, such as sumatriptan, ziprasidone, methiothepin, yohimbine, rizatriptan, and naratriptan; metergoline, ergotamine, BRL-15572, ergotamine, 5-(nonyloxy)tryptaime, vortioxetine, GR-127,935, LY- 5-(t-butyl)-N-methyltryptamine, CP- 310,762, LY-367,642, LY-456,219, 286,601, PNU-109,291, PNU- and LY-456,220 142,633, GR-46611, L-694,247, L- 772,405, CP-122,288, and CP- 135,807 5-HT.sub.1E BRL-54443, eletriptan 5-HT.sub.1F LY-334,370, 5-n-butyryloxy-DMT, BRL-54443, eletriptan, LY-344,864, naratriptan, and lasmiditan 5-HT.sub.2A 25I-NBOH, 25I-NBOMe, (R)-DOI, cyproheptadine, methysergide, TCB-2, mexamine, O-4310, PHA- quetiapine, nefazodone, olanzapine, 57378, OSU-6162, 25CN-NBOH, asenapine, pizotifen, LY-367,265, juncosamine, efavirenz, mefloquine, AMDA, hydroxyzine, 5-MeO-NBpBrT, lisuride, and 2C-B and niaprazine 5-HT.sub.2B fenfluramine, pergolide, cabergoline, agomelatine, aripiprazole, mefloquine, BW-723086, Ro60- sarpogrelate, lisuride, tegaserod, 0175, VER-3323, 6-APB, metadoxine, RS-127,445, SDZ SER- guanfacine, norfenfluramine, 5-MeO- 082, EGIS-7625, PRX-08066, SB- DMT, DMT, mCPP, aminorex, 200,646, SB-204,741, SB-206,553, chlorphentermine, MEM, MDA, LSD, SB-215,505, SB-228,357, LY- psilocin, MDMA 266,097, and LY-272,015 5-HT.sub.2C lorcaserin, lisuride, A-372,159, AL- agomelatine, CPC, eltoprazine, 38022A, CP-809,101, fenfluramine, etoperidone, fluoxetine, FR-260,010, mesulergine, MK-212, LU AA24530, methysergide, naphthyllisopropylamine, nefazodone, norfluoxetine, O- norfenfluramine, ORG-12,962, ORG- desmethyltramadol, RS-102,221, SB- 37,684, oxaflozane, PNU-22395, 200,646, SB-221,284, SB-242,084, PNU-181731, lysergamides, SDZ SER-082, tramadol, and phenethylamines, piperazines, trazodone tryptamines, Ro60-0175, vabicaserin, WAY-629, WAY- 161,503, WAY-163,909, and YM-348 5-HT.sub.2A/2C ketanserin, risperidone, trazodone, mirtazapine, clozapine 5-HT.sub.3 2-methyl-5-HT, alpha- dolasetron, granisetron, ondansetron, methyltryptamine, bufotenin, palonosetron, tropisetron, alosetron, chlorophenylbiguanide, ethanol, cilanosetron, mirtazapine, AS-8112, ibogaine, phenylbiguanide, bantopride, metroclopramide, quipazine, RS-56812, SR-57227, renzapride, zacopride, mianserin, varenicline, and YM-31636 vortioxetine, clozapine, olanzapine, quetiapine, menthol, thujone, lamotigrine, and 3-tropanyl indole-3- carboxylate 5-HT.sub.4 cisapride, tegaserod, prucalopride, piboserod, GR-113,808, GR-125,487, BIMU-8, CJ-033,466, ML-10302, RS-39604, SB-203,186, SB-204,070, mosapride, renzapride, RS-67506, and chamomile RS-67333, SL65.1055, zacopride, metoclopramide, and sulpride 5-HT.sub.5A valeronic acid ASP-5736, AS-2030680, AS- 2674723, latrepiridine, risperidone, and SB-699,551 5-HT.sub.6 EMDT, WAY-181,187, WAY- ALX-1161, AVN-211, BVT-5182, BVT- 208,466, N-(inden-5- 74316, cerlapiridine, EGIS-12233, yl)imidazothiazole-5-sulfonamide, E- idalopiridine, interpridine, latrepiridine, 6837, E-6801, and EMD-386,088 MS-245, PRX-07034, SB-258,585, SB-271,046, SB-357,134, SB- 339,885, Ro 04-6790, Ro-4368554, sertindole, olanzapine, asenapine, clozapine, rosa rugosa extract, and WAY-255315 5-HT.sub.7 AS-19, 5-CT, 5-MeOT, 8-OH-DAPT, amisulpride, amitriptyline, amoxapine, aripiprazole, E-55888, E-57431, LP- clomipramine, clozapine, DR-4485, 12, LP-44, MSD-5a, RA-7, and N,N- fluphenazine, fluperlapine, ICI Dimethyltryptamine 169,369, imipramine, ketanserine, JNJ-18038683, loxapine, lurasidone, LY-215,840, maprotiline, methysergide, mesulergine, mianserin, olanzepine, pimozide, ritanserin, SB-258,719, SB-258,741, SB-269,970, SB-656,104-A, SB- 691,673, sertindole, spiperone, tenilapine, TFMPP, vortioxetine, trifluoperazine, ziprasidone, and zotepine Non-selective 5-HT chlorpromazine, cyproheptadine, antagonists pizotifen, oxetorone, spiperone, ritanserin, parachlorophenylalanine, metergoline, propranolol, mianserin, carbinoxamine, methdilazine, promethazine, pizotifen, oxatomide, feverfew, fenclon in, and reserpine

    TABLE-US-00015 TABLE 9G GLUATAMATE RECEPTOR AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist Ionotropic AMPA, glutamic acid, ibotenic acid, AP5, AP7, CPPene, selfotel, HU-211, (GRIA-14, kainic acid, NMDA, quisqualic acid Huperzine A, gabapentin, GRIK1-5, and remacemide, amantadine, GRIN1-3B) atomoxetine, AZD6765, agmatine, chloroform, dextrallorphan, dextromethorphan, dextrorphan, diphenidine, dizocilpine (MK-801), ethanol, eticyclidine, gacyclidine, ibogaine, ifenprodil, ketamine, kynurenic acid, memantine, magnesium, methoxetamine, nitromemantine, nitrous oxide, PD- 137889, perampanel, phencyclidine, rolicyclidine, tenocyclidine, methoxydine, tiletamine, neramexane, eliprodil, etoxadrol, dexoxadrol, WMS- 2539, NEFA, delucemine, 8A-PDHQ, aptiganel, rhynchophylline Metabotropic L-AP4, ACPD, L-QA, CHPG, LY- AIDA, fenobam, MPEP, LY-367,385, (GRM1-8) 379,268, LY-354,740, ACPT, VU EGLU, CPPG, MAP4, MSOP, LY- 0155041 341,495 Glycine rapastinel, NRX-1074, 7- antagonists chlorokynurenic acid, 4- chlorokynurenine, 5,7- dichlorokynurenic acid, kynurenic acid, TK-40, 1- aminocyclopropanecarboxylic acid (ACPC), L-phenylalanine, and xenon

    TABLE-US-00016 TABLE 9H HISTAMINE AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist Non-selective histamine dihydrochloride, HTMT dimaleate, 2-pyridylethlyamine dihydrochloride H.sub.1 acrivastine, azelastine, astemizole, bilastine, bromodiphenhydramine, brompheniramine, buclizine, carbinoxamine, cetirizine, cetirizine dihydrochloride, clemastine fumarate, clemizole hydrochloride, chlorodiphenhydramine, chlorphenamine, chlorpromazine, clemastine, cyclizine, cyproheptadine, dexbrompheniramine, dexchlorpheniramine, dimenhydrinate, dimethindene maleate, dimetindene, diphenhydramine, diphenhydramine hydrochloride, doxepin hydrochloride, doxylamine, ebastine, embramine, fexofenadine, fexofenadine hydrochloride, hydroxyzine, ketotifen fumarate, loratadine, meclizine, meclizine dihydrochloride, mepyramine maleate, mirtazapine, olopatadine, olopatadine hydrochloride, orphenadrine, phenindamine, pheniramine, phenyltoloxamine, promethazine, quetiapine, rupatadine, terfenadine, tripelennamine, zotepine, trans- triprolidine hydrochloride, and triprolidine H.sub.1 inverse agonists cetirizine, levocetirizine, desloratadine, and pyrilamine H.sub.2 betazole, impromidine, dimaprit aminopotentidine, cimetidine, dihydrochloride, and amthamine famotidine, ICI 162,846, lafutidine, dihyrdobromide nizatidine, ranitidine, ranitidine hyrdochloride, roxatidine, zolantadine dimaleate, and toitidine H.sub.3 imetit dihydropbromide, immepip clobenpropit, clobenpropit dihyrdrobromide, immethridine dihydrobromide, A 3314440 dihydrobromide, α-Methylhistamine dihyrdochloride, BF 2649 dihydrobromide, N-methylhistamine hydrochloride, carcinine dihydrochloride, proxyfan oxalate, ditrifluoroacetate, ABT-239, ciprofaxin, and betahistine conessine, GT 2016, A-349,821, impentamine dihydrobromide, iodophenpropit dihydrobromide, JNJ 10181457 dihydrochloride, JNJ 5207852 dihydrochloride, ROS 234 dioxalate, SEN 12333, VUF 5681 dihydrobromide, and thioperamide H.sub.4 imetit dihydropbromide, immepip thioperamide, JNJ 7777120, A 943931 dihyrdrobromide, 4-methylhistamine dihydrochloride, A 987306, JNJ dihydrochloride, clobenpropit 10191584 maleate, and VUF-6002 dihydrobromide, VUF 10460, and VUF 8430 dihydrobromide

    TABLE-US-00017 TABLE 9I CANNABINOID AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist Cannabinoid receptor Anandamide, N-Arachidonoyl (non-selective) dopamine, 2-Arachidonoylglycerol (2-AG), 2-Arachidonyl glyceryl ether, Δ-9-Tetrahydrocannabinol, EGCG, Yangonin, AM-1221, AM-1235, AM- 2232, UR-144, JWH-007, JWH-015, JWH-018, ACEA, ACPA, arvanil, CP 47497, DEA, leelamine, methanandamide, NADA, noladin ether, oleamide, CB 65, GP-1a, GP- 2a, GW 405833, HU 308, JWH-133, L-759,633, L-759,656, LEI 101, MDA 19, and SER 601 CB.sub.1 receptor ACEA, ACPA, RVD-Hpα, (R)-(+)- rimonabant, cannabidiol, Δ.sup.9- methanandamide tetrahydrocannabivarin (THCV), taranabant, otenabant, surinabant, rosonabant, SLV-319, AVE1625, V24343, AM 251, AM 281, AM 6545, hemopressin, LY 320135, MJ 15, CP 945598, NIDA 41020, PF 514273, SLV 319, SR 1141716A, and TC-C 14G CB.sub.2 receptor CB 65, GP 1a, GP 2a, GW 405833, cannabidiol, Δ.sup.9- HU 308, JWH 133, L-759,656, L- tetrahydrocannabivarin (THCV), AM 759,633, SER 601, LEI 101 630, COR 170, JTE 907, and SR 144528

