MVA virus and uses thereof

Abstract

The present invention relates to a novel Modified Vaccinia Ankara (MVA) virus. The present invention also relates to a method for culturing said MVA virus and to a method for producing said MVA virus. Further, the present invention relates to a pharmaceutical composition comprising said MVA virus and one or more pharmaceutical acceptable excipient(s), diluent(s), and/or carrier(s). Furthermore, the present invention relates to a vaccine comprising said MVA virus. In addition, the present invention relates to said MVA virus for use in medicine.

Claims

1. A Modified Vaccinia Ankara (MVA) virus comprising a nucleic acid sequence encoding an A3L gene product and/or an A34R gene product, wherein said nucleic acid sequence comprises at least one mutation resulting in an amino acid sequence modification of said gene product(s); wherein the amino acid sequence modification is in a region spanning amino acid positions 634 to 644 of the A3L gene product according to SEQ ID NO: 1, or amino acid positions corresponding thereto, and/or wherein the amino acid sequence modification is in a region spanning amino acid positions 81 to 91 of the A34R gene product according to SEQ ID NO: 2, or amino acid positions corresponding thereto.

2. The MVA virus of claim 1, wherein the nucleic acid sequence further encodes an A9L gene product, wherein said nucleic acid sequence comprises at least one mutation resulting in an amino acid sequence modification of said gene product; wherein the amino acid sequence modification is in a region spanning amino acid positions 70 to 80 of the A9L gene product according to SEQ ID NO: 3, or amino acid positions corresponding thereto.

3. The MVA virus of claim 2, wherein (i) the virus comprises a nucleic acid sequence encoding an A3L gene product and an A9L gene product, wherein said nucleic acid sequence comprises at least one mutation resulting in an amino acid sequence modification of said gene products, wherein the amino acid sequence modification is in a region spanning amino acid positions 634 to 644 of the A3L gene product according to SEQ ID NO: 1, or amino acid positions corresponding thereto, and wherein the amino acid sequence modification is in a region spanning amino acid positions 70 to 80 of the A9L gene product according to SEQ ID NO: 3, or amino acid positions corresponding thereto; or (ii) the virus comprises a nucleic acid sequence encoding an A34R gene product and an A9L gene product, wherein said nucleic acid sequence comprises at least one mutation resulting in an amino acid sequence modification of said gene products, wherein the amino acid sequence modification is in a region spanning amino acid positions 81 to 91 of the A34R gene product according to SEQ ID NO: 2, or amino acid positions corresponding thereto, and wherein the amino acid sequence modification is in a region spanning amino acid positions 70 to 80 of the A9L gene product according to SEQ ID NO: 3, or amino acid positions corresponding thereto.

4. The MVA virus of claim 2, wherein the virus comprises a nucleic acid sequence encoding an A3L gene product, an A34R gene product and an A9L gene product, wherein said nucleic acid sequence comprise at least one mutation resulting in an amino acid sequence modification of said gene products; wherein the amino acid sequence modification is in a region spanning amino acid positions 634 to 644 of the A3L gene product according to SEQ ID NO: 1, or amino acid positions corresponding thereto, wherein the amino acid sequence modification is in a region spanning amino acid positions 81 to 91 of the A34R gene product according to SEQ ID NO: 2, or amino acid positions corresponding thereto, and wherein the amino acid sequence modification is in a region spanning amino acid positions 70 to 80 of the A9L gene product according to SEQ ID NO: 3, or amino acid positions corresponding thereto.

5. The MVA virus of claim 2, wherein (i) the amino acid sequence modification is at amino acid position 639 of the A3L gene product or at an amino acid position corresponding thereto, (ii) the amino acid sequence modification is at amino acid position 638 of the A3L gene product or at an amino acid position corresponding thereto, (iii) the amino acid sequence modification is at amino acid position 86 of the A34R gene product or at an amino acid position corresponding thereto, (iv) the amino acid sequence modification is at amino acid position 75 of the A9L gene product or at an amino acid position corresponding thereto, and/or (v) the amino acid sequence modification is at amino acid position 74 of the A9L gene product or at an amino acid position corresponding thereto.

6. The MVA virus of claim 5, wherein the amino acid sequence modification is an amino acid deletion or amino acid replacement, wherein (i) H at amino acid position 639 of the A3L gene product or at an amino acid position corresponding thereto is deleted or replaced by a hydrophobic amino acid, preferably A, V, I, L, M, F, Y or W, a negative amino acid, preferably D or E, or a polar uncharged amino acid, preferably S, T, N or Q, (ii) R at amino acid position 638 of the A3L gene product or at an amino acid position corresponding thereto is deleted or replaced by a hydrophobic amino acid, preferably A, V, I, L, M, F, Y or W, a negative amino acid, preferably D or E, or a polar uncharged amino acid, preferably S, T, N or Q, (iii) D at amino acid position 86 of the A34R gene product or at an amino acid position corresponding thereto is deleted or replaced by a hydrophobic amino acid, preferably A, V, I, L, M, F, Y or W, a positive amino acid, preferably R, H or K, or a polar uncharged amino acid, preferably S, T, N or Q, (iv) K at amino acid position 75 of the A9L gene product or at an amino acid position corresponding thereto which is deleted or replaced by a hydrophobic amino acid, preferably A, V, I, L, M, F, Y or W, a negative amino acid, preferably D or E, or a polar uncharged amino acid, preferably S, T, N or Q, and/or (v) K at amino acid position 74 of the A9L gene product or at an amino acid position corresponding thereto which is deleted or replaced by a hydrophobic amino acid, preferably A, V, I, L, M, F, Y or W, a negative amino acid, preferably D or E, or a polar uncharged amino acid, preferably S, T, N or Q.

7. The MVA virus of claim 6, wherein the amino acid replacement is an amino acid replacement of (i) H at amino acid position 639 of the A3L gene product or at an amino acid position corresponding thereto by Y (H639Y A3L gene product mutant), (ii) R at amino acid position 638 of the A3L gene product or at an amino acid position corresponding thereto by Y (R638Y A3L gene product mutant), (iii) D at amino acid position 86 of the A34R gene product or at an amino acid position corresponding thereto by Y (D86Y A34R gene product mutant), (iv) K at amino acid position 75 of the A9L gene product or at an amino acid position corresponding thereto by E (K75E A9L gene product mutant), and/or (v) K at amino acid position 74 of the A9L gene product or at an amino acid position corresponding thereto by E (K74E A9L gene product mutant).

8. The MVA virus of claim 7, wherein the amino acid replacement is an amino acid replacement of (i) H at amino acid position 639 of the A3L gene product or at an amino acid position corresponding thereto by Y and D at amino acid position 86 of the A34R gene product or at an amino acid position corresponding thereto by Y (H639Y A3L/D86Y A34R gene product mutant), (ii) H at amino acid position 639 of the A3L gene product or at an amino acid position corresponding thereto by Y and K at amino acid position 75 of the A9L gene product or at an amino acid position corresponding thereto by E (H639Y A3L/K75E A9L gene product mutant), (iii) D at amino acid position 86 of the A34R gene product or at an amino acid position corresponding thereto by Y and K at amino acid position 75 of the A9L gene product or at an amino acid position corresponding thereto by E (D86Y A34R/K75E A9L gene product mutant), or (iv) H at amino acid position 639 of the A3L gene product or at an amino acid position corresponding thereto by Y, D at amino acid position 86 of the A34R gene product or at an amino acid position corresponding thereto by Y, and K at amino acid position 75 of the A9L gene product or at an amino acid position corresponding thereto by E (H639Y A3L/D86Y A34R/K75E A9L gene product mutant).

