COMPOSITIONS AND METHODS FOR MODULATION OF LMNA EXPRESSION
20220031731 · 2022-02-03
Assignee
Inventors
- Priyam Singh (San Diego, CA, US)
- Frank Rigo (Carlsbad, CA)
- Tom Misteli (Bethesda, MD, US)
- Madaiah Puttaraju (Bethesda, MD, US)
Cpc classification
A61K31/7125
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
A61K47/542
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
C12N2310/3231
CHEMISTRY; METALLURGY
A61K31/713
HUMAN NECESSITIES
A61P1/00
HUMAN NECESSITIES
A61K31/711
HUMAN NECESSITIES
International classification
A61K31/713
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present disclosure provides compounds comprising oligonucleotides complementary to a portion of the LMNA gene. Such compounds are useful for modulating the expression of LMNA in a cell or animal, and in certain instances reducing the amount of progerin mRNA and/or progerin protein. Progerin mRNA results from aberrant splicing of LMNA and is translated to generate progerin protein. Accumulation of progerin protein causes Hutchinson-Gilford progeria syndrome (HOPS), a premature aging disease. In certain embodiments, hybridization of oligonucleotides complementary to a portion of the LMNA gene results in a decrease in the amount of progerin mRNA and/or progerin protein. In certain embodiments, oligonucleotides are used to treat Hutchinson-Gilford Progeria Syndrome.
Claims
1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 contiguous nucleobases complementary to an equal length portion of nucleobases 24759-24791 of SEQ ID NO: 1, nucleobases 2176-2198 of SEQ ID NO: 2 or SEQ ID NO:4, or nucleobases 2062-2085 of SEQ ID NO: 3.
2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, or at least 16 any of the nucleobase sequences of SEQ ID 14-157.
3. An oligomeric compound comprising a modified oligonucleotide consisting of a modified oligonucleotide having a nucleobase sequence comprising at least 17, at least 18, at least 19, or at least 20 of any of the nucleobase sequences of SEQ ID 14-38, 75-101, or 132-157.
4. The oligomeric compound of claim 1, 2, or 3, wherein the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 over the entire length of the modified oligonucleotide.
5. The oligomeric compound of any of claims 1-4, wherein the modified oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 modified nucleoside comprising a modified sugar moiety.
6. The oligomeric compound of any of claims 1-5, wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety.
7. The oligomeric compound of claim 5 or 6, wherein the modified sugar moiety is a 2′-methoxyethyl.
8. The oligomeric compound of any of claims 1-5, wherein the modified oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 modified nucleoside comprising a bicyclic sugar moiety having a 2′-4′ bridge.
9. The oligomeric compound of claim 8, wherein the 2′-4′ bridge is selected from —O—CH.sub.2—; and —O—CH(CH.sub.3)—.
10. The oligomeric compound of claim 9, wherein the 2′-4′ bridge is —O—CH(CH.sub.3)—.
11. The oligomeric compound of claim 10, wherein each nucleoside is selected from a modified nucleoside comprising a bicyclic sugar moiety having a 2′-4′ bridge or an unmodified, β-D-2′-deoxyribose nucleoside.
12. The oligomeric compound of claim 11, wherein the 2′-4′ bridge is —O—CH(CH.sub.3)—.
13. The oligomeric compound of any of claims 1-5, wherein the modified nucleotide has a modification pattern of (A).sub.m-(A—B—B).sub.n—(A).sub.o-(B).sub.p, wherein each A is a modified nucleoside comprising a bicyclic sugar moiety having a 2′-4′ bridge, each B is a non-bicyclic nucleoside, m is 0 or 1, n is from 5-9, o is 0 or 1, and p is 0 or 1, wherein if o is 0, p is also 0.
14. The oligomeric compound of claim 13, wherein the 2′-4′ bridge is —O—CH(CH.sub.3)—.
15. The oligomeric compound of claim 13 or 14, wherein each B is a modified nucleoside comprising a 2′-methoxyethyl modified sugar moiety.
16. The oligomeric compound of claim 13 or 14, wherein each B is an unmodified, β-D-2′-deoxyribose nucleoside.
17. The oligomeric compound of any of claims 1-16, wherein at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.
18. The oligomeric compound of claim 17, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
19. The oligomeric compound of any of claims 1-16, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.
20. The oligomeric compound of claim 19, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
21. The oligomeric compound of any of claims 1-18, wherein at least one internucleoside linkage of the modified oligonucleotide is a phosphodiester internucleoside linkage.
22. The oligomeric compound of any of claims 1-18 and 21, wherein each internucleoside linkage of the modified oligonucleotide is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.
23. The oligomeric compound of any of claim 1-5, 7-12, or 17-20, wherein the modified oligonucleotide is a gapmer.
24. The oligomeric compound of any of claims 1-22, wherein the modified oligonucleotide is not a gapmer.
25. The oligomeric compound of any of claim 1-5, 8-10, or 13, wherein the modified oligonucleotide has a sugar motif selected from among: kkddkddkddkddkddkk, kddkddkddkddkddk, kkeekeekeekeekeeke, or keekeekeekeekeek, wherein “k” represents a modified nucleoside comprising a is —O—CH(CH.sub.3)— 2′-4′ bridge, “d” represents a β-D-2′-deoxyribose, and “e” represents nucleoside comprising a 2′-methoxyethyl modified sugar moiety.
26. The oligomeric compound of any of claims 1-25, wherein the modified oligonucleotide consists of 12-18, 12-20, 14-18, 14-20, or 16-20 linked nucleosides.
27. The oligomeric compound of any of claims 1-26, wherein the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides.
28. The oligomeric compound of any of claims 1-27, wherein at least one nucleobase of the modified oligonucleotide comprises a modified nucleobase.
29. The oligomeric compound of claim 28, wherein the modified nucleobase is a 5-methyl cytosine.
30. The oligomeric compound of claim 28, wherein the modified nucleobase is hypoxanthine.
31. The oligomeric compound of any of claims 1-5, wherein each nucleobase is selected from among adenine, guanine, cytosine, thymine, or 5-methyl cytosine.
32. The oligomeric compound of any of claims 1-5, wherein each nucleobase is selected from among adenine, guanine, cytosine, thymine, 5-methyl cytosine, or hypoxanthine.
33. The oligomeric compound of claim 32, wherein each nucleoside comprising adenine, guanine, cytosine, thymine, or 5-methyl cytosine comprises a 2′-modified sugar moiety, and wherein each nucleoside comprising hypoxanthine comprises a β-D-2′-deoxyribose.
34. The oligomeric compound of claim 33, wherein the modified sugar moiety is a 2′-methoxyethyl.
35. The oligomeric compound of any of claims 1-34, consisting of the modified oligonucleotide.
36. The oligomeric compound of any of claims 1-34, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.
37. The oligomeric compound of claim 36, wherein the conjugate moiety comprises a lipophilic group.
38. The oligomeric compound of claim 37, wherein the conjugate moiety is selected from among: cholesterol, C10-C26 saturated fatty acid, C10-C26 unsaturated fatty acid, C10-C26 alkyl, triglyceride, tocopherol, or cholic acid.
39. The oligomeric compound of claim 38, wherein the conjugate moiety is a saturated fatty acid or an unsaturated fatty acid.
40. The oligomeric compound of claim 38, wherein the conjugate moiety is C16 alkyl.
41. The oligomeric compound of any of claims 36-40, wherein the conjugate linker consists of a single bond.
42. The oligomeric compound of any of claims 36-40, wherein the conjugate linker is cleavable.
43. The oligomeric compound of any of claims 36-40, wherein the conjugate linker comprises 1-3 linker nucleosides.
44. The oligomeric compound of claim 43, wherein the oligomeric compound comprises no more than 24 total linked nucleosides, including the modified oligonucleotide and linker nucleosides.
45. The oligomeric compound of any of claims 36-40, wherein the conjugate linker comprises a hexylamino group.
46. The oligomeric compound of any of claims 36-40, wherein the conjugate linker comprises a polyethylene glycol group.
47. The oligomeric compound of any of claims 36-40, wherein the conjugate linker comprises a triethylene group.
48. The oligomeric compound of any of claims 36-40, wherein the conjugate linker comprises a phosphate group.
49. The oligomeric compound of claim 36, wherein the conjugate group has formula I: ##STR00009##
50. The oligomeric compound of any of claims 1-49, wherein the oligomeric compound is single-stranded.
51. An oligomeric duplex comprising any oligomeric compound of any of claims 1-49.
52. An antisense compound comprising or consisting of an oligomeric compound of any of claims 1-50 or an oligomeric duplex of claim 51.
53. A pharmaceutical composition comprising an oligomeric compound of any of claims 1-50, an oligomeric duplex of claim 51, or an antisense compound of claim 52, and at least one of a pharmaceutically acceptable carrier or diluent.
54. The pharmaceutical composition of claim 53, wherein the modified oligonucleotide is a sodium salt.
55. A method comprising administering to an animal the pharmaceutical composition of claim 53 or 54.
56. The method of claim 55, wherein the animal is a human.
57. A method of treating a disease associated with LMNA comprising administering to an individual having or at risk of developing a disease associated with LMNA a therapeutically effective amount of a pharmaceutical composition of claim 53 or 54.
58. The method of claim 56, wherein the disease is Hutchinson-Gilford Progeria Syndrome
59. The method of claim 57, wherein at least one symptom of Hutchinson-Gilford Progeria Syndrome is ameliorated.
60. The method of claim 59, wherein the symptom is weight loss.
61. The method of claim 59, wherein the symptoms is premature death.
62. A method comprising the co-administration of two or more oligomeric compounds of any of claims 1-50 to an individual.
63. A method comprising the concomitant administration of two or more oligomeric compounds of any of claims 1-50 to an individual.
Description
DETAILED DESCRIPTION OF THE INVENTION
[0011] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.
[0012] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety.
Definitions
[0013] Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety.
[0014] Unless otherwise indicated, the following terms have the following meanings:
Definitions
[0015] As used herein, “2′-deoxyribonucleoside” means a nucleoside comprising a 2′-H(H) deoxyribosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2′-deoxyribonucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil). In certain embodiments, a 2′-deoxyribonucleoside may comprise hypoxanthine. In certain embodiments, a 2′-deoxyribonucleoside is in the β-D configuration, and is referred to as a nucleoside comprising a β-D-2′-deoxyribose sugar moiety.
[0016] As used herein, “2′-substituted nucleoside” means a nucleoside comprising a 2′-substituted sugar moiety. As used herein, “2′-substituted” in reference to a sugar moiety means a sugar moiety comprising at least one 2′-substituent group other than H or OH.
[0017] As used herein, “5-methyl cytosine” means a cytosine modified with a methyl group attached to the 5-position. A 5-methyl cytosine is a modified nucleobase.
[0018] As used herein, “administering” means providing a pharmaceutical agent to an animal.
[0019] As used herein, “administered concomitantly” or “co-administration” means administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Concomitant administration does not require that both compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. Concomitant administration or co-administration encompasses administration in parallel, sequentially, separate, or simultaneous administration.
[0020] As used herein, “animal” means a human or non-human animal.
[0021] As used herein, “antisense activity” means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
[0022] As used herein, “antisense compound” means an oligomeric compound or oligomeric duplex capable of achieving at least one antisense activity.
[0023] As used herein, “ameliorate” in reference to a treatment means improvement in at least one symptom relative to the same symptom in the absence of the treatment. In certain embodiments, amelioration is the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom. In certain embodiments, the symptom is a lack of subcutaneous fat, weight loss, hair loss, hypertension, metabolic syndrome, progressive cardiovascular disease resembling atherosclerosis, congestive heart failure, or premature death. In certain embodiments, amelioration of these symptoms results in a reduction of weight loss and increased survival.
[0024] As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety. As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.
[0025] As used herein, “cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
[0026] As used herein, “complementary” in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more regions thereof and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. Complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine (mC) and guanine (G). The nucleobase hypoxanthine (I) is able to hydrogen bond to A, T or U, G, C or mC, but preferentially pairs with C. Herein, a nucleotide containing hypoxanthine at a particular position is considered complementary to a second nucleotide containing A, T, U, C, G, or mC at the corresponding position. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary” or “100% complementary” in reference to oligonucleotides means that oligonucleotides are complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide.
[0027] As used herein, “conjugate group” means a group of atoms that is directly attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
[0028] As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
[0029] As used herein, “conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
[0030] As used herein, “contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence. As used herein, “constrained ethyl” or “cEt” or “cEt modified sugar moiety” means a β-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4′-carbon and the 2′ carbon of the β-D ribosyl sugar moiety, wherein the bridge has the formula 4′ —CH(CH.sub.3)—O—2′, and wherein the methyl group of the bridge is in the S configuration.
[0031] As used herein, “cEt” nucleoside” means a nucleoside comprising a cEt modified sugar moiety.
[0032] As used herein, “chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.
[0033] As used herein, “gapmer” means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.” Unless otherwise indicated, “gapmer” refers to a sugar motif. Unless otherwise indicated, the sugar moieties of the nucleosides of the gap of a gapmer are unmodified β-D-2′-deoxyribosyl. Thus, the term “MOE gapmer” indicates a gapmer having a sugar motif of 2′-MOE nucleosides in both wings and a gap of β-D-2′-deoxyribonucleosides. Unless otherwise indicated, a MOE gapmer may comprise one or more modified internucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.
[0034] As used herein, “hybridization” means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
[0035] As used herein, “increasing the amount or activity” refers to more transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample.
[0036] As used herein, “decreasing the amount or activity” refers to less transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample.
[0037] As used herein, “internucleoside linkage” is the covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. “Phosphorothioate linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.
[0038] As used herein, “linker-nucleoside” means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.
[0039] As used herein, “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
[0040] As used herein, “mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned. As used herein, a hypoxanthine (I) is not considered a mismatch to A, T, G, C, mC, or U.
[0041] As used herein, “MOE” means methoxyethyl. “2′-MOE” or “2′-MOE modified sugar moiety” means a 2′ —OCH.sub.2CH.sub.2OCH.sub.3 group in place of the 2′ OH group of a ribosyl sugar moiety.