    TABLE-US-00018 TABLE 9J PURINERGIC RECEPTOR AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist ADORA1 (P1 Adenosine, N6-Cyclopentyladenosine, Caffeine, theophylline, 8- adenosine receptor) N6-3-methoxyl-4-hydroxybenzyl Cyclopentyl-1,3-dimethylxanthine adenine riboside (B2), CCPA, (CPX), 8-Cyclopentyl-1,3- tecadenoson, selodenoson, Certain dipropylxanthine (DPCPX), 8- Benzodiazepines and Barbiturates, 2′- Phenyl-1,3-dipropylxanthine, MeCCPA, GR 79236, and SDZ WAG bamifylline, BG-9719, BG09928, FK- 994 453, FK838, rolofylline, N-0861, and PSB 36 ADORA2A (P1 Adenosine, N6-3-methoxyl-4- Caffeine, theophylline, istradefylline, adenosine receptor) hydroxybenzyl adenine riboside (B2), SCH-58261, SCH-442,416, ATL- YT-146, DPMA, UK-423,097, 444, MSX-3, preladenant, SCH- limonene, NECA, CV-3146, 412,348, VER-6623, VER-6947, binodenoson, ATL-146e, CGS-21680, VER-7835, vipadenant, and ZM- and Regadenoson 241,385 ADORA2B (P1 Adenosine, 5′-N- Caffeine, theophylline, CVT-6883, adenosine receptor) ethylcarboxamidoadenosine, BAY 60- ATL-801, compound 38, MRS-1706, 6583, LUF-5835, NECA, (S)- MRS-1754, OSIP-339,391, PSB- PHPNECA, and LUF-5845 603, PSB-0788, and PSB-1115 ADORA3 (P1 Adenosine, 2-(1-Hexynyl)-N- Caffeine, theophylline, MRS-1191, adenosine receptor) methyladenosine, CF-101 (IB-MECA), MRS-1220, MRS-1334, MRS-1523, CF-102, 2-CI-IB-MECA, CP-532,903, MRS-3777, MRE3008F20, inosine, LUF-6000, and MRS-3558 MRE3005F20, OT-7999, SSR161421, KF-26777, PSB-10, PSB-11, and VUF-5574 P2Y receptor ATP, ADP, UTP, UDP, UDP-glucose, clopidogrel, elinogrel, prasugrel, 2-methylthioladenosine 5′ diphosphate ticlopidine, ticagrelor, AR-C (2-MeSADP), lysophosphatidic acid, 118925XX, AR-C 66096, AR-C PSB 1114, PSB 0474, NF 546, MRS 69931, AZD 1283, MRS 2179, MRS 2365, MRS 2690, MRS 2693, MRS 2211, MRS 2279, MRS 2500, MRS 2768, MRS 2905, MRS 2957, MRS 2578, NF 157, NF 340, PPADS, 4062, and denufosol (P2Y.sub.2 agonist) PPTN hydrochloride, PSD 0739, SAR 216471, and suramin P2X receptor ATP A 438079, A 740003, A 804598, A 839977, AZ 10606120, AZ 11645373, 5-BDBD, BX 430, Evans Blue, JNJ 47965567, KN-62, NF 023, NF 110, NF 157, NF 279, NF 449, PPADS, iso-PPADS, PPNDS, Ro 0437626, Ro 51, RO-3, TC-P 262, suramin, TNP-ATP, and P2X.sub.7 antagonists NF279, calmidazolium, and KN-62

    TABLE-US-00019 TABLE 10 NEUROTRANSMISSION MODULATORS Type Modulators Norepinephrine reuptake inhibitors amedalin, atomoxetine, CP-39,332, daledalin, (increase adrenergic neurotransmission) edivoxetine, esreboxetine, lortalamine, nisoxetine, reboxetine, talopram, talsupram, tandamine, viloxazine, bupropion, ciclazindol, manifaxine, maprotiline, radafaxine, tapentadol, teniloxazine, protriptyline, nortriptyline, and desipramine Norepineprhine-dopamine reuptake inhibitors amineptine, bupropion, desoxypipradrol, (increase adrenergic and dopamine dexmethylphenidate, difemetorex, diphenylprolinol, neurotransmission) ethylphenidate, fencamfamine, fencamine, lefetamine, methylenedioxypyrovalerone, methylphenidate, nomifensine, O-2172, oxolinic acid, pipradrol, prolintane, pyrovalerone, tametraline, and WY-46824 Serotonin-norepinephrine-dopamine reuptake mazindol, nefazodone, sibutramine, venlafaxine, inhibitors (SNDRIs) and serotonin-norepinephrine esketamine, duloxetine, ketamine, phencyclidine, reuptake inhibitors (SNRIs) tripelennamine, mepiprazole, amitifadine, AN788, (increase adrengergic, dopamine, and serotonin ansofaxine, centanafadine, atomoxetine, neurotransmission) desvenlafaxine, milnacipran, levomilnacipran, dasotraline, Lu AA34893, Lu AA37096, NS-2360, tedatioxetine, tesofensine, bicifadine, BMS- 866,949, brasofensine, diclofensine, DOV-216,303, EXP-561, liafensine, NS-2359, RG-7166, SEP- 227,162, SEP-228,425, SEP-228,432, naphyrone, 3,3-Diphenylcyclobutanamine, 3,4- Dichlorotametraline, D-161, desmethylsertraline, DMNPC, DOV-102,677, fezolamine, GSK1360707F, indatraline, JNJ-7925476, JZ-IV- 10, JZAD-IV-22, LR-5182, methylnaphthidate, MI-4, PRC200-SS, PRC050, PRC025, SKF-83,959, TP1, phenyltropanes (e.g., WF-23, dichloropane, and RTI-55), Ginkgo biloba extract, St John's Wort, hyperforin, adhyperforin, and uliginosin B Dopamine reuptake inhibitors Dopamine reuptake inhbiitors (e.g., altropane, (increase dopamine neurotransmission) amfonelic acid, amineptine, BTCP, 3C-PEP, DBL- 583, difluoropine, GBR-12783, GBR-12935, GBR- 13069, GBR-13098, GYKI-52895, lometopane, methylphenidate, ethylphenidate, modafinil, armodafinil, RTI-229, vanoxerine, adrafinil, benztropine, bupropion, fluorenol, medifoxamine, metaphit, rimcazole, venlafaxine, Chaenomeles speciosa, and oroxylin A), dopamine releasing agents (e.g., p-Tyramine), dextroamphetamine, lisdexamfetamine, dexmethylphenidate, and cathinone Dopamine prodrugs Levopoda, docarpamine (increase dopamine neurotransmission) GABA reuptake inhibitors CL-996, deramciclane, gabaculine, guvacine, (increase GABA neurotransmission) nipecotic acid, NNC-711, NNC 05-2090, SKF- 89976A, SNAP-5114, tiagabine, and hyperforin GABA analogs gabapentin, butyric acid, valproic acid, valpromide, (increase GABA neurotransmission) valnoctamide, 3-hydroxybutanal, GHB, sodium, oxybate, aceburic acid, GBL, GHBAL, GHV, GVL, GHC, GCL, HOCPCA, UMB68, pregabalin, tolibut, phaclofen, sacolfen, arecaidine, gaboxadol, isonipecotic acid, 3-Methyl-GABA, AABA, BABA, DAVA, GAVA, Glutamic acid, hopantenic acid, piracetam, and vigabatrin GABA prodrugs L-Glutamine, N-lsonicotinoyl-GABA, picamilon, (increase GABA neurotransmission) progabide, tolgabide Acetylcholinesterase inhibitors carbamates, physostigmine, neostigmine, (increase nicotinic and muscarinic pyridostigmine, ambenonium, demecarium, neurotransmission) rivastigmine, phenanthrene derivatives, galantamine, caffeine, rosmarinic acid, alpha- pinene, piperidines, donepezil, tacrine, edrophonium, Huperzine A, ladostigil, ungeremine, lactucopicrin, dyflos, echothiophate, parathion, and quasi-irreversible acetylcholinesterase inhibitors Serotonin reuptake inhibitors alaproclate, cericlamine, citalopram, dapoxetine, (increase serotonin neurotransmission) escitalopram, femoxetine, fluoxetine, fluvoxamine, ifoxetine, indalpine, omiloxetine, panuramine, paroxetine, pirandamine, RTI-353, sertraline, zimelidine, desmethylcitalopram, didesmethylcitalopram, seproxetine ((S)- norfluoxetine), desvenlafaxine, cianopramine, litoxetine, lubazodone, SB-649,915, trazodone, vilazodone, vortioxetine, dextromethorphan, dextropropoxyphene, dimenhydrinate, diphenhydramine, mepyramine (pyrilamine), mifepristone, delucemine, mesembrenone, mesembrine, roxindole, duloxetine, levomilnacipran, milnacipran, dapoxetine, sibutramine, chlorpheniramine, dextropmethorphan, and methadone Serotonin releasing agents chlorphentermine, cloforex, dexfenfluramine, (increase serotonin neurotransmission) etolorex, fenfluramine, flucetorex, indeloxazine, levofenfluramine, tramadol, carbamazepine, amiflamine (FLA-336), viqualine (PK-5078), 2- Methyl-3,4-methylenedioxyamphetamine (2-Methyl- MDA), 3-Methoxy-4-methylamphetamine (MMA), 3- Methyl-4,5-methylenedioxyamphetamine (5-Methyl- MDA), 3,4-Ethylenedioxy-N-methylamphetamine (EDMA), 4-Methoxyamphetamine (PMA), 4- Methoxy-N-ethylamphetamine (PMEA), 4-Methoxy- N-methylamphetamine (PMMA), 4- Methylthioamphetamine (4-MTA), 5-(2- Aminopropyl)-2,3-dihydrobenzofuran (5-APDB), 5- Indanyl-2-aminopropane (IAP), 5-Methoxy-6- methylaminoindane (MMAI), 5-Trifluoromethyl-2- aminoindane (TAI), 5,6-Methylenedioxy-2- aminoindane (MDAI), 5,6-Methylenedioxy-N- methyl-2-aminoindane (MDMAI), 6-Chloro-2- aminotetralin (6-CAT), 6-Tetralinyl-2-aminopropane (TAP), 6,7-Methylenedioxy-2-aminotetralin (MDAT), 6,7-Methylenedioxy-N-methyl-2-aminotetralin (MDMAT), N-Ethyl-5-trifluoromethyl-2-aminoindane (ETAI), N-Methyl-5-indanyl-2-aminopropane, aminorex, MDMA, MDEA, MDA, MBDB, and tryptamines, such as DMT, αMT, 5MeO-NMT, NMT, NETP, Dimethyl-Serotonin, 5MeO-NET, αET and αMT Excitatory amino acid reuptake inhibitors didydrokanic acid, WAY-213,613, L-trans-2,4-PDC, (increase Glutamate receptor neurotransmission) amphetamine, and L-Theanine Glycine reuptake inhibitors bitopertin, Org 24598, Org 25935, ALX-5407, (increase Glutamate receptor neurotransmission) sacrosine, Org 25543, and N-arachidonylglycerine Histidine decarboxylase inhibitors Tritoqualine, catechin (decrease histamine neurotransmission) Endocannabinoid enhancers AM404, fatty acid amide hydrolase inhibitors (e.g., (increase cannabinoid neurotransmission) AM374, ARN2508, BIA 10-2472, BMS-469908, CAY-10402, JNJ-245, JNJ-1661010, JNJ- 28833155, JNJ-40413269, JNJ-42119779, JNJ- 42165279, MK-3168, MK-4409, MM-433593, OL- 92, OL-135, PF-622, PF-750, PF-3845, PF- 04457845, PF-04862853, RN-450, SA-47, SA-73, SSR-411298, ST-4068, TK-25, URB524, URB597, URB694, URB937, VER-156084, and V-158866 Monoacylglycerol lipase inhibitors N-arachidonoyl maleimide, JZL184 (increase cannabinoid neurotransmission) Endocannabinoid transporter inhibitors SB-FI-26 (increase cannabinoid neurotransmission) Endocannabinoid reuptake inhibitors AM404, AM1172, LY-2183240, O-2093, OMDM-2, (increase cannabinoid neurotransmission) UCM-707, VDM-11, guineensine, ETI-T-24_B_I, WOBE437, and RX-055 Adenosine uptake inhibitors cilostazol, dilazep, and dipyramidole (increase purinergic neurotransmission) Nucleoside transporter inhibitors 8MDP, Decynium 22, 5-iodotubercidin, NBMPR, (increase purinergic neurotransmission) and TC-T 6000

