ADENO-ASSOCIATED VIRAL VECTORS FOR THE TREATMENT OF BEST DISEASE
20220033826 · 2022-02-03
Assignee
Inventors
- William W. Hauswirth (Gainesville, FL)
- Alfred S. Lewin (Gainesville, FL, US)
- Cristhian J. Ildefonso (Gainesville, FL, US)
- Brianna M. Young (Ocklawaha, FL, US)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C07K14/705
CHEMISTRY; METALLURGY
C12N2800/22
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
A61K48/005
HUMAN NECESSITIES
C12N15/1138
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
C07K14/705
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
Abstract
Aspects of the disclosure relate to methods and compositions useful for treating bestrophinopathies, such as Best Disease.
Claims
1. A short hairpin RNA (shRNA) comprising: a) a sense strand comprising the nucleotide sequence CGUCAAAGCUUCACAGUGU (SEQ ID NO: 2) and an antisense strand comprising the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO: 3); and b) a loop.
2. The shRNA of claim 1, wherein the loop comprises the nucleotide sequence UUCAAGAGA (SEQ ID NO: 7).
3. The shRNA of claim 1, wherein the shRNA comprises the nucleotide sequence CGUCAAAGCUUCACAGUGUUUCAAGAGAACACUGUGAAGCUUUGACG (SEQ ID NO: 1).
4. A vector encoding the shRNA of claim 1.
5. The vector of claim 4 further comprising a recombinant bestrophin (BEST1) coding sequence that does not contain a sequence targeted by the shRNA.
6. The vector of claim 5, wherein the recombinant BEST1 coding sequence is codon-optimized for expression in a human cell.
7. The vector of claim 5, wherein the recombinant BEST1 coding sequence comprises a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 9.
8. The vector of claim 7, wherein the recombinant BEST1 coding sequence comprises the nucleotide sequence of SEQ ID NO: 9.
9. A vector encoding an shRNA of claim 1 and a recombinant BEST1 sequence comprising a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 11.
10. The vector of claim 9, wherein the vector comprises the nucleotide sequence of SEQ ID NO: 11.
11. The vector of claim 4, wherein the vector is a plasmid or a viral vector.
12. (canceled)
13. The vector of claim 11, wherein the viral vector is a recombinant adeno-associated viral (rAAV) vector.
14. The vector of claim 13, wherein the rAAV vector is self-complementary.
15. A recombinant adeno-associated viral (rAAV) particle comprising the rAAV vector of claim 13.
16. The rAAV particle of claim 15, wherein the rAAV viral particle is an AAV serotype 2 (AAV2) viral particle.
17. A composition comprising the rAAV particle of claim 15 and a pharmaceutically acceptable carrier.
18. A method of modulating BEST1 expression in a subject, the method comprising administering to the subject the composition of claim 17.
19. A method of treating Best Disease in a subject, the method comprising administering to the subject the composition of claim 17.
20. The method of claim 19, wherein the subject is a human subject.
21-24. (canceled)
25. A method of treating an autosomal recessive bestrophinopathy (ARB) in a human subject, the method comprising administering to the subject the composition of claim 17.
26-31. (canceled)
32. An shRNA that comprises a nucleotide sequence that differs from the nucleotide sequence of SEQ ID NO: 1 (CGUCAAAGCUUCACAGUGUUUCAAGAGAACACUGUGAAGCUUUGACG) by 1 or 2 nucleotides.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. It is to be understood that the data illustrated in the drawings in no way limit the scope of the disclosure.
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
DETAILED DESCRIPTION
[0048] Aspects of the application provide methods and compositions that are useful for treating Best Disease in a subject (e.g., in a human subject having Best Disease).
[0049] In some embodiments, the disclosure provides methods and compositions for delivering a functional bestrophin protein to subjects having one or more mutant BEST1 genes. In some embodiments, a recombinant BEST1 gene (e.g., a coding sequence, for example a cDNA or open reading frame) is provided on a viral vector (e.g., an rAAV vector). In some embodiments, expression of one or both alleles of the endogenous BEST1 gene are also knocked down. For example, in some embodiments an siRNA (e.g., an shRNA) is delivered to a subject along with a recombinant BEST1 gene. In some embodiments, a viral vector (e.g., an rAAV vector) encodes both a recombinant BEST1 gene and one or more siRNAs that target the endogenous BEST1 gene. In some embodiments, the recombinant BEST1 gene is modified to comprise one or more nucleotide substitutions that make it resistant to targeting by the one or more siRNAs. In some embodiments, the recombinant BEST1 gene is codon optimized (e.g., for expression in a subject, for example in a human subject).
[0050] In some embodiments, the disclosure provides a short hairpin RNA (shRNA) comprising a sense strand comprising the nucleotide sequence CGUCAAAGCUUCACAGUGU (SEQ ID NO: 2), an antisense strand comprising the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO: 3), and a loop. In some embodiments, the loop comprises the nucleotide sequence UUCAAGAGA (SEQ ID NO: 7)
[0051] In other embodiments, the disclosure provides a short hairpin RNA (shRNA) comprising a sense strand comprising the nucleotide sequence GCUGCUAUAUGGCGAGUUCUU (SEQ ID NO: 6), an antisense strand comprising the nucleotide sequence AAGAACUCGCCAUAUAGCAGC (SEQ ID NO: 5), and a loop. In some embodiments, the loop comprises the nucleotide sequence CUCGAG (SEQ ID NO: 8).
[0052] In some embodiments, the disclosure provides a short hairpin RNA (shRNA) that comprises an antisense strand comprising the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO: 3).
[0053] In some embodiments, the shRNA can be delivered using a vector as an shRNA driven by a promoter (e.g., a human H1 RNA promoter). In some embodiments, this vector is a plasmid. In some embodiments, the vector is a viral vector, such as an adeno-associated virus (AAV) vector. In some embodiments, the vector is a double-stranded or self-complementary AAV vector. In some embodiments, the vector sequence encoding the shRNA comprises a BEST1 sequence.
[0054] Accordingly, in some embodiments an shRNA can be encoded on a DNA vector (e.g., a viral vector) by a nucleic acid having a sequence of
TABLE-US-00001 (SEQ ID NO: 18) CCGTCAAAGCTTCACAGTGTTTCAA GAGAACACTGTGAAGCTTTGACG,
where the loop sequence is underlined. In some embodiments, a different loop sequence is substituted for the loop sequence shown in SEQ ID NO: 7.
[0055] Also, in some embodiments, an shRNA can be encoded on a DNA vector (e.g., a viral vector) by a nucleic acid having a sequence of
TABLE-US-00002 (SEQ ID NO: 19) GCTGCTATATGGCGAGTTCTTCTCG AGAAGAACTCGCCATATAGCAGC,
where the loop sequence is underlined. In some embodiments, a different loop sequence is substituted for the loop sequence shown in SEQ ID NO: 8.
[0056] In some embodiments, the same vector comprises a coding sequence that encodes normal (e.g., wild-type) Best1 protein but is resistant to the action of the shRNA expressed by the vector.
[0057] In some embodiments, the BEST1 coding sequence comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 9.
[0058] In some embodiments, the BEST1 coding sequence comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 10. In some embodiments, the BEST1 coding sequence comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 11.
[0059] In some embodiments, the BEST1 coding sequence comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15.
TABLE-US-00003 The 1757-bp wild-type BEST1 sequence is defined as follows (SEQ ID NO: 9): ATGACCATCACTTACACAAGCCAAGTGGCTAATGC CCGCTTAGGCTCCTTCTCCCGCCTGCTGCTGTGCT GGCGGGGCAGCATCTACAAGCTGCTATATGGCGAG TTCTTAATCTTCCTGCTCTGCTACTACATCATCCG CTTTATTTATAGGCTGGCCCTCACGGAAGAACAAC AGCTGATGTTTGAGAAACTGACTCTGTATTGCGAC AGNTACATCCAGCTCATCCCCATTTCCTTCGTGCT GGGCTTCTACGTGACGCTGGTCGTGACCCGCTGGT GGAACCAGTACGAGAACCTGCCGTGGCCCGACCGC CTCATGAGCCTGGTGTCGGGCTTCGTCGAAGGCAA GGACGAGCAAGGCCGGCTGCTGCGGCGCACGCTCA TCCGCTACGCCAACCTGGGCAACGTGCTCATCCTG CGCAGCGTCAGCACCGCAGTCTACAAGCGCTTCCC CAGCGCCCAGCACCTGGTGCAAGCAGGCTTTATGA CTCCGGCAGAACACAAGCAGTTGGAGAAACTGAGC CTACCACACAACATGTTCTGGGTGCCCTGGGTGTG GTTTGCCAACCTGTCAATGAAGGCGTGGCTTGGAG GTCGAATCCGGGACCCTATCCTGCTCCAGAGCCTG CTGAACGAGATGAACACCTTGCGTACTCAGTGTGG ACACCTGTATGCCTACGACTGGATTAGTATCCCAC TGGTGTATACACAGGTGGTGACTGTGGCGGTGTAC AGCTTCTTCCTGACTTGTCTAGTTGGGCGGCAGTT TCTGAACCCAGCCAAGGCCTACCCTGGCCATGAGC TGGACCTCGTTGTGCCCGTCTTCACGTTCCTGCAG TTCTTCTTCTATGTTGGCTGGCTGAAGGTGGCAGA GCAGCTCATCAACCCCTTTGGAGAGGATGATGATG ATTTTGAGACCAACTGGATTGTCGACAGGAATTTG CAGGTGTCCCTGTTGGCTGTGGATGAGATGCACCA GGACCTGCCTCGGATGGAGCCGGACATGTACTGGA ATAAGCCCGAGCCACAGCCCCCCTACACAGCTGCT TCCGCCCAGTTCCGTCGAGCCTCCTTTATGGGCTC CACCTTCAACATCAGCCTGAACAAAGAGGAGATGG AGTTCCAGCCCAATCAGGAGGACGAGGAGGATGCT CACGCTGGCATCATTGGCCGCTTCCTAGGCCTGCA GTCCCATGATCACCATCCTCCCAGGGCAAACTCAA GGACCAAACTACTGTGGCCCAAGAGGGAATCCCTT CTCCACGAGGGCCTGCCCAAAAACCACAAGGCAGC CAAACAGAACGTTAGGGGCCAGGAAGACAACAAGG CCTGGAAGCTTAAGGCTGTGGACGCCTTCAAGTCT GCCCCACTGTATCAGAGGCCAGGCTACTACAGTGC CCCACAGACNCCCCTCAGCCCCACTCCCATGTTCT TCCCCCTAGAACCATCAGCGCCGTCAAAGCTTCAC AGTGTCACAGGCATAGACACCAAAGACAAAAGCTT AAAGACTGTGAGTTCTGGGGCCAAGAAAAGTTTTG AATTGCTCTCAGAGAGCGATGGGGCCTTGATGGAG CACCCAGAAGTATCTCAAGTGAGGAGGAAAACTGT GGAGTTTAACCTGACGGATATGCCAGAGATCCCCG AAAATCACCTCAAAGAACCTTTGGAACAATCACCA ACCAACATACACACTACACTCAAAGATCACATGGA TCCTTATTGGGCCTTGGAAAACAGGGATGAAGCAC ATTCCTAA
[0060] In some embodiments, the BEST1 coding sequence comprises includes a short de-targeted sequence that corresponds a region of the wild-type BEST1 gene. An exemplary de-targeted sequence that may be used with a vector sequence encoding an shRNA744 sequence is defined as follows (SEQ ID NO: 10): CTACTGTACGGAGAATTTCT.