[0042] As used herein, “2′-MOE nucleoside” means a nucleoside comprising a 2′-MOE modified sugar moiety.
[0043] As used herein, “motif” means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.
[0044] As used herein, “nucleobase” means an unmodified nucleobase or a modified nucleobase. As used herein an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. A “5-methyl cytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. Hypoxanthine (I) is a universal base.
[0045] As used herein, “nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.
[0046] As used herein, “nucleoside” means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. As used herein, “modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase. “Linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are present between those that are linked).
[0047] As used herein, “oligomeric compound” means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired. A “singled-stranded oligomeric compound” is an unpaired oligomeric compound. The term “oligomeric duplex” means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”
[0048] As used herein, “oligonucleotide” means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.
[0049] As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.
[0050] As used herein “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
[0051] As used herein “pharmaceutical composition” means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
[0052] As used herein, “phosphorus moiety” means a group of atoms comprising a phosphorus atom. In certain embodiments, a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.
[0053] As used herein “prodrug” means a therapeutic agent in a form outside the body that is converted to a different form within an animal or cells thereof. Typically, conversion of a prodrug within the animal is facilitated by the action of an enzyme (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.
[0054] As used herein, “RNAi compound” means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid. The term RNAi compound excludes antisense compounds that act through RNase H.
[0055] As used herein, “self-complementary” in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.
[0056] As used herein, “standard cell assay” means the assay described in Example 1 and reasonable variations thereof.
[0057] As used herein, “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.
[0058] As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2′ —OH(H) furanosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2′ —H(H) moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1′, 3′, and 4′ positions, an oxygen at the 3′ position, and two hydrogens at the 5′ position. Unmodified sugar moieties are in the β-D ribosyl configuration. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
[0059] As used herein, “sugar surrogate” means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or nucleic acids.
[0060] As used herein, “target nucleic acid” and “target RNA” mean a nucleic acid that an antisense compound is designed to affect. An antisense compound hybridizes to the target nucleic acid, but may comprise one or more mismatches thereto.
[0061] As used herein, “target region” means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
[0062] As used herein, “terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
[0063] As used herein, “therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to an animal. For example, a therapeutically effective amount improves a symptom of a disease.
[0064] As used herein, “lamin A” or “lamin A protein” refers to the processed 646 amino acid lamin A protein after processing to remove the C-terminal tail.
[0065] As used herein, “LMNA” refers to the gene and the pre-mRNA gene product that produces lamin A, lamin C, and progerin. LMNA pre-mRNA nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NT_079484.1 truncated from nucleobase 2533930 to 2560103).
[0066] As used herein, “prelamin A mRNA” refers to the mRNA sequence that encodes the prelamin A protein. Wild-type prelamin A mRNA has the sequence set forth in SEQ ID NO: 2. HGPS-associated prelamin A mRNA has the sequence set forth in SEQ ID NO: 4.
[0067] As used herein, “prelamin A protein” refers to the 664 amino acid product of prelamin A mRNA, prior to removal of the C-terminal tail.
[0068] As used herein, “progerin mRNA” refers to the mRNA sequence that encodes the progerin protein. This mRNA has the sequence set forth in SEQ ID NO: 3 (GENBANK Accession No. NM_001282626.1).
[0069] As used herein, “progerin protein” refers to the 614 amino acid product of progerin mRNA. Progerin protein is farnesylated.
[0070] As used herein, “lamin C mRNA” refers to the mRNA sequence that encodes the lamin C protein. This mRNA has the sequence set forth in SEQ ID NO: 158 (GENBANK Accession No. NP_005563.1).
[0071] As used herein, “lamin C protein” refers to the protein product of the lamin C mRNA, having 572 amino acids.
The present disclosure provides the following non-limiting numbered embodiments:
[0072] Embodiment 1: An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 contiguous nucleobases complementary to an equal length portion of nucleobases 24759-24791 of SEQ ID NO: 1, nucleobases 2176-2198 of SEQ ID NO: 2 or SEQ ID NO:4, or nucleobases 2062-2085 of SEQ ID NO: 3.
[0073] Embodiment 2: An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, or at least 16 any of the nucleobase sequences of SEQ ID 14-157.
[0074] Embodiment 3: An oligomeric compound comprising a modified oligonucleotide consisting of a modified oligonucleotide having a nucleobase sequence comprising at least 17, at least 18, at least 19, or at least 20 of any of the nucleobase sequences of SEQ ID 14-38, 75-101, or 132-157
[0075] Embodiment 4: The oligomeric compound of embodiment 1, 2, or 3, wherein the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 over the entire length of the modified oligonucleotide.
[0076] Embodiment 5: The oligomeric compound of any of embodiments 1-4, wherein the modified oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 modified nucleoside comprising a modified sugar moiety.
[0077] Embodiment 6: The oligomeric compound of any of embodiments 1-5, wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety.
[0078] Embodiment 7: The oligomeric compound of embodiment 5 or 6, wherein the modified sugar moiety is a 2′-methoxyethyl.
[0079] Embodiment 8: The oligomeric compound of any of embodiments 1-5, wherein the modified oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 modified nucleoside comprising a bicyclic sugar moiety having a 2′-4′ bridge.
[0080] Embodiment 9: The oligomeric compound of embodiment 8, wherein the 2′-4′ bridge is selected from —O—CH.sub.2—; and —O—CH(CH.sub.3)—.
[0081] Embodiment 10: The oligomeric compound of embodiment 9, wherein the 2′-4′ bridge is —O—CH(CH.sub.3)—.
[0082] Embodiment 11: The oligomeric compound of embodiment 10, wherein each nucleoside is selected from a modified nucleoside comprising a bicyclic sugar moiety having a 2′-4′ bridge or an unmodified, β-D-2′-deoxyribose nucleoside.
[0083] Embodiment 12: The oligomeric compound of embodiment 11, wherein the 2′-4′ bridge is —O—CH(CH.sub.3)—.
[0084] Embodiment 13: The oligomeric compound of any of embodiments 1-5, wherein the modified nucleotide has a modification pattern of (A).sub.m-(A—B—B).sub.n—(A).sub.o-(B).sub.p, wherein each A is a modified nucleoside comprising a bicyclic sugar moiety having a 2′-4′ bridge, each B is a non-bicyclic nucleoside, m is 0 or 1, n is from 5-9, o is 0 or 1, and p is 0 or 1, wherein if o is 0, p is also 0.
[0085] Embodiment 14: The oligomeric compound of embodiment 13, wherein the 2′-4′ bridge is —O—CH(CH.sub.3)—.
[0086] Embodiment 15: The oligomeric compound of embodiment 13 or 14, wherein each B is a modified nucleoside comprising a 2′-methoxyethyl modified sugar moiety.
[0087] Embodiment 16: The oligomeric compound of embodiment 13 or 14, wherein each B is an unmodified, β-D-2′-deoxyribose nucleoside.
[0088] Embodiment 17: The oligomeric compound of any of embodiments 1-16, wherein at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.
[0089] Embodiment 18: The oligomeric compound of embodiment 17, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
[0090] Embodiment 19: The oligomeric compound of any of embodiments 1-16, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.
[0091] Embodiment 20: The oligomeric compound of embodiment 19, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
[0092] Embodiment 21: The oligomeric compound of any of embodiments 1-18, wherein at least one internucleoside linkage of the modified oligonucleotide is a phosphodiester internucleoside linkage.
[0093] Embodiment 22: The oligomeric compound of any of embodiments 1-18 and 21, wherein each internucleoside linkage of the modified oligonucleotide is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.
[0094] Embodiment 23: The oligomeric compound of any of embodiments 1-5, 7-12, or 17-20, wherein the modified oligonucleotide is a gapmer.
[0095] Embodiment 24: The oligomeric compound of any of embodiments 1-22, wherein the modified oligonucleotide is not a gapmer.
[0096] Embodiment 25: The oligomeric compound of any of embodiments 1-5, 8-10, or 13, wherein the modified oligonucleotide has a sugar motif selected from among: kkddkddkddkddkddkk, kddkddkddkddkddk, kkeekeekeekeekeeke, or keekeekeekeekeek, wherein “k” represents a modified nucleoside comprising a is —O—CH(CH.sub.3)— 2′-4′ bridge, “d” represents a β-D-2′-deoxyribose, and “e” represents nucleoside comprising a 2′-methoxyethyl modified sugar moiety.
[0097] Embodiment 26: The oligomeric compound of any of embodiments 1-25, wherein the modified oligonucleotide consists of 12-18, 12-20, 14-18, 14-20, or 16-20 linked nucleosides.
[0098] Embodiment 27: The oligomeric compound of any of embodiments 1-26, wherein the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides.
[0099] Embodiment 28: The oligomeric compound of any of embodiments 1-27, wherein at least one nucleobase of the modified oligonucleotide comprises a modified nucleobase.
[0100] Embodiment 29: The oligomeric compound of embodiment 28, wherein the modified nucleobase is a 5-methyl cytosine.
[0101] Embodiment 30: The oligomeric compound of embodiment 28, wherein the modified nucleobase is hypoxanthine
[0102] Embodiment 31: The oligomeric compound of any of embodiments 1-5, wherein each nucleobase is selected from among adenine, guanine, cytosine, thymine, or 5-methyl cytosine.
[0103] Embodiment 32: The oligomeric compound of any of embodiments 1-5, wherein each nucleobase is selected from among adenine, guanine, cytosine, thymine, 5-methyl cytosine, or hypoxanthine.
[0104] Embodiment 33: The oligomeric compound of embodiment 32, wherein each nucleoside comprising adenine, guanine, cytosine, thymine, or 5-methyl cytosine comprises a 2′-modified sugar moiety, and wherein each nucleoside comprising hypoxanthine comprises a β-D-2′-deoxyribose.
[0105] Embodiment 34: The oligomeric compound of embodiment 33, wherein the modified sugar moiety is a 2′-methoxyethyl.
[0106] Embodiment 35: The oligomeric compound of any of embodiments 1-34, consisting of the modified oligonucleotide.
[0107] Embodiment 36: The oligomeric compound of any of embodiments 1-34, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.
[0108] Embodiment 37: The oligomeric compound of embodiment 36, wherein the conjugate moiety comprises a lipophilic group.
[0109] Embodiment 38: The oligomeric compound of embodiment 37, wherein the conjugate moiety is selected from among: cholesterol, C10-C26 saturated fatty acid, C10-C26 unsaturated fatty acid, C10-C26 alkyl, triglyceride, tocopherol, or cholic acid.
[0110] Embodiment 39: The oligomeric compound of embodiment 38, wherein the conjugate moiety is a saturated fatty acid or an unsaturated fatty acid.
[0111] Embodiment 40: The oligomeric compound of embodiment 38, wherein the conjugate moiety is C16 alkyl.
[0112] Embodiment 41: The oligomeric compound of any of embodiments 36-40, wherein the conjugate linker consists of a single bond.
[0113] Embodiment 42: The oligomeric compound of any of embodiments 36-40, wherein the conjugate linker is cleavable.
[0114] Embodiment 43: The oligomeric compound of any of embodiments 36-40, wherein the conjugate linker comprises 1-3 linker nucleosides.
[0115] Embodiment 44: The oligomeric compound of embodiment 43, wherein the oligomeric compound comprises no more than 24 total linked nucleosides, including the modified oligonucleotide and linker nucleosides.
[0116] Embodiment 45: The oligomeric compound of any of embodiments 36-40, wherein the conjugate linker comprises a hexylamino group.
[0117] Embodiment 46: The oligomeric compound of any of embodiments 36-40, wherein the conjugate linker comprises a polyethylene glycol group.
[0118] Embodiment 47: The oligomeric compound of any of embodiments 36-40, wherein the conjugate linker comprises a triethylene group.
[0119] Embodiment 48: The oligomeric compound of any of embodiments 36-40, wherein the conjugate linker comprises a phosphate group.
[0120] Embodiment 49: The oligomeric compound of embodiment 36, wherein the conjugate group has formula I:
##STR00001##
[0121] Embodiment 50: The oligomeric compound of any of embodiments 1-49, wherein the oligomeric compound is single-stranded.
[0122] Embodiment 51: An oligomeric duplex comprising any oligomeric compound of any of embodiments 1-49.
[0123] Embodiment 52: An antisense compound comprising or consisting of an oligomeric compound of any of embodiments 1-50 or an oligomeric duplex of embodiment 51.
[0124] Embodiment 53: A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-50, an oligomeric duplex of embodiment 51, or an antisense compound of embodiment 52, and at least one of a pharmaceutically acceptable carrier or diluent.
[0125] Embodiment 54: The pharmaceutical composition of embodiment 53, wherein the modified oligonucleotide is a sodium salt.
[0126] Embodiment 55: A method comprising administering to an animal the pharmaceutical composition of embodiment 53 or 54.
[0127] Embodiment 56: The method of embodiment 55, wherein the animal is a human.
[0128] Embodiment 57: A method of treating a disease associated with LMNA comprising administering to an individual having or at risk of developing a disease associated with LMNA a therapeutically effective amount of a pharmaceutical composition of embodiments 53 or 54.
[0129] Embodiment 58: The method of embodiment 56, wherein the disease is Hutchinson-Gilford Progeria Syndrome
[0130] Embodiment 59: The method of embodiment 57, wherein at least one symptom of Hutchinson-Gilford Progeria Syndrome is ameliorated.
[0131] Embodiment 60: The method of embodiment 59, wherein the symptom is weight loss.
[0132] Embodiment 61: The method of embodiment 59, wherein the symptoms is premature death.
[0133] Embodiment 62: A method comprising the co-administration of two or more oligomeric compounds of any of embodiments 1-50 to an individual.
[0134] Embodiment 63: A method comprising the concomitant administration of two or more oligomeric compounds of any of embodiments 1-50 to an individual.
Certain Oligonucleotides
[0135] In certain embodiments, provided herein are oligonucleotides, which consist of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage.
Certain Modified Nucleosides
[0136] Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.