    [0302] In some embodiments, the neurotransmission blocker is a neurotoxin listed in Table 11, or a functional fragment or variant thereof. Neurotoxins include, without limitation, convulsants, nerve agents, parasympathomimetics, and uranyl compounds. Neurotoxins may be bacterial in origin, or fungal in origin, or plant in origin, or derived from a venom or other natural product. Neurotoxins may be synthetic or engineered molecules, derived de novo or from a natural product. Suitable neurotoxins include but are not limited to botulinum toxin and conotoxin. Exemplary neurotoxins are listed in Table 11.

    TABLE-US-00020 TABLE 11 NEUROTOXINS NEUROTOXINS 2,4,5-Trihydroxyamphetamine Grayanotoxin 2,4,5-Trihydroxymethamphetamine Hainantoxin 3,4-Dichloroamphetamine Halcurin 5,7-Dihydroxytryptamine Hefutoxin 5-Iodowillardiine Helothermine Ablomin Heteroscodratoxin-1 Aconitine Histrionicotoxin Aconitum Homoquinolinic acid Aconitum anthora Hongotoxin AETX Huwentoxin Agelenin Ibotenic acid Agitoxin Ikitoxin Aldrin inhibitor cystine knot Alpha-Methyldopamine Jingzhaotoxin Alpha-neurotoxin Kainic acid Altitoxin Kaliseptine Anatoxin-a Kappa-bungarotoxin Androctonus australis hector Kodaikanal mercury poisoning insect toxin Anisatin Kurtoxin Anthopleurin Latrotoxin Antillatoxin Lq2 Anuroctoxin Maitotoxin Apamin Margatoxin Arum italicum Maurotoxin Arum maculatum Mercury (element) Babycurus toxin 1 Methanol Batrachotoxin Meth iocarb BDS-1 MPP+ Bestoxin MPTP Beta-Methylamino-L-alanine Nemertelline BgK Neosaxitoxin Birtoxin Nicotine BmKAEP N-Methylconiine BmTx3 Oenanthotoxin BotlT2 Oxalyldiaminopropionic acid BotlT6 Oxidopamine Botulinum toxin Oxotoxin Brevetoxin Pahutoxin Bukatoxin Palytoxin Butantoxin Pandinotoxin Calcicludine Para-Bromoamphetamine Calciseptine Para-Chloroamphetamine Calitoxin Para-Chloromethamphetamine Caramboxin Para-Iodoamphetamine Carbon disulfide Penitrem A CgNa toxin Phaiodotoxin Charybdotoxin Phenol Cicutoxin Phoneutria nigriventer toxin-3 Ciguatoxin Phrixotoxin Cll1 Polyacrylamide Clostridium botulinum Poneratoxin Conantokins Psalmotoxin Conhydrine Pumiliotoxin Coniine Quinolinic acid Conotoxin Raventoxin Contryphan Resiniferatoxin CssII Samandarin CSTX Saxitoxin Curare Scyllatoxin Cyanide poisoning Sea anemone neurotoxin Cylindrospermopsin Slotoxin Cypermethrin SNX-482 Delta atracotoxin Stichodactyla toxin Dendrotoxin Taicatoxin Dieldrin Taipoxin Diisopropyl fluorophosphates Tamapin Dimethylmercury Tertiapin Discrepin Tetanospasmin Domoic acid Tetraethylammonium Dortoxin Tetramethylenedisulfotetramine DSP-4 Tetrodotoxin Ergtoxin Tityustoxin Falcarinol Tricresyl phosphate Fenpropathrin TsIV Gabaculine Vanillotoxin Ginkgotoxin Veratridine Grammotoxin

    [0303] Antibodies

    [0304] Neurotransmission modulators also include antibodies that bind to neurotransmitters or neurotransmitter receptors listed in Tables 7 and 8 and decrease neurotransmission. These antibodies include blocking and neutralizing antibodies. Antibodies to neurotransmitters or neurotransmitter receptors listed in Tables 7 and 8 can be generated by those of skill in the art using well established and routine methods.

    [0305] Neuronal Growth Factor Modulators

    [0306] In some embodiments, the α6*nAChR inhibitor is administered with a neuronal growth factor modulator (e.g., an agent that decreases or increases neurogenic/axonogenic signals, e.g., a neuronal growth factor or neuronal growth factor mimic, or an agonist or antagonist of a neuronal growth factor or neuronal growth factor receptor). For example, the neuronal growth factor modulator is a neuronal growth factor listed in Table 12, e.g., a neuronal growth factor having the sequence referenced by accession number or Entrez Gene ID in Table 12, or an analog thereof, e.g., a sequence having at least 75%, 80%, 85%, 90%, 90%, 98%, 99% identity to the sequence referenced by accession number or Entrez Gene ID in Table 12. Neuronal growth factor modulators also include agonists and antagonists of neuronal growth factors and neuronal growth factor receptors listed in Table 12. A neuronal growth factor modulator may increase or decrease neurogenesis, neuronal growth, neuronal differentiation, neurite outgrowth, synapse formation, synaptic maturation, synaptic refinement, or synaptic stabilization. Neuronal growth factor modulators regulate tissue innervation (e.g., innervation of a tumor) and the formation of synaptic connections between two or more neurons and between neurons and non-neural cells (e.g., between neurons and cancer cells). A neuronal growth factor modulator may block one or more of these processes (e.g., through the use of antibodies that block neuronal growth factors or their receptors) or promote one or more of these processes (e.g., through the use of neuronal growth factors or analogs thereof). Neuronal growth factor modulators can increase or decrease one of the above mentioned processes by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 200%, 500% or more.

    [0307] In some embodiments, the neuronal growth factor modulator is one that increases neurogenic/axonogenic signals, e.g., the method includes administering to the subject or contacting a cell with a neuronal growth factor modulator in an amount and for a time sufficient to increase neurogenesis or axonogenesis. For example, the neuronal growth factor modulator that leads to an increase in neurogenesis or axonogenesis is a neurotrophic factor. Relevant neurotrophic factors include NGF, BDNF, ProNGF, Sortilin, TGFβ and TGFβ family ligands and receptors (e.g., TGFβR1, TGFβR2, TGFβ1, TGFβ2 TGFβ4), GFRα family ligands and receptors (e.g., GFRα1, GFRα2, GFRα3, GFRα4, GDNF), CNTF, LIF, neurturin, artemin, persephin, neurotrophin, chemokines, cytokines, and others listed in Table 12. Receptors for these factors may also be targeted, as well as downstream signaling pathways including Jak-Stat inducers, and cell cycle and MAPK signaling pathways. In some embodiments, the neuronal growth factor modulator increases neurogenesis, axonogenesis or any of the processes mentioned above by administering, locally delivering, or stabilizing a neuronal growth factor listed in Table 12, or by upregulating, agonizing, or stabilizing a neuronal growth factor receptor listed in Table 12. In some embodiments, the neuronal growth factor modulator increases neurogenesis, axonogenesis or any of the processes mentioned above by stabilizing, agonizing, overexpressing, or upregulating a signaling protein encoded by a gene that is downstream of a neuronal growth factor. In some embodiments, the neuronal growth factor modulator increases neurogenesis, axonogenesis or any of the processes mentioned above by stabilizing, overexpressing, or upregulating a synaptic or structural protein. Neurogenesis, axonogenesis, neuronal growth, neuronal differentiation, neurite outgrowth, synapse formation, synaptic maturation, synaptic refinement, or synaptic stabilization can be increased in the subject at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80% or more, compared to before the administration. Neurogenesis, axonogenesis, neuronal growth, neuronal differentiation, neurite outgrowth, synapse formation, synaptic maturation, synaptic refinement, or synaptic stabilization can be increased in the subject between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%.

    [0308] In some embodiments, the neuronal growth factor modulator decreases neurogenic/axonogenic signals, e.g., the method includes administering to the subject or contacting a cell with a neuronal growth factor modulator in an amount and for a time sufficient to decrease neurogenesis, axonogenesis, or innervation. For example, the neuronal growth factor modulator that leads to a decrease in neurogenesis or axonogenesis is a blocking or neutralizing antibody against a neurotrophic factor. Relevant neurotrophic factors include NGF, BDNF, ProNGF, Sortilin, TGFβ and TGFβ family ligands and receptors (e.g., TGFβR1, TGFβR2, TGFβ1, TGFβ2 TGFβ4), GFRα family ligands and receptors (e.g., GFRα1, GFRα2, GFRα3, GFRα4, GDNF), CNTF, LIF, neurturin, artemin, persephin, neurotrophin, chemokines, cytokines, and others listed in Table 12. Receptors for these factors can also be targeted, as well as downstream signaling pathways including Jak-Stat inducers, and cell cycle and MAPK signaling pathways. In some embodiments, the neuronal growth factor modulator decreases neurogenesis, axonogenesis or any of the processes mentioned above by sequestering, blocking, antagonizing, degrading, or downregulating a neuronal growth factor or a neuronal growth factor receptor listed in Table 12. In some embodiments, the neuronal growth factor modulator decreases neurogenesis, axonogenesis or any of the processes mentioned above by blocking or antagonizing a signaling protein that is downstream of a neuronal growth factor. In some embodiments, the neuronal growth factor modulator decreases neurogenesis, axonogenesis or any of the processes mentioned above by blocking, disrupting, or antagonizing a synaptic or structural protein. Neurogenesis, axonogenesis, neuronal growth, neuronal differentiation, neurite outgrowth, synapse formation, synaptic maturation, synaptic refinement, synaptic stabilization, or tissue innervation can be decreased in the subject at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80% or more, compared to before the administration. Neurogenesis, axonogenesis, neuronal growth, neuronal differentiation, neurite outgrowth, synapse formation, synaptic maturation, synaptic refinement, synaptic stabilization, or tissue innervation can be decreased in the subject between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%. Neuronal growth factor blockers can be administered in any of the modalities described herein (e.g., antibody, small molecule, nucleic acid, polypeptide, or viral vector).