[0061] Other nucleotide substitutions can be made to de-target the BEST1 sequence. For example, in some embodiments, the de-targeted sequence is located in a different position on the BEST1 coding sequence and corresponds to a different region of the wild-type BEST1 gene. An exemplary de-targeted sequence that may be used with a vector sequence encoding an shRNA05 sequence and is defined as follows (SEQ ID NO: 11): CCAGCAAGCTGCACAGCGT.
[0062] In some embodiments, an shRNA (e.g., shRNA05) encoded by a nucleic acid comprising the sequence of SEQ ID NO: 1 (and/or the complement thereof) is transcribed in a host cell (e.g., in a subject, for example in a human subject) treated with the vector. In some embodiments, two or more different shRNAs (e.g., having different start sites and/or termination sites, for example differing from shRNA05 by one or two additional or fewer nucleotides) are transcribed in a host cell.
[0063] In some embodiments, the BEST1 coding sequence is driven by a promoter (e.g., a human opsin proximal promoter). In some embodiments, the promoter comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 12 below.
[0064] In some embodiments, the promoter driving shRNA expression comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 13 below. In some embodiments, the promoter driving shRNA expression comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 14 below.
[0065] The sequences of the exemplary promoters are as follows:
TABLE-US-00004 VMD2 promoter, 623 bp fragment (SEQ ID NO: 12) AATTCTGTCATTTTACTAGGGTGATGAAATTCCCA AGCAACACCATCCTTTTCAGATAAGGGCACTGAGG CTGAGAGAGGAGCTGAAACCTACCCGGCGTCACCA CACACAGGTGGCAAGGCTGGGACCAGAAACCAGGA CTGTTGACTGCAGCCCGGTATTCATTCTTTCCATA GCCCACAGGGCTGTCAAAGACCCCAGGGCCTAGTC AGAGGCTCCTCCTTCCTGGAGAGTTCCTGGCACAG AAGTTGAAGCTCAGCACAGCCCCCTAACCCCCAAC TCTCTCTGCAAGGCCTCAGGGGTCAGAACACTGGT GGAGCAGATCCTTTAGCCTCTGGATTTTAGGGCCA TGGTAGAGGGGGTGTTGCCCTAAATTCCAGCCCTG GTCTCAGCCCAACACCCTCCAAGAAGAAATTAGAG GGGCCATGGCCAGGCTGTGCTAGCCGTTGCTTCTG AGCAGATTACAAGAAGGGACCAAGACAAGGACTCC TTTGTGGAGGTCCTGGCTTAGGGAGTCAAGTGACG GCGGCTCAGCACTCACGTGGGCAGTGCCAGCCTCT AAGAGTGGGCAGGGGCACTGGCCACAGAGTCCCAG GGAGTCCCACCAGCCTAGTCGCCAGACC H1 promoter (SEQ ID NO: 13) TAAAACGACGGCCAGTGAATTCATATTTGCATGTC GCTATGTGTTCTGGGAAATCACCATAAACGTGAAA TGTCTTTGGATTTGGGAATCTTATAAGTTCTGTAT GAGACCACT U6 promoter (SEQ ID NO: 14) GAGGGCCTATTTCCCATGATTCCTTCATATTTGCA TATACGATACAAGGCTGTTAGAGAGATAATTGGAA TTAATTTGACTGTAAACACAAAGATATTAGTACAA AATACGTGACGTAGAAAGTAATAATTTCTTGGGTA GTTTGCAGTTTTAAAATTATGTTTTAAAATGGACT ATCATATGCTTACCGTAACTTGAAAGTATTTCGAT TTCTTGGCTTTATATATCTTGTGGAAAGGAC
[0066] In some embodiments, the BEST1 coding sequence is in a vector, such as an AAV vector or plasmid.
[0067] In some embodiments, the vector as described herein comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a de-targeted BEST1 sequence, SEQ ID NO: 10.
[0068] In some embodiments, a vector encoding a functional BEST1 sequence is provided to supplement or correct (e.g., at least partially) cellular BEST1 function without knocking down endogenous BEST1 gene expression. In some embodiments, the BEST1 sequence is codon-optimized.
[0069] In some embodiments, a vector encoding a functional BEST1 sequence and an shRNA sequence is provided to supplement or correct (e.g., at least partially) cellular BEST1 function and knock down endogenous BEST1 gene expression. In some embodiments, endogenous Best1 expression is knocked down using shRNA. In some embodiments, the BEST1 sequence is codon-optimized. In some embodiments, the BEST1 sequence is modified to be resistant to the shRNA. In some embodiments, the BEST1 and shRNA sequences are encoded on the same AAV vector.
[0070] In some embodiments, the disclosure provides a method of modulating BEST1 expression in a subject, the method comprising administering to the subject, such as a human subject, a composition comprising a vector or rAAV particle and a pharmaceutically acceptable carrier. In some aspects, the disclosure provides a method of treating bestrophinopathies (e.g., Best Disease and ARB) in a subject, the method comprising administering a composition.
[0071] In some embodiments, the disclosure provides a composition for use in treating Best Disease and a composition for use in the manufacture of a medicament to treat Best Disease. In some aspects, the disclosure provides a composition comprising a vector or rAAV particle, wherein the vector encodes a functional BEST1 sequence, for use in treating ARB and a composition for use in the manufacture of a medicament to treat ARB.
[0072] Aspects of the disclosure relate to recombinant adeno-associated virus (rAAV) particles for delivery of an rAAV vector as described herein (e.g., encoding an shRNA and/or a replacement BEST1) into various tissues, organs, and/or cells. In some embodiments, the rAAV particles comprise a capsid protein as described herein, e.g., an AAV2 capsid protein. In some embodiments, the vector contained within the rAAV particle encodes an RNA of interest (e.g., an shRNA comprising the sequence of SEQ ID NO: 1) and comprises a replacement BEST1 coding sequence (e.g., comprising the sequence of SEQ ID NO: 10).
[0073] Recombinant AAV (rAAV) vectors contained within an rAAV particle may comprise at a minimum (a) one or more heterologous nucleic acid regions (e.g., encoding an shRNA and/or a Best1 protein) and (b) one or more regions comprising inverted terminal repeat (ITR) sequences (e.g., wild-type ITR sequences or engineered ITR sequences) flanking the one or more heterologous nucleic acid regions (or transgenes). In some embodiments, the heterologous nucleic acid region encodes an RNA of interest (e.g., an shRNA comprising the sequence of SEQ ID NO: 3) and comprises a replacement BEST1 coding sequence (e.g., comprising the sequence of SEQ ID NO: 10). In some embodiments, the rAAV vector is between 4 kb and 5 kb in size (e.g., 4.2 to 4.7 kb in size). This rAAV vector may be encapsidated by a viral capsid, such as an AAV2 capsid. In some embodiments, the rAAV vector is single-stranded. In some embodiments, the rAAV vector is double-stranded. In some embodiments, a double-stranded rAAV vector may be, for example, a self-complementary vector that contains a region of the vector that is complementary to another region of the vector, initiating the formation of the double-strandedness of the vector.
[0074] As disclosed herein, analysis of Best1 structure with targeted mutations has shown that loss of retinal pigment epithelium apical microvilli and resulting microdetachment of the retina represent the earliest features of canine bestrophinopathies. Retinal light exposure expands, and dark adaptation contracts, the microdetachments. Subretinal adeno-associated virus-based gene therapy corrects both the vitelliform lesions and the light-modulated microdetachments.
[0075] Studies of molecular pathology in the canine BEST1 disease model revealed retina-wide abnormalities at the RPE-PR interface associated with defects in the RPE microvillar ensheathment and a cone PR-associated insoluble interphotoreceptor matrix. In vivo imaging demonstrated a retina-wide RPE-PR microdetachment, which contracted with dark adaptation and expanded upon exposure to a moderate intensity of light.
[0076] Subretinal BEST1 gene augmentation therapy using adeno-associated virus 2 reversed not only clinically detectable subretinal lesions but also the diffuse microdetachments. Immunohistochemical analyses showed correction of the structural alterations at the RPE-PR interface in areas with BEST1 transgene expression. Successful treatment effects were demonstrated in three different canine BEST1 genotypes with vector titers in the 0.1×10.sup.11 to 5×10.sup.11 vector genomes per mL range. Patients with biallelic BEST1 mutations exhibited large regions of retinal lamination defects, severe PR sensitivity loss, and slowing of the retinoid cycle. Human translation of canine BEST1 gene therapy success in reversal of macro- and microdetachments through restoration of cytoarchitecture at the RPE-PR interface has promise to result in improved visual function and prevent disease progression in patients affected with bestrophinopathies.
[0077] As further disclosed herein, it was discovered that adeno-associated virus (AAV)2-mediated BEST1 gene augmentation corrects this primary subclinical defect as well as the disease.
[0078] The rAAV particle may be of any AAV serotype, including any derivative or pseudotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 2/1, 2/5, 2/8, or 2/9). As used herein, the serotype of an rAAV particle refers to the serotype of the capsid proteins. In some embodiments, the rAAV particle is AAV2. Non-limiting examples of derivatives and pseudotypes include rAAV2/1, rAAV2/5, rAAV2/8, rAAV2/9, AAV2-AAV3 hybrid, AAVrh.10, AAVhu.14, AAV3a/3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15/17, AAVM41, AAV9.45, AAV6(Y445F/Y731F), AAV2.5T, AAV-HAE1/2, AAV clone 32/83, AAVShH10, AAV2 (Y->F), AAV8 (Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45. Such AAV serotypes and derivatives/pseudotypes, and methods of producing such derivatives/pseudotypes are known in the art (see, e.g., Mol Ther. 2012 April; 20(4):699-708. doi: 10.1038/mt.2011.287. Epub 2012 Jan. 24. The AAV vector toolkit: poised at the clinical crossroads. Asokan Al, Schaffer D V, Samulski R J.). In some embodiments, the rAAV particle is a pseudotyped rAAV particle, which comprises (a) a nucleic acid vector comprising ITRs from one serotype (e.g., AAV2) and (b) a capsid comprised of capsid proteins derived from another serotype (e.g., AAV5). Methods for producing and using pseudotyped rAAV vectors are known in the art (see, e.g., Duan et al., J. Virol., 75:7662-7671, 2001; Halbert et al., J. Virol., 74:1524-1532, 2000; Zolotukhin et al., Methods, 28:158-167, 2002; and Auricchio et al., Hum. Molec. Genet., 10:3075-3081, 2001).
[0079] Methods of producing rAAV particles and rAAV vectors are also known in the art and commercially available (see, e.g., Zolotukhin et al. Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods 28 (2002) 158-167; and U.S. Patent Publication Nos. US 2007/0015238 and US 2012/0322861, which are incorporated herein by reference; and plasmids and kits available from ATCC and Cell Biolabs, Inc.). For example, a plasmid containing the rAAV vector may be combined with one or more helper plasmids, e.g., that contain a rep gene (e.g., encoding Rep78, Rep68, Rep52 and Rep40) and a cap gene (e.g., encoding VP1, VP2, and VP3, including a modified VP3 region as described herein), and transfected into a producer cell line such that the rAAV particle can be packaged and subsequently purified.
