Plant resistance gene
09732354 · 2017-08-15
Assignee
Inventors
Cpc classification
International classification
C12N15/82
CHEMISTRY; METALLURGY
Abstract
The invention relates to a new gene that is able to provide plants with resistance against pathogens, more preferably Verticillium, Ralstonia or Fusarium. Said gene is typical for Brassicaceae and encodes for a proteins having a sequence as depicted in FIG. 7 or FIG. 2A. Also provided are methods for enhancing the pathogen resistance of plants, wherein said plants preferably are Brassicaceae, but wherein the resistance also is functional in other plants. Further provided are host cells with a nucleotide construct encoding said protein.
Claims
1. A method for providing at least partial resistance or increasing resistance in a plant against pathogen infection, the method comprising providing a plant or a part thereof transformed with a nucleic acid encoding the amino acid sequence EVR1 of SEQ ID NO: 2 or a functional homologue thereof having at least 90% identity to SEQ ID NO: 2, resulting in increased expression of SEQ ID NO: 2, or the functional homologue thereof, over endogenous levels.
2. The method according to claim 1, wherein said pathogen infection comprises Verticillium, Fusarium and/or Ralstonia infection.
3. The method according to claim 1, wherein the functional homologue is an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NOS: 3, 4, 5, or 6.
4. The method according to claim 1, wherein the nucleic acid sequence is selected from the group consisting of SEQ ID NOS: 1, 3, 4, 5, and 6.
5. A method for breeding a pathogen resistant plant, comprising: a. providing a first plant transformed with a nucleic acid sequence encoding the amino acid sequence EVR1 of SEQ ID NO: 2 or a functional homologue thereof having at least 90% identity to SEQ ID NO: 2, wherein said step optionally comprises adapting the ploidy level of gametes of said transformed plant; b. crossing said first plant with a second plant; and c. selecting the offspring of said cross for the presence of said nucleic acid sequence.
6. The method of claim 1 further comprising the step of selecting a plant or progeny thereof for its resistance to a pathogen infection.
7. The method of claim 1 where the plant is from the Brassicaceae or Solanaceae family.
8. The method of claim 6 further comprising the step of testing at least part of said plant or progeny thereof for the presence of said nucleic acid sequence.
Description
LEGENDS TO THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10) Typical symptoms of V. dahliae on the wild-type (WT), AtEVR1 (EVR1-a, b, c) (A) and BoEVR1 (BoEVR1-a, b, c (B) over-expressing N. benthamiana plants. Pictures were made at 10 dpi and the upper and lower rows indicate mock- and V. dahliae-inoculated plants, respectively. C) Percentage of plants (n=20) that showed clear Verticillium symptoms at 10 dpi.
(11)
(12)
(13)
(14)
(15)
(16)
(17)
DETAILED DESCRIPTION
(18) In the following description and examples a number of terms are used. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given such terms, the following definitions are provided. Unless otherwise defined herein, all technical and scientific terms used have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
(19) As used herein, the term “plant or part thereof” means any complete or partial plant, single cells and cell tissues such as plant cells that are intact in plants, cell clumps and tissue cultures from which plants can be regenerated. Examples of plant parts include, but are not limited to, single cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems shoots, tubers, including potato tubers for consumption or ‘seed tubers’ for cultivation or clonal propagation, and seeds; as well as pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, scions, rootstocks, seeds, protoplasts, calli, and the like.
(20) As used herein, the term “population” means a genetically heterogeneous collection of plants sharing a common genetic derivation.
(21) As used herein, the term “variety” is as defined in the UPOV treaty and refers to any plant grouping within a single botanical taxon of the lowest known rank, which grouping can be: (a) defined by the expression of the characteristics that results from a given genotype or combination of genotypes, (b) distinguished from any other plant grouping by the expression of at least one of the said characteristics, and (c) considered as a unit with regard to its suitability for being propagated unchanged.