Certain Sugar Moieties
[0137] In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
[0138] In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2′, 4′, and/or 5′ positions. In certain embodiments one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched. Examples of 2′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2′ —F, 2′ —OCH.sub.3(“OMe” or “O-methyl”), and 2′ —O(CH.sub.2).sub.2OCH.sub.3 (“MOE”). In certain embodiments, 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF.sub.3, OCF.sub.3, O—C.sub.1-C.sub.10 alkoxy, O—C.sub.1-C.sub.10 substituted alkoxy, O—C.sub.1-C.sub.10 alkyl, O—C.sub.1-C.sub.10 substituted alkyl, S-alkyl, N(R.sub.m)-alkyl, O-alkenyl, S-alkenyl, N(R.sub.m)-alkenyl, O-alkynyl, S-alkynyl, N(R.sub.m)-alkynyl, O-alkynyl—O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n) or OCH.sub.2C(═O)—N(R.sub.m)(R.sub.n), where each R.sub.m and R.sub.n is, independently, H, an amino protecting group, or substituted or unsubstituted C.sub.1-C.sub.10 alkyl, and the 2′-substituent groups described in Cook et al., U.S. Pat. No. 6,531,584; Cook et al., U.S. Pat. No. 5,859,221; and Cook et al., U.S. Pat. No. 6,005,087. Certain embodiments of these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106,128. Examples of 5′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5′-methyl (R or S), 5′-vinyl, and 5′-methoxy. In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2′ —F— 5′-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101,157 and Rajeev et al., US2013/0203836.).
[0139] In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, NH.sub.2, N.sub.3, OCF.sub.3, OCH.sub.3, O(CH.sub.2).sub.3NH.sub.2, CH.sub.2CH═CH.sub.2, OCH.sub.2CH═CH.sub.2, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n), O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and N-substituted acetamide (OCH.sub.2C(═O)—N(R.sub.m)(R.sub.n)), where each R.sub.m and R.sub.n is, independently, H, an amino protecting group, or substituted or unsubstituted C.sub.1-C.sub.10 alkyl.
[0140] In certain embodiments, a 2′-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCF.sub.3, OCH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(CH.sub.3).sub.2, O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and OCH.sub.2C(═O)—N(H)CH.sub.3 (“NMA”).
[0141] In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCH.sub.3, and OCH.sub.2CH.sub.2OCH.sub.3.
[0142] Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms. Examples of such 4′ to 2′ bridging sugar substituents include but are not limited to: 4′ —CH.sub.2-2′, 4′ —(CH.sub.2).sub.2-2′, 4′ —(CH.sub.2).sub.3-2′, 4′ —CH.sub.2—O-2′ (“LNA”), 4′ —CH.sub.2—S— 2′, 4′-(CH.sub.2).sub.2—O— 2′ (“ENA”), 4′ —CH(CH.sub.3)—O-2′ (referred to as “constrained ethyl” or “cEt”), 4′ —CH.sub.2—O—CH.sub.2-2′, 4′ —CH.sub.2—N(R)— 2′, 4′ —CH(CH.sub.2OCH.sub.3)—O— 2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 7,399,845, Bhat et al., U.S. Pat. No. 7,569,686, Swayze et al., U.S. Pat. No. 7,741,457, and Swayze et al., U.S. Pat. No. 8,022,193), 4′ —C(CH.sub.3)(CH.sub.3)—O— 2′ and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283), 4′ —CH.sub.2—N(OCH.sub.3)— 2′ and analogs thereof (see, e.g., Prakash et al., U.S. Pat. No. 8,278,425), 4′ —CH.sub.2—O—N(CH.sub.3)— 2′ (see, e.g., Allerson et al., U.S. Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745), 4′ —CH.sub.2—C(H)(CH.sub.3)— 2′ (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4′ —CH.sub.2—C(═CH.sub.2)— 2′ and analogs thereof (see e.g., Seth et al., U.S. Pat. No. 8,278,426), 4′ —C(R.sub.aR.sub.b)—N(R)—O— 2′, 4′ —C(R.sub.aR.sub.b)—O—N(R)— 2′, 4′ —CH.sub.2—O—N(R)— 2′, and 4′ —CH.sub.2—N(R)—O— 2′, wherein each R, R.sub.a, and R.sub.b is, independently, H, a protecting group, or C.sub.1-C.sub.12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672).
[0143] In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(R.sub.a)(R.sub.b)].sub.n—, —[C(R.sub.a)(R.sub.b)].sub.n—O—, —C(R.sub.a)═C(R.sub.b)—, —C(R.sub.a)═N—, —C(═NR.sub.a)—, —C(═O)—, —C(═S)—, —O—, —Si(R.sub.a).sub.2—, —S(═O).sub.x—, and —N(R.sub.a)—;
[0144] wherein:
[0145] x is 0, 1, or 2;
[0146] n is 1, 2, 3, or 4;
[0147] each R.sub.a and R.sub.b is, independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O).sub.2-J.sub.1), or sulfoxyl (S(═O)-J.sub.1); and each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.
[0148] Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2017, 129, 8362-8379; Wengel et a., U.S. Pat. No. 7,053,207; Imanishi et al., U.S. Pat. No. 6,268,490; Imanishi et al. U.S. Pat. No. 6,770,748; Imanishi et al., U.S. RE44,779; Wengel et al., U.S. Pat. No. 6,794,499; Wengel et al., U.S. Pat. No. 6,670,461; Wengel et al., U.S. Pat. No. 7,034,133; Wengel et al., U.S. Pat. No. 8,080,644; Wengel et al., U.S. Pat. No. 8,034,909; Wengel et al., U.S. Pat. No. 8,153,365; Wengel et al., U.S. Pat. No. 7,572,582; and Ramasamy et al., U.S. Pat. No. 6,525,191; Torsten et al., WO 2004/106356; Wengel et al., WO 1999/014226; Seth et al., WO 2007/134,181; Seth et al., U.S. Pat. No. 7,547,684; Seth et al., U.S. Pat. No. 7,666,854; Seth et al., U.S. Pat. No. 8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth et al., U.S.
[0149] 8,030,467; Seth et al., U.S. Pat. No. 8,268,980; Seth et al., U.S. Pat. No. 8,546,556; Seth et al., U.S. Pat. No. 8,530,640; Migawa et al., U.S. Pat. No. 9,012,421; Seth et al., U.S. Pat. No. 8,501,805; and U.S. Patent Publication Nos. Allerson et al., US2008/0039618 and Migawa et al., US2015/0191727.
[0150] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β-D configuration.
##STR00002##
α-L-methyleneoxy (4′ —CH.sub.2—O-2′) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified.
[0151] In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).
[0152] In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2′-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5′ position.
[0153] In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see, e.g., Leumann, C J. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:
##STR00003##
“F—HNA”, see e.g. Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; Swayze et al., U.S. Pat. No. 8,796,437; and Swayze et al., U.S. Pat. No. 9,005,906; F—HNA can also be referred to as a F-THP or 3′-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:
##STR00004##
wherein, independently, for each of said modified THP nucleoside:
[0154] Bx is a nucleobase moiety;
[0155] T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′-terminal group; q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each, independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted C.sub.2-C.sub.6 alkynyl; and
[0156] each of R.sub.1 and R.sub.2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(═X)J.sub.1, OC(═X)NJ.sub.1J.sub.2, NJ.sub.3C(═X)NJ.sub.1J.sub.2, and CN, wherein X is O, S or NJ.sub.1, and each J.sub.1, J.sub.2, and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.
[0157] In certain embodiments, modified THP nucleosides are provided wherein q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and are each H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R.sub.1 and R.sub.2 is F. In certain embodiments, R.sub.1 is F and R.sub.2 is H, in certain embodiments, R.sub.1 is methoxy and R.sub.2 is H, and in certain embodiments, R.sub.1 is methoxyethoxy and R.sub.2 is H.
[0158] In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:
##STR00005##
In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.”
[0159] In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.
[0160] Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides).
Certain Modified Nucleobases
[0161] In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.
[0162] In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C≡C—CH.sub.3) uracil, 5-propynylcytosine, 6-azauracil, 6-azacytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443.
[0163] Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manohara et al., US2003/0158403; Manoharan et al., US2003/0175906; Dinh et al., U.S. Pat. No. 4,845,205; Spielvogel et al., U.S. Pat. No. 5,130,302; Rogers et al., U.S. 5,134,066; Bischofberger et al., U.S. Pat. No. 5,175,273; Urdea et al., U.S. Pat. No. 5,367,066; Benner et al., U.S. Pat. No. 5,432,272; Matteucci et al., U.S. Pat. No. 5,434,257; Gmeiner et al., U.S. Pat. No. 5,457,187; Cook et al., U.S. Pat. No. 5,459,255; Froehler et al., U.S. Pat. No. 5,484,908; Matteucci et al., U.S. Pat. No. 5,502,177; Hawkins et al., U.S. Pat. No. 5,525,711; Haralambidis et al., U.S. Pat. No. 5,552,540; Cook et al., U.S. Pat. No. 5,587,469; Froehler et al., U.S. Pat. No. 5,594,121; Switzer et al., U.S. Pat. No. 5,596,091; Cook et al., U.S. Pat. No. 5,614,617; Froehler et al., U.S. Pat. No. 5,645,985; Cook et al., U.S. Pat. No. 5,681,941; Cook et al., U.S. Pat. No. 5,811,534; Cook et al., U.S. Pat. No. 5,750,692; Cook et al., U.S. Pat. No. 5,948,903; Cook et al., U.S. Pat. No. 5,587,470; Cook et al., U.S. 5,457,191; Matteucci et al., U.S. Pat. No. 5,763,588; Froehler et al., U.S. Pat. No. 5,830,653; Cook et al., U.S. Pat. No. 5,808,027; Cook et al., 6,166,199; and Matteucci et al., U.S. Pat. No. 6,005,096.
Certain Modified Internucleoside Linkages
[0164] In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P═O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P═S”), and phosphorodithioates (“HS—P═S”). Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (—CH.sub.2—N(CH.sub.3)—O—CH.sub.2—), thiodiester, thionocarbamate (—O—C(═O)(NH)—S—); siloxane (—O—SiH.sub.2—O—); and N,N′-dimethylhydrazine (—CH.sub.2—N(CH.sub.3)—N(CH.sub.3)—). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.
[0165] Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
##STR00006##
Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
[0166] Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′ —CH.sub.2—N(CH.sub.3)—O-5′), amide-3 (3′ —CH.sub.2—C(═O)—N(H)-5′), amide-4 (3′ —CH.sub.2—N(H)—C(═O)-5′), formacetyl (3′-O—CH.sub.2—O-5′), methoxypropyl, and thioformacetal (3′-S—CH.sub.2—O-5′). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH.sub.2 component parts.
Certain Motifs
[0167] In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
Certain Sugar Motifs
[0168] In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.
[0169] In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.” The three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3′-most nucleoside of the 5′-wing and the 5′-most nucleoside of the 3′-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5′-wing differs from the sugar motif of the 3′-wing (asymmetric gapmer).
[0170] In certain embodiments, the wings of a gapmer comprise 1-5 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer is a modified nucleoside. In certain embodiments, at least one nucleoside of each wing of a gapmer is a modified nucleoside. In certain embodiments, at least two nucleosides of each wing of a gapmer are modified nucleosides. In certain embodiments, at least three nucleosides of each wing of a gapmer are modified nucleosides. In certain embodiments, at least four nucleosides of each wing of a gapmer are modified nucleosides.
[0171] In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer is an unmodified β-D-2′-deoxy nucleoside.
[0172] In certain embodiments, the gapmer is a deoxy gapmer. In embodiments, the nucleosides on the gap side of each wing/gap junction are unmodified β-D-2′-deoxy nucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides. In certain embodiments, each nucleoside of the gap is an unmodified β-D-2′-deoxy nucleoside. In certain embodiments, each nucleoside of each wing of a gapmer is a modified nucleoside.
[0173] Herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5′-wing]−[# of nucleosides in the gap]−[# of nucleosides in the 3′-wing]. Thus, a 5-10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise unmodified β-D-2′-deoxyribonucleoside sugars. Thus, a 5-10-5 MOE gapmer consists of 5 linked MOE modified nucleosides in the 5′-wing, 10 linked β-D-2′-deoxyribonucleosides in the gap, and 5 linked MOE nucleosides in the 3′-wing.
[0174] In certain embodiments, modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 BNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 LNA gapmers.
[0175] In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety (uniformly modified sugar motif). In certain embodiments, the uniformly modified sugar motif is 7 to 20 nucleosides in length. In certain embodiments, each nucleoside of the uniformly modified sugar motif is a 2′-substituted nucleoside, a sugar surrogate, or a bicyclic nucleoside. In certain embodiments, each nucleoside of the uniformly modified sugar motif comprises either a 2′ —OCH.sub.2CH.sub.2OCH.sub.3 group or a 2′ —OCH.sub.3 group. In certain embodiments, modified oligonucleotides having at least one fully modified sugar motif may also have at least 1, at least 2, at least 3, or at least 4 2′-deoxyribonucleosides.
[0176] In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety (fully modified oligonucleotide). In certain embodiments, a fully modified oligonucleotide comprises different 2′-modifications. In certain embodiments, each nucleoside of a fully modified oligonucleotide is a 2′-substituted nucleoside, a sugar surrogate, or a bicyclic nucleoside. In certain embodiments, each nucleoside of a fully modified oligonucleotide comprises either a 2′ —OCH.sub.2CH.sub.2OCH.sub.3 group and at least one 2′ —OCH.sub.3 group.