[0080] In some embodiments, the one or more helper plasmids include a first helper plasmid comprising a rep gene and a cap gene (e.g., encoding a rAAV capsid protein as described herein) and a second helper plasmid comprising a E1a gene, a E1b gene, a E4 gene, a E2a gene, and a VA gene. In some embodiments, the rep gene is a rep gene derived from AAV2 and the cap gene is derived from AAV2 and may include modifications to the gene in order to produce the modified capsid protein described herein. Helper plasmids, and methods of making such plasmids, are known in the art and commercially available (see, e.g., pDM, pDG, pDP1rs, pDP2rs, pDP3rs, pDP4rs, pDP5rs, pDP6rs, pDG (R484E/R585E), and pDP8.ape plasmids from PlasmidFactory, Bielefeld, Germany; other products and services available from Vector Biolabs, Philadelphia, Pa.; Cellbiolabs, San Diego, Calif.; Agilent Technologies, Santa Clara, Ca; and Addgene, Cambridge, Mass.; pxx6; Grimm et al. (1998), Novel Tools for Production and Purification of Recombinant Adenoassociated Virus Vectors, Human Gene Therapy, Vol. 9, 2745-2760; Kern, A. et al. (2003), Identification of a Heparin-Binding Motif on Adeno-Associated Virus Type 2 Capsids, Journal of Virology, Vol. 77, 11072-11081.; Grimm et al. (2003), Helper Virus-Free, Optically Controllable, and Two-Plasmid-Based Production of Adeno-associated Virus Vectors of Serotypes 1 to 6, Molecular Therapy, Vol. 7, 839-850; Kronenberg et al. (2005), A Conformational Change in the Adeno-Associated Virus Type 2 Capsid Leads to the Exposure of Hidden VP1 N Termini, Journal of Virology, Vol. 79, 5296-5303; and Moullier, P. and Snyder, R. O. (2008), International efforts for recombinant adeno-associated viral vector reference standards, Molecular Therapy, Vol. 16, 1185-1188).
[0081] An exemplary, non-limiting, rAAV particle production method is described next. One or more helper plasmids are produced or obtained, which comprise rep and cap ORFs for the desired AAV serotype and the adenoviral VA, E2A (DBP), and E4 genes under the transcriptional control of their native promoters. The cap ORF may also comprise one or more modifications to produce a modified capsid protein as described herein. HEK293 cells (available from ATCC®) are transfected via CaPO4-mediated transfection, lipids or polymeric molecules such as Polyethylenimine (PEI) with the helper plasmid(s) and a plasmid containing a heterologous nucleic acid vector described herein (e.g. a plasmid containing a heterologous nucleic acid comprising wild-type or mutant cBEST1 or hBEST1 gene shown in
[0082] The disclosure also contemplates host cells that comprise an shRNA, a vector, or an rAAV particle as described herein. Such host cells include mammalian host cells, with human host cells being preferred, and may be isolated, e.g., in cell or tissue culture. In some embodiments, the host cell is a cell of the eye.
[0083] In some aspects, the disclosure provides formulations of one or more rAAV-based compositions disclosed herein in pharmaceutically acceptable solutions for administration to a cell or an animal, either alone or in combination with one or more other modalities of therapy, and in particular, for therapy of human cells, tissues, and diseases affecting man.
[0084] Accordingly, in some embodiments, a composition is provided which comprises an shRNA, a vector, or an rAAV particle as described herein and optionally a pharmaceutically acceptable carrier. In some embodiments, the compositions described herein can be administered to a subject in need of treatment. In some embodiments, the subject has or is suspected of having one or more conditions, diseases, or disorders of the brain and/or eye (e.g., Best Disease). In some embodiments, the subject has or is suspected of having one or more of the conditions, diseases, and disorders disclosed herein (e.g., Best Disease). In some embodiments, the subject has one or more endogenous mutant BEST1 alleles (e.g., associated with or that cause a disease or disorder of the eye or retina). In some embodiments, the subject has at least one autosomal dominant mutant BEST1 allele (e.g., that causes Best Disease). In some embodiments, the subject is a human. In some embodiments, the subject is a non-human primate. Non-limiting examples of non-human primate subjects include macaques (e.g., cynomolgus or rhesus macaques), marmosets, tamarins, spider monkeys, owl monkeys, vervet monkeys, squirrel monkeys, baboons, gorillas, chimpanzees, and orangutans. Other exemplary subjects include domesticated animals such as dogs and cats; livestock such as horses, cattle, pigs, sheep, goats, and chickens; and other animals such as mice, rats, guinea pigs, and hamsters.
[0085] In some embodiments, the dose of rAAV particles administered to a cell or a subject may be on the order ranging from 10.sup.6 to 10.sup.14 particles/mL or 10.sup.3 to 10.sup.15 particles/mL, or any values therebetween for either range, such as for example, about 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10, 10.sup.11, 10.sup.12, 10.sup.13, or 10.sup.14 particles/mL. In one embodiment, rAAV particles of higher than 10.sup.13 particles/mL are be administered. In some embodiments, the dose of rAAV particles administered to a subject may be on the order ranging from 10.sup.6 to 10.sup.14 vector genomes (vgs)/mL or 10.sup.3 to 10.sup.15 vgs/mL, or any values therebetween for either range, such as for example, about 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10, 10.sup.11, 10.sup.12, 10.sup.13, or 10.sup.14 vgs/mL. In one embodiment, rAAV particles of higher than 10.sup.13 vgs/mL are be administered. The rAAV particles can be administered as a single dose, or divided into two or more administrations as may be required to achieve therapy of the particular disease or disorder being treated. In some embodiments, 0.0001 mL to 10 mLs (e.g., 0.0001 mL, 0.001 mL, 0.01 mL, 0.1 mL, 1 mL, 10 mLs) are delivered to a subject in a dose.
[0086] In some embodiments, rAAV particle titers range from 1×10.sup.10 to 5×10.sup.13 vg/ml. In some embodiments, rAAV particle titers can be about 1×10.sup.10, 2.5×10.sup.10, 5×10.sup.10, 1×10.sup.11, 2×10.sup.11, 2.5×10.sup.11, 5×10.sup.11, 1×10.sup.12, 2.5×10.sup.12, 5×10.sup.12, 1×10.sup.13, 2.5×10.sup.13, or 5×10.sup.13 vg/mL. In some embodiments, particle titers are less than 1×10.sup.10 vg/mL. In some embodiments, rAAV particle titers are greater than 1×10.sup.15 vg/mL. In some embodiments, rAAV particle titers are greater than 5×10.sup.13 vgs/mL. In particular embodiments, rAAV particle titers are about 2×10.sup.11 or 2.5×10.sup.11. In some embodiments, rAAV particles are administered via methods further described herein (e.g., subretinally or intravitreally).
[0087] The rAAV particles can be administered as a single dose, or divided into two or more administrations as may be required to achieve therapy of the particular disease or disorder being treated. In some embodiments, from 1 to 500 microliters of a composition (e.g., comprising an rAAV particle) described in this application is administered to one or both eyes of a subject. For example, in some embodiments, about 1, about 10, about 50, about 100, about 200, about 300, about 400, or about 500 microliters can be administered to each eye. However, it should be appreciated that smaller or larger volumes could be administered in some embodiments.
[0088] If desired, rAAV particle or nucleic acid vectors may be administered in combination with other agents as well, such as, e.g., proteins or polypeptides or various pharmaceutically-active agents, including one or more systemic or topical administrations of therapeutic polypeptides, biologically active fragments, or variants thereof. In fact, there is virtually no limit to other components that may also be included, given that the additional agents do not cause a significant adverse effect upon contact with the target cells or host tissues. The rAAV particles may thus be delivered along with various other agents as required in the particular instance. Such compositions may be purified from host cells or other biological sources, or alternatively may be chemically synthesized as described herein.
[0089] In other aspects, the disclosure provides formulations of one or more of the plasmids encoding an shRNA as disclosed herein in pharmaceutically acceptable solutions for administration to a cell or an animal, either alone or in combination with one or more other modalities of therapy, and in particular, for therapy of human cells, tissues, and diseases affecting man. The disclosure also provides methods of administration of plasmids encoding an shRNA as disclosed herein. Exemplary methods comprised methods of administration of plasmids to mammals, e.g. humans.
[0090] In some embodiments, the disclosed plasmid formulations for administration to mammals (e.g., humans) comprise DNA plasmid vector in phosphate buffered saline (PBS). The concentration of the vector may be between 1 mg/ml and 3 mg/ml. In certain embodiments, the concentration is about 2 mg/ml. In other embodiments, the concentration is about 1.6 mg/ml, about 1.7 mg/ml, about 1.75 mg/ml, about 1.8 mg/ml, about 1.85 mg/ml, about 1.9 mg/ml, about 1.95 mg/ml, about 2.05 mg/ml, about 2.1 mg/ml, or about 2.15 mg/ml.
[0091] Formulation of pharmaceutically-acceptable excipients and carrier solutions is well-known to those of skill in the art, as is the development of suitable dosing and treatment regimens for using the particular compositions described herein in a variety of treatment regimens, including e.g., oral, parenteral, intravenous, intranasal, intra-articular, and intramuscular administration and formulation.
[0092] Typically, these formulations may contain at least about 0.1% of the therapeutic agent (e.g., rAAV particle or plasmid) or more, although the percentage of the active ingredient(s) may, of course, be varied and may conveniently be between about 1 or 2% and about 70% or 80% or more of the weight or volume of the total formulation. Naturally, the amount of therapeutic agent(s) (e.g., rAAV particle) in each therapeutically-useful composition may be prepared in such a way that a suitable dosage will be obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.
[0093] In certain circumstances it will be desirable to deliver an shRNA, a vector, or an rAAV particle as described herein in suitably formulated pharmaceutical compositions disclosed herein, either subcutaneously, intraocularly, intravitreally, parenterally, subcutaneously, intravenously, intracerebro-ventricularly, intramuscularly, intrathecally, orally, intraperitoneally, by oral or nasal inhalation, or by direct injection to one or more cells, tissues, or organs by direct injection.
[0094] The pharmaceutical forms of compositions (e.g., comprising an shRNA, a vector, or an rAAV particle as described herein) suitable for injectable use include sterile aqueous solutions or dispersions. In some embodiments, the form is sterile and fluid to the extent that easy syringability exists. In some embodiments, the form is stable under the conditions of manufacture and storage and is preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, saline, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
[0095] The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the shRNA, vector, or rAAV particle as described herein is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum oil such as mineral oil, vegetable oil such as peanut oil, soybean oil, and sesame oil, animal oil, or oil of synthetic origin. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers.
[0096] The compositions of the present disclosure can be delivered to the eye through a variety of routes. They may be delivered intraocularly, by topical application to the eye or by intraocular injection into, for example the vitreous (intravitreal injection) or subretinal (subretinal injection) inter-photoreceptor space. In some embodiments, they are delivered to rod photoreceptor cells. Alternatively, they may be delivered locally by insertion or injection into the tissue surrounding the eye. They may be delivered systemically through an oral route or by subcutaneous, intravenous or intramuscular injection. Alternatively, they may be delivered by means of a catheter or by means of an implant, wherein such an implant is made of a porous, non-porous or gelatinous material, including membranes such as silastic membranes or fibers, biodegradable polymers, or proteinaceous material. They can be administered prior to the onset of the condition, to prevent its occurrence, for example, during surgery on the eye, or immediately after the onset of the pathological condition or during the occurrence of an acute or protracted condition.