    [0309] In some embodiments, the neuronal growth factor modulator decreases the number of nerves in an affected tissue. For example, the subject has cancer (e.g., the subject has a highly innervated tumor). For example, the neuronal growth factor blocker is administered in an amount and for a time sufficient to decrease neurogenesis/axonogenesis.

    [0310] Neuronal growth factor blockers include antibodies that bind to neuronal growth factors or neuronal growth factor receptors and decrease their signaling (e.g., blocking antibodies). Exemplary neuronal growth factor blocking antibodies are listed below in Table 13. Antibodies to neuronal growth factors listed in Table 12 can also be generated by those of skill in the art using well established and routine methods.

    TABLE-US-00021 TABLE 12 NEURONAL GROWTH FACTORS Accession Entrez Gene Type Number Gene ID ARTN Ligand Q5T4W7 9048 BDNF Ligand P23560 627 BDNF-AS Ligand 497258 BEX1 Signaling Q9HBH7 55859 BEX3 Signaling Q00994 27018 CD34 Receptor P28906 947 CDNF Ligand Q49AH0 441549 CNTF Ligand P26441 1270 CNTFR Receptor P26992 1271 CRLF1 Receptor O75462 9244 CSPG5 Ligand O95196 10675 DCLK1 Signaling O15075 9201 DISC1 Signaling Q9NRI5 27185 DNAJC5 Signaling Q9H3Z4 80331 DPYSL2 Signaling Q16555 1808 DVL1 Signaling O14640 1855 EFNA5 Ligand P52803 1946 EGR3 Signaling Q06889 1960 ENO2 Signaling P09104 2026 EphA1 Receptor P21709 2041 EphA10 Receptor Q5JZY3 284656 EphA2 Receptor P29317 1969 EphA3 Receptor P29320 2042 EphA4 Receptor P29317 2043 EphA5 Receptor P54756 2044 EphA6 Receptor Q9UF33 285220 EphA7 Receptor Q15375 2045 EphA8 Receptor P29322 2046 EphB1 Receptor P54762 2047 EphB2 Receptor P29323 2048 EphB3 Receptor P54753 2049 EphB4 Receptor P54760 2050 EphB6 Receptor O15197 2051 ETBR2 Receptor O60883 9283 FSTL4 Receptor Q6MZW2 23105 GDNF Ligand P39905 2668 GFRA1 Receptor P56159 2674 GFRA2 Receptor O00451 2675 GFRA3 Receptor O60609 2676 GFRA4 Receptor Q9GZZ7 64096 GPR37 Receptor O15354 2861 GPRIN1 Signaling Q7Z2K8 114787 GPRIN2 Signaling O60269 9721 GPRIN3 Signaling Q6ZVF9 285513 GRB2 Signaling P62993 2885 GZF1 Signaling Q9H116 64412 IFNA1 Ligand P01562 3439 IGF1 Ligand P05019 3479 IGF2 Ligand P01344 3481 IL11RA Receptor Q14626 3590 IL1B Ligand P01584 3553 IL3 Ligand P08700 3562 IL4 Ligand P05112 3565 IL6 Ligand P05231 3569 IL6R Receptor P08887 3570 IL6ST Signaling P40189 3572 INS Ligand P01308 3630 L1CAM Signaling P32004 3897 LIF Ligand P15018 3976 LIFR Receptor P42702 3977 MAGED1 Signaling Q9Y5V3 9500 MANF Ligand P55145 7873 NDNF Ligand Q8TB73 79625 NENF Ligand Q9UMX5 29937 NENFP1 Ligand 106480294 NENFP2 Ligand 100129880 NENFP3 Ligand 106481703 NGF Ligand P01138 4803 NGFR Receptor P08138 4804 NRG1 Ligand Q02297 3084 NRP1 Receptor O14786 8829 NRTN Ligand Q99748 902 NTF3 Ligand P20783 4908 NTF4 Ligand P34130 4909 NTRK1 Receptor P04629 4914 NTRK2 Receptor Q16620 4915 NTRK3 Receptor Q16288 4916 PDPK1 Signaling O15530 5170 PEDF Ligand P36955 5176 PLEKHH3 Signaling Q7Z736 79990 PSAP Ligand P07602 5660 PSEN1 Signaling P49768 5663 PSPN Ligand O70300 5623 PTN Ligand P21246 5764 RELN Ligand P78509 5649 RET Signaling P07949 5979 ROR1 Receptor Q01973 4919 ROR2 Receptor Q01974 4920 RPS6KA3 Signaling P51812 6197 SDC3 Receptor O75056 9672 SEMA3E Ligand O15041 9723 SERPINE2 Ligand P07093 5270 SERPINF1 Ligand P36955 5176 SHC1 Signaling P51812 6464 SNTG1 Biosynthesis P07602 54212 SORCS1 Receptor O75056 114815 SORCS2 Receptor O15041 57537 SORCS3 Receptor P07093 22986 SORT1 Receptor Q99523 6272 SULF1 Signaling Q8IWU6 23213 SULF2 Signaling Q8IWU5 55959 TGFB1 Ligand P01137 7040 TGFB2 Ligand P61812 7042 TGFB3 Ligand P10600 7043 TMEM158 Receptor Q8WZ71 25907 TNF Ligand P01375 7124 TPM3 Receptor P06753 7170 VEGFA Ligand P15692 7422 VEGFB Ligand P49765 7423 VGF Ligand O15240 7425 XCR1 Receptor P46094 2829 ZN274 Signaling Q96GC6 10782

    TABLE-US-00022 TABLE 13 NEURONAL GROWTH FACTOR ANTIBODIES Neuronal Growth Factor Antibody Company BDNF 38B8 (agonist antibody) Pfizer BDNF 29D7 (agonist antibody) Pfizer EphA3 KB004 KaloBios Pharmaceuticals, Inc. IFNA1 Faralimomab Creative Biolabs IFNA1 Sifalimumab (MEDI-545) MedImmune IFNA1 Rontalizumab Genentech IGF Figitumumab (CP-751,871) - an Pfizer IGR-1R MAb IGF SCH717454 (Robatumamab, Merck inhibits IGF initiated phosphorylation) IGF Cixutumumab (IGF-1R antibody) Eli Lilly IGF Teprotumumab (IGF-1R Genmab/Roche blocking antibody) IGF-2 Dusigitumab MedImmune/AstraZeneca IGF-2 DX-2647 Dyax/Shire IGF Xentuzumab Boehringer Ingelheim/Eli Lilly IGF Dalotuzumab (IGFR1 blocking Merck & Co. antibody) IGF Figitumumab (IGFR1 blocking Pfizer antibody) IGF Ganitumab (IGFR1 blocking Amgen antibody) IGF Robatumumab (IGFR1 blocking Roche/Schering-Plough antibody) IL1B Canakinumab Novartis IL1B APX002 Apexigen IL1B Gevokizumab XOMA IL4 Pascolizumab GlaxoSmithKline IL4 Dupilumab Regeneraon/Sanofi IL6 Siltuximab Janssen Biotech, Inc. IL6 Olokizumab UCB/R-Pharm IL6 Elsilimomab Orphan Pharma International IL6 Sirukumab Centocor IL6 Clazakizumab Bristol Myers Squib/Alder Biopharmaceuticals IL6 Gerilimzumab (ARGX-109) arGEN-X/RuiYi IL6 FE301 Ferring Pharmaceuticals IL6 FM101 Femta Pharmaceuticals IL-6R Sarilumab (directed against Regeneron/Sanofi IL6R) IL-6R Tocilizumab Hoffmann-La Roche/Chugai IL-6R Sapelizumab Chugai IL-6R Vobarilizumab Ablynx L1CAM AB417 Creative biolabs L1CAM L1-9.3 Creative biolabs L1CAM L1-14.10 Biolegend NGF Tanezumab Pfizer NGF Fulranumab (JNJ-42160443), Amgen NGF MNAC13 (anti-TrkA, the NGF Creative Biolabs receptor) NGF mAb 911 Rinat/Pfizer NGF Fasinumab Regeneron/Teva NRG1 538.24 Hoffman-La Roche NRP1 Vesencumab Genentech/Roche ROR1 Cirmtuzumab Oncternal Therapeutics SAP GSK2398852 GlaxoSmithKline TGFβ Fresolimumab (pan-TGFβ Genzyme/Aventis antibody) TGFβ IMC-TR1 (LY3022859) (MAb Eli Lilly against TGFβRII) TGFβ TβM1 (anti-TGFβ1 MAb) Eli Lilly TGFβ2 Lerdelimumab (CAT-152) Genzyme TGFβ1 Metelimumab Genzyme TGFβ1 LY2382770 Eli Lilly TGFβ PF-03446962 (MAb against Pfizer TGFβRI) TNF Infliximab Janssen Biotech, Inc. TNF Adalimumab AbbVie Inc. TNF Certolizumab pegol UCB TNF Golimumab Janssen Biotech, Inc. TNF Afelimomab TNF Placulumab Teva Pharmaceutical Industries, Inc. TNF Nerelimomab Chiron/Celltech TNF Ozoralizumab Pfizer/Ablynx VEGFA Bevacizumab Genentech VEGFA Ranibizumab Genentech VEGF Alacizumab pegol (anti- UCB VEGFR2) VEGFA Brolucizumab Novartis VEGF Icrucumab (anti-VEGFR1) Eli Lilly VEGF Ramucirumab (anti-VEGFR2) Eli Lilly

    [0311] Neuronal growth factor modulators also include agents that agonize or antagonize neuronal growth factors and neuronal growth factor receptors. For example, neuronal growth factor modulators include TNF inhibitors (e.g., etanercept, thalidomide, lenalidomide, pomalidomide, pentoxifylline, bupropion, and DOI), TGFβ1 inhibitors, (e.g., disitertide (P144)), TGFβ2 inhibitors (e.g., trabedersen (AP12009)). Exemplary neuronal growth factor agonists and antagonists are listed in Table 14.