[0177] In certain embodiments, each nucleoside of a fully modified oligonucleotide comprises the same 2′-modification (uniformly modified oligonucleotide). In certain embodiments, each nucleoside of a uniformly modified oligonucleotide is a 2′-substituted nucleoside, a sugar surrogate, or a bicyclic nucleoside. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises either a 2′ —OCH.sub.2CH.sub.2OCH.sub.3 group or a 2′ —OCH.sub.3 group
[0178] In certain embodiments, modified oligonucleotides comprise at least 12, at last 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleosides comprising a modified sugar moiety. In certain embodiments, each nucleoside of a modified oligonucleotide is a 2′-substituted nucleoside, a sugar surrogate, a bicyclic nucleoside, or a β-D-2′-deoxyribonucleoside. In certain embodiments, each nucleoside of a modified oligonucleotide comprises a 2′ —OCH.sub.2CH.sub.2OCH.sub.3 group, a 2′-H(H) deoxyribosyl sugar moiety, or a cEt modified sugar.
[0179] In certain embodiments, modified oligonucleotides comprise a modification pattern of (A).sub.m-(A—B—B).sub.n—(A).sub.o-(B).sub.p, wherein each A is a modified nucleoside comprising a bicyclic sugar moiety having a 2′-4′ bridge, each B is a non-bicyclic nucleoside, m is 0 or 1, n is from 5-9, o is 0, 1, or 2 and p is 0 or 1, wherein if o is 0, p is also 0. Examples of sugar motifs represented by this formula are exemplified in the table below.
TABLE-US-00001 TABLE 1 Sugar Motifs A B m n o p length sugar motif k d 1 5 2 0 18 kkddkddkddkddkddkk k d 0 5 1 0 16 kddkddkddkddkddk k e 1 5 1 1 18 kkeekeekeekeekeeke k e 0 5 1 0 16 keekeekeekeekeek
In the table above, “k” represents modified nucleoside with a bicyclic sugar moiety having a —O—CH(CH.sub.3)—2′-4′ bridge (cEt), “e” represents a 2′-methoxyethyl modified nucleoside, and “d” represents a β-D-2′-deoxyribose nucleoside.
[0180] In certain embodiments, modified oligonucleotides comprise a modification pattern of (C).sub.m—(C-D).sub.n-(C).sub.o, wherein m is 0 or 1, n is 7 to 12, and o is 0-2. When m is 0, n is 9, and o is 2, and C is a modified nucleoside comprising a 2′-methoxyethyl modified sugar moiety and D is a β-D-2′-deoxyribonucleoside, this modification pattern can also be represented by the sugar motif notation edededededededededee, wherein “e” represents a 2′-methoxyethyl modified nucleoside, and “d” represents a 2′-deoxyribose nucleoside.
Certain Nucleobase Motifs
[0181] In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines. In certain embodiments, all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.
[0182] In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3′-end of the oligonucleotide. In certain embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5′-end of the oligonucleotide.
[0183] In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a β-D-2′-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine. In certain embodiments, the modified nucleobase is a hypoxanthine
Certain Internucleoside Linkage Motifs
[0184] In certain embodiments, oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P═O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P═S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs.
Certain Lengths
[0185] It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89: 7305-7309, 1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.
[0186] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.
Certain Modified Oligonucleotides
[0187] In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif. Likewise, such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
[0188] In certain embodiments, modified oligonucleotides are uniformly modified with a 2′-methoxyethyl at all positions other than one or two positions comprising a hypoxanthine nucleobase. In certain such embodiments, the nucleoside comprising hypoxanthine comprises a β-D-2′-deoxyribosyl sugar moiety.
Certain Populations of Modified Oligonucleotides
[0189] Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for β-D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for both β-D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration.
Nucleobase Sequence
[0190] In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain such embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.
Certain Oligomeric Compounds
[0191] In certain embodiments, provided herein are oligomeric compounds, which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2′-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3′ and/or 5′-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3′-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5′-end of oligonucleotides.
[0192] Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
Certain Conjugate Groups
[0193] In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di—O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecyLamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), a GalNAc cluster (e.g., WO2014/179620). Other targeting groups are described in WO/2017/053995, hereby incorporated by reference.
[0194] In certain embodiments, the conjugate group has formula I:
##STR00007##
Conjugate Moieties
[0195] Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
[0196] In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
[0197] In certain embodiments, a conjugate moiety is selected from among: cholesterol, C10-C26 saturated fatty acid, C10-C26 unsaturated fatty acid, C10-C26 alkyl, triglyceride, tocopherol, or cholic acid. In certain embodiments, a conjugate moiety is C16 alkyl.
Conjugate Linkers
[0198] Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
[0199] In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.
[0200] In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
[0201] Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C.sub.1-C.sub.10 alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl or substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
[0202] In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-S-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
[0203] Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.
[0204] In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
[0205] In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.
[0206] In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is a 2′-deoxy nucleoside that is attached to either the 3′ or 5′-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2′-deoxyadenosine.
Certain Terminal Groups
[0207] In certain embodiments, oligomeric compounds comprise one or more terminal groups. In certain such embodiments, oligomeric compounds comprise a stabilized 5′-phosphate. Stabilized 5′-phosphates include, but are not limited to 5′-phosphonates, including, but not limited to 5′-vinylphosphonates. In certain embodiments, terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides. In certain embodiments, terminal groups comprise one or more 2′-linked nucleosides. In certain such embodiments, the 2′-linked nucleoside is an abasic nucleoside.
Oligomeric Duplexes
[0208] In certain embodiments, oligomeric compounds described herein comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid. In certain embodiments, an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex. Such oligomeric duplexes comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group. The oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.
Antisense Activity
[0209] In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when they increase the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
[0210] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
[0211] In certain antisense activities, an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid by Argonaute. Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).
[0212] In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid.
[0213] In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in an increase in the amount or activity of a target nucleic acid.
[0214] Use of oligomeric compounds is an effective means for modulating the expression of one or more specific gene products and is uniquely useful in a number of therapeutic, diagnostic, and research applications. Provided herein are oligomeric compounds useful for modulating gene expression via antisense mechanisms of action, including antisense mechanisms based on target occupancy. In certain embodiments, the oligomeric compounds provided herein modulate splicing of a target gene.
[0215] In certain embodiments, an antisense compound is complementary to a region of an LMNA pre-mRNA. In certain embodiments, a modified oligonucleotide modulates splicing of a pre-mRNA. In certain embodiments, a modified oligonucleotide modulates splicing of an LMNA pre-mRNA. In certain such embodiments, the LMNA pre-mRNA is transcribed from a mutant variant of LMNA. In certain embodiments, the mutant variant comprises an aberrant splice site. In certain embodiments, the aberrant splice site of the mutant variant comprises a mutation that induces a cryptic 5′ splice site. In certain embodiments, a modified oligonucleotide reduces progerin mRNA. In certain embodiments, a modified oligonucleotide increases the production of lamin C mRNA or protein while reducing progerin mRNA or protein.
Certain Target Nucleic Acids
[0216] In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: a mature RNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is a mature RNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid has a disease-associated mutation. In certain embodiments, the target nucleic acid is the RNA transcriptional product of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from: a long non-coding RNA, a short non-coding RNA, an intronic RNA molecule.
Complementarity/Mismatches to the Target Nucleic Acid
[0217] It is possible to introduce mismatch bases without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93: 463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16: 3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, and a 28 and 42 nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides.
[0218] In certain embodiments, oligonucleotides that are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, 12 to 14, 12 to 16, 14 to 16, 16 to 18, or 18 to 20 nucleobases in length.
[0219] In certain embodiments, oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain embodiments selectivity of the oligonucleotide is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5′-end of the gap region. In certain embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3′-end of the gap region. In certain embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5′-end of the wing region. In certain embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3′-end of the wing region.
LMNA
[0220] In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is LMNA. In certain embodiments, LMNA nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NT_079484.1 truncated from nucleobase 2533930 to 2560103). In certain embodiments, the target nucleic acid is prelamin mRNA as set forth in SEQ ID NO: 2 (GENBANK Accession No. NM_170707.1) or SEQ ID NO: 4. In certain embodiments, the target nucleic acid is progerin mRNA as set forth in SEQ ID NO: 3 (GENBANK Accession No. NM_001282626.1). In certain embodiments, prelamin A mRNA associated with HGPS has the sequence set forth in SEQ ID NO: 4. SEQ ID NO: 4 is identical to SEQ ID NO:2 aside from a C to T mutation at position 2036.
TABLE-US-00002 TABLE 2 LMNA Isoforms Protein Amino acid Protein product Amino acids mRNA SEQ product in after post- after post- mRNA Accession ID before translated translational translational name # NO: processing product processing processing wild-type NM_170707.1 2 prelamin A 664 lamin A 646 prelamin A HGPS- N/A 4 prelamin A* 664 lamin A 646 associated lamin A progerin NM_001282626.1 3 progerin 614 N/A N/A lamin C NP_005563.1 158 lamin C 572 N/A N/A *The mutation most commonly associated with HGPS does not change the protein sequence of the translated prelamin A protein. Instead, the mutation changes the splicing ratio of progerin and prelamin A. It is a silent mutation on the protein level such that the prelamin A protein that is produced is identical.
[0221] In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 increases the amount of prelamin A mRNA, and in certain embodiments increases the amount of Lamin A protein. In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1, or SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 decreases the amount of progerin mRNA, and in certain embodiments decreases the amount of progerin protein. In certain embodiments, contacting a cell with an oligomeric compound comprising a modified oligonucleotide complementary to SEQ ID NO: 1, or SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 selectively decreases the amount of progerin mRNA and/or protein relative to prelamin A mRNA and/or lamin A protein. In certain embodiments, contacting a cell with an oligomeric compound comprising a modified oligonucleotide complementary to SEQ ID NO: 1, or SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 decreases progerin mRNA and/or protein and increases lamin C mRNA and/or lamin C protein.
[0222] In certain embodiments, contacting a cell in an animal with an oligomeric compound complementary SEQ ID NO: 1, or SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 ameliorates one or more symptoms of HGPS. Such symptoms include a lack of subcutaneous fat, sclerotic skin, joint contractures, bone abnormalities, weight loss, hair loss, hypertension, metabolic syndrome, central nervous system sequelae, conductive hearing loss, oral deficits, craniofacial abnormalities, progressive cardiovascular disease resembling atherosclerosis, congestive heart failure, and premature death. In certain embodiments, contacting a cell in an animal with an oligonucleotide complementary to SEQ ID NO: 1, or SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 results in reduced weight loss and prolonged survival.
Certain Target Nucleic Acids in Certain Tissues
[0223] In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissues are the cells and tissues that comprise the liver, bladder, kidneys, lungs, stomach, intestines, vasculature, skeletal muscle, and cardiac muscle.
Certain Pharmaceutical Compositions
[0224] In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
[0225] In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
[0226] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compound and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
[0227] In certain embodiments, oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
[0228] In certain embodiments, pharmaceutical compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide, upon administration to an animal, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.
[0229] Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid, such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue.
[0230] In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
[0231] In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.
[0232] In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
[0233] In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80™ and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
[0234] In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal, intracerebroventricular, etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
Nonlimiting disclosure and incorporation by reference
Each of the literature and patent publications listed herein is incorporated by reference in its entirety. While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.
Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2′-OH in place of one 2′-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of an uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “ATmCGAUCG,” wherein mC indicates a cytosine base comprising a methyl group at the 5-position.
[0235] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or 13 such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds provided herein that are drawn or described with undefined stereochemistry included all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise. Likewise, all tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.
[0236] The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the .sup.1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: .sup.2H or .sup.3H in place of .sup.1H, .sup.13C or .sup.14C in place of .sup.12C, .sup.15N in place of .sup.14N, .sup.17O or .sup.18O in place of .sup.16O, and .sup.33S, .sup.34S, .sup.35S, or .sup.36S in place of .sup.32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.
EXAMPLES
[0237] The following examples illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.
Example 1 Effect of Modified Oligonucleotides Complementary to the Human Progerin 5′-Splice Site, in Vitro
[0238] Modified oligonucleotides complementary to the human progerin 5′-splice site were designed and tested for their effect on progerin mRNA, prelamin A mRNA, and lamin C mRNA in vitro in HGPS patient-derived fibroblasts. Modified oligonucleotides in the table below are complementary to wild-type human LMNA pre-mRNA (SEQ ID NO: 1) or the mutant prelamin A mRNA having the HGPS-associated G608G mutation (SEQ ID NO: 4). The oligonucleotides comprise 2′-4′-constrained ethyl (cEt) nucleosides, 2′-methoxyethyl nucleosides, and β-D-2′-deoxyribonucleosides and each internucleoside linkage is a phosphorothioate linkage. Each cytosine residue is a 5-methyl cytosine. The sugar motif of each modified oligonucleotide is provided in the sugar motif column of Table 5 below.
[0239] Nucleosides that are underlined represent a single nucleoside mismatch to the wild-type human genomic sequence of LMNA L(SEQ ID NO:1) at that position. In the table below, each underlined nucleoside is an adenine, and it is aligned with a cytosine in SEQ ID NO:1. Compounds are 100% complementary to SEQ ID NO: 4.