9. The MVA virus of claim 7, wherein (i) the A3L gene product with the H639Y mutation has an amino acid sequence according to SEQ ID NO: 4, wherein said variant comprises the amino acid Y at amino acid position 639 or at an amino acid position corresponding thereto, (ii) the A34R gene product with the D86Y mutation has an amino acid sequence according to SEQ ID NO: 5, wherein said variant comprises the amino acid Y at amino acid position 86 or at an amino acid position corresponding thereto, and/or (iii) the A9L gene product with the K75E mutation has an amino acid sequence according to SEQ ID NO: 6 or is a variant thereof which is at least 95% identical to said amino acid sequence, wherein said variant comprises the amino acid E at amino acid position 75 or at an amino acid position corresponding thereto.

10. The MVA virus of claim 1, wherein the virus further comprises a heterologous nucleic acid sequence.

11. The MVA virus of claim 10, wherein the heterologous nucleic acid sequence is selected from a sequence coding for an antigen, particularly an epitope of an antigen, a diagnostic compound, or a therapeutic compound.

12. A genome of the MVA virus according to claim 1.

13. A cell comprising a MVA virus according to claim 1.

14. The cell of claim 13, wherein the cell is a non-adherent/suspension cell.

15. The cell of claim 13, wherein the cell is an avian cell.

16. A cell comprising a genome according to claim 12.

17. The cell of claim 14, wherein the cell is an avian cell.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1: (A) Blind passage of MVA where concentration of input virus of the previous passage was not known. Intended MOI was 0.01 to 0.1 or 2×10^4 to 2×10^5 pfu/mL input virus at 2×10^6 cells/mL at the time of infection. (B) Repeat of experiment shown in (A) with exception that each passage was initiated with defined MOI of 0.05, and that high and low passage MVA were always investigated in parallel. Note sudden increase in yields again starting with passage 10 of MVA demonstrating reproducibility. (C) Peak titers usually were obtained 48 h post infection. Only these yields are shown in this chart. Note constant yields in the reference passage of the individual experiments (within variation of the titration method, bold symbols) and gradual to sudden improvements in yields as passage number increases. (D) Ratio of yields in high to low passage MVA 48 h post infection. Calculation was performed with data from panel (C). A ratio of 1 indicates similar properties and is observed for MVA of passage 10 to passage 23.

(2) FIG. 2: Location of the here described mutations in the genome of chorioallantois vaccinia Ankara (CVA, Genbank entry AM501482), the parental virus of highly attenuated modified vaccinia Ankara (MVA). Shown are selected restriction enzyme sites for orientation, the inverted terminal repeats, and deletion sites (Meyer, et al. 1991 in J Gen Virol 72 (Pt 5), 1031-1038) (light boxes with roman numerals). The affected genes (A3L, A9L and A34R) are indicated with bold boxes. The dashed lines point to the associated sequence changes. Shown is the coding strand, the alphanumericals describe the mutation at DNA and amino acid level in the respective genes in strain MVA-CR.

(3) FIG. 3: Nomenclature of the different lineages added to data partially shown in FIG. 1. (A) Blind passage of MVA where concentration of input virus of the previous passage was not known. Intended MOI was 0.01 to 0.1 or 2×10^4 to 2×10^5 pfu/mL input virus at 2×10^6 cells/mL at the time of infection. In this experiment, MVA-A2 has been passaged into lineage MVA-X, leading to isolates MVA-X14 and MVA-X20. (B) Repeat of experiment shown in (A) with exception that each passage was initiated with defined MOI of 0.05, and that high and low passage MVA were always investigated in parallel: the low passage thread was started with MVA-A2, the reference high passage thread was started with MVA-X14. Note sudden increase in yields again starting with passage 10 of MVA demonstrating reproducibility. (C) Peak titers usually were obtained 48 h post infection. Only these yields are shown in this chart. Note constant yields in the reference passage of the individual experiments (within variation of the titration method, bold symbols) and gradual to sudden improvements in yields as passage number increases. In this controlled experiment MVA-A2 leads into lineage MVA-CR, and MVA-X14 leads into lineage MVA-Y. The genomic DNA of isolates MVA-A2, MVA-CR7 and MVA-CR11 were sequenced. (D) Genotype G256T in A34R is enriched by the inventors: note suddenly appearing and continuously accumulating resistance to BsaWI in MVA-X14, MVA-Y23 and MVA-CR11. The undigested PCR amplicons together with a non-template control is shown in (F). (E) Ratio of yields in high to low passage MVA 48 h post infection. Calculation was performed with data from panel (C). A ratio of 1 indicates similar properties and is observed for MVA of passage 10 to passage 23.

(4) FIG. 4: MVA-CR is a novel strain and MVA-CR19 is a pure isolate of this strain. (A) Progress of plaque purification followed by diagnostic restriction enzyme digest. (B) Conventional sequencing chromatograms demonstrate that virus isolate MVA-CR19 has the novel pure genotype in all three genes A3L, A9L and A34R.

(5) FIG. 5: Macroscopic plaque phenotypes of MVA-A2 and MVA-CR19 in cell monolayers stained with crystal violet. Note appearance of comets in MVA-CR19 already 72 h post infection at a time where MVA-A2 infected CR cells appear dotted with circular plaques. 96 h post infection the culture is in fulminant CPE after infection with MVA-CR19 and the overall stain intensity therefore appears weaker due to extensive loss of cell mass. At this time point comets are visible also after infection with MVA-A2. An inverse relationship is visible in the mammalian R05T culture: plaques are prominent and shaped like comets 120 h post infection only after infection with parental MVA-A2. The MVA-CR19 isolate appears to be highly attenuated for this cell line. The left panel shows plaques as visible with the unaided eye (scale bar of 0.5 cm), the right panel shows cells after initial 40× magnification (scale bar of 100 μm).

(6) FIG. 6: Plaque phenotype at 40-fold initial magnification. Note that plaques are more pronounced in CR cells (top row) infected with MVA-CR19 compared to MVA-A2; plaque size caused by MVA-CR11 is intermediate as if the mutation excerpts a helper function already in a mixture of genotypes. The reverse situation was observed on R05T cells with MVA-CR19 appearing to be more attenuated than MVA-A2 (bottom row); again with MVA-CR11 in an intermediate position.

(7) FIG. 7: Virus release from the CR producer cell in suspension cultures. A2 and CR19 refers to MVA isolate, CD-U3 and CD-VP4 refers to 1 volume of corresponding medium added for virus production, cell proliferation was always performed in CD-U3. (A) Kinetic of replication of isolates MVA-A2 and MVA-CR19 in cell proliferation medium with (bold symbols) or without (open symbols) addition of virus production medium. The dashed line at 10^5 pfu/mL corresponds to input virus, MOI of 0.05. (B) Distribution of infectious units in supernatant or complete lysate (supernatant and cell-associated virus) 48 h post infection. Light columns indicate pfu/mL of the complete lysate, dark columns concentration of infectious units released into the cell supernatant. The pie charts on top of the columns refer to infectious units in cell free space (SN) in relation to complete lysate (LYS). The curves shown in (A) are the average of three independent parallel experiments, standard deviation is not shown to maintain clarity in a comparison of four independent curves. In (B) standard deviation of the three repeats is shown for the 48 h-values. The samples used to obtain these data points are from the kinetic of panel (A).