(22) The term “cultivar” (for cultivated variety) as used herein is defined as a variety that is not normally found in nature but that has been cultivated by humans, i.e. having a biological status other than a “wild” status, which “wild” status indicates the original non-cultivated, or natural state of a plant or accession. The term “cultivar” further includes, but is not limited to, semi-natural, semi-wild, weedy, traditional cultivar, landrace, breeding material, research material, breeder's lines, synthetic population, hybrid, founder stock/base population, inbred line (parent of hybrid cultivar), segregating population, mutant/genetic stock, and advanced/improved cultivar.
(23) As used herein, “crossing” means the fertilization of female plants (or gametes) by male plants (or gametes). The term “gamete” refers to the haploid or diploid reproductive cell (egg or sperm) produced in plants by meiosis, or by first or second restitution, or double reduction from a gametophyte and involved in sexual reproduction, during which two gametes of opposite sex fuse to form a diploid or polyploid zygote. The term generally includes reference to pollen (including the sperm cell) and an ovule (including the ovum). “Crossing” therefore generally refers to the fertilization of ovules of one individual with pollen from another individual, whereas “selfing” refers to the fertilization of ovules of an individual with pollen from genetically the same individual.
(24) The term “backcrossing” as used herein means the process wherein the plant resulting from a cross between two parental lines is crossed with one of its parental lines, wherein the parental line used in the backcross is referred to as the recurrent parent. Repeated backcrossing results in the genome becoming more and more similar to the recurrent parent, as far as this can be achieved given the level of homo- or heterozygosity of said parent.
(25) As used herein, “selfing” is defined as refers to the process of self-fertilization wherein an individual is pollinated or fertilized with its own pollen.
(26) The term “marker” as used herein means any indicator that is used in methods for inferring differences in characteristics of genomic sequences. Examples of such indicators are restriction fragment length polymorphism (RFLP) markers, amplified fragment length polymorphism (AFLP) markers, single nucleotide polymorphisms (SNPs), insertion mutations, microsatellite markers (SSRs), sequence-characterized amplified regions (SCARs), cleaved amplified polymorphic sequence (CAPS) markers or isozyme markers or combinations of the markers described herein which defines a specific genetic and chromosomal location.
(27) As used herein, “locus” is defined as the genetic or physical position that a given gene occupies on a chromosome of a plant.
(28) The term “allele(s)” as used herein means any of one or more alternative forms of a gene, all of which alleles relate to the presence or absence of a particular phenotypic trait or characteristic in a plant. In a diploid cell or organism, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes. It is in some instance more accurate to refer to “haplotypes” (i.e. an allele of a chromosomal segment) in stead of “allele”, however, in these instances, the term “allele” should be understood to comprise the term “haplotype”.
(29) The term “heterozygous” as used herein, and confined to diploids, means a genetic condition existing when different alleles reside at corresponding loci on homologous chromosomes.
(30) As used herein, and confined to diploids, “homozygous” is defined as a genetic condition existing when identical alleles reside at corresponding loci on homologous chromosomes.
(31) As used herein, and confined to multiploids, the term “nulliplex”, “simplex”, “duplex”, “triplex”, “quadruplex” and up to “multiplex”, is defined as a genetic condition existing when a specific allele at a corresponding locus on corresponding homologous chromosomes is present 0, 1, 2, 3, 4 or n times, wherein n is the number of chromosomes, respectively. At the tetraploid level the phenotypic effect associated with a recessive allele is only observed when the allele is present in quadruplex condition, whereas the phenotypic effect associated with a dominant allele is already observed when the allele is present in a simplex or higher condition.
(32) The terms “haploid”, “diploid”, “tetraploid” and “multiploid” as used herein are defined as having respectively one, two, four or a not further determined multiple pairs of each chromosome in each cell (excluding reproductive cells).
(33) The term “haplotype” as used herein means a combination of alleles at multiple loci that are transmitted together on the same chromosome. This includes haplotypes referring to as few as two loci, and haplotypes referring to an entire chromosome depending on the number of recombination events that have occurred between a given set of loci.