[0097] For administration of an injectable aqueous solution, for example, the solution may be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, intravitreal, subcutaneous and intraperitoneal administration. In this connection, a sterile aqueous medium that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, “Remington's Pharmaceutical Sciences” 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, and the general safety and purity standards as required by, e.g., FDA Office of Biologics standards.
[0098] Sterile injectable solutions may be prepared by incorporating an shRNA, a vector, or an rAAV particle as described herein in the required amount in the appropriate solvent with several of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0099] The amount of composition (e.g., comprising an shRNA, a vector, or an rAAV particle as described herein) and time of administration of such composition will be within the purview of the skilled artisan having benefit of the present teachings. It is likely, however, that the administration of therapeutically-effective amounts of the disclosed compositions may be achieved by a single administration, such as for example, a single injection of sufficient numbers of rAAV particles to provide therapeutic benefit to the patient undergoing such treatment. Alternatively, in some circumstances, it may be desirable to provide multiple, or successive administrations of the composition, either over a relatively short, or a relatively prolonged period of time, as may be determined by the medical practitioner overseeing the administration of such compositions.
[0100] In some embodiments, rod cells remain structurally intact and/or viable upon silencing of cellular BEST1 gene expression. In some embodiments, rod cells in which cellular BEST1 gene expression is silenced may have shortened outer segments which would normally contain BEST1. In some embodiments, the length of the outer segments can be maintained or restored (e.g., partially or completely) using the exogenously added (hardened) BEST1 gene, the expression of which is resistant to silencing using the compositions described in this application.
[0101] To “treat” a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject (e.g., Best Disease). The compositions described above are typically administered to a subject in an effective amount, that is, an amount capable of producing a desirable result. The desirable result will depend upon the active agent being administered. For example, an effective amount of a rAAV particle may be an amount of the particle that is capable of transferring a heterologous nucleic acid to a host organ, tissue, or cell.
[0102] Toxicity and efficacy of the compositions utilized in methods of the disclosure can be determined by standard pharmaceutical procedures, using either cells in culture or experimental animals to determine the LD50 (the dose lethal to 50% of the population). The dose ratio between toxicity and efficacy the therapeutic index and it can be expressed as the ratio LD50/ED50. Those compositions that exhibit large therapeutic indices are preferred. While those that exhibit toxic side effects may be used, care should be taken to design a delivery system that minimizes the potential damage of such side effects. The dosage of compositions as described herein lies generally within a range that includes an ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
[0103] Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present disclosure to its fullest extent. The following specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All publications cited herein are incorporated by reference for the purposes or subject matter referenced herein.
EXAMPLES
Example 1
Early Retina-Wide Pathology at the RPE-PR Interface.
[0104] To understand the pathophysiology behind the impaired RPE-PR interaction, cBest retinas with clinically obvious disease were evaluated. The key features of RPE apical membrane responsible for direct interaction with PR OS s were examined by immunohistochemistry (IHC) against EZRIN, a membrane-cytoskeleton linker protein essential for formation of RPE apical MV, and combined with human cone arrestin (hCAR) and peanut agglutinin lectin (PNA) labeling to distinguish the cone PR matrix-specific interface. Confocal microscopy and analysis of 3D reconstruction images from the wild-type (WT) retina exposed a complex sheet-like structure of both inherent constituents of RPE apical membrane: cone- and rod-associated MV. Cone-MV (also known as RPE apical cone sheath) were more pronounced than rod-MV, and formed a highly organized wrapping that tethered individual cone outer segments (COSs) to the RPE apical surface (
[0105] To evaluate the possibility that the structural cone-MV abnormalities are secondary to cone dysfunction and disease, the RPE-COS interaction in a different canine IRD model was examined: a primary cone photoreceptor channelopathy, CNGB3-associated achromatopsia. The RPE-COS complex was first examined at 6 wk of age; CNGB3-mutant retinas, harboring either a missense or locus deletion mutation, showed no apparent irregularities at the RPE-PR interface, and the proper localization of RPE apical markers was associated with specific anti-BEST1 labeling (
[0106] The findings in CNGB3-mutant retinas suggested that the structural alterations associated with cone-MV ensheathment in cBest were not secondary to a cone defect but specific to the RPE channelopathy triggered by mutations in BEST1. The 6-week time point, which is well before clinical disease onset and near the end of postnatal retinal differentiation in dogs, was the focus of these experiments (
cBEST1-Mutant Eyes have Retina-Wide Microdetachments that Expand with Light Exposure.
[0107] To determine in vivo correlates of the early RPE-PR interface abnormalities detected by IHC, noninvasive imaging with optical coherence tomography (OCT) was used to evaluate cBest eyes at young ages, well before ophthalmoscopic lesions are detectable. Qualitatively, central retinas of all evaluated eyes showed an additional hyposcattering layer in the outer retina located distal to the outer nuclear layer (ONL) that was not detectable in WT eyes (
[0108] Quantitative studies were performed by obtaining longitudinal reflectivity profiles and making measurements both at nasal and temporal retinal locations. WT eyes (n=12, ages 15 to 17 wk) showed outer retinal hyperscattering peaks at the outer plexiform layer (OPL) and the external limiting membrane (ELM) defining the intervening hyposcattering layer as the ONL (
[0109] Two types of experiments were performed to better understand the thickness of the hyposcattering layer as a function of light exposure. In the main experiment (WT, n=12, age 15 to 17 wk; cBest, n=3, age 13 wk), eyes were dark-adapted overnight and then sequential imaging was performed in the dark over a 2-h period with five intervening brief 488-nm light exposures of incrementally greater intensity ranging from very dim lights to moderate lights produced by standard clinical ophthalmic equipment (
[0110] In preparation for localized gene therapy, retinotopic distribution of light-driven microdetachments was evaluated in fully light-adapted cBest and WT eyes (
[0111] To assess the potential adverse consequences on photoreceptors, ONL thickness was topographically mapped across the retinal areas with microdetachments (
Natural History of Canine Bestrophinopathy.
[0112] As a prerequisite to assessing gene therapy outcomes, the natural history of cBest was determined from a group of 18 dogs [12 male (M) and 6 female (F); age range 6 to 297 wk] (Table 1). cBest dogs were serially monitored by ophthalmoscopy and noninvasive imaging to detect the onset of earliest disease and understand disease progression. Based on the systematic in vivo imaging, the first disease signs were detected as early as 11 wk of age (mean age of 15 wk) as a subtle focal retinal elevation of the canine fovea-like regions (
[0113] In each case followed by serial imaging (Table 1), cBest manifested bilaterally and nearly always presented a remarkable symmetry, albeit with a variable rate of progression (
TABLE-US-00005 TABLE 1 Summary of AAV-BEST1-treated and control eyes used in the study. AAV titer Last cBEST1 Age, inj., Volume examination, Dog ID Sex status Eye Treatment wk vg/mL inj., μL wk p.i. Outcome EM356 M R25*/ OD AAV- 52 1.5E+10 50 245 Reversal P463fs cBEST1 OS UnTx 245 Progression EM385 M R25*/ OD BSS 39 50 105 Progression R25* OS AAV- 39 1.5E+11 60 105 Reversal cBEST1 EMC1 F R25*/ OD AAV- 27 2.0E+11 110 156 Reversal R25* hBEST1 OS BSS 27 110 156 Progression EMC3 F R25*/ OD BSS 27 110 103 Progression R25* OS AAV- 27 2.0E+11 120 103 Reversal hBEST1 EML4 M R25*/ OD BSS 58 150 79 Progression P463fs OS AAV- 58 2.5E+11 95 79 Reversal hBEST1 EML6 F R25*/ OD AAV- 43 2.0E+11 100 51 Reversal P463fs hBEST1 OS BSS 43 110 51 Progression EML9 M R25*/ OD AAV- 69 5.0E+11 65 54 Reversal P463fs hBEST1 OS BSS 69 70 54 Progression EML13 F R25*/ OD UnTx 52 Progression P463fs OS AAV- 45 1.5E+11 100 52 Reversal hBEST1 EML22 R25*/ OD AAV- 27 3.5E+11 100 39 Reversal P463fs hBEST1 OS AAV- 27 3.5E+11 100 39 Reversal hBEST1 LH15 P463fs/ OD AAV- 65 2.5E+11 180 207 Reversal P463fs hBEST1 OS AAV- 65 2.5E+11 50 207 Reversal hBEST1 LH21 P463fs/ OD BSS 27 50 207 Progression P463fs OS AAV- 27 2.5E+11 50 207 Reversal hBEST1 LH30 P463fs/ OD AAV- 31 2.5E+11 110 13 Reversal P463fs hBEST1 OS AAV- 31 2.5E+11 110 13 Reversal hBEST1 AS277 M WT OU UnTx 6 control EML24 M R25*/ OU UnTx 6 P463fs control EML21 M R25*/ OU UnTx 13 P463fs control EML23 F R25*/ OU UnTx 13 P463fs control N306 M WT OU UnTx 15 control N307 F WT OU UnTx 15 control N308 F WT OU UnTx 15 control N300 M WT OU UnTx 17 control N301 M WT OU UnTx 17 control N302 F WT OU UnTx 17 control CCAN M WT OU UnTx 37 control CCGS M WT OU UnTx 37 control LH14 M WT OU UnTx 42 control EML31 M R25*/ OD UnTx 43 P463fs control EML27 M R25*/ OD UnTx 52 P463fs control EM346 M R25*/ OS UnTx 89 R25* control N284 F WT OS UnTx 145 control N269 F WT OS UnTx 199 control Key: BSS, balanced salt solution; cBEST1, canine transgene; hBEST1, human transgene; Inj., injected; OD, right eye; OS, left eye; OU, bilateral; p.i., postinjection; UnTx, untreated; vg, vector genomes; WT, wild type. cBEST1 mutations: R25*/R25*, p.Arg25Ter-homozygote; P463fs/P463fs, p.Pro463fs-homozygote; R25*/P463fs, p.Arg25Ter/p.Pro463fs-compound heterozygous.
Subretinal BEST1 Gene Augmentation Therapy Stably Corrects Disease.
[0114] To evaluate proof of concept for AAV2-mediated subretinal gene augmentation therapy, 22 cBest eyes were injected [vector titers in the 0.1 to 5×10.sup.11 vector genomes (vg) per mL range or balanced salt solution (BSS) control] at 27 to 69 wk (Table 1) with a canine (cBEST1) or human (hBEST1) transgene driven by the human VMD2 promoter. Maps of exemplary AAV vectors comprising hBEST1 and cBEST1 heterologous nucleic acids used to make the disclosed rAAV particles are shown in
[0115] A representative result is shown from a compound heterozygous (R25*/P463fs) dog displaying advanced central retinal detachment in the right eye (EM356-OD) (
[0116] AAV-mediated treatment with the hBEST1 also resulted in lesion reversal and long-term disease correction (n=13 eyes). Representative in vivo imaging results and MC evaluations (
[0117] Retinas were preserved after AAV-hBEST1 treatment in three cBest models [cmr1 (R25*/R25*), cmr1/cmr3 (R25*/P463fs), and cmr3 (P463fs/P463fs)] in comparison with the wild-type control and cBest untreated eyes. cBest eyes were injected with AAV-hBEST1 (2×10.sup.11 vg/mL) at 27 wk (cmr1), 45 wk (cmr1/cmr3), or 63 wk (cmr3) of age, and evaluated by IHC at 103 wk, 51 wk, or 207 wk p.i., respectively (
[0118] Representative confocal photomicrographs are shown in
Correction of Light-Modulated Microdetachments with Gene Therapy.