    TABLE-US-00023 TABLE 14 NEURONAL GROWTH FACTOR AGONISTS AND ANTAGONISTS Agonist Antagonist TrkA NGF, amitriptyline, and ALE-0540 gambogic amide, gambogic acid TrkB BDNF, NT3, NT4, 3,7- ANA-12, cyclotraxin B, and Dihydroxyflavone, 3,7,8,2′- gossypetin Tetrahydroxyflavone, 4′- Dimethylamino-7,8- dihydroxyflavone, 7,3′- Dihydroxyflavone, 7,8- Dihydroxyflavone, 7,8,2′- Trihydroxyflavone, 7,8,3′- Trihydroxyflavone, Amitriptyline.sup., Deoxygedunin, Diosmetin, HIOC, LM22A-4, N- Acetylserotonin, Norwogonin (5,7,8-THF), R7, LM22A4, and TDP6 Pan-Trk receptor entrectinib (RXDX-101), AG 879, GNF 5837, GW 441756, and PF 06273340 GFRα1R GDNF and XIB4035 VEGF receptor AEE 788, AG 879, AP 24534, axitinib, DMH4, GSK 1363089, Ki 8751, RAF 265, SU 4312, SU 5402, SU 5416, SU 6668, sunitinib, toceranib, vatalanib, XL 184, ZM 306416, and ZM 323881 TGFβRI galunisertib (LY2157299), TEW- 7197, SB-431542, A 83-01, D 4476, GW 788388, LY 364947, R 268712, RepSox, SB 505124, SB 525334, and SD 208

    [0312] In any of the combination therapy approaches described herein, the first and second therapeutic agent (e.g., an α6*nAChR inhibitor described herein and the additional therapeutic agent) are administered simultaneously or sequentially, in either order. The first therapeutic agent may be administered immediately, up to 1 hour, up to 2 hours, up to 3 hours, up to 4 hours, up to 5 hours, up to 6 hours, up to 7 hours, up to, 8 hours, up to 9 hours, up to 10 hours, up to 11 hours, up to 12 hours, up to 13 hours, 14 hours, up to hours 16, up to 17 hours, up 18 hours, up to 19 hours up to 20 hours, up to 21 hours, up to 22 hours, up to 23 hours up to 24 hours or up to 1-7, 1-14, 1-21 or 1-30 days before or after the second therapeutic agent.

    Diagnosis and Prognosis of α6*nAChR-Associated Cancer

    [0313] The methods described herein include methods of diagnosing or identifying patients with α6*nAChR-associated cancer. Subjects who can be diagnosed or identified as having α6*nAChR-associated cancer are subjects who have cancer (e.g., subjects identified as having cancer), or subjects suspected of having cancer. Subjects can be diagnosed or identified as having α6*nAChR-associated cancer based on screening of patient cancer samples (e.g., tumor biopsies containing immune cells or isolated immune cells, e.g., Tregs). α6*nAChR expression (e.g., gene or protein expression) can be assessed in a cancer sample isolated from a subject using standard techniques known in the art, such as immunohistochemistry, western blot analysis, quantitative RT-PCR, RNA sequencing, fluorescent in situ hybridization, cDNA microarray, and droplet digital PCR. α6*nAChR can be assessed by comparing measurements obtained from samples isolated form a subject to measurements of α6*nAChR expression obtained from a reference sample (e.g., an immune cell of the same type from a subject that does not have cancer or a cell that does not express α6*nAChR, e.g., a HEK cell). Reference samples can be obtained from healthy subjects (e.g., subjects without cancer. Reference samples can be obtained from healthy subjects (e.g., subjects without cancer), or they can be obtained from databases in which average measurements of α6*nAChR expression are cataloged for immune cells from healthy subjects (e.g., subjects without cancer).

    [0314] Subjects are diagnosed or identified as having α6*nAChR-associated cancer if α6*nAChR expression (e.g., gene or protein expression) is elevated in the cancer sample compared to the reference sample. An increase of α6*nAChR expression of 1.1-fold or more (e.g., 1.1, 1.2, 1.3, 1.4, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0-fold or more) in the cancer sample compared to the reference indicates that the subject has α6*nAChR-associated cancer. Subjects diagnosed or identified as having α6*nAChR-associated cancer can be treated with the methods and compositions described herein (e.g., α6*nAChR inhibitors). Subjects with cancer can also be treated with the methods and compositions described herein if an immune cell from the subject (e.g., an immune cell from a tumor biopsy or an isolated immune cell, e.g., a Treg) is found to express α6*nAChR.

    [0315] The methods described herein also include methods of predicting patient response (e.g., the response of cancer in a subject) to α6*nAChR inhibitors in order to determine whether α6*nAChR inhibitors can be used for cancer treatment. In some embodiments, a cancer sample (e.g., a tumor biopsy containing immune cells or an isolated immune cell, e.g., a Treg) is isolated from a subject and contacted with one or more α6*nAChR inhibitors or α6*nAChR-specific inhibitors (e.g., samples are cultured and contacted with one or more inhibitors in vitro). The response of the sample to the one or more α6*nAChR inhibitors or α6*nAChR-specific inhibitors is evaluated to predict response to treatment. Responses that are evaluated include: cancer cell or tumor growth, cancer cell or tumor proliferation, cancer cell or tumor migration, cancer cell or tumor metastasis, cancer cell or tumor invasion, cancer cell or tumor death, cancer cell autophagy, immune cell migration, proliferation, recruitment, tumor homing, tumor egress, differentiation, activation, polarization, cytokine production, or immune cell α6*nAChR expression or copy number. A decrease of at least 5% or more (e.g., 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99%, or more) in cancer cell or tumor growth, cancer cell or tumor proliferation, cancer cell or tumor migration, cancer cell or tumor metastasis, cancer cell or tumor invasion, immune cell migration, proliferation, recruitment, tumor homing, activation, polarization, cytokine production, or α6*nAChR expression or copy number in treated cells compared to untreated or control-treated cells, or an increase of at least 5% or more (e.g., 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99%, or more) in tumor egress, cancer cell death, or cancer cell autophagy in treated cells compared to untreated or control-treated cells indicates that the cancer would respond to treatment with an α6*nAChR inhibitor.

    [0316] The methods used above to diagnose or identify a subject with α6*nAChR-associated cancer can also be used to predict patient response (e.g., the response of cancer in a subject) to treatment with an α6*nAChR inhibitor. If the expression (e.g., gene or protein expression) of α6*nAChR is elevated in a sample isolated from the subject compared to a reference (e.g., 1.1, 1.2, 1.3, 1.4, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0-fold or more higher in the cancer sample compared to the reference), the subject can be predicted to respond to treatment with an α6*nAChR inhibitor. Subjects predicted to respond to treatment with an α6*nAChR inhibitor or α6*nAChR-specific inhibitor can be treated using the methods and compositions described herein (e.g., α6*nAChR inhibitors).

    Methods of Treatment

    [0317] Administration

    [0318] An effective amount of an α6*nAChR inhibitor described herein for treatment of cancer can be administered to a subject by standard methods. For example, the agent can be administered by any of a number of different routes including, e.g., intravenous, intradermal, subcutaneous, percutaneous injection, oral, transdermal (topical), or transmucosal. The α6*nAChR inhibitor can be administered orally or administered by injection, e.g., intramuscularly, or intravenously. The most suitable route for administration in any given case will depend on the particular agent administered, the patient, the particular disease or condition being treated, pharmaceutical formulation methods, administration methods (e.g., administration time and administration route), the patients age, body weight, sex, severity of the diseases being treated, the patient's diet, and the patient's excretion rate. The agent can be encapsulated or injected, e.g., in a viscous form, for delivery to a chosen site, e.g., a tumor site. The agent can be provided in a matrix capable of delivering the agent to the chosen site. Matrices can provide slow release of the agent and provide proper presentation and appropriate environment for cellular infiltration. Matrices can be formed of materials presently in use for other implanted medical applications. The choice of matrix material is based on any one or more of: biocompatibility, biodegradability, mechanical properties, and cosmetic appearance and interface properties. One example is a collagen matrix.

    [0319] The agent (e.g., α6*nAChR inhibitor, e.g., polypeptide, small molecule, nucleic acid, or antibody) can be incorporated into pharmaceutical compositions suitable for administration to a subject, e.g., a human. Such compositions typically include the agent and a pharmaceutically acceptable carrier. As used herein the term “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances are known. Except insofar as any conventional media or agent is incompatible with the active compound, such media can be used in the compositions of the invention. Supplementary active compounds can also be incorporated into the compositions.

    [0320] A pharmaceutical composition can be formulated to be compatible with its intended route of administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

    [0321] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

    [0322] Sterile injectable solutions can be prepared by incorporating the active compound (e.g., an α6*nAChR inhibitor described herein) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

    [0323] Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, or corn starch; a lubricant such as magnesium stearate; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

    [0324] Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.

    [0325] The active compounds can be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art.

    [0326] Nucleic acid molecule agents described herein can be administered directly (e.g., therapeutic mRNAs) or inserted into vectors used as gene therapy vectors. Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (see U.S. Pat. No. 5,328,470) or by stereotactic injection (see, e.g., Chen et al., PNAS 91:3054 1994). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can include a slow release matrix in which the gene delivery vehicle is embedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.

    [0327] The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.

    [0328] Methods of formulating pharmaceutical agents are known in the art, e.g., Niazi, Handbook of Pharmaceutical Manufacturing Formulations (Second Edition), CRC Press 2009, describes formulation development for liquid, sterile, compressed, semi-compressed and OTC forms. Transdermal and mucosal delivery, lymphatic system delivery, nanoparticles, controlled drug release systems, theranostics, protein and peptide drugs, and biologics delivery are described in Wang et al., Drug Delivery: Principles and Applications (Second Edition), Wiley 2016; formulation and delivery of peptide and protein agent is described, e.g., in Banga, Therapeutic Peptides and Proteins: Formulation, Processing, and Delivery Systems (Third Edition), CRC Press 2015.

    [0329] Local Administration

    [0330] The α6*nAChR inhibitors described herein can be administered locally, e.g., to the site of cancer in the subject. Examples of local administration include epicutaneous, inhalational, intra-articular, intrathecal, intravaginal, intravitreal, intrauterine, intra-lesional administration, lymph node administration, intratumoral administration and administration to a mucous membrane of the subject, wherein the administration is intended to have a local and not a systemic effect. As an example, for the treatment of a cancer described herein, the α6*nAChR inhibitor may be administered locally (e.g., intratumorally) in a compound-impregnated substrate such as a wafer, microcassette, or resorbable sponge placed in direct contact with the affected tissue. Alternatively, the α6*nAChR inhibitor is infused into the brain or cerebrospinal fluid using standard methods. As yet another example, a pulmonary cancer described herein may be treated, for example, by administering the α6*nAChR inhibitor locally by inhalation, e.g., in the form of an aerosol spray from a pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide or a nebulizer. an α6*nAChR inhibitor for use in the methods described herein can be administered at the site of a tumor, e.g., intratumorally. In certain embodiments, the agent is administered to a mucous membrane of the subject.