(34) As used herein, the term “infer” or “inferring”, when used in reference to assessing the presence of the fungal resistance as related to the expression of the EVR1 gene, means drawing a conclusion about the presence of said gene in a plant or part thereof using a process of analyzing individually or in combination nucleotide occurrence(s) of said gene in a nucleic acid sample of the plant or part thereof. As disclosed herein, the nucleotide occurrence(s) can be further identified directly by examining the qualitative differences or quantitative differences in expression levels of nucleic acid molecules, or indirectly by examining (the expression level of) a the EVR1 protein.
(35) The term “primer” as used herein refers to an oligonucleotide which is capable of annealing to the amplification target allowing a DNA polymerase to attach thereby serving as a point of initiation of DNA synthesis when placed under conditions in which synthesis of primer extension product which is complementary to a nucleic acid strand is induced, i.e., in the presence of nucleotides and an agent for polymerization such as DNA polymerase and at a suitable temperature and pH. The (amplification) primer is preferably single stranded for maximum efficiency in amplification. Preferably, the primer is an oligodeoxyribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the agent for polymerization. The exact lengths of the primers will depend on many factors, including temperature and source of primer. A “pair of bi-directional primers” as used herein refers to one forward and one reverse primer as commonly used in the art of DNA amplification such as in PCR amplification.
(36) As used herein, the term “probe” means a single-stranded oligonucleotide sequence that will recognize and form a hydrogen-bonded duplex with a complementary sequence in a target nucleic acid sequence analyte or its cDNA derivative.
(37) The terms “stringency” or “stringent hybridization conditions” refer to hybridization conditions that affect the stability of hybrids, e.g., temperature, salt concentration, pH, formamide concentration and the like. These conditions are empirically optimised to maximize specific binding and minimize non-specific binding of primer or probe to its target nucleic acid sequence. The terms as used include reference to conditions under which a probe or primer will hybridise to its target sequence, to a detectably greater degree than other sequences (e.g. at least 2-fold over background). Stringent conditions are sequence dependent and will be different in different circumstances. Longer sequences hybridise specifically at higher temperatures. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridises to a perfectly matched probe or primer.
(38) Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M Na+ ion, typically about 0.01 to 1.0 M Na+ ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes or primers (e.g. 10 to 50 nucleotides) and at least about 60° C. for long probes or primers (e.g. greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringent conditions or “conditions of reduced stringency” include hybridization with a buffer solution of 30% formamide, 1 M NaCl, 1% SDS at 37° C. and a wash in 2×SSC at 40° C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1×SSC at 60° C. Hybridization procedures are well known in the art and are described in e.g. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., Struhl, K. eds. (1998) Current protocols in molecular biology. V. B. Chanda, series ed. New York: John Wiley & Sons.
(39) The present invention describes the cloning of the EVR1 gene that has been found with transposon-based activation tagging. Four activation-tagged Arabidopsis mutants that displayed resistance to Verticillium wilt disease, and especially one of these that also displayed resistance to the bacterial vascular wilt pathogen Ralstonia solanacearum were used to determine the genetic cause of this resistance. Further, several EVR1-genes from closely related Brassicaceae species were inspected and appeared to be highly homologous to the tagged gene.
(40) In a first embodiment, the invention provides an isolated or recombinant nucleic acid sequence comprising a nucleic acid sequence encoding the amino acid sequence EVR1 as presented in
(41) The term “nucleic acid” means a single or double stranded DNA or RNA molecule.
(42) Also included are the complementary sequences of the herein described nucleotide sequences.
(43) The term “functional fragment thereof” is typically used to refer to a fragment of the EVR1 protein that is capable of providing at least partial resistance or increasing resistance in a plant against a fungal or bacterial infection.