(8) FIG. 8: Virus release from adherent producer cells cultivated in presence of serum. Light columns indicate pfu/mL of the complete lysate, dark columns concentration of infectious units released into the cell supernatant, and the pie charts on top of the columns the percentage of cell-free virus in the lysate. Cultures were assayed for MVA-A2 or MVA-CR19 48 h p.i. in infected CR or CR.pIX cells and 144 h p.i. in R05T cells.

(9) FIG. 9: Sequential generations of MVA on adherent serum-dependent CR cells and mammalian R05T cells. MVA-B is the lineage derived from adherent CR cells and MVA-R is the lineage derived from the R05T cells. (A) Sequential infection was performed without knowing the titer of the previous generation. The resulting fluctuations in input virus are shown in the lower (black) curve, the yield is shown in the upper curve. Units are log 10 of pfu/mL. (B) Dividing yield by input virus describes amplification of virus for each generation. MVA-X (broken upper curve) is the lineage that was derived from the chemically-defined suspension culture shown in FIG. 1. Higher generation numbers show greater amplification with peak value of 10000 infectious progeny viruses per pfu of input virus.

(10) (C): No emergence of the D86Y A34R phenotype in MVA populations passaged on adherent cells. Compare to FIG. 3D for restriction fragment length polymorphism where the D86Y genotype in A34R accumulates. Maintenance of wild type sequence in the complete genes A3L, A9L and A34R was also confirmed by conventional sequencing, with the relevant region shown for MVA-B20 in FIG. 10.

(11) FIG. 10: Excellent specificity for the chemically-defined suspension environment. Sequence of the A3L C1915T, A9L A223G and A34R G256T region in strains MVA-B and MVA-R. The two lineages passaged on adherent cultures of duck or fruit bat origin maintain wild-type sequence without any signs at all of genotype changes in the here described open reading frames.

(12) FIG. 11: Appearance of Vero cells after staining for microfocus assay. Foci are more prominent in titrations of MVA-R18 (virus strain or lineage obtained by passaging on cells from the Egyptian rousette) than MVA-B20 (obtained from the adherent Muscovy duck cell line) that was isolated in parallel. A newly gained limited replication in cells of primate origin indicates potential for greater immune stimulation as vaccine strain.

(13) FIG. 12: Attenuation of MVA-CR isolates MVA-CR11 and MVA-CR19. Panel (A′) shows replication properties of isolate MVA-CR11, again in an intermediate position to isolate MVA-CR19 shown in (A). Panel (B) shows examples of cytopathic effect (or absence of cytopathic effect) in infected non-avian cells caused by MVA-CR19. The images at 200-fold initial magnification (with scale bar of 20 μm) show cells at day 9 of the chart (A).