[0119] To understand the consequences of BEST1 gene augmentation therapy on retinal regions without ophthalmoscopically detectable retinal detachments, IS/OS-RPE/T distance was measured topographically within and outside subretinal blebs, A representative result with a control subretinal BSS injection at age 69 wk in a cBest (R25*/P463fs) dog showed homogeneous microdetachment covering all the imaged retina at age 87 wk (
[0120] The region of efficacy with subretinal gene therapy is often shown to extend beyond the bleb formed at the time of the surgery to include a penumbral region. In cBest dogs with successful gene therapy, there was also a penumbral region but it appeared to be qualitatively larger than typically encountered previously (
[0121] To understand the potential consequences of gene therapy on retinal degeneration, ONL thickness was mapped across treated eyes (
Human Autosomal Recessive Bestrophinopathies: Structure and Function.
[0122] To facilitate clinical translation of successful gene therapy in BEST1-mutant dogs, studies were performed to better understand the human pathophysiology of autosomal recessive bestrophinopathies (ARBs) and to gain insight into the distribution of retina-wide disease beyond the gross ophthalmoscopically detectable lesions previously described. Data are shown (
[0123] Rod and cone function was sampled at high density along the horizontal meridian to better understand the topography of vision loss and its correspondence to retinal structural abnormalities. Both patients demonstrated a deep (>3 log) loss of rod-mediated sensitivity centrally in long-term dark-adapted eyes; there was relative preservation of rod function in the temporal field (nasal retina) in both patients and the parapapillary area in one patient (
[0124] Cross-sectional imaging with OCT was performed to evaluate the retinal lamination abnormalities along the horizontal meridian crossing the fovea (
[0125] To understand the implications of structural abnormalities at the level of the outer retina and RPE for the kinetics of retinoid transfer between these cellular layers, dark-adaptation testing was performed. At the parapapillary location shown in
[0126] The RPE has a key role in maintaining the metabolically active environment of the subretinal space. Due to the dynamic relationship with adjacent retinal layers, mutations in RPE-specific genes often adversely affect the neighboring sensory neurons, leading to loss of visual function and PR degeneration. Mutations in BEST1 are known to disrupt transepithelial ion and fluid transport in response to abnormal levels of intracellular calcium. Abnormal RPE calcium signaling is also thought to lead to dysregulation of other pathways through altered expression and interactions of Ca.sup.2+-sensitive proteins. Based on findings in cBest, one such protein is EZRIN, a membrane-cytoskeleton linker essential for the formation and proper maturation of RPE apical MV. It has been demonstrated that the activation of EZRIN's membrane-F-actin cross-linking function occurs directly in response to Ca.sup.2+ transients, and Ezrin-KO mice exhibit a substantial decrease in elaboration of RPE MV. The apparent underdevelopment of RPE apical MV found in the BEST1-mutant RPE is consistent with these findings. Furthermore, comparative IHC assessments with other IRD models demonstrated that these major structural alterations associated with microvillar ensheathment are specific to the primary RPE channelopathy triggered by BEST1 mutations, and not secondary to cone dysfunction and degeneration.
[0127] The structural components of RPE apical processes are very different from those of nonmotile intestinal microvilli. The presence of contractile proteins (such as myosin) in the RPE apical microvilli, and also molecules typically found at the sites of cell attachments, suggests that the RPE actively adheres to, and exerts tension on, the neural retina. The dearth of a proper microvillar ensheathment at the RPE-PR interface in cBest, and thus an absence of physical and electrostatic support by these projections to the PR OS, would be expected to weaken the adhesive forces and lead to separation of the RPE-PR complex retina-wide. The microdetachment of the PR layer from the underlying RPE found in cBest at the earliest stages of disease would be consistent with this process. Moreover, the presence of contractile elements in the RPE apical projections and the fact that they have evolved from cells in which pigment migration occurred indicate that MV are capable of active contraction while interdigitating with PR OS, and are destined to facilitate circadian phagocytic activity. A single RPE cell can accommodate about 30 to 50 PRs, depending on the retinal location and packing density; the elaborate network of microvilli allows each RPE cell to handle such a high metabolic load on a daily basis. Insights from proteomic profiling support this argument. There is an enriched fraction of retinoid-processing proteins expressed along the RPE apical MV, together with a number of channel proteins and transporters (e.g., Na.sup.+/K.sup.+ ATPase) central to the efficient transport of water, ions, and metabolites between the RPE and PR OS. Considering the topographic differences in the size of RPE cells and taking into account the density and length of MV quantified in this study, MV extensions expand the functional surface of a single RPE cell by 20- to 30-fold in the central retina, which is consistent with earlier estimates. This number is even higher (˜50-fold) for the small RPE cells in the macular region that adapted to a higher turnover rate of shed POS while facing the most densely packed PRs. Such dramatic reduction in a total apical surface area in BEST1-mutant RPE will lead to a chronic delay in processing of metabolites, and arrest the abilities of the RPE to maintain both the proper cell volume as well as chemical composition and physiological pH levels in the subretinal space. Since these factors are essential for retinal adhesion, any limitation in the RPE transporting system will alter the balance of hydrostatic forces and result in decreased osmoelastic properties of the RPE-PR complex with subsequent separation from the neuroretina. Indeed, the primary serous detachment in human and canine bestrophinopathy is first evident in the fovea, the central area of highest metabolic activity. The absence of high-reaching RPE apical processes, which in the structurally intact retina tightly wrap COS up to the ellipsoids, would explain the predilection of this cone-rich structure for its primary detachment in bestrophinopathies. There would be almost exclusive reliance on the frictional interactions with the MV. This is consistent with observations in cBest, documenting formation of the focal previtelliform lesions within the canine fovea-like area of the area centralis, and also the susceptibility of other central cone-rich areas (like visual streak) to subretinal detachment.
[0128] The major expansion of microdetachments in cBest upon exposure to dim and moderate light intensities was an unexpected result. In normal eyes, light exposure is known to change molecular composition of the subretinal space. There is also evidence that measurable structural changes occur in the normal outer retina with light exposure, such as changes in outer segment length, hydration of the subretinal space, increased actin staining along RPE apical MV, and phototropism of outer segments. However, all of the normal changes are substantially smaller than those measured in cBest. For example, normal human eyes showed changes of ˜1 μm, and normal mouse eyes showed changes of ˜4 μm in the outer retina, compared with ˜18-μm expansion of the subretinal space driven by light in cBest. Human ARB has only recently been recognized and the literature on the earliest disease stages is limited. The recessive cBest disease appears to have phenotypic similarities to both dominant and recessive bestrophinopathies in humans. In patients with Best disease (BVMD), there has been some controversy regarding the structural features of retinal regions surrounding vitelliform or later-stage lesions, or retinas in the previtelliform stage of disease. Some studies have demonstrated minor abnormalities at the level of the RPE-PR interface, whereas results from others support no detectable structural defects. Contributing to this controversy could be genotype, the resolution of different methodological approaches used, or light history preceding the imaging. Indeed, light-dependent outer retinal changes have been described in BVMD using methods such as those disclosed herein; still, the magnitude of the changes in patients was smaller (˜2 μm) than in cBest. In general, however, the abnormal response of the affected retina to light stimuli could be related to the markedly reduced light peak/dark trough ratio in the electrooculogram, a finding consistent in all, even presymptomatic, Best Disease patients.
[0129] Of importance, both the micro- and macrodetachments in cBest had adverse effects on photoreceptor health: Regions of microdetachment tended to correspond to hyperthick ONL, whereas large lesions with gross macrodetachment showed thinning of ONL. Smaller lesions with macrodetachment could not be assessed with the sampling methods used here. ONL contains the nuclei of all rods and cones, and classic studies in animal models and human eye donors have generally shown thinning of the ONL with disease progression. Less well known are some of the earliest stages of retinal disease showing ONL thickening, which has only become measurable with the advancement of in vivo imaging methods. Human studies have previously demonstrated such ONL thickening in early stages of retinal diseases. There has also been evidence in animal studies of ONL thickening associated with retinal stress. The hyperthick regions of ONL mapped in cBest when examined microscopically showed the number of PR nuclei to be comparable to control, suggesting a greater internuclear spacing within the ONL, likely corresponding to a level of retinal stress that is below the apoptosis threshold. Gross retinal detachments, on the other hand, may cause greater retinal stress and progressive degeneration.
[0130] To prevent the photoreceptor and vision loss associated with BEST1 mutations, subretinal gene augmentation therapy directed to retinal areas with macro- and microdetachments was performed. Results showed that AAV-mediated BEST1 gene augmentation is safe, reverses the clinically obvious lesions, ameliorates the diffuse microdetachments, and results in normalization of hyperthick ONL. Furthermore, gene therapy was successful in three distinct BEST1 genotypes with both focal and multifocal presentations, and confirmed long-term durability of the treatment effect. At the molecular level, the ability of the canine as well as the human BEST1 transgene to correct the apposition of the RPE-PR complex and restore the cytoarchitecture of this critical interface was confirmed. This study suggests that early as well as more advanced stages of autosomal recessive disease are sensible to approach with this therapy. Further studies utilizing human inducible pluripotent stem cell (hiPSC)-derived RPE models derived from patients harboring autosomal Best1 mutations will determine whether the gene augmentation approach would also be beneficial for BVMD patients.
[0131] To facilitate the clinical translation of successful gene augmentation therapy, ARB patients were studied to gain insight into their retina-wide disease. Consistent with most, but not all, previous descriptions, retinal disease in ARB patients extended well beyond the macula into the midperiphery. Retinotopic mapping of en face and cross-sectional imaging and rod and cone function demonstrated the existence of a distinct transition from disease to health in the midperipheral retina, a feature not previously emphasized. Within the diseased region, severe abnormalities in retinal structure were associated with severe loss of rod function; unexpectedly, cone function was relatively retained. Rod dysfunction within the central retina was also associated with extreme slowing of the retinoid cycle, whereas the healthier periphery showed near-normal recycling of the retinoids. There are at least two retinoid cycles that provide the 11-cis-retinal chromophore to photoreceptor pigments. The canonical retinoid cycle functions in the RPE to produce chromophore for rod and cone PRs. The retinal retinoid cycle, on the other hand, is thought to regenerate chromophore within the retina for the specific use of cones. The abnormal RPE-PR interface in Best disease would most likely affect the chromophore delivery from the canonical RPE retinoid cycle; the retinal retinoid cycle may be relatively unaffected, thus explaining the greater retention of cone function.
[0132] In summary, as disclosed herein, new molecular contributors to the pathophysiology of bestrophinopathies at the RPE-PR interface were surprisingly uncovered. The earliest expression of disease was discovered—a diffuse microdetachment potentiated by light exposure that was easily detectable by in vivo imaging. AAV-mediated BEST1 augmentation gene therapy reversed both the grossly obvious lesions and microdetachments, and restored the cytoarchitecture of the RPE-PR interface. Evaluation of ARB patients showed retinotopic distribution and properties of structural and functional defects beyond that expected from PR degeneration. Such visual dysfunction may be expected to improve upon successful application of BEST1 gene augmentation therapy to patients affected with bestrophinopathies.