(44) The term “functional homologue” is typically used to refer to a protein sequence that is highly homologous to or has a high identity with the herein described EVR1 protein, which protein is capable of providing at least partial resistance or increasing resistance in a plant against a fungal or bacterial infection, preferably an infection caused by Verticillium, Fusarium or Ralstonia. Included are artificial changes or amino acid residue substitutions that at least partly maintain the effect of the EVR1 protein. For example, certain amino acid residues can conventionally be replaced by others of comparable nature, e.g. a basic residue by another basic residue, an acidic residue by another acidic residue, a hydrophobic residue by another hydrophobic residue, and so on. Examples of hydrophobic amino acids are valine, leucine and isoleucine. Phenylalanine, tyrosine and tryptophan are examples of amino acids with an aromatic side chain and cysteine as well as methionine are examples of amino acids with sulphur-containing side chains. Serine and threonine contain aliphatic hydroxyl groups and are considered to be hydrophilic. Aspartic acid and glutamic acid are examples of amino acids with an acidic side chain. In short, the term “functional homologue thereof” includes variants of the EVR1 protein in which amino acids have been inserted, replaced or deleted and which at least partly maintain the effect of the EVR1 protein (i.e. at least partly providing or increasing resistance in a plant against a fungal or bacterial infection). Preferred variants are variants which only contain conventional amino acid replacements as described above. A high identity in the definition as mentioned above means an identity of at least 80, 85 or 90%. Even more preferred are amino acids that have an identity of 91, 92, 93, 94 or 95%. Most preferred are amino acids that have an identity of 96, 97, 98 or 99% with the amino acid sequence of EVR1. Homologous proteins are for example the sequences encoded by the nucleic acids other than the Arabidopsis nucleic acid that are shown in
(45) A functional homologous nucleic acid sequence is a nucleic acid sequence that encodes a functional homologous protein as described above. A functional fragment of a nucleotide sequence is defined as a nucleotide sequence that encodes for a functional amino acid sequence as defined above.
(46) Homology and/or identity percentages can for example be determined by using computer programs such as BLAST, ClustalW or ClustalX.
(47) Many nucleic acid sequences code for a protein that is 100% identical to the EVR1 protein as presented in
(48) Fragments as well as homologues of the herein described EVR1 gene and protein can for example be tested for their functionality by using an Agrobacterium tumefaciens transient transformation assay (agro-infiltration) and/or by using a detached leaf assay.
(49) Such an assay can be performed by a functional screen for testing candidate genes using agro-infiltration, whereby 4 week old wild type Arabidopsis thaliana plants are infiltrated with Agrobacterium strains containing the candidate EVR1 homologues. The infiltrated leaves are subsequently challenged one day after infiltration with a Verticillium strain that is virulent on Arabidopsis, for example Verticillium dahliae, in detached leaf assays. This system is equally suitable for testing candidate homologous fragments of EVR1. A person skilled in the art thus can easily determine whether or not an EVR1 homolog or fragment can be considered to be a functional homolog or fragment.
(50) Transient gene expression, as is achieved through agro-infiltration, is a fast, flexible and reproducible approach to high-level expression of useful proteins. In plants, recombinant strains of Agrobacterium tumefaciens can be used for transient expression of genes that have been inserted into the T-DNA region of the bacterial Ti plasmid. A bacterial culture is infiltrated into leaves, and upon T-DNA transfer, there is ectopic expression of the gene of interest in the plant cells. However, the utility of the system is limited because the ectopic RNA expression ceases after 2-3 days. It is shown that post-transcriptional gene silencing (PTGS) is a major cause for this lack of efficiency. A system based on co-expression of a viral-encoded suppressor of gene silencing, the p19 protein of tomato bushy stunt virus (TBSV), prevents the onset of PTGS in the infiltrated tissues and allows high level of transient expression. Expression of a range of proteins was enhanced 50-fold or more in the presence of p19 so that protein purification could be achieved from as little as 100 mg of infiltrated leaf material. Although it is clear that the use of p19 has advantages, an agroinfiltration without p19 can also be used to test the functionality of candidate fragments and functional homologues.
(51) Alternatively, each candidate nucleotide sequence (for example being a fragment or homologue) construct is targeted for transformation to a plant that is susceptible for Verticillium, preferably a Brassicaceae plant, more preferably Arabidopsis, most preferably A. thaliana Col-0 or Ws ecotype. Primary transformants are challenged by inoculation with Verticillium dahliae. Transformants that are resistant to these isolates harbour for example functional fragments or homologues of EVR1.