REFERENCES

(14) [1] Zurbriggen, S., Tobler, K., Abril, C. et al. Isolation of sabin-like polioviruses from wastewater in a country using inactivated polio vaccine. Appl Environ Microbiol 2008, 74(18), 5608-5614. [2] Kemper, A. R., Davis, M. M. & Freed, G. L. Expected adverse events in a mass smallpox vaccination campaign. Eff Clin Pract 2002, 5(2), 84-90. [3] Parrino, J. & Graham, B. S. Smallpox vaccines: Past, present, and future. J Allergy Clin Immunol 2006, 118(6), 1320-1326. [4] Excler, J. L., Parks, C. L., Ackland, J., Rees, H., Gust, I. D. & Koff, W. C. Replicating viral vectors as HIV vaccines: Summary report from the IAVI-sponsored satellite symposium at the AIDS vaccine 2009 conference. Biologicals 2010, 38(4), 511-521. [5] Plotkin, S. A. Vaccines: the fourth century. Clin Vaccine Immunol 2009, 16(12), 1709-1719. [6] Cebere, I., Dorrell, L., McShane, H. et al. Phase I clinical trial safety of DNA- and modified virus Ankara-vectored human immunodeficiency virus type 1 (HIV-1) vaccines administered alone and in a prime-boost regime to healthy HIV-1-uninfected volunteers. Vaccine 2006, 24(4), 417-425. [7] Dorrell, L., Williams, P., Suttill, A. et al. Safety and tolerability of recombinant modified vaccinia virus Ankara expressing an HIV-1 gag/multiepitope immunogen (MVA.HIVA) in HIV-1-infected persons receiving combination antiretroviral therapy. Vaccine 2007, 25(17), 3277-3283. [8] Gilbert, S. C., Moorthy, V. S., Andrews, L. et al. Synergistic DNA-MVA prime-boost vaccination regimes for malaria and tuberculosis. Vaccine 2006, 24(21), 4554-4561. [9] Mayr, A. Smallpox vaccination and bioterrorism with pox viruses. Comp Immunol Microbiol Infect Dis 2003, 26 (5-6), 423-430. [10] Webster, D. P., Dunachie, S., Vuola, J. M. et al. Enhanced T cell-mediated protection against malaria in human challenges by using the recombinant poxviruses FP9 and modified vaccinia virus Ankara. Proc Natl Acad Sci USA 2005, 102(13), 4836-4841. [11] Drillien, R., Spehner, D. & Hanau, D. Modified vaccinia virus Ankara induces moderate activation of human dendritic cells. J Gen Virol 2004, 85 (Pt 8), 2167-2175. [12] Liu, L., Chavan, R. & Feinberg, M. B. Dendritic cells are preferentially targeted among hematolymphocytes by Modified Vaccinia Virus Ankara and play a key role in the induction of virus-specific T cell responses in vivo. BMC Immunol 2008, 9, 15. [13] Ryan, E. J., Harenberg, A. & Burdin, N. The Canarypox-virus vaccine vector ALVAC triggers the release of IFN-gamma by Natural Killer (NK) cells enhancing Th1 polarization. Vaccine 2007, 25(17), 3380-3390. [14] Sutter, G. & Moss, B. Nonreplicating vaccinia vector efficiently expresses recombinant genes. Proc Natl Acad Sci USA 1992, 89(22), 10847-10851. [15] Sutter, G., Wyatt, L. S., Foley, P. L., Bennink, J. R. & Moss, B. A recombinant vector derived from the host range-restricted and highly attenuated MVA strain of vaccinia virus stimulates protective immunity in mice to influenza virus. Vaccine 1994, 12(11), 1032-1040. [16] Mayr, A. & Munz, E. [Changes in the vaccinia virus through continuing passages in chick embryo fibroblast cultures]. Zentralbl Bakteriol Orig 1964, 195(1), 24-35. [17] Meyer, H., Sutter, G. & Mayr, A. Mapping of deletions in the genome of the highly attenuated vaccinia virus MVA and their influence on virulence. J Gen Virol 1991, 72 (Pt 5), 1031-1038. [18] Sancho, M. C., Schleich, S., Griffiths, G. & Krijnse-Locker, J. The block in assembly of modified vaccinia virus Ankara in HeLa cells reveals new insights into vaccinia virus morphogenesis. J Virol 2002, 76(16), 8318-8334. [19] Mayr, A. & Danner, K. Vaccination against pox diseases under immunosuppressive conditions. Dev Biol Stand 1978, 41, 225-234. [20] Philipp, H. C. & Kolla, I. Laboratory host systems for extraneous agent testing in avian live virus vaccines: problems encountered. Biologicals 2010, 38(3), 350-351. [21] Enserink, M. Influenza. Crisis underscores fragility of vaccine production system. Science 2004, 306(5695), 385. [22] Jordan, I., Vos, A., Beilfuss, S., Neubert, A., Breul, S. & Sandig, V. An avian cell line designed for production of highly attenuated viruses. Vaccine 2009, 27(5), 748-756. [23] Jordan, I., Northoff, S., Thiele, M. et al. A chemically defined production process for highly attenuated poxviruses. Biologicals 2011, 39(1), 50-58. [24] Jordan, I., Horn, D., Oehmke, S., Leendertz, F. H. & Sandig, V. Cell lines from the Egyptian fruit bat are permissive for modified vaccinia Ankara. Virus Res 2009, 145(1), 54-62. [25] Stickl, H., Hochstein-Mintzel, V., Mayr, A., Huber, H. C., Schafer, H. & Holzner, A. [MVA vaccination against smallpox: clinical tests with an attenuated live vaccinia virus strain (MVA) (author's transl)]. Dtsch Med Wochenschr 1974, 99(47), 2386-2392. [26] Rosel, J. L., Earl, P. L., Weir, J. P. & Moss, B. Conserved TAAATG sequence at the transcriptional and translational initiation sites of vaccinia virus late genes deduced by structural and functional analysis of the HindIII H genome fragment. J Virol 1986, 60(2), 436-449. [27] Byrd, C. M., Bolken, T. C. & Hruby, D. E. The vaccinia virus I7L gene product is the core protein proteinase. J Virol 2002, 76(17), 8973-8976. [28] Heljasvaara, R., Rodriguez, D., Risco, C., Carrascosa, J. L., Esteban, M. & Rodriguez, J. R. The major core protein P4a (A10L gene) of vaccinia virus is essential for correct assembly of viral DNA into the nucleoprotein complex to form immature viral particles. J Virol 2001, 75(13), 5778-5795. [29] Kato, S. E., Strahl, A. L., Moussatche, N. & Condit, R. C. Temperature-sensitive mutants in the vaccinia virus 4b virion structural protein assemble malformed, transcriptionally inactive intracellular mature virions. Virology 2004, 330(1), 127-146. [30] Yeh, W. W., Moss, B. & Wolffe, E. J. The vaccinia virus A9L gene encodes a membrane protein required for an early step in virion morphogenesis. J Virol 2000, 74(20), 9701-9711. [31] Husain, M., Weisberg, A. S. & Moss, B. Resistance of a vaccinia virus A34R deletion mutant to spontaneous rupture of the outer membrane of progeny virions on the surface of infected cells. Virology 2007, 366(2), 424-432. [32] Blasco, R., Sisler, J. R. & Moss, B. Dissociation of progeny vaccinia virus from the cell membrane is regulated by a viral envelope glycoprotein: effect of a point mutation in the lectin homology domain of the A34R gene. J Virol 1993, 67(6), 3319-3325. [33] Katz, E., Wolffe, E. & Moss, B. Identification of second-site mutations that enhance release and spread of vaccinia virus. J Virol 2002, 76(22), 11637-11644. [34] Meiser, A., Boulanger, D., Sutter, G. & Krijnse Locker, J. Comparison of virus production in chicken embryo fibroblasts infected with the WR, IHD-J and MVA strains of vaccinia virus: IHD-J is most efficient in trans-Golgi network wrapping and extracellular enveloped virus release. J Gen Virol 2003, 84 (Pt 6), 1383-1392. [35] van Belkum, A., Tassios, P. T., Dijkshoorn, L. et al. Guidelines for the validation and application of typing methods for use in bacterial epidemiology. Clin Microbiol Infect 2007, 13 Suppl 3, 1-46. [36] Coulibaly, S., Bruhl, P., Mayrhofer, J., Schmid, K., Gerencer, M. & Falkner, F. G. The nonreplicating smallpox candidate vaccines defective vaccinia Lister (dVV-L) and modified vaccinia Ankara (MVA) elicit robust long-term protection. Virology 2005, 341(1), 91-101. [37] Rotz, L. D., Dotson, D. A., Damon, I. K. & Becher, J. A. Vaccinia (smallpox) vaccine: recommendations of the Advisory Committee on Immunization Practices (ACIP), 2001. MMWR Recomm Rep 2001, 50 (RR-10), 1-25; quiz CE21-27. [38] Hess, R. D., Weber, F., Watson, K. & Schmitt, S. Regulatory, biosafety and safety challenges for novel cells as substrates for human vaccines. Vaccine 2012, 30(17), 2715-2727. [39] McIntosh, A. A. & Smith, G. L. Vaccinia virus glycoprotein A34R is required for infectivity of extracellular enveloped virus. J Virol 1996, 70(1), 272-281. [40] Attramadal, A. The effect of divalent cations on cell adhesion in vitro. J Periodontal Res 1969, 4(2), 166. [41] Jordan, I., Munster, V. J. & Sandig, V. Authentication of the R06E Fruit Bat Cell Line. Viruses 2012, 4(5), 889-900.

EXAMPLES

Example 1: Serial Isolates of MVA in Chemically Defined Suspension Cultures

(15) In this example, we investigated properties of successive generations of MVA on a cell line already fully permissive for this virus. The selective environment is imposed by the chemically defined media and the absence of virion-stabilizing components such as abundant extracellular protein and lipids contained in the minimally purified lysate of embryonated eggs or bovine serum supplements commonly found in vertebrate cell cultures.

(16) With the motivation to confirm stability expected from a DNA virus, we passaged MVA on the CR cell line. For the experiment, we used the MVA strain according to accession number AY603355 (version AY603355.1 and GI:47088326). The suspension culture and chemically defined procedure employed is fully within the constrains suggested by regulatory authorities and was developed and presented previously (Jordan, et al. 2011 in Biologicals 39, 50-58). Briefly described here, to produce hyperattenuated poxvirus to high titers, CR or CR.pIX suspension cultures in CD-U3 medium were allowed to proliferate to 4×10^6 cells/mL. One volume of CD-VP4 virus production medium was added and the culture inoculated with virus to a multiplicity of infection (MOI) as indicated, usually within 0.01 and 0.1. The CR and CR.pIX cell lines are derived from immortalized muscovy duck retina cells (Jordan, et al. 2009 in Vaccine 27, 748-756) and were designed for vaccine production. The CD-U3 medium (PAA, catalog #T1250, 3001) is an improved version of the CD-U2 cell proliferation medium, and CD-VP4 (Biochrom catalog #F9127) is a virus production medium developed to complement the proliferation medium during virus replication (Jordan, et al. 2011 in Biologicals 39, 50-58). All cultures described in the following examples were performed at 37° C. in an atmosphere enriched to 8% CO2. Suspension cultures were incubated in a shaking incubator (Infors) with 5 cm amplitude and 180 rpm for shake tubes and 150 rpm for shake flasks.