Example 2
[0133] The vector technology of Example 2 was designed to suppress the expression of endogenous BEST1 mRNA (both the mutated and the normal copy) using RNA interference. These vectors simultaneously replace the endogenous BEST1 mRNA with normal BEST1 mRNA to produce only normal protein. The technology uses adeno-associated virus to deliver an intronless copy of the BEST1 gene plus a gene for a small hairpin RNA (shRNA) that leads to the production of a small interfering RNA (siRNA). The BEST1 gene has been rendered resistant to the siRNA because of silent mutations in its reading frame. Two shRNAs, and therefore two modified human BEST1 genes, were designed. Both BEST1 genes are driven by a 623 bp fragment of the human VMD2 promoter. The BEST1 cDNA is preceded by a synthetic intron and followed by a poly adenylation sequence, both derived from the SV40 virus. In one case, shRNA05 is driven by the RNA polymerase III (pol III) H1 promoter, and in the other, shRNA744 it is driven by the pol III U6 promoter. A sequence of six thymidines, serves as a termination sequence for each shRNA. To identify these active shRNAs, nine potential siRNA or shRNA sequences were screened.
[0134] The genetic sequences encoding the shRNAs are as follows:
TABLE-US-00006 shRNA05 (SEQ ID NO: 1) CGUCAAAGCUUCACAGUGU UUCAAGAGA ACACUGUGAAGCUUUGACG shRNA05 shRNA05 sense Loop anti-sense (SEQ ID NO: 2) (SEQ ID NO: 7) (SEQ ID NO: 3) shRNA744 (SEQ ID NO: 4) AAGAACUCGCCAUAUAGCAGC CUCGAG GCUGCUAUAUGGCGAGUUCUU shRNA744 antisense Loop shRNA744 sense (SEQ ID NO: 5) (SEQ ID NO: 8) (SEQ ID NO: 6)
[0135] Maps of exemplary AAV vectors comprising heterologous nucleic acids encoding shRNA05 and shRNA744 as well as a hBEST1 gene that includes a de-targeted sequence (e.g., one of SEQ ID NOs: 10 or 11), which are used to produce the disclosed rAAV particles, are shown in
[0136] In some embodiments, disclosure provides an shRNA05 sense strand that comprises a sense strand comprising the nucleotide sequence of SEQ ID NO: 2, plus an additional nucleotide immediately prior to the first cytosine of this sequence. In certain embodiments, this additional nucleotide comprises a cytosine (C).
[0137] In some embodiments, the disclosure provides an shRNA05 that comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO: 3.
[0138] An exemplary genetic sequence corresponding to the region of the vector encoding the pol III H1 promoter, shRNA05, and termination sequence is as follows:
TABLE-US-00007 (SEQ ID NO: 20) TAAAACGACGGCCAGTGAATTCATATTTGCATGTC GCTATGTGTTCTGGGAAATCACCATAAACGTGAAA TGTCTTTGGATTTGGGAATCTTATAAGTTCTGTAT GAGACCACTcggatccCGTCAAAGCTTCACAGTGT TTCAAGAGAACACTGTGAAGCTTTGACGTTTTTT.
This sequence further includes a BamHI endonuclease site (ggatcc) to facilitate screening and ensure that the start site of the shRNA05 would be positioned 25 nucleotides downstream of the H1 promoter TATA box (TATAA). Accordingly, in some embodiments, an shRNA (e.g., shRNA05) encoded by a nucleic acid comprising this sequence (and/or the complement thereof) is transcribed in a host cell (e.g., in a subject, for example in a human subject, treated with the vector). In some embodiments, two or more different shRNAs (e.g., having different start sites and/or termination sites, for example differing from shRNA05 by one or two additional or fewer nucleotides) are transcribed in a host cell.
[0139]
Materials and Methods
Canine BEST1 Models and In Vivo Retinal Imaging.
[0140] cBest-mutant dogs (n=18) of both sexes (12 M and 6 F) harboring either homozygous (c.73C>T) (p.R25*/R25*) or (c.1388delC) (p.P463fs/P463fs) or biallelic (c.73C>T/1388delC) (p.R25*/P463fs) mutations in cBEST1 (GB*NM 001097545) were included. For ease of annotating the multipanel figures, the three genotypes, respectively, are referred to as cmr1, cmr3, and cmr1/cmr3. The study was conducted in comparison with control cross-bred dogs (n=12; 7 M and 5 F) (Table 1). All animals were bred and maintained at the Retinal Disease Studies Facility (RDSF). The studies were carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the NIH and in compliance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research. The protocols were approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania (IACUC nos. 804956 and 803422). En face and retinal cross-sectional imaging was performed with the dogs under general anesthesia as previously described.
Human Subjects.
[0141] Light-adapted and two-color dark-adapted function was measured at 2° intervals across the central visual field (central 60° along horizontal and vertical meridians) and at 12° intervals throughout the visual field. Photoreceptor mediation under dark-adapted conditions was determined by the sensitivity difference between 500- and 650-nm stimuli. Dark-adaptation kinetics was evaluated similar to techniques previously described (92-94) using an LED-based dark adaptometer (Roland Consult) and a short-duration (30 s) moderate light exposure from a clinical short-wavelength autofluorescence imaging device (25% laser output; Spectralis HRA; Heidelberg Engineering). Optical coherence tomography (OCT) was used to analyze laminar architecture across the retina. Retinal cross-sections were recorded with a spectral-domain (SD) OCT system (RTVue-100; Optovue). Postacquisition data analysis was performed with custom programs (MATLAB 7.5; MathWorks). Recording and analysis techniques have been previously described (30, 31, 94). Longitudinal reflectivity profiles (LRPs) were used to identify retinal features. A confocal scanning laser ophthalmoscope (Spectralis HRA; Heidelberg Engineering) was used to record en face images and estimate RPE health with short-wavelength reduced-illuminance autofluorescence imaging (SW-RAFI) as previously described (95). All images were acquired with the high-speed mode (30°×30° square field or 50° circular field).
Canine BEST1 Models and in Vivo Retinal Imaging.
[0142] Overlapping en face images of reflectivity with near-infrared illumination (820 nm) were obtained (Spectralis HRA+OCT) with 30°- and 55°-diameter lenses to delineate fundus features such as the optic nerve, retinal blood vessels, boundaries of injection blebs, retinotomy sites, and other local changes. Custom programs (MATLAB 7.5; MathWorks) were used to digitally stitch individual photos into a retina-wide panorama. Short-wavelength autofluorescence and reflectance imaging was used to outline the boundary of the tapetum and pigmented RPE. Spectraldomain optical coherence tomography (SD-OCT) was performed with overlapping (30°×25°) raster scans across large regions of the retina. Postacquisition processing of OCT data was performed with custom programs (MATLAB 7.5). For retina-wide topographic analysis, integrated backscatter intensity of each raster scan was used to position its precise location and orientation relative to the retinal features visible on the retinawide mosaic formed by near-infrared reflectance (NIR) images. Individual LRPs forming all registered raster scans were allotted to regularly spaced bins (1°×1°) in a rectangular coordinate system centered at the optic nerve; LRPs in each bin were aligned and averaged. Intraretinal peaks and boundaries corresponding to the OPL, ELM, IS/OS, and RPE/T were segmented using both intensity and slope information of backscatter signal along each LRP. Topographic maps of ONL thickness were generated from the OPL-to-ELM distance, and maps of IS/OSto-RPE/T thickness were generated from the distance between these peaks. For all topographic results, locations of blood vessels, optic nerve head, bleb, tapetum boundaries, and fovea-like area (24) were overlaid for reference. First, maps from WT dogs were registered by the centers of the optic nerve head and rotated to bring the fovea-like areas in congruence, and a map of mean WT topography was derived. The fovea-like area of cBest mutant dogs was determined by superimposing a WT template onto mutant eyes by alignment of the optic nerve head, major superior blood vessels, and boundary of the tapetum. Next, cBEST1-mutant maps were registered to the WT map by the center of the optic nerve and estimated fovea-like area, and difference maps were derived. Difference maps were sampled within and outside treatment blebs for each eye. The relation between exposure to light and changes to outer retinal structure was evaluated by two approaches. In a subset of eyes, cross-sectional OCT imaging was performed early in each experimental session followed initially by autofluorescence imaging with a bright short-wavelength light followed subsequently by further OCT imaging. OCT records obtained early in such sessions were considered to be from retinas exposed to less light compared with records obtained late, although the exact light exposure could not be quantified. In another subset of eight eyes, OCT recordings were performed after overnight dark adaptation, and serially in a dark room following short intervals of short-wavelength light exposure from a cSLO. In three of the eyes, five increasingly greater light exposures were used: L1: laser, 20%; duration, 60 s; L2: laser, 25%; duration, 30 s; L3: laser, 50%; duration, 30 s; L4: laser, 100%; duration, 30 s; L5: laser, 100%; duration, 300 s. In three eyes, only L4 and L5 were used. In two additional eyes, only L5 was used to follow the recovery of light-mediated microdetachment over a 24-h period. The standard (100%) laser setting is estimated to correspond to a human retinal irradiance of 330 μW.Math.cm-2 at 488-nm wavelength (98). In both approaches, the areas selected for analysis were based on near-infrared imaging of the fundus with the cSLO before the start of the study, and excluded areas where overt clinically visible macrodetachments were located.
Subretinal Injections and Postoperative Procedures.
[0143] Subretinal injections of recombinant AAV2/2 delivering either the cBEST1 or hBEST1 transgene under control of the human VMD2 promoter (46) were performed under general anesthesia following previously published procedures (46, 82, 97). Vector production and validation have been detailed previously (46). Injection volumes ranging from 50 to 180 μL of the viral vector solution (titer range of 0.1 to 5×10.sup.11 vg/mL) (Table 1) were delivered subretinally using a custom-modified RetinaJect subretinal injector (SurModics) (97) under direct visualization with an operating microscope via a transvitreal approach without vitrectomy. An anterior chamber paracentesis was performed immediately after injection to prevent increase in intraocular pressure. Directly after injection, formation of a subretinal bleb was documented by fundus photography (RetCam Shuttle; Clarity Medical Systems). In all cases, the surgical bleb flattened and the retina reattached within 24 to 48 h p.i. Ophthalmic examinations, including biomicroscopy, indirect ophthalmoscopy, and fundus photography, were conducted on a regular basis (24 h, 48 h, and 5 d p.i., and then weekly for the first 2 mo followed by a monthly eye examination thereafter) throughout the injection-end point evaluation time interval. Postoperative management was performed as described previously (46).
Histological and Immunohistochemical Evaluations.
[0144] Ocular tissues for ex vivo analyses were collected as previously described (24, 99). All efforts were made to improve animal welfare and minimize discomfort. For all ex vivo assessments, cBest and control (WT) eyes were fixed in 4% paraformaldehyde, embedded in optimal cutting temperature media, and processed as reported previously (99). Histological assessments were made using standard hematoxylin/eosin (H&E) staining, and all immunohistochemical experiments were performed on 10-μm-thick cryosections following established protocols (46, 99). Briefly, retinal cryosections were permeabilized with 1×PBS/0.25% Triton X-100, blocked for 1 h at room temperature, and incubated overnight with a primary antibody (Table 2). For multicolor labeling, primary antibodies were combined with Alexa Fluor 488 phalloidin (Thermo Fisher Scientific) or PNA-AF647 (L32460; Molecular Probes), followed by incubation with a corresponding secondary antibody (Alexa Fluor) for 1 h. The slides were examined by epifluorescence or transmitted light microscopy (Axioplan; Carl Zeiss Meditec), and digital images were collected with a Spot 4.0 camera (Diagnostic Instruments).