TABLE-US-00003 TABLE 3 Modified oligonucleotides complementary to the human progerin 5′-splice site SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound Sequence NO: 1 NO: 1 NO: 4 NO: 4 ID ID (5′ to 3′) start site stop site start site stop site NO: 586000 AGCACGGTGCGCGAGCGC 24226 24243 1955 1972 14 586001 CGCACAGCACGGTGCGCG 24231 24248 1960 1977 15 586002 GGTCCCGCACAGCACGGT 24236 24253 1965 1982 16 586003 CCGCAGGTCCCGCACAGC 24241 24258 1970 1987 17 586004 GCTGCCCGCAGGTCCCGC 24246 24263 1975 1992 18 586005 GGCAGGCTGCCCGCAGGT 24251 24268 1980 1997 19 586006 TTGTCGGCAGGCTGCCCG 24256 24273 1985 2002 20 586007 ATGCCTTGTCGGCAGGCT 24261 24278 1990 2007 21 586008 GGCAGATGCCTTGTCGGC 24266 24283 1995 2012 22 586009 CCGCTGGCAGATGCCTTG 24271 24288 2000 2017 23 586010 CTGAGCCGCTGGCAGATG 24276 24293 2005 2022 24 586011 GGCTCCTGAGCCGCTGGC 24281 24298 2010 2027 25 586012 TGGGCTCCTGAGCCGCTG 24283 24300 2012 2029 26 586013 CCTGGGCTCCTGAGCCGC 24285 24302 2014 2031 27 586014 CACCTGGGCTCCTGAGCC 24287 24304 2016 2033 28 586015 CCCACCTGGGCTCCTGAG 24289 24306 2018 2035 29 586016 CACCCACCTGGGCTCCTG 24291 24308 2020 2037 30 586017 TCCACCCACCTGGGCTCC 24293 24310 2022 2039 31 586018 GGTCCACCCACCTGGGCT 24295 24312 2024 2041 32 586019 TGGGTCCACCCACCTGGG 24297 24314 2026 2043 33 586020 GATGGGTCCACCCACCTG 24299 24316 2028 2045 34 586021 GAGATGGGTCCACCCACC 24301 24318 2030 2047 35 586022 AGGAGATGGGTCCACCCA 24303 24320 2032 2049 36 586023 AGAGGAGATGGGTCCACC 24305 24322 2034 2051 37 586024 CCAGAGGAGATGGGTCCA 24307 24324 2036 2053 38 586025 CCCACCTGGGCTCCTG 24291 24306 2020 2035 39 586026 CACCCACCTGGGCTCC 24293 24308 2022 2037 40 586027 TCCACCCACCTGGGCT 24295 24310 2024 2039 41 586028 GGTCCACCCACCTGGG 24297 24312 2026 2041 42 586029 TGGGTCCACCCACCTG 24299 24314 2028 2043 43 586030 AGCACGGTGCGCGAGCGC 24226 24243 1955 1972 14 586031 CGCACAGCACGGTGCGCG 24231 24248 1960 1977 15 586032 GGTCCCGCACAGCACGGT 24236 24253 1965 1982 16 586033 CCGCAGGTCCCGCACAGC 24241 24258 1970 1987 17 586034 GCTGCCCGCAGGTCCCGC 24246 24263 1975 1992 18 586035 GGCAGGCTGCCCGCAGGT 24251 24268 1980 1997 19 586036 TTGTCGGCAGGCTGCCCG 24256 24273 1985 2002 20 586037 ATGCCTTGTCGGCAGGCT 24261 24278 1990 2007 21 586038 GGCAGATGCCTTGTCGGC 24266 24283 1995 2012 22 586039 CCGCTGGCAGATGCCTTG 24271 24288 2000 2017 23 586040 CTGAGCCGCTGGCAGATG 24276 24293 2005 2022 24 586041 GGCTCCTGAGCCGCTGGC 24281 24298 2010 2027 25 586042 TGGGCTCCTGAGCCGCTG 24283 24300 2012 2029 26 586043 CCTGGGCTCCTGAGCCGC 24285 24302 2014 2031 27 586044 CACCTGGGCTCCTGAGCC 24287 24304 2016 2033 28 586045 CCCACCTGGGCTCCTGAG 24289 24306 2018 2035 29 586046 CACCCACCTGGGCTCCTG 24291 24308 2020 2037 30 586047 TCCACCCACCTGGGCTCC 24293 24310 2022 2039 31 586048 GGTCCACCCACCTGGGCT 24295 24312 2024 2041 32 586049 TGGGTCCACCCACCTGGG 24297 24314 2026 2043 33 586050 GATGGGTCCACCCACCTG 24299 24316 2028 2045 34 586051 GAGATGGGTCCACCCACC 24301 24318 2030 2047 35 586052 AGGAGATGGGTCCACCCA 24303 24320 2032 2049 36 586053 AGAGGAGATGGGTCCACC 24305 24322 2034 2051 37 586054 CCAGAGGAGATGGGTCCA 24307 24324 2036 2053 38 586055 CCCACCTGGGCTCCTG 24291 24306 2020 2035 39 586056 CACCCACCTGGGCTCC 24293 24308 2022 2037 40 586057 TCCACCCACCTGGGCT 24295 24310 2024 2039 41 586058 GGTCCACCCACCTGGG 24297 24312 2026 2041 42 586059 TGGGTCCACCCACCTG 24299 24314 2028 2043 43 Nucleosides that are underlined are a mismatch to SEQ ID NO: 1; nucleotides are 100% complementary to SEQ ID NO: 4.
In Vitro Activity in Patient Fibroblasts
[0240] Patient-derived HGPS fibroblasts (Coriell Institute, AG06297; described in Scaffidi and Misteli Nat Cell Biol. 10: 452-459, 2008) were transfected with 100 nM modified oligonucleotide using Lipofectamine®2000 (ThermoFisher) per manufacturer's instructions. After 24 hours, cells were lysed, and mRNA was harvested for analysis.
[0241] RT-qPCR was used to analyze RNA levels and quantify relative levels of progerin mRNA and prelamin A mRNA (LMNA). Primer probe sets were designed to only amplify each indicated mRNA variant by selecting binding sites only present in the respective mRNA after splicing events. These primer probe sequences are presented in Table 4 below. Levels of mRNA were normalized with GADPH and normalized to cells that were mock transfected with PBS.
[0242] As shown in Tables 5 and 6, below, several modified oligonucleotides complementary to the progerin 5′ splice site are useful to reduce the amount of progerin mRNA (a LMNA transcription product associated with Hutchinson-Gilford progeria syndrome) in HGPS patient fibroblasts.
TABLE-US-00004 TABLE 4 Primer Probe Sets Variant SEQ ID detected Sequence (5′ to 3′) NO: prelamin Forward CAGCTTCGGGGACAATCTG 5 A mRNA Sequence Reverse GGCATGAGGTGAGGAGGAC 6 Sequence Probe GTCACCCGCTCCTACCTCC 7 Sequence T progerin Forward GCGTCAGGAGCCCTGAGC 8 mRNA Sequence Reverse GACGCAGGAAGCCTCCAC 9 Sequence Probe AGCATCATGTAATCTGGGA 10 Sequence CC
TABLE-US-00005 TABLE 5 In vitro activity of modified oligonucleotides complementary to the 5′-splice site of human progerin Progerin Compound Sugar Motif mRNA ID (5′ to 3′) (% control) 586000 kkeekeekeekeekeeke 91 586001 kkeekeekeekeekeeke 150 586002 kkeekeekeekeekeeke 105 586003 kkeekeekeekeekeeke 100 586004 kkeekeekeekeekeeke 123 586005 kkeekeekeekeekeeke 75 586006 kkeekeekeekeekeeke 133 586007 kkeekeekeekeekeeke 94 586008 kkeekeekeekeekeeke 75 586009 kkeekeekeekeekeeke 188 586010 kkeekeekeekeekeeke 92 586011 kkeekeekeekeekeeke 148 586012 kkeekeekeekeekeeke 97 586013 kkeekeekeekeekeeke 114* 586014 kkeekeekeekeekeeke 129* 586015 kkeekeekeekeekeeke 120* 586016 kkeekeekeekeekeeke 92* 586017 kkeekeekeekeekeeke 92 586018 kkeekeekeekeekeeke 99 586019 kkeekeekeekeekeeke 106 586020 kkeekeekeekeekeeke 77 586021 kkeekeekeekeekeeke 78 586022 kkeekeekeekeekeeke 90 586023 kkeekeekeekeekeeke 69 586024 kkeekeekeekeekeeke 99 586025 keekeekeekeekeek 86 586026 keekeekeekeekeek 97 586027 keekeekeekeekeek 68 586028 keekeekeekeekeek 76 586029 keekeekeekeekeek 93 586030 kkddkddkddkddkddkk 72 586031 kkddkddkddkddkddkk 95 586032 kkddkddkddkddkddkk 78 586033 kkddkddkddkddkddkk 67 586034 kkddkddkddkddkddkk 90 586035 kkddkddkddkddkddkk 69 586036 kkddkddkddkddkddkk 100 586037 kkddkddkddkddkddkk 98 586038 kkddkddkddkddkddkk 82 586039 kkddkddkddkddkddkk 101 586040 kkddkddkddkddkddkk 92 586041 kkddkddkddkddkddkk 108 586042 kkddkddkddkddkddkk 76 586043 kkddkddkddkddkddkk 90* 586044 kkddkddkddkddkddkk 108* 586045 kkddkddkddkddkddkk 94* 586046 kkddkddkddkddkddkk 79* 586047 kkddkddkddkddkddkk 94 586048 kkddkddkddkddkddkk 89 586049 kkddkddkddkddkddkk 163 586050 kkddkddkddkddkddkk 72 586051 kkddkddkddkddkddkk 78 586052 kkddkddkddkddkddkk 69 586053 kkddkddkddkddkddkk 67 586054 kkddkddkddkddkddkk 110 586055 kddkddkddkddkddk 91 586056 kddkddkddkddkddk 78 586057 kddkddkddkddkddk 83 586058 kddkddkddkddkddk 89 586059 kddkddkddkddkddk 92 “k” represents a cEt modified nucleoside comprising a 2′-4′-O—CH(CH3)- bridge. “e” represents a modified nucleoside comprising a 2′-methoxyethyl modified sugar moiety, and “d” represents nucleoside comprising a β-D-2′-deoxyribose. *Values with an asterisk represent the average of two independent experiments
TABLE-US-00006 TABLE 6 In vitro activity of modified oligonucleotides complementary to the 5'-splice site of human progerin Progerin mRNA Prelamin A mRNA Compound ID (% control) (% control) 586013 108 99 586014 145 117 586015 124 99 586016 116 111 586017 98 80 586018 98 110 586019 113 106 586020 83 65 586021 78 68 586022 97 68 586023 68 74 586024 106 80 586025 92 97 586026 98 88 586027 63 71 586028 81 75 586029 90 68
Example 2 Effect of Modified Oligonucleotides Complementary to the Human Exon 10 Donor Site of LMNA, In Vitro
[0243] Modified oligonucleotides complementary to the exon 10 donor site were designed and tested for their effect on progerin and prelamin A mRNA in vitro. Modified oligonucleotides in the table below are complementary to the exon 10 donor site in human LMNA pre-mRNA (SEQ ID NO: 1) or are complementary to the exon 10 donor site within wild-type human prelamin A mRNA (SEQ ID NO: 2). Each nucleoside of the oligonucleotides in the table below is modified with a 2′-methoxyethyl and each internucleoside linkage is a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.
[0244] Patient-derived HGPS cells were transfected with 100 nM modified oligonucleotide using Lipofectamine®2000 (ThermoFisher) per manufacturer's instructions. After 24 hours, cells were lysed and mRNA and protein were harvested for analysis.
[0245] RT-qPCR was used to analyze mRNA and quantify relative levels of progerin mRNA and prelamin A mRNA, as described in Example 1. As shown in the table below, several modified oligonucleotides complementary to the exon 10 donor site of LMNA are useful to reduce the amount of progerin mRNA (a LMNA transcription product associated with HGPS) in HGPS patient fibroblasts.
TABLE-US-00007 TABLE 7 In vitro activity of modified oligonucleotides complementary to the exon 10 donor site of human LMNA SEQ ID SEQ ID SEQ ID SEQ ID progerin prelamin NO: 1 NO: 1 NO: 2 NO: 2 SEQ mRNA A mRNA Compound Sequence start stop start stop ID (% (% ID (5′ to 3′) site site site site NO Control) Control) 585180 GTCCTCAACCAC 23378 23395 1851 1868 44 71 60 AGTCAC 585181 TCGTCGTCCTCA 23383 23400 1856 1873 45 69 65 ACCACA 585182 CATCCTCGTCGT 23388 23405 1861 1878 46 43 40 CCTCAA 585183 ATCCTCATCCTC 23393 23410 1866 1883 47 53 41 GTCGTC 585184 TCTCCATCCTCA 23398 23415 1871 1888 48 56 46 TCCTCG 585185 GGTCATCTCCAT 23403 23420 1876 1893 49 78 73 CCTCAT 585186 GAGCAGGTCATC 23408 23425 1881 1898 50 82 94 TCCATC 585187 TGATGGAGCAGG 23413 23430 1886 1903 51 79 78 TCATCT 585188 GGTGGTGATGGA 23418 23435 1891 1908 52 87 50 GCAGGT 585189 GTGGTGGTGATG 23420 23437 1893 1910 53 89 83 GAGCAG 585190 ACGTGGTGGTGA 23422 23439 N/A N/A 54 49 58 TGGAGC 585191 TCACGTGGTGGT 23424 23441 N/A N/A 55 33 48 GATGGA 585192 ACTCACGTGGTG 23426 23443 N/A N/A 56 65 78 GTGATG 585193 CCACTCACGTGG 23428 23445 N/A N/A 57 61 77 TGGTGA 585194 TACCACTCACGT 23430 23447 N/A N/A 58 48 54 GGTGGT 585195 GCTACCACTCAC 23432 23449 N/A N/A 59 49 49 GTGGTG 585196 CGGCTACCACTC 23434 23451 N/A N/A 60 58 54 ACGTGG 585197 GGCGGCTACCAC 23436 23453 N/A N/A 61 54 59 TCACGT 585198 GCGGCGGCTACC 23438 23455 N/A N/A 62 58 48 ACTCAC 585199 CAGCGGCGGCTA 23440 23457 N/A N/A 63 52 70 CCACTC 585200 CTCAGCGGCGGC 23442 23459 N/A N/A 64 65 56 TACCAC 585201 GCCTCAGCGGCG 23444 23461 N/A N/A 65 105 70 GCTACC 585202 GCTCGGCCTCAG 23449 23466 N/A N/A 66 104 157 CGGCGG 585203 TGCAGGCTCGGC 23454 23471 N/A N/A 67 86 112 CTCAGC 585204 CCCAGTGCAGGC 23459 23476 N/A N/A 68 89 123 TCGGCC 585205 GTGGCCCCAGTG 23464 23481 N/A N/A 69 94 137 CAGGCT 585206 GCTGGGTGGCCC 23469 23486 N/A N/A 70 103 104 CAGTGC 585207 GCCTGGCTGGGT 23474 23491 N/A N/A 71 95 96 GGCCCC 585208 CCCAGGCCTGGC 23479 23496 N/A N/A 72 84 94 TGGGTG 585209 CTGCCCCCAGGC 23484 23501 N/A N/A 73 49 100 CTGGCT
Example 3 Effect of Combination Treatment in Patient Fibroblasts
[0246] Patient-derived HGPS cells were transfected with 100 nM of two different modified oligonucleotides complementary to different sites on LMNA using Lipofectamine®2000 (ThermoFisher) per manufacturer's instructions. After 24 hours, cells were lysed and mRNA was harvested for analysis.