(17) Samples were removed from the suspension cultures at defined intervals and infectious virus therein usually was released by sonication for 45 s with a Branson S250-D® a unit powering a 3.2 mm sonifier tip with 10% energy.

(18) Number of infectious units were determined by adding serial dilutions of a virus preparation to 80% confluent Vero monolayers in DMEM:F12 medium (Gibco) containing 5% FCS. MVA cannot replicate in Vero cells so using such a substrate allows to strictly quantify only the input virus. After 48 hours, the cells were fixed with methanol and incubated with polyclonal vaccinia virus antibodies (Quartett Immunodiagnostika, Berlin, Germany) at 1:1000 dilution in PBS containing 1% fetal calf serum. Two wash steps were performed with PBS containing 0.05% Tween 20® and secondary antibody to the vaccinia-specific antibody is added at 1:1000. This secondary antibody is coupled to the peroxidase enzyme that catalyzes a color reaction upon incubation with AEC reagent (3-amino-9-ethyl-carbozole; 0.3 mg/ml in 0.1 M acetate buffer pH 5.0 containing 0.015% H.sub.2O2). Infected foci are identified by light microscopy and plaque units/nil are calculated from the maximum dilution of MVA suspension that yields a positive dye reaction. All titrations were performed in parallel replicates (giving a total of four titration values per sample).

(19) This is the first time that MVA, already adapted to proliferation in primary chicken cells, has been serially exposed to an immortal (rather than primary) culture that at the same time is an avian production substrate not derived from chicken. Furthermore, we have performed the passaging in chemically-defined culture medium without the addition of serum, albumin, or other components expected to stabilize viruses.

(20) As shown in FIG. 1A/3A, there is a gradual increase in yields with increasing passage. This initial experiment was performed such that virus yield from each immediately previous generation was estimated and with this estimate, we aimed to infect the subsequent culture with an MOI of 0.01 to 0.1. Because of the time required until titrations can be evaluated the true MOI varied from passage to passage and in our case (any passaging could also have an attenuating or dampening effect on virus replication) yields and MOI increased with increasing passage. After having discovered a surprising potential passage effect for MVA in a fully permissive cell line, we repeated the experiment under more stringent conditions.

(21) The data shown in FIGS. 1B to 1C were obtained by adjusting MOI of each passage to 0.05 with virus isolated 48 h post infection of the respective previous passage. The penultimate passage 14 virus from the initial experiment of FIG. 1A/3A was used as high-passage reference. Any changes in MVA properties are, therefore, confirmed in this repeat experiment.

(22) FIG. 1B shows the kinetics of the various passages superimposed. For each experiment, two independent parallel infections in independent duplicates were quantified starting with a low-passage and the high-passage MVA. At passage 10 and 11 of the thread initiated with low-passage virus we noticed a strong shift from (already high) yields in the range of 10^8 pfu/mL to beyond 10^9 pfu/mL.

(23) To better visualize the effect, FIG. 1C depicts only the 48 h peak virus titers against passage numbers. MVA passages starting with passage 14 oscillate around 3.4×10^9 pfu/mL whereas MVA passages below 10 are in the range of 3.8×10^8 pfu/mL. Passage 10 and 11 virus suddenly replicates to a mean peak value of 3.66×10^9 pfu/mL. As determination of virus titers is associated with variations, FIG. 1D/3D depicts the ratios of low to high passage virus for each particular passage. As replication properties of high passage virus remain stable, this approach standardizes against titer deviations. A large number indicates an advantage of high passage virus, a ratio of 1 indicates that properties of low and high passage virus are highly similar or even identical.

(24) The data in FIG. 1D show that with each generation yield of the lower passage virus approaches yield of high passage virus. Whereas 20-fold greater amount of high passage virus is being released at the onset of the experiment, this number decreases to parity after passage 10. In this particular experiment, an additional step towards high passage phenotype starts at passage 8. Stable ultra-high yield virus is obtained with passage 10, shown to be maintained in passage 11. Overall stability is demonstrated for over 8 passages starting with the independent reference lineage initiating with passage 14.

Example 2: Sequencing of MVA Genomic DNA

(25) We next determined the DNA sequence of selected virus passages: 100 mL of AGE1.CR cultures at 2×10^6 cells/mL were infected with MVA at 0.01 MOI in a 1:1 mixture of CD-U3 and CD-VP4 media as described (Jordan, et al. 2011 in Biologicals 39, 50-58). 48 h post infection cells were removed by centrifugation with 200×g. Polyethylene glycol was added to 8% (from a 13% w/v stock solution in pure water) to the cleared supernatant. After incubation on ice for 30 min the suspension was centrifuged for 60 min with 6600×g and the translucent pellet containing viral particles was resuspended in 500 μL of PBS.

(26) Extraviral DNA was digested with 8 units of Turbo DNase® (Ambion), then total DNA (predominately viral genome) was isolated with the DNA blood mini preparation kit (Qiagen®) and, both procedures according to the descriptions of the manufacturers.

(27) To calculate expected yields: 178 kbp of MVA genome and 660 g/mol per DNA by correspond to 1.17×10^8 g of DNA per mol of virus. Divided by NA of 6.02×10^23 per mol this yields 1.95×10^(−16) g DNA per MVA particle. Assuming a yield of 10^8 pfu/mL, 1.95×10^(−8) g viral DNA/mL, or 19.5 ng/mL can be expected.

(28) We obtained approx 8 μg total DNA in the preparations and performed multiplex qPCR to further estimate ratios of viral genomic DNA to cellular DNA. MVA levels were quantified with qPCR against the gene of membrane protein MVA128L of the intracellular mature virus, by 120811-120898 of GenBank #U94848, with CgTTTTgCATCATACCTCCATCTT (SEQ ID NO: 13), 6FAM-AggCATAAACgATTgCTgCTgTTCCTCTgT-BHQ1 (SEQ ID NO: 14), and gCgggTgCTggAgTgCTT (SEQ ID NO: 15). For detection of cellular DNA the E1A transgene was quantified with TgACTCCggTCCTTCTAACACA (SEQ ID NO: 16), YAK-CCCggTggTCCCgCTgTgC-BHQ1 (SEQ ID NO: 17), and TCACggCAACTggTTTAATgg (SEQ ID NO: 18). In a final reaction volume of 25 μL, 100 nM primers and 80 nM probes were mixed with dNTPs to 200 μM and Taq Man Universal® PCR Master Mix (#4324018, Applied Biosystems) to 1× concentration. Thermocycling was performed in a ABI Prism 7000 with 2 min at 50° C., 10 min at 95° C., and 40 cycles of 15 s at 95° C. and 1 min at 60° C. Typical Ct values were 16 for MVA and 33 for cellular DNA. Differences of Ct values indicate differences in relative molecule concentration so that ratio of viral to host DNA is 2^(33−16) or 130000:1, which is suitable for full genome sequencing.

(29) Sequences were obtained with the Roche®/454 GS FLX+ technology. The genomic viral DNA of passages 2, 7, and 11 (shown in FIG. 1) were sequenced with 50-fold coverage for each genome and assembled using an unforced (without guide sequence) algorithm. Alignment of the three passages revealed extremely high sequence conservation as expected from pox viruses. A number of single-base deletions in nucleotide repeats most likely represent sequencing artefacts (for example tttttat-aaaataa versus tttttataaaaataa) and were not included in further analysis.