TABLE-US-00008 TABLE 2 List of primary antibodies used for immunohistochemical assessments. Antibody Dilution Source Mouse monoclonal anti-BEST1 1:400 Ab2182; Abcam Mouse monoclonal anti-EZRIN 1:400 Ab4069; Abcam Mouse monoclonal anti-RPE65 1:500 NB100-355; Novus Biologicals Mouse monoclonal anti-BEST1 .sup. 1:1,000 MAB5316; Millipore Rabbit polyclonal anti-hCAR 1:10,000 Courtesy of C. M. Craft, University of Southern California, Los Angeles Rabbit polyclonal anti- 1:100 AB5405; Millipore RED/GREEN OPSIN Rabbit polyclonal anti- .sup. 1:5,000 AB5407; Millipore BLUE OPSIN Rabbit polyclonal anti- 1:500 Courtesy of N. J. SLC16A1 Philp, Thomas Jefferson University, Philadelphia Chicken polyclonal anti- 1:500 Michigan State CNGB3 University
Confocal Microscopy and Image Analysis.
[0145] Confocal images were acquired on a TCS-SP5 confocal microscope system (Leica Microsystems) or an A1R laser scanning confocal microscope (Nikon Instruments). To obtain counts of cone-associated MV (cone-MV), two adjacent fields, each region of interest (ROI) 155 μm long, were imaged 4 mm from the optic nerve head in 10 retinal sections per retinal quadrant (temporal, superior, inferior, and nasal) (n=80 ROIs per eye) in both eyes from 6-wkold cBest (R25*/P463fs) and an age-matched WT control. Image stacks were acquired at 0.25-μm Z-steps and deconvolved with Huygens deconvolution software version 17.04 (Scientific Volume Imaging). All deconvolved images were rendered in the Leica LAS X 3D rendering module, where the cone-MV were counted manually. The length of both cone- and rod-MV was assessed within the Leica LAS X software from maximum projection images. Data were analyzed in Microsoft Excel and quantified using Prism software version 7 (GraphPad).
REFERENCES
[0146] 1. Bramall A N, Wright A F, Jacobson S G, McInnes R R (2010) The genomic, biochemical, and cellular responses of the retina in inherited photoreceptor degenerations and prospects for the treatment of these disorders. Annu Rev Neurosci 33:441-472. [0147] 2. Veleri S, et al. (2015) Biology and therapy of inherited retinal degenerative disease: Insights from mouse models. Dis Model Mech 8:109-129. [0148] 3. Cideciyan A V (2010) Leber congenital amaurosis due to RPE65 mutations and its treatment with gene therapy. Prog Retin Eye Res 29:398-427. [0149] 4. Ghazi N G, et al. (2016) Treatment of retinitis pigmentosa due to MERTK mutations by ocular subretinal injection of adeno-associated virus gene vector: Results of a phase I trial. Hum Genet 135:327-343. [0150] 5. Russell S, et al. (2017) Efficacy and safety of voretigene neparvovec (AAV2-hRPE65v2) in patients with RPE65-mediated inherited retinal dystrophy: A randomised, controlled, open-label, phase 3 trial. Lancet 390:849-860. [0151] 6. Best F (1905) Uber eine hereditare Maculaaffektion. Z Augenheilkd 13:199-212. [0152] 7. Petrukhin K, et al. (1998) Identification of the gene responsible for Best macular dystrophy. Nat Genet 19:241-247. [0153] 8. Boon C J, et al. (2009) The spectrum of ocular phenotypes caused by mutations in the BEST1 gene. Prog Retin Eye Res 28:187-205. [0154] 9. Marmorstein A D, et al. (2000) Bestrophin, the product of the Best vitelliform macular dystrophy gene (VMD2), localizes to the basolateral plasma membrane of the retinal pigment epithelium. Proc Natl Acad Sci USA 97:12758-12763. [0155] 10. Sun H, Tsunenari T, Yau K W, Nathans J (2002) The vitelliform macular dystrophy protein defines a new family of chloride channels. Proc Natl Acad Sci USA 99: 4008-4013. [0156] 11. Neussert R, Muller C, Milenkovic V M, Strauss O (2010) The presence of bestrophin1 modulates the Ca2+ recruitment from Ca2+ stores in the ER. Pflugers Arch 460: 163-175. [0157] 12. Hartzell H C, Qu Z, Yu K, Xiao Q, Chien L T (2008) Molecular physiology of bestrophins: Multifunctional membrane proteins linked to Best disease and other retinopathies. Physiol Rev 88:639-672. [0158] 13. Strauß O, Muller C, Reichhart N, Tamm E R, Gomez N M (2014) The role of bestrophin1 in intracellular Ca(2+) signaling. Adv Exp Med Biol 801:113-119. [0159] 14. Fischmeister R, Hartzell H C (2005) Volume sensitivity of the bestrophin family of chloride channels. J Physiol 562:477-491. [0160] 15. Milenkovic A, et al. (2015) Bestrophin 1 is indispensable for volume regulation in human retinal pigment epithelium cells. Proc Natl Acad Sci USA 112:E2630-E2639. [0161] 16. Mullins R F, Kuehn M H, Faidley E A, Syed N A, Stone E M (2007) Differential macular and peripheral expression of bestrophin in human eyes and its implication for Best disease. Invest Ophthalmol Vis Sci 48:3372-3380. [0162] 17. Guziewicz K E, et al. (2017) Bestrophinopathy: An RPE-photoreceptor interface disease. Prog Retin Eye Res 58:70-88. [0163] 18. Kane Dickson V, Pedi L, Long S B (2014) Structure and insights into the function of a Ca(2+)-activated Cl(−) channel. Nature 516:213-218. [0164] 19. Yang T, et al. (2014) Structure and selectivity in bestrophin ion channels. Science 346: 355-359. [0165] 20. Vaisey G, Miller A N, Long S B (2016) Distinct regions that control ion selectivity and calcium-dependent activation in the bestrophin ion channel. Proc Natl Acad Sci USA 113:E7399-E7408. [0166] 21. Deutman A F (1969) Electro-oculography in families with vitelliform dystrophy of the fovea. Detection of the carrier state. Arch Ophthalmol 81:305-316. [0167] 22. Arden G B, Constable P A (2006) The electro-oculogram. Prog Retin Eye Res 25: 207-248. [0168] 23. Guziewicz K E, et al. (2007) Bestrophin gene mutations cause canine multifocal retinopathy: A novel animal model for best disease. Invest Ophthalmol Vis Sci 48: 1959-1967. [0169] 24. Beltran W A, et al. (2014) Canine retina has a primate fovea-like bouquet of cone photoreceptors which is affected by inherited macular degenerations. PLoS One 9: e90390. [0170] 25. Hageman G S, Johnson L V (1991) The photoreceptor-retinal pigment epithelium interface. Principles and Practise of Clinical Electrophysiology of Vision, eds Heckenlively J R, Arden G B (Mosby-Year Book, St. Louis), pp 53-68. [0171] 26. Strauss O (2005) The retinal pigment epithelium in visual function. Physiol Rev 85: 845-881. [0172] 27. Huang B, Karwoski C J (1992) Light-evoked expansion of subretinal space volume in the retina of the frog. J Neurosci 12:4243-4252. [0173] 28. Putting B J, Zweypfenning R C, Vrensen G F, Oosterhuis J A, van Best J A (1992) Bloodretinal barrier dysfunction at the pigment epithelium induced by blue light. Invest Ophthalmol Vis Sci 33:3385-3393. [0174] 29. Li J D, Govardovskii V I, Steinberg R H (1994) Light-dependent hydration of the space surrounding photoreceptors in the cat retina. Vis Neurosci 11:743-752. [0175] 30. Huang Y, et al. (1998) Relation of optical coherence tomography to microanatomy in normal and rd chickens. Invest Ophthalmol Vis Sci 39:2405-2416. [0176] 31. Pianta M J, et al. (2003) In vivo micropathology of Best macular dystrophy with optical coherence tomography. Exp Eye Res 76:203-211. [0177] 32. Cideciyan A V, et al. (2005) In vivo dynamics of retinal injury and repair in the rhodopsin mutant dog model of human retinitis pigmentosa. Proc Natl Acad Sci USA 102: 5233-5238. [0178] 33. Bizheva K, et al. (2006) Optophysiology: Depth-resolved probing of retinal physiology with functional ultrahigh-resolution optical coherence tomography. Proc Natl Acad Sci USA 103:5066-5071. [0179] 34. Kay C N, et al. (2012) Three-dimensional distribution of the vitelliform lesion, photoreceptors, and retinal pigment epithelium in the macula of patients with best vitelliform macular dystrophy. Arch Ophthalmol 130:357-364. [0180] 35. Bissig D, Berkowitz B A (2012) Light-dependent changes in outer retinal water diffusion in rats in vivo. Mol Vis 18:2561. [0181] 36. Abràmoff M D, et al. (2013) Human photoreceptor outer segments shorten during light adaptation. Invest Ophthalmol Vis Sci 54:3721-3728. [0182] 37. Li Y, Fariss R N, Qian J W, Cohen E D, Qian H (2016) Light-induced thickening of photoreceptor outer segment layer detected by ultra-high resolution OCT imaging. Invest Ophthalmol Vis Sci 57:OCT105-OCT111. [0183] 38. Lu Y, Wang B, Pepperberg D R, Yao X (2016) Stimulus-evoked outer segment changes occur before the hyperpolarization of retinal photoreceptors. Biomed Opt Express 8: 38-47. [0184] 39. Zhang P, et al. (2017) In vivo optophysiology reveals that G-protein activation triggers osmotic swelling and increased light scattering of rod photoreceptors. Proc Natl Acad Sci USA 114:E2937-E2946. [0185] 40. Lu C D, et al. (2017) Photoreceptor layer thickness changes during dark adaptation observed with ultrahigh-resolution optical coherence tomography. Invest Ophthalmol Vis Sci 58:4632-4643. [0186] 41. Steinberg R H (1985) Interactions between the retinal pigment epithelium and the neural retina. Doc Ophthalmol 60:327-346. [0187] 42. Mieziewska K (1996) The interphotoreceptor matrix, a space in sight. Microsc Res Tech 35:463-471. [0188] 43. Sidjanin D J, et al. (2002) Canine CNGB3 mutations establish cone degeneration as orthologous to the human achromatopsia locus ACHM3. Hum Mol Genet 11: 1823-1833. [0189] 44. Komáromy A M, et al. (2013) Transient photoreceptor deconstruction by CNTF enhances rAAV-mediated cone functional rescue in late stage CNGB3-achromatopsia. Mol Ther 21:1131-1141. [0190] 45. Acland G M, Aguirre G D (1987) Retinal degenerations in the dog: IV. Early retinal degeneration (erd) in Norwegian elkhounds. Exp Eye Res 44:491-521. [0191] 46. Guziewicz K E, et al. (2013) Recombinant AAV-mediated BEST1 transfer to the retinal pigment epithelium: Analysis of serotype-dependent retinal effects. PLoS One 8: e75666. [0192] 47. Bruewer A R, et al. (2013) Evaluation of lateral spread of transgene expression following subretinal AAV-mediated gene delivery in dogs. PLoS One 8:e60218. [0193] 48. Beltran W A, et al. (2017) Optimization of retinal gene therapy for X-linked retinitis pigmentosa due to RPGR mutations. Mol Ther 25:1866-1880. [0194] 49. Sparrow J R, Hicks D, Hamel C P (2010) The retinal pigment epithelium in health and disease. Curr Mol Med 10:802-823. [0195] 50. Jacobson S G, et al. (2008) Photoreceptor layer topography in children with Leber congenital amaurosis caused by RPE65 mutations. Invest