[0247] RT-qPCR was used to analyze RNA and quantify relative levels of LMNA isoforms as described in Example 1. The level of lamin C mRNA was also measured using the lamin C primer probe set (forward sequence: ACGGCTCTCATCAACTCCAC(SEQ ID NO: 11), reverse sequence: GCGGCGGCTACCACTCAC (SEQ ID NO: 12), probe sequence: GGTTGAGGACGACGAGGATG(SEQ ID NO:13)). Data are normalized to mock-transfected cells and presented in the table below.
[0248] As shown in the Table below, co-administration of modified oligonucleotides is useful to reduce the amount of progerin mRNA (a LMNA transcription product associated with HGPS) in HGPS patient fibroblasts.
TABLE-US-00008 TABLE 8 Effect of combination treatment in patient fibroblasts progerin prelamin A lamin C Compound Compound mRNA mRNA mRNA (% ID 1 ID 2 (% control) (% Control) Control) 586033 N/A 51 31 154 586035 N/A 75 41 125 586038 N/A 142 65 150 586050 N/A 65 64 210 586052 N/A 58 48 201 586053 N/A 75 54 180 586033 586050 94 55 174 586033 586052 69 38 165 586033 586053 65 43 162 586035 586050 91 77 200 586035 586052 46 38 126 586035 586053 66 48 151 586038 586050 66 48 242 586038 586052 61 33 221 586038 586053 55 43 195 585182 N/A 48 65 22 585191 N/A 63 58 92 586033 585182 72 48 21 586033 585191 54 49 115 586035 585182 68 69 42 586035 585191 75 52 115
Example 4 Effect of Modified Oligonucleotides Complementary to the Human Progerin 5′ Splice Site, in Vitro
[0249] Modified oligonucleotides complementary to the human progerin 5′-splice site were designed and tested for their effect on progerin mRNA, prelamin A mRNA, and lamin C mRNA in vitro. Modified oligonucleotides in the table below are complementary to the wild-type human LMNA pre-mRNA (SEQ ID NO: 1) or the mutant prelamin A mRNA having the HGPS-associated G608G mutation (SEQ ID NO: 4). Each nucleoside of the oligonucleotides in the table below is modified with a 2′-methoxyethyland each internucleoside linkage is a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.
[0250] Nucleosides that are underlined represent a single nucleoside mismatch to wild-type human LMNA, SEQ ID NO:1 at that position. In the table below, each underlined nucleoside is an adenine, and it is aligned with a cytosine in SEQ ID NO:1. Compounds are 100% complementary to SEQ ID NO: 4.
TABLE-US-00009 TABLE 9 Modified oligonucleotides complementary to the human progerin 5′-splice site SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 4 NO: 4 SEQ Compound start stop start stop ID ID Sequence (5′ to 3′) site site site site NO: 383790 GGGTCCACCCACCTGGGCTCCTGAG 24289 24313 2018 2042 74 637837 CTGGGCTCCTGAGCCGCTGGCAGAT 24277 24301 2006 2030 75 637838 ACCTGGGCTCCTGAGCCGCTGGCAG 24279 24303 2008 2032 76 637839 CCACCTGGGCTCCTGAGCCGCTGGC 24281 24305 2010 2034 77 637840 ACCCACCTGGGCTCCTGAGCCGCTG 24283 24307 2012 2036 78 637841 CCACCCACCTGGGCTCCTGAGCCGC 24285 24309 2014 2038 79 637842 GTCCACCCACCTGGGCTCCTGAGCC 24287 24311 2016 2040 80 637843 ATGGGTCCACCCACCTGGGCTCCTG 24291 24315 2020 2044 81 637844 AGATGGGTCCACCCACCTGGGCTCC 24293 24317 2022 2046 82 637845 GGAGATGGGTCCACCCACCTGGGCT 24295 24319 2024 2048 83 637846 GAGGAGATGGGTCCACCCACCTGGG 24297 24321 2026 2050 84 637847 CAGAGGAGATGGGTCCACCCACCTG 24299 24323 2028 2052 85 637848 GCCAGAGGAGATGGGTCCACCCACC 24301 24325 2030 2054 86 637849 GAGCCAGAGGAGATGGGTCCACCCA 24303 24327 2032 2056 87 637850 AAGAGCCAGAGGAGATGGGTCCACC 24305 24329 2034 2058 88 637851 AGAAGAGCCAGAGGAGATGGGTCCA 24307 24331 2036 2060 89 637852 GCAGAAGAGCCAGAGGAGATGGGTC 24309 24333 2038 2062 90 Nucleosides that are underlined are a mismatch to SEQ ID NO: 1.
[0251] Patient-derived HGPS cells were transfected with 100 nM modified oligonucleotide using Lipofectamine®2000 (ThermoFisher) per manufacturer's instructions. After 24 hours, cells were lysed and mRNA and protein were harvested for analysis.
[0252] RT-qPCR was used to analyze mRNA and quantify relative levels of LMNA mRNA isoforms as described in Examples 1 and 3. As shown in the Table below, several modified oligonucleotides complementary to the exon 10 donor site of LMNA are useful to reduce the amount of progerin mRNA (a LMNA transcription product associated with HGPS) in HGPS patient fibroblasts.
TABLE-US-00010 TABLE 10 Activity of modified oligonucleotides complementary to the 5'-splice site of human progerin Progerin Wild type prelamin Lamin C Compound mRNA A mRNA mRNA ID (% control) (% control) (% control) 383790 181 91 182 637837 71 66 153 637838 137 81 113 637839 133 70 89 637840 122 48 91 637841 65 39 87 637842 118 33 135 637843 109 38 103 637844 269 147 141 637845 67 59 135 637846 104 68 111 637847 121 37 119 637848 40 27 136 637849 46 25 167 637850 83 28 112 637851 141 155 199 637852 95 19 50
Example 5 Modified Oligonucleotides Complementary to Alternatively Spliced LMNA Isoforms
[0253] Modified oligonucleotides complementary to several LMNA isoforms were designed and tested for their effect on progerin mRNA, prelamin A mRNA, and lamin C mRNA in vitro. Modified oligonucleotides in the table below are complementary to the wild-type prelamin A human mRNA (SEQ ID NO: 2) or the progerin mRNA (SEQ ID NO: 3). The compounds in the tables below have (1) a 5-10-5 MOE gapmer motif, consisting of 5 linked MOE modified nucleosides in the 5′-wing, 10 linked β-D-2′-deoxyribonucleosides in the gap, and 5 linked MOE nucleosides in the 3′-wing (Table 11); (2) a 3-10-3 cEt gapmer motif, consisting of 3 linked cEt modified nucleosides in the 5′-wing, 10 linked β-D-2′-deoxyribonucleosides in the gap, and 3 linked cEt nucleosides in the 3′-wing (Table 12); or (3) a mixed sugar motif kk-d(8)-kekeke, where k represents a cEt modified nucleoside, e represents a MOE modified nucleoside, and d represents a β-D-2′-deoxyribonucleoside (Table 13). Each internucleoside linkage in the modified oligonucleotides below is a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.
TABLE-US-00011 TABLE 11 5-10-5 MOE gapmer modified oligonucleotides complementary to progerin SEQ ID SEQ ID SEQ ID SEQ ID NO: 2 NO: 2 NO: 3 NO: 3 SEQ Compound start stop start stop ID ID Sequence (5′ to 3′) site site site site NO: 638291 GGGGCTCTGGGCTCCTGAGC N/A N/A 2054 2073 91 638292 GGGGGCTCTGGGCTCCTGAG N/A N/A 2055 2074 92 638293 TGGGGGCTCTGGGCTCCTGA N/A N/A 2056 2075 93 638294 AGTTCTGGGGGCTCTGGGCT N/A N/A 2061 2080 94 638295 CAGTTCTGGGGGCTCTGGGC N/A N/A 2062 2081 95 638296 GCAGTTCTGGGGGCTCTGGG 2176 2195 2063 2082 96 638297 GCTGCAGTTCTGGGGGCTCT 2179 2198 2066 2085 97 638298 TGCTGCAGTTCTGGGGGCTC 2180 2199 2067 2086 98 638299 CTGGGCTCCTGAGCCGCTGG 2011 2030 2048 2067 99 638300 CTCTGGGCTCCTGAGCCGCT N/A N/A 2050 2069 100 638301 GCTCTGGGCTCCTGAGCCGC N/A N/A 2051 2070 101 358688 TCTGGGGGCTCTGGGCTCCT N/A N/A 2058 2077 102 366687 GGGCTCTGGGCTCCTGAGCC N/A N/A 2053 2072 103 366791 CTGCAGTTCTGGGGGCTCTG N/A N/A 2065 2084 104 366822 TCTGGGCTCCTGAGCCGCTG N/A N/A 2049 2068 105 366823 GGCTCTGGGCTCCTGAGCCG N/A N/A 2052 2071 106 366824 CTGGGGGCTCTGGGCTCCTG N/A N/A 2057 2076 107 366825 TTCTGGGGGCTCTGGGCTCC N/A N/A 2059 2078 108 366826 GTTCTGGGGGCTCTGGGCTC N/A N/A 2060 2079 109 366827 TGCAGTTCTGGGGGCTCTGG N/A N/A 2064 2083 110 366828 ATGCTGCAGTTCTGGGGGCT N/A N/A 2068 2087 111 358688 TCTGGGGGCTCTGGGCTCCT N/A N/A 2058 2077 102
TABLE-US-00012 TABLE 12 3-10-3 cEt gapmer modified oligonucleotides complementary to progerin SEQ ID SEQ ID SEQ ID SEQ ID NO: 2 NO: 2 NO: 3 NO: 3 SEQ Compound Sequence start stop start stop ID ID (5′ to 3′) site site site site NO: 638257 CTGGGCTCCTGAGCCG 2015 2030 2052 2067 112 638258 TCTGGGCTCCTGAGCC 2016 2031 2053 2068 113 638259 CTCTGGGCTCCTGAGC N/A N/A 2054 2069 114 638260 GCTCTGGGCTCCTGAG N/A N/A 2055 2070 115 638261 GGCTCTGGGCTCCTGA N/A N/A 2056 2071 116 638262 GGGCTCTGGGCTCCTG N/A N/A 2057 2072 117 638263 GGGGCTCTGGGCTCCT N/A N/A 2058 2073 118 638264 GGGGGCTCTGGGCTCC N/A N/A 2059 2074 119 638265 TGGGGGCTCTGGGCTC N/A N/A 2060 2075 120 638266 CTGGGGGCTCTGGGCT N/A N/A 2061 2076 121 638267 TCTGGGGGCTCTGGGC N/A N/A 2062 2077 122 638268 TTCTGGGGGCTCTGGG 2176 2191 2063 2078 123 638269 GTTCTGGGGGCTCTGG 2177 2192 2064 2079 124 638270 AGTTCTGGGGGCTCTG 2178 2193 2065 2080 125 638271 CAGTTCTGGGGGCTCT 2179 2194 2066 2081 126 638272 GCAGTTCTGGGGGCTC 2180 2195 2067 2082 127 638273 TGCAGTTCTGGGGGCT 2181 2196 2068 2083 128
TABLE-US-00013 TABLE 13 modified oligonucleotides with a kk-d8-kekeke sugar motif (5′ to 3′) complementary to progerin SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound Sequence NO: 2 NO: 2 NO: 3 NO: 3 ID ID (5′ to 3′) start site stop site start site stop site NO: 638274 CTGGGCTCCTGAGCCG 2015 2030 2052 2067 112 638275 TCTGGGCTCCTGAGCC N/A N/A 2053 2068 113 638276 CTCTGGGCTCCTGAGC N/A N/A 2054 2069 114 638277 GCTCTGGGCTCCTGAG N/A N/A 2055 2070 115 638278 GGCTCTGGGCTCCTGA N/A N/A 2056 2071 116 638279 GGGCTCTGGGCTCCTG N/A N/A 2057 2072 117 638280 GGGGCTCTGGGCTCCT N/A N/A 2058 2073 118 638281 GGGGGCTCTGGGCTCC N/A N/A 2059 2074 119 638282 TGGGGGCTCTGGGCTC N/A N/A 2060 2075 120 638283 CTGGGGGCTCTGGGCT N/A N/A 2061 2076 121 638284 TCTGGGGGCTCTGGGC N/A N/A 2062 2077 122 638285 TTCTGGGGGCTCTGGG 2176 2191 2063 2078 123 638286 GTTCTGGGGGCTCTGG 2177 2192 2064 2079 124 638287 AGTTCTGGGGGCTCTG 2178 2193 2065 2080 125 638288 CAGTTCTGGGGGCTCT 2179 2194 2066 2081 126 638289 GCAGTTCTGGGGGCTC 2180 2195 2067 2082 127 638290 TGCAGTTCTGGGGGCT 2181 2196 2068 2083 128
[0254] Patient-derived HGPS cells were transfected with 100 nM modified oligonucleotide using Lipofectamine®2000 (ThermoFisher) per manufacturer's instructions. After 24 hours, cells were lysed and mRNA was harvested for analysis.
[0255] RT-qPCR was used to analyze mRNA and quantify relative levels of LMNA isoforms as described in Examples 1 and 3. As shown in the Table below, several modified oligonucleotides are useful to reduce the amount of progerin mRNA (a LMNA transcription product associated with HGPS) in HGPS patient fibroblasts.