(30) There were only three point mutations that fit the non-artefact definition and they were discovered in the examined passage 11 of the viral genome. All three point mutations were in coding regions, each affected a different structural protein, and each changed the amino acid composition. We consider these changes highly significant and completely unexpected. Thus, we have recovered a novel strain of MVA which we call MVA-CR in the remaining text.

(31) The first of the three mutations discovered in MVA-CR is at by position 111561 of the CVA strain used here for orientation purposes (GeneBank #AM501482). This mutation is a C to T transition of nucleotide 1915 (abbreviated as C1915T) in the coding sequence of the gene called A3L according to one common poxvirus genomic notation (Meyer, et al. 1991 in J Gen Virol 72 (Pt 5), 1031-1038; Rosel et al. 1986 in J Virol 60, 436-449). The gene product is the major core protein P4b precursor. The C1915T mutation causes a change in the amino acid sequence from His (CAU) to Tyr (UAU) at codon 639. Note that the A3L gene is in antisense orientation in the poxvirus genome so that C1915T in the coding sequence corresponds to G111561A in the genomic DNA of CVA.

(32) The second mutation is a A223G transition in the coding sequence of the 10.6 k virion membrane protein, encoded by A9L, a T119151C transition in the genome of CVA. The A223G mutation changes codon 75 from Lys (AAG) to Glu (GAG).

(33) The third mutation is a G256T transversion in the coding sequence of the EEV membrane glycoprotein, encoded by A34R, a G144417T transversion in the genomic DNA of CVA. The G256T mutation changes codon 86 from Asp (GAT) to Tyr (UAU).

(34) Location in the genome of MVA used in this experiment, accession number AY603355 (version AY603355.1 and GI:47088326): A3L, by 100334 to by 102268 on the complementary strand; A9L, by 107855 to by 108139 on the complementary strand; and A34R, 129078 . . . 129584 on the genomic strand. The strain used is the virus obtainable from the American Type Culture Collection (ATCC) under the number #VR-1508.

(35) All three mutations affect proteins of MVA that are components of infectious particles. Functions of the affected proteins in greater detail are:

(36) A3L gene product: The A3L gene product, P4b, is one of three major core proteins and processed by the I7L-encoded viral protease (Byrd et al. 2002 in J Virol 76, 8973-8976) during the maturation of the spherical and non-infectious immature virion (IV) to the intracellular mature virion (IMV). The P4b protein contributes to virion morphogenesis at a very early step. It is involved in the correct condensation and membrane rearrangements in the transition towards the infectious IMV (Heljasvaara et al. 2001 in J Virol 75, 5778-5795; Kato et al. 2004 in Virology 330, 127-146).

(37) A9L gene product: This gene product, similar to P4b, is involved in the early steps of MVA maturation. It is a factor important for correct condensation of the core of the IMV (Yeh et al. 2000 in J Virol 74, 9701-9711).

(38) A34R gene product: The extracellular enveloped virus (EEV) has evolved as a vehicle to allow virus to spread to distant sites. The additional membrane of the EEV is not equipped to mediate fusion with the target cell and must be disrupted to release the IMV, the actual infectious unit of vaccinia virus. Studies with A34R deletion mutants demonstrated that by destabilizing the EEV outer membrane, this factor is extremely important for infectious activity in the extracellular space and for spread of vaccinia virus (Husain et al. 2007 in Virology 366, 424-432). The A34R protein, together with the A33R and B5R proteins (Blasco et al. 1993 in J Virol 67, 3319-3325; Katz et al. 2002 in J Virol 76, 11637-11644; Meiser et al. 2003 in J Gen Virol 84, 1383-1392), modulates the rate at which the cell-associated enveloped virus (CEV) detaches from the producing cell.

(39) A MVA virus with the above mutations has never been described before. Thus, passaging of MVA in chemically defined suspension cultures of a stable avian cell line improved the actual infectious entity, the mature virus, by changes in two integral proteins, the A3L and A9L gene products. These changes increase infectivity, improve maturation rates, and/or increase stability in such an environment that does not contain the expected stabilizing components of serum. In addition, a point mutation was detected in the A34R gene product that modulates properties of the extracellular form of the virus. This change increase detachment rates and decrease stability of the outer viral envelope that masks the infectivity of the mature particle.

Example 3: Confirmation Experiments

(40) To preclude sequencing artifacts as explanation for our unexpected finding, we performed confirmation experiments. To confirm presence of MVA-CR in the preparation, we designed primers for amplification of all affected open reading frames for additional sequencing reactions. The PCR was performed with KOD HiFi® DNA polymerase (TOYOBO Novagen) 36 cycles of 20 s 55° C. annealing, 60 s 72° C. amplification (120 s for A3L), and 20 s 94° C. denaturation. The primers (f=forward and r=reverse) for amplification of the coding sequence of A9L were GCAAACGCGATAAGGATACG (a9lf) (SEQ ID NO: 19) and AAGCGGATGCAGAATAGACG (a9lr) (SEQ ID NO: 20), and of A34R were gCggAATCATCAACACTACCC (a34rf) (SEQ ID NO: 21) and TAATAACAAACgCggCgTCCATggC (a34rr) (SEQ ID NO: 22). Sequencing of the rather large A3L open reading frame was spanned with several primers: amplification was performed with GCAGAAGAACACCGCTTAGG (a3lf) (SEQ ID NO: 23) and (a3lr) (SEQ ID NO: 24), sequencing was performed with TGAGAGCTCGCATCAATC (a3lf2) (SEQ ID NO: 25), ATCGGACTGTCGGATGTTGTG (a3lf3) (SEQ ID NO: 26), and CTAGAATCGGTGACCAACTC (a3lr3) (SEQ ID NO: 27).

(41) Serendipitously, mutation D86Y in A34R introduces a target site for the AccI restriction enzyme: from ccggatact to ccG/TATACt (bold face for the mutation, uppercase letters for the restriction target site). At the same time, the BsaWI site of the wildtype is lost by the mutation D86Y, from agA/CCGGAt to agaccgtat. Digestion of the 772 bp A34R amplicon with AccI yields 399 and 373 bp for the parental MVA, and 399, 316 and 57 bp for MVA-CR. Conversely, digestion with BsaWI yields 452 and 320 bp for parental MVA and the full 772 bp for MVA-CR. The fragments were separated by 3% agarose gel electrophoresis in TAE buffer.

(42) FIG. 3D shows that the D86Y mutation in A34R is part of the MVA-CR11 population. It was also independently obtained in the X14 lineages. This result confirms that the here discovered mutation is not a chance event but connected to the environment in effect during virus replication.

(43) We also confirmed these surprising results by conventional sequencing of the amplified fragments. Because sequencing intentionally was performed directly on the purified PCR reactions without subcloning, the chromatograms shown in FIG. 4 are expected to reflect the average sequence, i.e. not merely the most abundant sequence but also presence of sequence variations. Purification of the PCR reaction was performed by resolving the PCR products by agarose gel electrophoresis, excision of the gel slice containing the single prominent signal, and isolation of the DNA mixture therein using the QIAquick Gel Extraction® kit (Qiagen®) according to the instructions of the manufacturer. Sequencing was performed with the same primers used also for amplification.