Ophthalmol Vis Sci 49: 4573-4577. [0196] 51. Charbel Issa P, et al. (2009) Characterisation of severe rod-cone dystrophy in a consanguineous family with a splice site mutation in the MERTK gene. Br J Ophthalmol 93:920-925. [0197] 52. Meunier I, et al. (2016) A dominant mutation in MAPKAPK3, an actor of p38 signaling pathway, causes a new retinal dystrophy involving Bruch's membrane and retinal pigment epithelium. Hum Mol Genet 25:916-926. [0198] 53. Singh R, et al. (2013) iPS cell modeling of Best disease: Insights into the pathophysiology of an inherited macular degeneration. Hum Mol Genet 22:593-607. [0199] 54. Bonilha V L, Finnemann S C, Rodriguez-Boulan E (1999) Ezrin promotes morphogenesis of apical microvilli and basal infoldings in retinal pigment epithelium. J Cell Biol 147: 1533-1548. [0200] 55. Koltzscher M, Neumann C, König S, Gerke V (2003) Ca2+-dependent binding and activation of dormant Ezrin by dimeric S100P. Mol Biol Cell 14:2372-2384. [0201] 56. Bonilha V L, et al. (2006) The retinal pigment epithelium apical microvilli and retinal function. Adv Exp Med Biol 572:519-524. [0202] 57. Bonilha V L, Rayborn M E, Saotome I, McClatchey A I, Hollyfield J G (2006) Microvilli defects in retinas of ezrin knockout mice. Exp Eye Res 82:720-729. [0203] 58. Philp N J, Nachmias V T (1985) Components of the cytoskeleton in the retinal pigmented epithelium of the chick. J Cell Biol 101:358-362. [0204] 59. Bonilha V L, et al. (2004) Proteomic characterization of isolated retinal pigment epithelium microvilli. Mol Cell Proteomics 3:1119-1127. [0205] 60. Gao H, Hollyfield J G (1992) Aging of the human retina. Differential loss of neurons and retinal pigment epithelial cells. Invest Ophthalmol Vis Sci 33:1-17. [0206] 61. Kiser P D, Golczak M, Palczewski K (2014) Chemistry of the retinoid (visual) cycle. Chem Rev 114:194-232. [0207] 62. Miller S S, Steinberg R H (1977) Passive ionic properties of frog retinal pigment epithelium. J Membr Biol 36:337-372. [0208] 63. Volland S, Esteve-Rudd J, Hoo J, Yee C, Williams D S (2015) A comparison of some organizational characteristics of the mouse central retina and the human macula. PLoS One 10:e0125631. [0209] 64. Cuenca N, Ortuño-Lizarán I, Pinilla I (Oct. 13, 2017) Cellular characterization of optical coherence tomography and outer retinal bands using specific immunohistochemistry markers and clinical implications. Ophthalmology, 10.1016/j.ophtha.2017.09.016. [0210] 65. Uehara F, Matthes M T, Yasumura D, LaVail M M (1990) Light-evoked changes in the interphotoreceptor matrix. Science 248:1633-1636. [0211] 66. Jonnal R S, Kocaoglu O P, Wang Q, Lee S, Miller D T (2012) Phase-sensitive imaging of the outer retina using optical coherence tomography and adaptive optics. Biomed Opt Express 3:104-124. [0212] 67. Hillmann D, et al. (2016) In vivo optical imaging of physiological responses to photostimulation in human photoreceptors. Proc Natl Acad Sci USA 113:13138-13143. [0213] 68. Bialek S, Miller S S (1994) K+ and Cl− transport mechanisms in bovine pigment epithelium that could modulate subretinal space volume and composition. J Physiol 475: 401-417. [0214] 69. Lu R, Levy A M, Zhang Q, Pittler S J, Yao X (2013) Dynamic near-infrared imaging reveals transient phototropic change in retinal rod photoreceptors. J Biomed Opt 18: 106013. [0215] 70. Querques G, et al. (2011) The spectrum of subclinical Best vitelliform macular dystrophy in subjects with mutations in BEST1 gene. Invest Ophthalmol Vis Sci 52: 4678-4684. [0216] 71. Qian C X, et al. (2017) Optical coherence tomography examination of the retinal pigment epithelium in Best vitelliform macular dystrophy. Ophthalmology 124: 456-463. [0217] 72. Kay D B, et al. (2013) Outer retinal structure in best vitelliform macular dystrophy. JAMA Ophthalmol 131:1207-1215. [0218] 73. Arora R, et al. (2016) Unilateral BEST1-associated retinopathy. Am J Ophthalmol 169: 24-32. [0219] 74. Scoles D, et al. (2017) Photoreceptor inner segment morphology in Best vitelliform macular dystrophy. Retina 37:741-748. [0220] 75. Abràmoff M D, Mullins R F, Stone E M (2014) Outer segment length in different Best disease genotypes. JAMA Ophthalmol 132:1152-1153. [0221] 76. Faktorovich E G, Steinberg R H, Yasumura D, Matthes M T, LaVail M M (1990) Photoreceptor degeneration in inherited retinal dystrophy delayed by basic fibroblast growth factor. Nature 347:83-86. [0222] 77. Milam A H, Li Z Y, Fariss R N (1998) Histopathology of the human retina in retinitis pigmentosa. Prog Retin Eye Res 17:175-205. [0223] 78. Jacobson S G, et al. (2006) Remodeling of the human retina in choroideremia: Rab escort protein 1 (REP-1) mutations. Invest Ophthalmol Vis Sci 47:4113-4120. [0224] 79. Jacobson S G, Cideciyan A V (2010) Treatment possibilities for retinitis pigmentosa. N Engl J Med 363:1669-1671. [0225] 80. Cideciyan A V, et al. (2011) Cone photoreceptors are the main targets for gene therapy of NPHP5 (IQCB1) or NPHP6 (CEP290) blindness: Generation of an all-cone Nphp6 hypomorph mouse that mimics the human retinal ciliopathy. Hum Mol Genet 20:1411-1423. [0226] 81. Sadigh S, et al. (2013) Abnormal thickening as well as thinning of the photoreceptor layer in intermediate age-related macular degeneration. Invest Ophthalmol Vis Sci 54: 1603-1612. [0227] 82. Beltran W A, et al. (2015) Successful arrest of photoreceptor and vision loss expands the therapeutic window of retinal gene therapy to later stages of disease. Proc Natl Acad Sci USA 112:E5844-E5853. [0228] 83. Johnson A A, et al. (2017) Bestrophin 1 and retinal disease. Prog Retin Eye Res 58: 45-69. [0229] 84. Schatz P, Klar J, Andréasson S, Ponjavic V, Dahl N (2006) Variant phenotype of Best vitelliform macular dystrophy associated with compound heterozygous mutations in VMD2. Ophthalmic Genet 27:51-56. [0230] 85. Burgess R, et al. (2008) Biallelic mutation of BEST1 causes a distinct retinopathy in humans. Am J Hum Genet 82:19-31. [0231] 86. Kinnick T R, et al. (2011) Autosomal recessive vitelliform macular dystrophy in a large cohort of vitelliform macular dystrophy patients. Retina 31:581-595. [0232] 87. Bitner H, et al. (2011) A homozygous frameshift mutation in BEST1 causes the classical form of Best disease in an autosomal recessive mode. Invest Ophthalmol Vis Sci 52: 5332-5338. [0233] 88. Boon C J, et al. (2013) Autosomal recessive bestrophinopathy: Differential diagnosis and treatment options. Ophthalmology 120:809-820. [0234] 89. Lamb T D, Pugh E N, Jr (2004) Dark adaptation and the retinoid cycle of vision. Prog Retin Eye Res 23:307-380. [0235] 90. Wang J S, Kefalov V J (2011) The cone-specific visual cycle. Prog Retin Eye Res 30: 115-128. [0236] 91. Kaylor J J, et al. (2013) Identification of DES1 as a vitamin A isomerase in Muller glial cells of the retina. Nat Chem Biol 9:30-36. [0237] 92. Cideciyan A V, Pugh E N, Jr, Lamb T D, Huang Y, Jacobson S G (1997) Rod plateau during dark adaptation in Sorsby's fundus dystrophy and vitamin A deficiency. Invest Ophthalmol Vis Sci 38:1786-1794. [0238] 93. Cideciyan A V, et al. (2000) Rod and cone visual cycle consequences of a null mutation in the 11-cis-retinol dehydrogenase gene in man. Vis Neurosci 17:667-678. [0239] 94. Cideciyan A V, et al. (2013) Human cone visual pigment deletions spare sufficient photoreceptors to warrant gene therapy. Hum Gene Ther 24:993-1006. [0240] 95. Cideciyan A V, et al. (2007) Reduced-illuminance autofluorescence imaging in ABCA4-associated retinal degenerations. J Opt Soc Am A Opt Image Sci Vis 24:1457-1467. [0241] 96. National Research Council (2011) Guide for the Care and Use of Laboratory Animals (Natl Acad Press, Washington, D.C.), 8th Ed. [0242] 97. Komáromy A M, Varner S E, de Juan E, Acland G M, Aguirre G D (2006) Application of a new subretinal injection device in the dog. Cell Transplant 15:511-519. [0243] 98. Delori F, et al. (2011) Quantitative measurements of autofluorescence with the scanning laser ophthalmoscope. Invest Ophthalmol Vis Sci 52:9379-9390. [0244] 99. Beltran W A, Hammond P, Acland G M, Aguirre G D (2006) A frameshift mutation in RPGR exon ORF15 causes photoreceptor degeneration and inner retina remodeling in a model of X-linked retinitis pigmentosa. Invest Ophthalmol Vis Sci 47:1669-1681.
Other Embodiments
[0245] All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.
[0246] From the above description, one skilled in the art can easily ascertain the essential characteristics of the present disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications of the disclosure to adapt it to various usages and conditions. Thus, other embodiments are also within the claims.
EQUIVALENTS
[0247] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.
[0248] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
[0249] All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
[0250] The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”
[0251] The phrase “and/or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and/or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and/or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and/or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
[0252] As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and/or” as defined above. For example, when separating items in a list, “or” or “and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e., “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.
[0253] As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and/or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
[0254] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
[0255] In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of” and “consisting essentially of” shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be appreciated that embodiments described in this document using an open-ended transitional phrase (e.g., “comprising”) are also contemplated, in alternative embodiments, as “consisting of” and “consisting essentially of” the feature described by the open-ended transitional phrase. For example, if the disclosure describes “a composition comprising A and B”, the disclosure also contemplates the alternative embodiments “a composition consisting of A and B” and “a composition consisting essentially of A and B”.