TABLE-US-00014 TABLE 14 Activity of modified oligonucleotides complementary to human progerin mRNA or pre-mRNA progerin prelamin A Lamin C Compound mRNA mRNA (% mRNA ID (% control) control) (% control) 638291 83 64 94 638292 58 52 112 638293 68 63 115 638294 55 36 137 638295 47 26 104 638296 35 31 85 638297 28 29 116 638298 68 47 127 638299 25 29 94 638300 22 13 38 638301 24 8 81 358688 50 63 114 366687 51 61 121 366791 41 50 119 366822 25 22 45 366823 53 58 101 366824 54 49 106 366825 51 53 119 366826 48 48 134 366827 48 42 118 366828 46 41 104 638257 66 49 60 638258 61 37 52 638259 63 48 77 638260 69 53 61 638261 68 44 86 638262 95 61 78 638263 94 43 53 638264 83 62 72 638265 90 55 73 638266 82 28 70 638267 68 46 80 638268 82 54 78 638269 77 37 72 638270 110 59 95 638271 101 72 92 638272 119 73 79 638273 100 85 128 638274 96 99 106 638275 103 134 131 638276 104 121 89 638277 92 108 106 638278 71 82 87 638279 97 104 97 638280 110 128 102 638281 110 115 112 638282 88 137 92 638283 103 140 84 638284 106 119 113 638285 11 106 99 638286 91 70 75 638287 102 147 120 638288 89 126 73 638289 144 120 153 638290 197 158 187
[0256] 5-10-5 MOE or 3-10-3 cEt modified oligonucleotides can modulate the splicing of LMNA in HGPS patient fibroblasts.
Example 6 Modified Oligonucleotides Complementary to Prelamin A or Progerin mRNA
[0257] Modified oligonucleotides complementary to several LMNA isoforms were designed and tested for their effect on progerin mRNA, prelamin A mRNA, and lamin C mRNA in vitro. Modified oligonucleotides in the table below are complementary to the complementary to the prelamin A human mRNA (SEQ ID NO: 2) or progerin mRNA (SEQ ID NO: 3). Each nucleoside of the oligonucleotides in the table below is either (1) modified with 2′-methoxyethyl; or (2) comprises 2′-methoxyethyl nucleosides and β-D-2′-deoxyribonucleosides having the motif (5′-3′) of edededededededededee, as indicated in the table below. Each internucleoside linkage is a phosphorthioate internucleoside linkage. Each cytosine is a 5-methyl cytosine. As shown in Table 16, below, several modified oligonucleotides are useful to reduce the amount of progerin mRNA (a LMNA transcription product associated with HGPS) in HGPS patient fibroblasts.
TABLE-US-00015 TABLE 15 Modified Oligonucleotides SEQ SEQ SEQ SEQ ID ID ID ID NO: 2 NO: 2 NO: 3 NO: 3 SEQ Compound Sequence Sugar Motif start stop start stop ID ID (5′ to 3′) (5′ to 3′) site site site site NO: 796553 CAGTTCTGGGG Uniform MOE N/A N/A 2062 2081 95 GCTCTGGGC 796554 GCAGTTCTGGG Uniform MOE 2176 2195 2063 2082 96 GGCTCTGGG 796555 GCTGCAGTTCT Uniform MOE 2179 2198 2066 2085 97 GGGGGCTCT 796556 CTGGGCTCCTG Uniform MOE 2011 2030 2048 2067 99 AGCCGCTGG 796557 CTCTGGGCTCC Uniform MOE N/A N/A 2050 2069 100 TGAGCCGCT 796558 GCTCTGGGCTC Uniform MOE N/A N/A 2051 2070 101 CTGAGCCGC 796559 TCTGGGCTCCT Uniform MOE N/A N/A 2049 2068 105 GAGCCGCTG 796560 CAGTTCTGGGG edededededededededee N/A N/A 2062 2081 95 GCTCTGGGC 796561 GCAGTTCTGGG edededededededededee 2176 2195 2063 2082 96 GGCTCTGGG 796562 GCTGCAGTTCT edededededededededee 2179 2198 2066 2085 97 GGGGGCTCT 796563 CTGGGCTCCTG edededededededededee 2011 2030 2048 2067 99 AGCCGCTGG 796564 CTCTGGGCTCC edededededededededee N/A N/A 2050 2069 100 TGAGCCGCT 796565 GCTCTGGGCTC edededededededededee N/A N/A 2051 2070 101 CTGAGCCGC 796566 TCTGGGCTCCT edededededededededee N/A N/A 2049 2068 105 GAGCCGCTG e represents a modified nucleoside comprising a 2′-methoxyethyl modified sugar moiety; d represents a nucleoside comprising a β-D-2′-deoxyribose sugar moiety.
TABLE-US-00016 TABLE 16 Activity of modified oligonucleotides complementary to various isoforms of LMNA prelamin progerin A Lamin C mRNA mRNA (% mRNA Compound ID (% control) control) (% control) 796553 3 1 135 796554 3 1 125 796555 4 2 120 796556 21 47 67 796557 9 36 56 796558 10 45 58 796559 22 54 73 796560 9 28 134 796561 15 29 138 796562 16 37 142 796563 15 22 239 796564 14 21 187 796565 8 33 187 796566 13 25 211
Example 7 Design of Modified Oligonucleotides Complementary to the 5′-Splice Site of Progerin mRNA
[0258] Modified oligonucleotides complementary to the 5′-splice site of progerin mRNA were designed. Modified oligonucleotides in the table below are complementary to the wild-type human genomic sequence of LMNA (SEQ ID NO: 1) or the mutant prelamin A mRNA having the HGPS-associated G608G mutation (SEQ ID NO: 4). The oligonucleotides comprise 2′-4′-constrained ethyl (cEt) nucleosides and deoxyribonucleosides as indicated in the table below, and each internucleoside linkage is a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methyl cytosine. Sugar motif of the modified oligonucleotides is indicated in Table 18. Nucleosides that are underlined represent a single nucleoside mismatch to wild-type human genomic sequence, SEQ ID NO:1.
TABLE-US-00017 TABLE 17 Modified Oligonucleotides SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 4 NO: 4 SEQ Compound Sequence start stop start stop ID ID (5′ to 3′) site site site site NO: 637853 ATGGGTCCACCCACCT 24300 24315 2029 2044 129 637856 GAGATGGGTCCACCCA 24303 24318 2032 2047 130 637857 GGAGATGGGTCCACCC 24304 24319 2033 2048 131
TABLE-US-00018 TABLE 18 Chemistry Motifs Compound Chemistry Motif ID (5′ to 3′) 637853 kddkddkddkddkddk 637856 kddkddkddkddkddk 637857 kddkddkddkddkddk
Example 8 Protein Levels in Cells Treated with Modified Oligonucleotides
[0259] Modified oligonucleotides described above were designed and tested for their effect on progerin mRNA, prelamin A mRNA, and lamin C mRNA in vitro. HGPS cells were transfected with 100 nM of modified oligonucleotide using Lipofectamine®2000. Cells were harvested and protein was analyzed 48 hours after transfection by western blot western blot with the antibody ab40567 (Abcam), which detects an epitope that is common to lamin A, lamin C, and progerin. Levels of protein were normalized to beta-actin and are reported relative to levels in cells undergoing mock transfection (100%). Modified oligonucleotides were useful to reduce progerin and lamin A protein levels.
TABLE-US-00019 TABLE 19 Reduction of protein levels in HGPS fibroblasts Compound Progerin Lamin A (% Lamin C ID (% control) control) (% control) 638296 6.5 5.2 86 638297 7.2 5.2 85 638299 13 9.0 42 638300 11 9.4 37 638301 7.3 5.3 30 366822 20 11 47 637853 38 16 176 637856 66 29 200 637857 33 15 166
Example 9 Effect of Modified Oligonucleotides Complementary to Human LMNA
[0260] Modified oligonucleotides complementary to several LMNA isoforms were designed and tested for their effect on progerin mRNA, prelamin A mRNA, and lamin C mRNA in vitro. Modified oligonucleotides in the table below are complementary to human LMNA pre-mRNA (SEQ ID NO: 1) or are complementary to progerin mRNA (SEQ ID NO: 3). The oligonucleotides comprise 2′-4′-constrained ethyl (cEt) nucleosides, 2′-methoxyethyl nucleosides, and deoxyribonucleosides as indicated in the table below, and all compounds have a full phosphorothioate backbone. Each cytosine residue is a 5-methyl cytosine. The chemical modifications are indicated in the chemistry notation column according the legend following the table.
TABLE-US-00020 TABLE 20 Modified Oligonucleotides SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 NO: 3 NO: 3 SEQ Compound Sequence and Chemistry start stop start stop start stop ID ID Notation (5′ to 3′) site site site site site site NO 796553 .sup.mC.sub.esA.sub.esG.sub.esT.sub.esT.sub.es.sup.mC.sub.esT.sub.esG.sub.esG.sub.esG.sub.es n/a n/a N/A N/A 2025 2044 95 G.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.esT.sub.esG.sub.esG.sub.esG.sub.es.sup.mC.sub.e 847115 G.sub.esG.sub.esG.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.esT.sub.esA.sub.esA.sub.esG.sub.es 24759 24778 N/A N/A N/A N/A 132 A.sub.esG.sub.esA.sub.esG.sub.esA.sub.esA.sub.esA.sub.esA.sub.es.sup.mC.sub.esA.sub.e 847118 G.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.dsA.sub.dsA.sub.ksG.sub.dsA.sub.dsG.sub.ks 24761 24776 N/A N/A N/A N/A 133 A.sub.dsG.sub.dsA.sub.ksA.sub.dsA.sub.dsA.sub.k 847119 G.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.dsT.sub.dsA.sub.ksA.sub.dsG.sub.dsA.sub.ks 24762 24777 N/A N/A N/A N/A 134 G.sub.dsA.sub.dsG.sub.ksA.sub.dsA.sub.dsA.sub.k 847120 G.sub.ksG.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.ksA.sub.dsA.sub.dsG.sub.ks 24763 24778 N/A N/A N/A N/A 135 A.sub.dsG.sub.dsA.sub.ksG.sub.dsA.sub.dsA.sub.k 847121 G.sub.ksI.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.dsA.sub.dsA.sub.ks 24764 24779 N/A N/A N/A N/A 136 G.sub.dsA.sub.dsG.sub.ksA.sub.dsG.sub.dsA.sub.k 847122 G.sub.ksG.sub.dsI.sub.dsG.sub.ksI.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.dsT.sub.dsA.sub.ks 24765 24780 N/A N/A N/A N/A 137 A.sub.dsG.sub.dsA.sub.ksG.sub.dsA.sub.dsG.sub.k 847123 T.sub.ksG.sub.dsI.sub.dsG.sub.ksI.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.ks 24766 24781 N/A N/A N/A N/A 138 A.sub.dsA.sub.dsG.sub.ksA.sub.dsG.sub.dsA.sub.k 847124 .sup.mC.sub.ksT.sub.dsI.sub.dsG.sub.ksI.sub.dsG.sub.dsG.sub.ks.sup.m.sub.dsT.sub.ds.sup.mC.sub.ks 24767 24782 N/A N/A N/A N/A 139 T.sub.dsA.sub.dsA.sub.ksG.sub.dsA.sub.dsG.sub.k 847125 T.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.ksI.sub.dsG.sub.dsG.sub.ksI.sub.ds.sup.mC.sub.dsT.sub.ks 24768 24783 N/A N/A N/A N/A 140 .sup.mC.sub.dsT.sub.dsA.sub.ksA.sub.dsG.sub.dsA.sub.k 847126 T.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.dsI.sub.dsG.sub.ksI.sub.dsG.sub.ds.sup.mC.sub.ks 24769 24784 N/A N/A N/A N/A 141 T.sub.ds.sup.mC.sub.dsT.sub.ksA.sub.dsA.sub.dsG.sub.k 847127 G.sub.ksT.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.dsI.sub.dsG.sub.ksI.sub.dsG.sub.dsG.sub.ks 24770 24785 N/A N/A N/A N/A 142 .sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.dsA.sub.dsA.sub.k 847129 .sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.dsI.sub.dsG.sub.ks 24772 24787 2179 2194 2029 2044 143 I.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.k 847130 G.sub.es.sup.mC.sub.esA.sub.esG.sub.esT.sub.esT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsI.sub.ds 24769 24788 N/A N/A N/A N/A 144 G.sub.dsI.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.esT.sub.esA.sub.esA.sub.esG.sub.e 847131 .sup.mC.sub.esT.sub.esG.sub.es.sup.mC.sub.esA.sub.esG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds 24771 24790 N/A N/A N/A N/A 145 T.sub.dsG.sub.dsI.sub.dsG.sub.dsI.sub.dsG.sub.dsC.sub.esT.sub.es.sup.mC.sub.esT.sub.es A.sub.e 847134 T.sub.esG.sub.esI.sub.dsG.sub.esI.sub.dsG.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.esT.sub.es 24762 24781 N/A N/A N/A N/A 146 A.sub.esA.sub.esG.sub.esA.sub.esG.sub.esA.sub.esG.sub.esA.sub.esA.sub.esA.sub.e 847135 .sup.mC.sub.esT.sub.esG.sub.esI.sub.dsG.sub.esI.sub.dsG.sub.es.sup.mC.sub.esT.sub.es 24763 24782 N/A N/A N/A N/A 147 .sup.mC.sub.esT.sub.esA.sub.esA.sub.esG.sub.esA.sub.esG.sub.esA.sub.esG.sub.es A.sub.esA.sub.e 847136 T.sub.es.sup.mC.sub.esT.sub.esG.sub.esI.sub.dsG.sub.esI.sub.dsG.sub.es.sup.mC.sub.esT.sub.es 24764 24783 N/A N/A N/A N/A 148 .sup.mC.sub.esT.sub.esA.sub.esA.sub.esG.sub.esA.sub.esG.sub.esA.sub.esG.sub.esA.sub.e 847137 T.sub.esT.sub.es.sup.mC.sub.esT.sub.esG.sub.esI.sub.dsG.sub.esI.sub.dsG.sub.es.sup.mC.sub.es 24765 24784 N/A N/A N/A N/A 149 T.sub.es.sup.mC.sub.esT.sub.esA.sub.esA.sub.esG.sub.esA.sub.esG.sub.esA.sub.esG.sub.e 847142 T.sub.esG.sub.es.sup.mC.sub.esA.sub.esG.sub.esT.sub.esT.sub.es.sup.mC.sub.esT.sub.esG.sub.es 24770 24789 N/A N/A N/A N/A 150 I.sub.dsG.sub.esI.sub.dSG.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.esT.sub.esA.sub.esA.sub.e 847143 .sup.mC.sub.esT.sub.esG.sub.es.sup.mC.sub.esA.sub.esG.sub.esT.sub.esT.sub.es.sup.mC.sub.es 24771 24790 N/A N/A N/A N/A 145 T.sub.esG.sub.esI.sub.dsG.sub.esI.sub.dsG.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.es T.sub.esA.sub.e 847144 G.sub.es.sup.mC.sub.esT.sub.esG.sub.es.sup.mC.sub.esA.sub.esG.sub.esT.sub.esT.sub.es 24772 24791 2179 2198 2029 2048 151 .sup.mC.sub.esT.sub.esG.sub.esI.sub.dsG.sub.esI.sub.dsG.sub.es.sup.mC.sub.esT.sub.es .sup.mC.sub.esT.sub.e 847935 G.sub.esT.sub.esT.sub.es.sup.mC.sub.esT.sub.esG.sub.esI.sub.dsG.sub.esI.sub.dsG.sub.es 24766 24785 N/A N/A N/A N/A 152 .sup.mC.sub.esT.sub.es.sup.mC.sub.esT.sub.esA.sub.esA.sub.esG.sub.esA.sub.esG.sub.esA.sub.e 847936 A.sub.esG.sub.esT.sub.esT.sub.es.sup.mC.sub.esT.sub.esG.sub.esI.sub.dsG.sub.esI.sub.ds 24767 24786 N/A N/A N/A N/A 153 G.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.esT.sub.esA.sub.esA.sub.esG.sub.esA.sub.esG.sub.e 847938 G.sub.es.sup.mC.sub.esA.sub.esG.sub.esT.sub.esT.sub.es.sup.mC.sub.esT.sub.esG.sub.esI.sub.ds 24769 24788 N/A N/A N/A N/A 144 G.sub.esI.sub.dsG.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.esT.sub.esA.sub.esA.sub.esG.sub.e A subscript “e” indicates a nucleoside comprising a 2′-methoxyethyl modified sugar moiety; a subscript “k” indicates a nucleoside comprising a 2′-constrained ethyl modified sugar moiety; a subscript “s” indicates a phosphorothioate internucleoside linkage; a subscript “d” indicates a nucleoside comprising a β-D-2′-deoxyribose sugar moiety; “I” indicates a nucleoside comprising a hypoxanthine nucleobase; and “.sup.mC” indicates 5-methylCytosine.