(44) We confirmed the presence of all three observed mutations in MVA-CR11 and in the independent X14 lineage.

Example 4: Isolation and Purification of the Novel MVA-CR Strain

(45) To obtain a pure MVA-CR virus, we next performed plaque purification: 1×10^6 adherent CR cells were seeded per well of a 6-well plate in DMEM:F12 medium containing 5% FCS (Biochrom). After 24 h, only 10^4 total pfu of MVA-CR16 was added, that is, a descendant of MVA-CR11 that had been passaged for additional 5 generations in chemically defined CR suspension cultures. To infect with low number of infectious units allows one to obtain well separated plaques. After 30 min, the culture medium was replaced with 0.8% of low-gelling agarose (Sigma #A9045) in DMEM:F12 medium containing 5% FCS. The agarose overlay prevents diffusion of progeny virus released by the infected monolayer so that individual plaques are not cross contaminated. The overlay also allows isolation of progeny virus by recovery of small (approximately 2 mm diameter) agarose cores with a hollow needle. Such agarose cores were picked from foci of cytopathic effect and transferred to a fresh adherent cell monolayer at 80% of maximum confluency in 12-well plates, each agarose core into a separate well. Virus diffuses out of the agarose core, infects the cells in the well, and virus obtained by this procedure is considered purified as it is (in theory) derived from a single initial plaque. However, some viruses tend to aggregate, a problem also encountered with poxviruses, so that a particular host culture may become infected with a mixture of viruses. As shown in FIG. 4, isolate #9 of this preparation removed by 17 generations from MVA-A2 (hence termed MVA-CR17*, with an asterisk to denote plaque purification as additional manipulation) is considered pure and was chosen for further plaque purification. The second round gave the desired A34R genotypes. Isolate #1 of this second round was chosen and amplified in chemically defined CR cultures. The A3L, A9L and A34R genes were sequenced directly out of PCR without any subcloning of the fragments and revealed a novel, pure and unique population.

(46) In summary, by repeated isolation of virus derived from a chemically defined process on an immortal cell line, we obtained and further purified a novel vaccinia virus strain, with strain according to microbiological definition meaning “the descendants of a single isolation in pure culture [ . . . ] that can be distinguished from other isolates [ . . . ] by phenotypic and genotypic characteristics” (van Belkum et al. 2007 in Clin Microbiol Infect 13 Suppl 3, 1-46). We called this strain MVA-CR. The first fully purified, tangible member of this strain is MVA-CR19, and distinguishing features are at least one of the mutations selected from the group consisting of C1915T in A3L, A223G in A9L and G256T in A34R genes, all numbers referring to the coding strand.

Example 5: Properties of MVA-CR (Yield)

(47) The yield of a preparation containing MVA-CR is greater by almost 10-fold compared to a population containing the parental strain. This is an extremely important property. Hyperattenuation of the MVA-based vaccines is an important safety feature but comes at the cost of dose requirement: 10^8 infectious units of MVA per vaccination are estimated to be required for efficient stimulation of the immune system (Coulibaly et al. 2005 in Virology 341, 91-101; Gilbert, et al. 2006 in Vaccine 24, 4554-4561) and for global programs against infectious diseases hundreds of million of doses of the highly attenuated poxviruses may be required annually. For comparison, lesser attenuated strains with limited replication potential also produced on avian cells include vaccines against measles, mumps and yellow fever; these require only 10^3 to 5.5×10^4 infectious units per dose (information from the package inserts of YF-VAX® from Sanofi Pasteur and M-M-R®II from Merck). The protective dose of the vaccinia strain Dryvax in routine vaccination against smallpox is 2.5×10^5 infectious units (Rotz et al. 2001 in MMWR Recomm Rep 50, 1-25; quiz CE21-27), 400 fold lower than the dose recommended for MVA-based vaccines. Hence, to reach all intended vaccinees, novel highly efficient and robust production systems for MVA-based vaccines will be required, and novel MVA strains are required to complement the technological advancements.

Example 6: Properties of MVA-CR (Escape from Host Cells)

(48) Another, equally important property pertains to purity of the virus preparation. For any vaccine derived from a continuous cell line, purification of the preparation to deplete host cell derived components is required. With respect to residual DNA, a maximum level of 10 ng per dose (Hess et al. 2012 in Vaccine 30, 2715-2727) is considered acceptable. A considerable portion of conventional MVA is highly cell associated. The novel mutations which we have identified facilitate virus release and dissociation from the host cell. Destabilization of the external membrane of the EEV led to a greater fraction of actual infectious units of the virus (virions corresponding to the IMV) present in the extracellular volume.

(49) For confirmation purposes, a “comet assay” as described previously for the non-attenuated vaccinia viruses (McIntosh and Smith 1996 in J Virol 70, 272-281) was conducted. Such an assay visualizes the ability of a virus to escape the host cell: circular plaques indicate strong cell association, whereas elongated comet-like plaques suggest that progeny viruses dissociate from the host cell to initiate infection at more distant sites. In our experiments, 1×10^6 adherent CR or 1.5×10^6 R05T cells were seeded into a T25 flask. R05T is a cell line obtained by immortalization of primary cells from the Egyptian rousette. This is one of very few mammalian cell lines permissive for MVA (Jordan, et al. 2009 in Virus Res 145, 54-62) and serves as a reference in the here described experiments. After 24 h, 50000 pfu of MVA-A2 or MVA-CR19 were added. The flasks were put into an incubator and kept undisturbed for at least 72 h to ensure that released virus reinfects in the immediate vicinity so that it still can be associated with the primary plaque. The cell monolayer was fixed by addition of 0.2 volumes of 10% formaldehyde in PBS directly to the medium. As shown in FIG. 5, after staining with 0.05% crystal violet (Sigma) in water different plaque morphologies of MVA-A2 and MVA-CR19 are visible even by the unaided eye.

(50) FIG. 6 shows typical plaques at 40× initial magnification in monolayers of CR and R05T cells infected with MVA-A2, MVA-CR11 or MVA-CR19. At this greater magnification, we more clearly observed the greater attenuation of MVA-CR19 on R05T and confirmed presence of the prominent plaques caused by MVA-CR19 in CR cells.

(51) We next examined, whether plaque phenotype in adherent cultures is an indication of greater viral mobility also within chemically defined infected cell cultures. We, therefore, infected CR.pIX suspension cultures with isolates MVA-A2 and MVA-CR19 as described in example 1 but this time centrifuged samples for 5 min at 200×g to obtain a cell-free supernatant (abbreviated “SN”). The cell pellet was discarded and virus in the SN was subjected to three freeze/thaw cycles (−85° C./37° C.) to rupture the outer membrane of the EEV for increased infectivity.

(52) Furthermore, we tested virus replication also in a monophasic process only in CD-U3 cell proliferation medium without addition of CD-VP4 virus production medium. We have shown previously that a biphasic process where CD-VP4 is added at the time of infection increases yields of hyperattenuated poxviruses significantly (Jordan, et al. 2011 in Biologicals 39, 50-58). For this reason it was highly surprising that a comparison of replication kinetics as shown in FIG. 7A indicates that isolate MVA-CR19 replicates just as efficiently in the monophasic process as in the biphasic environment (gray curves). For MVA-A2, the expected at least 10-fold differences were confirmed (black curves, open symbols for the monophasic process).