    [0331] Combination Therapy

    [0332] The α6*nAChR inhibitors described herein may be administered in combination with one or more additional therapies (e.g., 1, 2, 3 or more additional therapeutic agents). The two or more agents can be administered at the same time (e.g., administration of all agents occurs within 15 minutes, 10 minutes, 5 minutes, 2 minutes or less). The agents can also be administered simultaneously via co-formulation. The two or more agents can also be administered sequentially, such that the action of the two or more agents overlaps and their combined effect is such that the reduction in a symptom, or other parameter related to the disorder is greater than what would be observed with one agent or treatment delivered alone or in the absence of the other. The effect of the two or more treatments can be partially additive, wholly additive, or greater than additive (e.g., synergistic). Sequential or substantially simultaneous administration of each therapeutic agent can be effected by any appropriate route including, but not limited to, oral routes, intravenous routes, intramuscular routes, local routes, and direct absorption through mucous membrane tissues. The therapeutic agents can be administered by the same route or by different routes. For example, a first therapeutic agent of the combination may be administered by intravenous injection while a second therapeutic agent of the combination can be administered locally in a compound-impregnated microcassette. The first therapeutic agent may be administered immediately, up to 1 hour, up to 2 hours, up to 3 hours, up to 4 hours, up to 5 hours, up to 6 hours, up to 7 hours, up to, 8 hours, up to 9 hours, up to 10 hours, up to 11 hours, up to 12 hours, up to 13 hours, 14 hours, up to hours 16, up to 17 hours, up 18 hours, up to 19 hours up to 20 hours, up to 21 hours, up to 22 hours, up to 23 hours up to 24 hours or up to 1-7, 1-14, 1-21 or 1-30 days before or after the second therapeutic agent.

    [0333] For use in treating cancer, the second agent may be a checkpoint inhibitor, a chemotherapeutic drug, a biologic drug, a biologic cancer agent (e.g., an agent listed in Table 5), a cancer-specific agent (e.g., an agent listed in Table 6), a non-drug therapy, a neurotransmission blocker, or a neuronal growth factor blocker. In one embodiment, the inhibitor of checkpoint is an inhibitory antibody (e.g., a monospecific antibody such as a monoclonal antibody). The antibody may be, e.g., humanized or fully human. In other embodiments, the inhibitor of checkpoint is a fusion protein, e.g., an Fc-receptor fusion protein. In some embodiments, the inhibitor of checkpoint is an agent, such as an antibody, that interacts with a checkpoint protein. In other embodiments, the inhibitor of checkpoint is an agent, such as an antibody, that interacts with the ligand of a checkpoint protein. In one embodiment, the inhibitor of checkpoint is an inhibitor (e.g., an inhibitory antibody or small molecule inhibitor) of CTLA-4 (e.g., an anti-CTLA4 antibody such as ipilimumab or tremelimumab). In one embodiment, the inhibitor of checkpoint is an inhibitor (e.g., an inhibitory antibody or small molecule inhibitor) of PD-1 (e.g., nivolumab; pembrolizumab; pidilizumab/CT-011). In one embodiment, the inhibitor of checkpoint is an inhibitor (e.g., an inhibitory antibody or small molecule inhibitor) of PDL1 (e.g., MPDL3280A/RG7446; MED14736; MSB0010718C; BMS 936559). In one embodiment, the inhibitor of checkpoint is an inhibitor (e.g., an inhibitory antibody or Fc fusion or small molecule inhibitor) of PDL2 (e.g., a PDL2/Ig fusion protein such as AMP 224). In one embodiment, the inhibitor of checkpoint is an inhibitor (e.g., an inhibitory antibody or small molecule inhibitor) of B7-H3 (e.g., MGA271), B7-H4, BTLA, HVEM, TIM3, GAL9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK 1, CHK2, A2aR, B-7 family ligands, or a combination thereof. The second agent may also be an anti-angiogenic drug, e.g., an anti-VEGF antibody, or the second agent may be an oncolytic agent e.g., a chemotherapy, a drug that targets cancer metabolism, an antibody that marks a cancer cell surface for destruction, e.g., rituximab or trastuzumab, an antibody-drug conjugate, e.g., trastuzumab emtansine, a cell therapy, or other commonly-used anti-neoplastic agent.

    [0334] Dosing

    [0335] Subjects that can be treated as described herein are subjects with cancer or at risk of developing cancer. The cancer may be a primary tumor or a metastasized tumor. In some embodiments, the cancer is an α6*nAChR-associated cancer. Subjects who can be treated with the methods disclosed herein include subjects who have had one or more tumors resected, received chemotherapy or other pharmacological treatment for the cancer, received radiation therapy, and/or received other therapy for the cancer. Subjects who have never previously been treated for cancer can also be treated using the methods described herein.

    [0336] In some embodiments, the agent is administered in an amount and for a time effective to result in one of (or more, e.g., 2 or more, 3 or more, 4 or more of): (a) reduced tumor size, (b) reduced rate of tumor growth, (c) increased tumor cell death (d) reduced tumor progression, (e) reduced number of metastases, (f) reduced rate of metastasis, (g) reduced tumor migration, (h) reduced tumor invasion, (i) reduced tumor volume, (j) decreased tumor recurrence, (k) increased survival of subject, (I) increased progression free survival of subject.

    [0337] The methods described herein may include a step of selecting a treatment for a patient. The method includes (a) identifying (e.g., diagnosing) a patient who has cancer or is at risk of developing cancer, and (b) selecting an α6*nAChR inhibitor, e.g., an α6*nAChR inhibitor described herein, to treat the condition in the patient. In some embodiments, the method includes administering the selected treatment to the subject. In some embodiments, a patient is identified as having cancer based on imaging (e.g., MRI, CT, or PET scan), biopsy, or blood sample (e.g., detection of blood antigen markers, circulating tumor DNA (e.g., by PCR). In some embodiments, a patient is identified as having cancer after presenting with one or more symptoms of a paraneoplastic syndrome (e.g., fever, auto-antibodies directed against nervous system proteins, ataxia, dizziness, nystagmus, difficulty swallowing, loss of muscle tone, loss of fine motor coordination, slurred speech memory loss, vision loss, sleep disturbances, dementia, seizures, dysgeusia, cachexia, anemia, itching, or sensory loss in the limbs). In some embodiments, a patient presents with symptoms of paraneoplastic syndrome and is then identified as having cancer based on imaging (e.g., CT, MRI, or PET scans).

    [0338] The method may also include (a) identifying (e.g., diagnosing) a patient who has a neoplasm, (b) optionally evaluating the neoplasm for innervation, and (c) selecting an α6*nAChR inhibitor (e.g., an α6*nAChR inhibitor described herein) to treat the patient if the neoplasm is highly innervated (e.g., if the level of innervation is at least 10% higher (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80% higher) than the level of innervation in control tissue, e.g., non-cancerous tissue of the same subject). Innervation may be measured by staining tissue sections for neural markers e.g., immuno-histochemical staining for tyrosine hydroxylase, vesicular acetylcholine transporter; NGF-Inducible Large External glycoprotein, choline acetyltransferase, parvalbumin, neurofilament protein, Synapsin, synaptophysin, NeuN, NSE, MAP2, Beta III tubulin, 160 kD Neurofilament medium/200 kD Neurofilament Heavy, NSE, PSD93/PSD95, Doublecortin (DCX), c-fos, PSA-NCAM, NeuroD or Beta2, Tau, Calbindin-D28k, Calretinin, Neurofilament Protein (NFP), Glial fibrillary acidic protein (GFAP), S100β, Vimentin and CNPase; or by staining tissue sections with cell-identifying stains, e.g., H&E stain, Nissl Stain, Cresyl violet, Neutral red, Thionine and Toluidine blue, Luxol Fast blue stain, Weigert's Chromium hematoxylin method, Page's iron-eriochrome cyanine R, Dextran Conjugates (Fluorescein, Tetramethylrhodamine, Texas Red, Rhodamine Green), Hydrazides & Biocytins, Isolectin GS-IB4 conjugates, Golgi silver stain, or myelin stain; or by imaging the nervous system, e.g., by MRI, CT, PET, EEG, EMG, Myelogram, or magnetoencephalography. In some embodiments, the neoplasm is selected from: head and neck squamous cell carcinoma, adenoid cystic carcinoma, lymphoma, rhabdomyosarcoma, biliary tract cancer, gastric cancer, pancreatic cancer, prostate cancer, lung cancer, breast cancer, skin cancer (e.g., melanoma), renal cell carcinoma, or colorectal cancer. In some embodiments, the neoplasm is derived from a secretory tissue, glandular tissue, or endocrine or hormonal tissue.

    [0339] In one embodiment, the method includes (a) identifying (e.g., diagnosing) a patient who has a neoplasm, (b) optionally evaluating the neoplasm for perineural invasion, and (c) selecting an α6*nAChR inhibitor to treat the patient if the neoplasm exhibits perineural invasion. In some embodiments, the neoplasm is selected from: head and neck squamous cell carcinoma, adenoid cystic carcinoma, lymphoma, rhabdomyosarcoma, biliary tract cancer, gastric cancer, pancreatic cancer, and prostate cancer.

    [0340] In one embodiment, the method includes (a) identifying (e.g., diagnosing) a patient who has a neoplasm, (b) optionally evaluating the subject for metastasis to brain or spinal cord, and (c) selecting an α6*nAChR inhibitor to treat the patient if the neoplasm exhibits metastasis to brain or spinal cord. In some embodiments, the neoplasm is a lung cancer, breast cancer, skin cancer (e.g., melanoma), lymphoma, renal cell carcinoma, GI tract cancer, prostate cancer, or colorectal cancer.

    [0341] In one embodiment, the method includes (a) identifying (e.g., diagnosing) a patient who has cancer, (b) optionally evaluating the subject for nAChRα6 overexpression, and (c) selecting an α6*nAChR inhibitor to treat the patient if the cancer exhibits nAChRα6 overexpression (e.g., if the patient has α6*nAChR-associated cancer). In some embodiments, the neoplasm is a lung cancer, breast cancer, skin cancer (e.g., melanoma), lymphoma, renal cell carcinoma, GI tract cancer, prostate cancer, ovarian cancer, uterine cancer, head and neck cancer, esophageal cancer, mesothelioma or colorectal cancer. α6*nAChR expression can be measured in a sample of immune cells or a Treg-infiltrated tumor biopsy collected from a subject with cancer using standard techniques known in the art, such as immunohistochemistry, western blot analysis, quantitative RT-PCR, RNA sequencing, fluorescent in situ hybridization, cDNA microarray, and droplet digital PCR. A sample can be evaluated for increased expression of α6*nAChR by comparison to a reference sample (e.g., an immune cell of the same type from a subject that does not have cancer).

    [0342] In some embodiments, the method includes administering the selected treatment to the subject.