[0261] HGPS skin fibroblasts were plated at 100,000 cells per well in a 6 well plate for 24 hours prior to transfection with modified oligonucleotide. Modified oligonucleotides were added at 100 nM and transfected with Lipofectamine®2000 (ThermoFisher) per manufacturer's instructions. After 48 hours, cells were lysed and mRNA and protein were harvested for analysis.
[0262] RT-qPCR was used to analyze mRNA and quantify relative levels of LMNA isoforms as described in Examples 1 and 3. As shown in the table below, several modified oligonucleotides are useful to reduce the amount of progerin mRNA (a LMNA transcription product associated with HGPS) in HGPS patient fibroblasts.
TABLE-US-00021 TABLE 21 In vitro activity of modified oligonucleotides Compound prelamin A mRNA progerin mRNA lamin C mRNA ID (% control) (% control) (% control) 847115 45 90 143 847118 112 54 111 847119 28 19 101 847120 77 30 104 847121 66 26 93 847122 105 58 117 847123 80 36 87 847124 57 31 100 847125 45 22 90 847126 84 52 100 847127 49 31 120 847129 14 25 120 847130 32 30 85 847131 11 30 108 847134 43 18 101 847135 34 19 79 847136 46 31 104 847137 21 17 71 847142 15 38 93 847143 5 12 133 847144 4 21 117 847935 31 31 96 847936 13 15 80 847938 15 28 95
[0263] For a subset of compounds, protein levels of Lamin A and progerin were measured by western blot analysis as described in Example 8. Protein expression levels were normalized to (3-actin and relative band intensity was measured. Expression levels are reported relative to those of mock-transfected HGPS cells.
TABLE-US-00022 TABLE 22 Expression levels of Lamin A protein and Progerin protein in HGPS cells Compound ID Lamin A protein Progerin protein Mock 100 100 796553 39 58 847119 49 30 847120 78 45 847121 66 39 847122 74 63 847123 79 44 847124 64 76 847125 70 47 847126 69 52 847127 52 68 847129 47 61 847130 37 55 847131 31 56 847134 37 51 847135 37 49 817136 59 57 847137 40 43 847142 34 51 847143 23 41 847144 47 52 847936 25 44 847938 32 27
Example 10 Activity of Modified Oligonucleotides Complementary to Human LMNA in a Mouse Model
[0264] Modified oligonucleotides complementary to human LMNA were tested in vivo in an HGPS mouse model. The compounds in the table below contain a single mismatch to SEQ ID NO: 1 and are fully complementary to SEQ ID NO: 4. The modified oligonucleotides in the table below comprise a 2′-methoxyethyl sugar moiety at each nucleoside and each internucleoside linkage is a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.
TABLE-US-00023 TABLE 23 Modified Oligonucleotides SEQ ID SEQ ID SEQ ID SEQ ID SEQ Compound Sequence and Chemistry NO: 1 NO: 1 NO: 4 NO: 4 ID ID Notation (5′ to 3′) start site stop site start site stop site NO: 845221 A.sub.esG.sub.esA.sub.esT.sub.esG.sub.esG.sub.esG.sub.esT.sub.es.sup.mC.sub.esA.sub.es 24298 24317 2027 2046 154 .sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.esA.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esG.sub.esG.sub.e 845222 G.sub.esA.sub.esG.sub.esA.sub.esT.sub.esG.sub.esG.sub.esG.sub.esT.sub.es.sup.mC.sub.es 24299 24318 2028 2047 155 .sup.mC.sub.esA.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.esA.sub.es.sup.mC.sub.es.sup.mC.sub.es T.sub.esG.sub.e 845223 A.sub.esG.sub.esG.sub.esA.sub.esG.sub.esA.sub.esT.sub.esG.sub.esG.sub.esG.sub.es 24301 24320 2030 2049 156 T.sub.es.sup.mC.sub.es.sup.mC.sub.esA.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.esA.sub.es .sup.mC.sub.es.sup.mC.sub.e 845224 G.sub.es.sup.mC.sub.es.sup.mC.sub.esA.sub.esG.sub.esA.sub.esG.sub.esG.sub.esA.sub.es 24306 24325 2035 2054 157 G.sub.esA.sub.esT.sub.esG.sub.esG.sub.esG.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.es A.sub.es.sup.mC.sub.e
[0265] LMNA G608G transgenic mice have been described by Varga, et. al., “Progressive vascular smooth muscle cell defects in a mouse model of Hutchinson-Gilford progeria syndrome,” PNAS Feb. 28, 2006 103 (9) 3250-3255, hereby incorporated by reference. Homozygous LMNA G608G mice were administered 150 mg/kg modified oligonucleotide by subcutaneous injection. Three weeks later, mice were sacrificed and tissues were harvested for analysis. One group of mice was administered PBS as a control. RT-PCR was used to measure LMNA isoforms as described in Examples 1 and 3, and protein levels were measured by western blot with the antibody ab40567 (Abcam), which detects an epitope that is common to lamin A, lamin C, prelamin A, and progerin. As shown in the tables below, modified oligonucleotides complementary to human LMNA are useful to reduce the amount of progerin mRNA (a LMNA transcription product associated with HGPS) and progerin protein in a HGPS mouse model.
TABLE-US-00024 TABLE 24 mRNA levels in vivo in various tissues Liver Heart Aorta prelamin lamin prelamin lamin prelamin lamin Compound A progerin C A progerin C A progerin C ID mRNA mRNA mRNA mRNA mRNA mRNA mRNA mRNA mRNA PBS 100 100 100 100 100 100 100 100 100 637853 37 29 51 63 45 145 63 116 96 637856 28 30 67 53 56 163 76 75 99 845221 40 38 49 69 68 102 80 131 106 845222 71 63 58 71 63 90 76 138 102 845223 93 83 77 93 83 134 66 106 146 845224 23 31 83 55 43 142 59 61 164 847120 139 117 189 189 186 222 85 89 190 847125 32 23 189 32 38 189 37 34 187 847134 162 126 175 168 167 175 115 79 133 847143 5 17 214 15 26 214 17 22 250
TABLE-US-00025 TABLE 25 Protein levels in heart tissue Compound ID Lamin A protein Progerin protein Mock 100 100 637853 64 72 637856 66 75 845221 82 69 845222 46 51 845223 78 73 845224 69 64 847120 86 138 847125 42 46 847134 78 146 847143 39 51
Example 11 Activity of an Oligomeric Compound Targeting Human LMNA in a Mouse Model
[0266] An oligomeric compound 958328 comprising the modified oligonucleotide 847143 with a 5′-C.sub.16 conjugate represented by formula I below was synthesized and tested in a mouse model of HGPS.
##STR00008##
[0267] Homozygous LMNA G608G mice were treated with PBS, 17 mg/kg 958328, 50 mg/kg 958328, or 17 mg/kg scrambled control oligonucleotide SCRAM (884760; sequence GCTCATTTAGTCTGCCTGAT (SEQ ID NO: 159)). Each nucleoside of 884760 has a 2′-methoxyethyl modified sugar moiety, each internucleoside linkage is a phosphorothioate, and the compound comprises a 5′-C.sub.16 conjugate identical to that on 958328. A total of 24 mice per treatment group were administered a dose 3x/week in the first week of treatment and two doses per week thereafter for a total of 12 weeks. For histopathology and mRNA analysis, a group of 6 mice per treatment were sacrificed after 3 months and another group of 6 mice were sacrificed at the completion of the study. RT-PCR was used to analyze LMNA mRNA isoforms as described in Examples 1 and 3 above. Data are reported relative to PBS-treated animals and were normalized to the mouse housekeeping gene mTfrc. For survival analysis, twelve mice per treatment as described above were monitored for the duration of the study.
TABLE-US-00026 TABLE 26 mRNA Levels Liver Heart Aorta Compound Dose Duration progerin lamin C progerin lamin C progerin lamin C ID (mg/kg) (months) mRNA mRNA mRNA mRNA mRNA mRNA SCRAM 50 3.5 57 79 72 68 106 114 SCRAM 50 5.5 50 97 98 71 93 73 958328 17 3.5 6.7 138 4.9 104 5.5 133 958328 17 5.5 0.23 281 3.0 176 6.0 164 958328 50 3.5 5.7 154 3.8 123 2.0 143 958328 50 5.5 0.19 222 0.8 169 0.71 145
Protein levels were analyzed by individual treated animal by western blots as described above. Each data point represents the data from one treated animal in the indicated treatment group for liver and heart tissues and 2-3 pooled aorta for the treatment group.
TABLE-US-00027 TABLE 27 Protein Levels Liver Heart Aorta Compound Dose Duration progerin lamin C progerin lamin C progerin lamin C ID (mg/kg) (months) protein protein protein protein protein protein SCRAM 50 5.5 25 37 67 101 100 47 SCRAM 50 5.5 48 97 62 131 69 54 958328 17 5.5 20 110 54 127 73 41 958328 17 5.5 23 113 52 122 76 48 958328 17 5.5 n.d. n.d. 41 112 n.d. n.d. 958328 50 5.5 6 152 27 116 44 54 958328 50 5.5 10 113 29 115 91 78 958328 50 5.5 3 83 27 104 44 54
[0268] Survival for groups of 12 mice was monitored. The median survival in days is reported in the table below. As shown in the table below, treatment with oligomeric compound 958328 prolongs survival as compared to control treated HGPS mice.
TABLE-US-00028 TABLE 28 Survival Median Compound Dose Survival ID (mg/kg) (days) SCRAM 50 232 958328 17 308 958328 50 275
[0269] Body weight for groups of 12 mice was monitored. The median body weight over the duration of the experiment is presented in the table below. Treatment with oligomeric compound 958328 reduces weight loss in HGPS mice.
TABLE-US-00029 TABLE 29 Body Weight (g) Treatment Day of SCRAM, 958328, 958328, Treatment 50 mg/kg 17 mg/kg 50 mg/kg 46 17.7 18.6 18.2 50 18.9 19.0 18.9 60 19.7 19.9 19.2 67 20.4 20.3 19.5 74 21.0 20.8 20.2 81 21.4 21.1 20.7 88 21.5 21.5 21.0 95 21.8 22.4 21.7 102 21.7 22.3 21.9 109 23.1 22.8 21.9 116 23.0 22.8 22.0 123 22.3 22.7 21.9 130 22.3 22.4 21.4 137 21.6 22.5 21.4 144 21.6 22.4 21.8 151 22.4 23.0 22.3 158 22.3 23.0 22.8 165 22.6 22.8 22.5 172 22.1 22.6 22.5 179 21.5 22.4 21.9 186 21.0 21.9 22.2 193 20.9 21.8 22.3 200 21.1 21.6 22.5 207 20.8 21.6 22.4 214 19.5 21.2 22.0 221 18.6 20.6 20.9 228 17.7 20.4 20.8 235 17.5 20.1 20.9 242 18.3 19.9 20.8 249 18.0 19.4 20.5 256 17.5 19.7 20.3 263 17.8 19.3 20.5 270 17.8 19.3 20.6 277 17.7 19.5 20.3 284 17.8 19.7 19.6 291 17.5 19.4 19.9 298 n.d. 19.8 19.2 305 n.d. 18.5 19.6 312 n.d. 19.4 19.7 319 n.d. 19.2 19.1 326 n.d. n.d. 19.7 333 n.d. n.d. 21.2 340 n.d. n.d. 18.6