(53) Thus, we have obtained gain-of-function mutations that facilitate release of MVA from the host cell. This is confirmed in the data shown in FIG. 7 also when we compare infectious units in the supernatant (SN) and in the complete lysate. For the chart in panel B, 48 h post infection virus was assayed not only from SN but also from a sonicated lysate of the complete cell suspension. A greater percentage of infectious MVA-CR19 virus is in the cell-free compartment (74.0% in the monophasic process, 37.5% in the biphasic process) compared to MVA-A2 (3.6% and 4.9%, respectively).

(54) The fact that more MVA-CR19 virus is trapped in host cells in presence of virus production medium is consistent with our intention of inducing cell aggregates to facilitate cell-to-cell spread of virus. This observation is also confirmed in adherent cultures shown in FIG. 8, where the release of MVA-CR19 compared to MVA-A2 is facilitated in all of the tested cultures, albeit with far less pronounced differences. As discussed earlier, the outer membrane of the EEV interferes with infectivity of MVA and one reason for increased extracellular infectivity of MVA-CR is due to the decreased stability of this component. Without agitation and in presence of virion-stabilizing fetal calf serum, this outer membrane of MVA-CR19 is retained for greater time intervals, levelling this potential advantage of MVA-CR19. Furthermore, concentrations of divalent cations are elevated in media designed for adherent cultures as these are known to promote cell adherence (Attramadal 1969 in J Periodontal Res 4, 166). Increased concentration of Mg2+ and Ca2+ probably also strengthens the association of virus envelopes to plasma membranes, again levelling any advantages that we observed for MVA-CR in chemically defined suspension cultures.

(55) Thus, MVA-CR19 has gained an increased ability to escape the host cell. Completely unexpected and surprising, however, is the clear tendency that with increasing purity of the MVA-CR strain (that we have obtained with isolate MVA-CR19) attenuation in the R05T cell line appears to increase, manifested by small and fully confined foci in this cell line. The properties are extremely valuable: the novel MVA-CR strain remains highly attenuated and at the same time escapes more easily from the producer cell. An increase of the fraction of extracellular virus facilitates purification tremendously as cell-free supernatants instead of whole-cell lysates can be used as harvest bulk. Furthermore, true monophasic production processes are possible: MVA-CR can be produced to high titers in the same culture medium that is also used for cell proliferation. Except for addition of small volumes (less than 5 to 20% of the culture volume) of feed to provide glucose and other nutrients, or to regulate pH, no virus production medium is required anymore.

Example 7: Properties of MVA-CR (Specificity for the Chemically Defined Process)

(56) To further characterize the selective pressures driving emergence of strain MVA-CR, we also isolated successive generations of MVA from adherent CR and R05T cell lines in an experiment that mirrors the initial experiment described in Example 1. The adherent CR cell line has been used to examine whether emergence of MVA-CR is also influenced by host cell characteristics in addition to culturing conditions. R05T as a mammalian, yet MVA-permissive cell line, serves as a reference, again testing specificity of the selection and stability of parental MVA.

(57) For this experiment, 1.5×10^6 CR.pIX and 1×10^6 R05T cells were seeded into T25 flasks for each generation. Infection was performed to an estimated MOI of 0.1. The actual input virus as determined by titration at later stages is shown in FIG. 9A. For the sequential virus generations, CR cultures with full cytopathic effect were recovered 48 h to 72 h post infection and R05T cultures between 72 h to 96 h. Virus was released from the lysate by sonication as described in example 1.

(58) FIG. 9B depicts amplification of virus via ratio of input virus to released progeny virus for each generation obtained from suspension CR, adherent CR or adherent R05T cultures, respectively. Data for calculation of amplification in suspension is obtained from the first experiment described in example 1. Linear regression lines of the three experiments indicates that efficiency of virus replication increases with generation number suggesting some adaptation of MVA in all three systems. The effect appears to be greatest in the mammalian R05T cells, which are also farthest removed from the cognate chicken host of MVA.

(59) However, truly surprising and an extremely strong confirmation of this study is the fact that although MVA is adapted to the serum-dependent cultures, the G256T genotype in A34R does not emerge and accumulate in any of these two systems. This is conclusively shown in panel C of FIG. 9, with the same method established in example 3.

(60) The observations shown in FIG. 9C have been confirmed by sequencing of the A3L, A9L and A34R genes. As shown in FIG. 10, there are no indications at all that the novel MVA-CR genotype emerges or accumulates in the viruses passaged on adherent cell lines derived from duck or fruit bat.

(61) Sequential increase of amplification rate is greatest for R05T-derived MVA. Furthermore, in determination of infectious units, we observed that MVA-R strain, for example MVA-R18 isolate shown in FIG. 11, produces a stronger signal and often foci involving more than one cell compared to MVA-B20 that was isolated in parallel (replication of MVA is faster in CR cells resulting in a lead of 2 generations at the end of the 12-weeks experiment). Foci involving several cells and stronger staining leads to the conclusion that replication is limited in the usually non-permissive Vero indicator cell line. MVA-R strain, as opposed to all of the CR-derived strains examined here (MVA-B, MVA-X, MVA-Y and MVA-CR proper) appears to be less attenuated in a mammalian system. Such a virus may have desirable properties other than strain MVA-CR: it may be more immunogenic due to limited replication at the site of infection and it may be extremely suitable as backbone for vectored vaccines in animals (especially chiropterans that are difficult to reach for rabies vaccination).

(62) In summary, replication of MVA in a chemically defined suspension culture is the main driving force for emergence of MVA-CR. Usually, interactions of parasite (virus) and host shape a selective environment. However, here the artificial chemically-defined medium, the suspension culture, or the combination of both (which best meets the requirement for industrial production of a vaccine) clearly is the main driving force in the transformation of the initial wildtype MVA genotype towards MVA-CR.

Example 8: Properties of MVA-CR: Attenuation

(63) Attenuation describes any loss of replication potential of a virus population compared to the parental population. Compared to vaccinia virus, MVA has lost the potential to replicate in most mammalian cells, especially in primate (including human) cells. This property is an important feature that allows application of MVA as vaccine vector also in immunocompromized human recipients.

(64) To test whether attenuation of MVA-CR has been maintained, we infected adherent monolayers of CR, Vero and R05T cell lines with MVA-A2, MVA-CR11 and MVA-CR19. Cells were seeded with 5×10^5 (CR), 2×10^5 (R05T), and 1×10^5 (R06E and Vero), respectively, per well of a 6-well plate and MVA was added to an MOI of 0.1. Cell lysate was prepared by freezing the plates and sonicating a thawed lysate thereof at the indicated time points. All samples were stored at −85° C. and at the end of the experiment titered together in a microfocus assay on Vero cells as described above. The replication data in FIG. 12 confirms that strain MVA-CR is fully attenuated and does not replicate in Vero, replicates very slowly in R06E (also a cell line from the Egyptian rousette), moderately in R05T and with very high productivities CR cultures. A similar replication phenotype has been confirmed previously for MVA-A2 (Jordan et al. 2012 in Viruses 4, 889-900).