    [0343] The method may also include a step of assessing the subject for a parameter of cancer progression or remission, e.g., assessing the subject for one or more (e.g., 2 or more, 3 or more, 4 or more) of: primary tumor size (e.g., by imaging), number of metastases (e.g., by imaging or biopsy), cell death in situ (e.g., by biopsy), blood antigen markers (e.g., by ELISA), circulating tumor DNA (e.g., by PCR), or function of the affected organ (e.g., by a test of circulating enzymes for liver, albuminuria for kidney, lung capacity for lung, etc.).

    [0344] In some embodiments, the tumor is treated with an α6*nAChR inhibitor and a second therapeutic agent. The second therapeutic agent can be selected based on tumor type, tumor tissue of origin, tumor stage, tumor innervation, or mutations in genes expressed by the tumor.

    [0345] In certain embodiments, an α6*nAChR inhibitor administered according to the methods described herein does not have a direct effect on the central nervous system (CNS) or gut. Any effect on the CNS or gut is reduced compared to the effect observed if the α6*nAChR inhibitor is administered directly to the CNS or gut. In some embodiments, direct effects on the CNS or gut are avoided by modifying the α6*nAChR inhibitor not to cross the BBB, as described herein above, or administering the agent locally to a subject.

    [0346] Subjects with cancer or at risk of developing cancer are treated with an effective amount of an α6*nAChR inhibitor. The methods described herein also include contacting immune cells with an effective amount of an α6*nAChR inhibitor. In some embodiments, an effective amount of an α6*nAChR inhibitor is an amount sufficient to increase or decrease lymph node innervation, tumor innervation, the development of HEVs or TLOs, immune cell migration, proliferation, recruitment, lymph node homing, lymph node egress, differentiation, tumor homing, tumor egress, activation, polarization, cytokine production, degranulation, maturation, ADCC, ADCP, or antigen presentation. In some embodiments, an effective amount of an α6*nAChR inhibitor is an amount sufficient to increase or decrease tumor innervation or nerve activity in a tumor. In some embodiments, an effective amount of an α6*nAChR inhibitor is an amount sufficient to treat the cancer or tumor, cause remission, reduce tumor growth, volume, metastasis, migration, invasion, proliferation, or number, increase cancer cell death, increase time to recurrence, or improve survival.

    [0347] The methods described herein may also include a step of assessing the subject for a parameter of immune response, e.g., assessing the subject for one or more (e.g., 2 or more, 3 or more, 4 or more) of: Th2 cells, T cells, circulating monocytes, neutrophils, peripheral blood hematopoietic stem cells, macrophages, mast cell degranulation, activated B cells, NKT cells, macrophage phagocytosis, macrophage polarization, antigen presentation, immune cell activation, immune cell proliferation, immune cell lymph node homing or egress, T cell differentiation, immune cell recruitment, immune cell migration, lymph node innervation, dendritic cell maturation, HEV development, TLO development, or cytokine production. In embodiments, the method includes measuring a cytokine or marker associated with the particular immune cell type, as listed in Table 2 (e.g., performing an assay listed in Table 2 for the cytokine or marker). In some embodiments, the method includes measuring a chemokine, receptor, or immune cell trafficking molecule, as listed in Tables 3 and 4 (e.g., performing an assay to measure the chemokine, marker, or receptor). The assessing may be performed after the administration, before the first administration and/or during a course a treatment, e.g., after a first, second, third, fourth or later administration, or periodically over a course of treatment, e.g., once a month, or once every 3 months. In one embodiment, the method includes assessing the subject prior to treatment or first administration and using the results of the assessment to select a subject for treatment. In certain embodiments, the method also includes modifying the administering step (e.g., stopping the administration, increasing or decreasing the periodicity of administration, increasing or decreasing the dose of the α6*nAChR inhibitor) based on the results of the assessment. For example, in embodiments where increasing a parameter of immune response described herein is desired (e.g., cancer where, e.g., an increase in T cells is desired), the method includes stopping the administration if a marker of T cells is not increased at least 5%, 10%, 15%, 20%, 30%, 40%, 50% or more; or the method includes increasing the periodicity of administration if the marker of T cells is not increased at least 5%, 10%, 15%, 20%, 30%, 40%, 50% or more; or the method includes increasing the dose of the α6*nAChR inhibitor if the marker of T cells is not increased at least 5%, 10%, 15%, 20%, 30%, 40%, 50% or more.

    [0348] In certain embodiments, immune effects (e.g., immune cell activities) are modulated in a subject (e.g., a subject having a cancer or inflammatory or autoimmune condition) or in a cultured cell by at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, compared to before an administration, e.g., of a dosing regimen, of an α6*nAChR inhibitor such as those described herein. In certain embodiments, the immune effects are modulated in the subject or a cultured cell between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%, between 50-100%, between 100-500%. The immune effects described herein may be assessed by standard methods:

    [0349] The α6*nAChR inhibitors described herein are administered in an amount (e.g., an effective amount) and for a time sufficient to effect one of the outcomes described above. The α6*nAChR inhibitor may be administered once or more than once. The α6*nAChR inhibitor may be administered once daily, twice daily, three times daily, once every two days, once weekly, twice weekly, three times weekly, once biweekly, once monthly, once bimonthly, twice a year, or once yearly. Treatment may be discrete (e.g., an injection) or continuous (e.g., treatment via an implant or infusion pump). Subjects may be evaluated for treatment efficacy 1 week, 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or more following administration of an α6*nAChR inhibitor depending on the α6*nAChR inhibitor and route of administration used for treatment. Depending on the outcome of the evaluation, treatment may be continued or ceased, treatment frequency or dosage may change, or the patient may be treated with a different α6*nAChR inhibitor. Subjects may be treated for a discrete period of time (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months) or until the disease or condition is alleviated, or treatment may be chronic depending on the severity and nature of the disease or condition being treated.

    Kits

    [0350] The invention also features a kit including (a) a pharmaceutical composition including an α6*nAChR inhibitor described herein, and (b) instructions for administering the pharmaceutical composition to treat cancer.

    EXAMPLES

    [0351] The following examples are provided to further illustrate some embodiments of the present invention, but are not intended to limit the scope of the invention; it will be understood by their exemplary nature that other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used.

    Example 1—Identification of CHRNA6 on Immune Cells

    [0352] Natural Tregs were magnetically isolated from human PBMC using a human CD4+CD127low CD25+ regulatory T cell isolation kit (StemCell Technologies). Naïve CD4+ T cells were isolated from human PBMCs using negative magnetic bead selection (Stemcell Technologies). To generate inducible Tregs, naïve CD4+ cells were resuspended in 1 ml of T cell expansion and differentiation media (Stemcell Technologies). Cells were activated with human CD3/CD28 T cell activator (StemCell). Cells were lysed and RNA was extracted (Qiagen).

    [0353] RNA was sequenced at the Broad Technology Labs (BTL) at the Broad Institute using their Smart-Seq2 protocol, a protocol for full-length transcript sequencing from single cells. Smart-Seq2 libraries were sequenced on a high output sequence machine (Illumina) using a high out-put flow cell and reagent kit to generate 2×25 bp reads (plus dual index reads). Further details are available through the BTL, but in brief, reads were demultiplexed and aligned utilizing an ultrafast RNAseq alignment algorithm (Dobin et al., Bioinformatics. 29:15, 2013) with the following parameters: --twopassMode Basic, --alignIntronMax 1000000, --alignMatesGapMax 1000000, --sjdbScore 2, --quantMode TranscriptomeSAM, and --sjdbOverhang 24.

    [0354] Quantification of individual read counts was performed using the DESeq2 algorithm (Love et al., Genome Biology 15:550, 2014), a method for differential analysis of count data, using shrinkage estimation for dispersions and fold changes to improve stability and interpretability of estimates. This enabled a more quantitative analysis focused on the strength rather than the mere presence of differential expression. The output of the DESeq2 algorithm was an expression level, in arbitrary units, normalized to an internal factor derived from the sequencing depth of the sample.

    [0355] Gene expression for CHRNA6 was found to be high in inducible Tregs compared to natural Tregs or PBMCs, as shown in Table 15 below.

    TABLE-US-00024 TABLE 15 CHRNA6 EXPRESSION IN TREGS Expression Level Cell Type Gene Name (DESeq2 normalized) Human PBMCs CHRNA6 (Entrez: 8973) 0.185 Human Natural CHRNA6 (Entrez: 8973) 0 Tregs Human Inducible CHRNA6 (Entrez: 8973) 19.2 Tregs

    Example 2—CHRNA6 Expression in Tregs Correlates with Survival of Cancer Patients

    [0356] A data set in which T cells (Th1, Th17, Tregs) were isolated from tumors of patients with treatment-naive colorectal cancer (CRC) or non-small-cell lung cancer (NSCLC) was analyzed. The full transcriptional profile of the T cells was analyzed and compared to the transcriptional profile of similar Th1, Th17, and Treg cells isolated from normal tissue or peripheral blood.

    [0357] The impact of CHRNA6 expression in tumor infiltrating Tregs on survival of cancer patients was analyzed using a clinical history dataset of 177 colorectal cancer patients (GSE17536) and 275 NSCLC patients (GSE41721). Expression of CHRNA6 was normalized to CD3G to account for differential immune infiltration across patients. For each study, an upper (median+STD/10) and lower (median−STD/10) threshold value of CHRNA6 expression was set. Patients in each study were stratified into a “High” CHRNA6 expression group (gene expression at least as high as the upper threshold) or a “Low” CHRNA6 expression group (gene expression less than or equal to the lower threshold). A survival curve was generated for differential expression of CHRNA6 by calculating the number of days from initial pathological diagnosis to death, or if not recorded, then the number of days from initial pathological diagnosis to the last time the patient was reported to be alive.

    [0358] Patients with higher CHRNA6 expression in Tregs resulted in significantly worse survival in both NSCLC and colorectal cancer, as shown below in Table 16, suggesting that CHRNA6 expression on Tregs promotes their immune regulatory function.

    TABLE-US-00025 TABLE 16 5 YEAR SURVIVAL IN CANCER PATIENTS WITH HIGH OR LOW TREG CHRNA6 EXPRESSION 5 Year survival - 5 Year survival - High Low Cancer Type CHRNA6 CHRNA6 P-value NSCLC 52.8% 69.2% P = 0.0034 Colorectal Cancer 61.3% 83.1% P = 0.0019

    Example 3—Treatment of Cancer Using an α6*nAChR Inhibitor

    [0359] According to the methods disclosed herein, a physician of skill in the art can treat a patient, such as a human patient with a solid tumor that is a candidate for immunotherapy (e.g., the patient has substantial immune cell infiltration (e.g., infiltration of Tregs) into the tumor as assessed by histological analysis of a biopsy), so as to inhibit solid tumor growth or reduce tumor volume. The method of treatment can include diagnosing or identifying a patient as a candidate for immunotherapy based on biopsy results conducted by the physician or a skilled laboratory technician. To treat the patient, a physician of skill in the art can administer to the human patient an α6*nAChR inhibitor (e.g., an α6*nAChR inhibitory antibody, or a small molecule α6*nAChR inhibitor, e.g., CHEMBL3104238). The agent can be conjugated to an antibody that recognizes a protein expressed by a Treg (e.g., CD4, CD25, CD39, or CD73) and administered systemically (e.g., intravenous injection) or it can be administered locally (e.g., intratumoral injection) to inhibit tumor growth. The α6*nAChR inhibitor-antibody conjugate is administered in a therapeutically effective amount, such as from 10 μg/kg to 500 mg/kg (e.g., 10 μg/kg, 100 μg/kg, 500 μg/kg, 1 mg/kg, 10 mg/kg, 50 mg/kg, 100 mg/kg, 250 mg/kg, or 500 mg/kg). In some embodiments, the α6*nAChR inhibitor-antibody conjugate is administered bimonthly, once a month, once every two weeks, or at least once a week or more (e.g., 1, 2, 3, 4, 5, 6, or 7 times a week or more).

    [0360] The antibody binds to the patient's Tregs, and the attached α6*nAChR inhibitor decreases activation of the patient's Tregs (e.g., decreases Treg production of one or more anti-inflammatory cytokines, e.g., IL-10 or TGFβ). The α6*nAChR inhibitor-antibody conjugate is administered to the patient in an amount sufficient to decrease tumor burden, increase progression free survival, or decrease anti-inflammatory cytokine levels by 10% or more (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more). Cytokine production can be assessed by collecting a blood sample from the patient and evaluating one or more anti-inflammatory cytokines (e.g., IL-10 or TGFβ). The blood sample can be collected one day or more after administration of the α6*nAChR inhibitor-antibody conjugate (e.g., 1, 2, 3, 4, 5, 6, 7, 10, 14, 21, or 30 or more days after administration). The blood sample can be compared to a blood sample collected from the patient prior to administration of the α6*nAChR inhibitor-antibody conjugate (e.g., a blood sample collected earlier the same day, 1 day, 1 week, 2 weeks, one month or more before administration of the α6*nAChR inhibitor-antibody conjugate). Tumor burden can be assessed using standard imaging methods (e.g., digital radiography, positron emission tomography (PET) scan, computed tomography (CT) scan, or magnetic resonance imaging (MRI) scan). Images from before and after administration of the α6*nAChR inhibitor-antibody conjugate can be compared to evaluate the efficacy of the treatment. A finding of a reduction in the total number of tumors, number of primary tumors, volume of tumors, positive lymph nodes, or distant metastases, or an increase in progression free survival indicates that the α6*nAChR inhibitor-antibody conjugate has successfully treated the cancer.

    Example 4—Modulation of α6*nAChR Using Compounds on Inducible Human Tregs

    [0361] Naïve CD4+ T cells were isolated from human PBMCs using negative magnetic bead selection (Stemcell Technologies). To generate inducible Tregs (iTregs), naïve CD4+ cells were resuspended in 1 ml of T-cell expansion and differentiation media (Stemcell Technologies), 1:50 dilution of Treg differentiation supplement (Stemcell Technologies), 30 ng/mL recombinant human IL-2 (Peprotech), and 100 ng/mL rapamycin (Sigma-Aldrich). Cells were activated with Dynabeads Human T-Activator CD3/CD28 (Invitrogen). Cells were maintained in culture for 7 days to allow for complete differentiation, which was later confirmed by flow cytometry by detecting markers for CD3, CD4, CD25, and FoxP3 on most cells in the population.

    [0362] To perform the suppressive co-culture assay, iTregs were cultured with CD8+ T-cells isolated from the same human PBMCs using negative magnetic bead selection (Stemcell Technologies). The CD8+ T-cells were isolated 3 days prior to the co-culture and maintained in culture with T-cell expansion and differentiation media (Stemcell Technologies), 30 ng/mL recombinant human IL-2 (Peprotech), and DynaBeads Human T-Activator CD3/CD28 (Invitrogen).

    [0363] On the day of co-culture, iTregs were combined with CD8+ T-cells. This co-culture was maintained in T-cell expansion and differentiation media (Stemcell Technologies), 30 ng/mL recombinant human IL-2 (Peprotech), and DynaBeads Human T-Activator CD3/CD28 (Invitrogen). Three days after co-culture, cells were processed by flow cytometry to discriminate between the two different populations and intracellular staining of the cytokine IFNγ was used to determine activation of CD8+ T-cells. To determine the effect of compounds on iTreg-mediated immunosuppression of CD8+ T-cell activation, compounds were also added at the beginning of co-culture.

    [0364] In co-culture, it was found that the addition of □-conotoxin PIA (Tocris) at a final concentration of 3 nM led to a trend of increasing IFNγ+CD8+ T cells, suggesting that blockade of α6*nAChR by this compound impaired the ability of iTregs to suppress CD8+ activity. Conversely, it was found that the addition of nicotine (Tocris) at a final concentration of 2 nM led to a trend of decreasing IFNγ+CD8+ T-cells, suggesting that stimulation of α6*nAChR by this compound enhanced the ability of iTregs to suppress CD8+ activity.

    [0365] Fold change of % IFNγ+CD8+ T-cells in co-culture with compound added relative to % IFNγ+CD8+ T-cells in co-culture without compound are presented per donor for each ratio of CD4:CD8 co-culture condition and shown in Tables 17 and 18 below.

    TABLE-US-00026 TABLE 17 EFFECT OF α6*nAChR ANTAGONIST ON IFNγ+ CD8+ T CELLS Donor (CD4+ T-Cell:CD8+ Fold Change % IFNγ+ CD8+ Relative to T-Cell Ratio) No Compound Condition BX26425 (2:1) 1.48 ± 0.25 BX26425 (1:1) 2.07 ± 0.18 BX26425 (1:2) 5.65 ± 1.57 BX26825 (1:1) 3.05 ± 0.66 BX26825 (1:2) 2.02 ± 0.16 BX24250 (2:1)  1.16 ± 0.0058 BX24250 (1:2) 0.95 ± 0.01 BX23981 (2:1) 0.93 ± 0.13 BX23981 (1:2)  1.22 ± 0.042

    TABLE-US-00027 TABLE 18 EFFECT OF α6*nAChR AGONIST ON IFNγ+ CD8+ T CELLS Donor (CD4+ T-Cell:CD8+ Fold Change % IFNγ+ CD8+ Relative to T-Cell Ratio) No Compound Condition BX26425 (2:1) 0.18 ± 0.11  BX26425 (1:1) 0.31 ± 0.089 BX26425 (1:2) 0.42 ± 0.044 BX26825 (1:1) 0.70 ± 0.10  BX26825 (1:2) 0.91 ± 0.14  BX24250 (2:1) 1.07 ± 0.046 BX24250 (1:2) 0.84 ± 0.10  BX23981 (2:1) 0.88 ± 0.035 BX23981 (1:2) 1.20 ± 0.038 BX27275 (2:1) 0.9 ± 0.12 BX27275 (1:1) 1.16 ± 0.12  BX27275 (2:1) 1.38 ± 0.41 

    Example 5—Knockout of CHRNA6 in Inducible Human Tregs Affects their Immunosuppressive Potency

    [0366] Naïve CD4+ T cells were isolated from human PBMCs using negative magnetic bead selection (Stemcell Technologies). To generate inducible Tregs (iTregs), naïve CD4+ cells were resuspended in 1 ml of T-cell expansion and differentiation media (Stemcell Technologies), 1:50 dilution of Treg differentiation supplement (Stemcell Technologies), 30 ng/mL recombinant human IL-2 (Peprotech), and 100 ng/mL rapamycin (Sigma-Aldrich). Cells were activated with Dynabeads Human T-Activator CD3/CD28 (Invitrogen). Cells were maintained in culture for 7 days to allow for complete differentiation, which was later confirmed by flow cytometry by detecting markers for CD3, CD4, CD25, and FoxP3 on most cells in the population.

    [0367] To perform the suppressive co-culture assay, iTregs were cultured with CD8+ T-cells isolated from the same human PBMCs using negative magnetic bead selection (Stemcell Technologies). The CD8+ T-cells were isolated 3 days prior to the co-culture and maintained in culture with T-cell expansion and differentiation media (Stemcell Technologies), 30 ng/mL recombinant human IL-2 (Peprotech), and DynaBeads Human T-Activator CD3/CD28 (Invitrogen).

    [0368] On the day of co-culture, iTregs were combined with CD8+ T-cells. This co-culture was maintained in T-cell expansion and differentiation media (Stemcell Technologies), 30 ng/mL recombinant human IL-2 (Peprotech), and DynaBeads Human T-Activator CD3/CD28 (Invitrogen). Three days after co-culture, cells were processed by flow cytometry to discriminate between the two different populations and intracellular staining of the cytokine IFNγ was used to determine activation of CD8+ T-cells.

    [0369] To determine the effect of knockout of CHRNA6 on iTreg-mediated immunosuppression of CD8+ T-cell activation, CHRNA6 was knocked out using nucleofection. This process involved mixing the isolated Naïve CD4+ T-cells on the day of isolation with P4 Buffer (Lonza), Recombinant Cas9 (Life Technologies), and 3 unique sgRNA for CHRNA6 (Synthego) and performing the nucleofection procedure with program CM137 using the 4D-Nucleofector (Lonza). The cells were then cultured as described above. The iTregs with CHRNA6 knocked out were then co-cultured as previously described to determine the effect of knocking out CHRNA6 on CD8+ immunosuppression by iTregs.

    [0370] For knockout of CHRNA6, the 3 sgRNA sequences were combined. The sgRNA had the sequences:GUUUGGCCUCACAGGCUGUG(SEQ ID NO: 1), CUGUGUGGGCUGUGCAACUG(SEQ ID NO: 2), and UGGGCUGUGCAACUGAGGAG (SEQ ID NO: 3).

    [0371] It was found that when CHRNA6 was knocked out in iTregs, there was a trend of increasing IFNγ+ in CD8+ T-cells, suggesting immunosuppression by iTregs was reduced in the absence of CHRNA6.

    [0372] Percent IFNγ+ CD8+ T-cells in co-culture with Tregs nucleofected with either negative control KO or CHRNA6 KO are presented in Table 19 below.

    TABLE-US-00028 TABLE 19 EFFECT OF α6*nAChR KNOCKOUT ON IFNγ IN CD8+ T CELLS Donor Co-culture Condition % IFNγ+ CD8+ BX28521 Negative KO in iTregs 1.62 ± 0.28 BX28521 CHRNA6 KO in iTregs 2.05 ± 0.46 BX28480 Negative KO in iTregs 1.47 ± 0.36 BX28480 CHRNA6 KO in iTregs 2.12 ± 0.64

    Other Embodiments

    [0373] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the invention that come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth, and follows in the scope of the claims. Other embodiments are within the claims.