(52) In yet another embodiment, the invention provides a vector comprising a nucleic acid as provided herein, i.e. a nucleic acid capable of providing at least partial resistance or increasing resistance in a plant, particularly a plant of the Brassicaceae family against a fungal or bacterial infection, more particularly against an infection with Verticillium, Fusarium or Ralstonia. More particularly, the invention provides a vector comprising an isolated, synthetic or recombinant nucleic acid sequence comprising a nucleic acid sequence encoding the amino acid sequence EVR1 of
(53) Examples of a suitable vector are pBeloBACII, pBINplus, pKGW-MG or any commercially available (binary) cloning vector.
(54) As will be outlined below there are multiple ways in which a nucleic acid of the invention can be transferred to a plant. One suitable means of transfer is mediated by Agrobacterium in which the nucleic acid to be transferred is part of a binary vector and hence it is preferred that the above described vector is a binary vector. Also suitable are other transgenic approaches, such as particle bombardment or naked DNA transfer. These alternatives are well known to the skilled person.
(55) Another suitable means is by crossing a plant which contains the gene encoding EVR1 to a plant that does not contain the gene and to identify those progeny of the cross that have inherited the EVR1 gene.
(56) The invention further provides a host cell comprising a nucleic acid as described herein or a vector as described herein. Examples of a preferred host cell are an E. coli cell suitable for BAC clones (e.g. DH10B) or an Agrobacterium (host) cell. In another embodiment, said host cell comprises a plant cell. A preferred plant cell is a cell derived from a member of the Brassicaceae or the Solanaceae family. From such a cell, a transgenic or genetically modified plant (for example a canola, potato or tomato plant) can be obtained by methods known by the skilled person (for example regeneration protocols).
(57) The invention further provides a leaf, tuber, fruit or seed or other plant part or the progeny of a genetically modified plant as described herein, wherein the cells of said plant part of progeny still contain the nucleotide sequence of the invention.
(58) In yet another embodiment, the invention provides a protein encoded by the herein described isolated or recombinant nucleic acid or a functional fragment or a functional homologue thereof. In a preferred embodiment, the invention provides a protein encoded by a nucleic acid sequence as depicted in
(59) The herein described EVR1 protein comprises 70 amino acids and does not reveal any known domains that are connected with pathogen resistance. The presence of an N-terminal signal peptide, an overall net positive charge (+2), and a relatively high number of hydrophobic amino acids (28%) are typical features that are shared with many antimicrobial peptides (AMPs). In plants, six different AMPs families have been described, comprising thionins, defensins, lipid transfer proteins, knottins, heveins, and snakins, of which defensins are the largest group and best characterised (Hancock and Diamond, 2000; Thomma et al., 2002; Wang and Wang, 2004; Brown and Hancock, 2006). In Arabidopsis, 825 small cysteine-rich proteins with typical features of antimicrobial peptides have been predicted (Silverstein et al., 2007). Several lines of evidence indicate that AMPs play role in plant defence against viral, bacterial and fungal pathogens (Hancock and Diamond, 2000; Thomma et al., 2002; Wang and Wang, 2004; Brown and Hancock, 2006; Hancock and Sahl, 2006). AMPs are expressed in plants both constitutively and in response to pathogen attack (Garcia-Olmedo et al., 1998; Thomma et al., 2002). It has been shown that constitutive over-expression of AMPs increases plant defence against bacterial and fungal pathogens.
(60) Vascular wilt symptoms such as wilting, stunting, chlorosis and leaf defoliation are similar to those symptoms caused by drought stress. Indeed, the physical presence of vascular wilt pathogens in the xylem vessels, enzymes secreted by the fungus or plant defence responses may interfere with water transport in the xylem (Cirulli et al., 2010). In potato, it has been shown that Verticillium resistant potato cultivars also show drought stress tolerance (Arbogast et al., 1999). We observed that EVR1 over-expressing plants similarly show drought stress tolerance. Leaf morphology such as size, thickness and shape has direct implication on water loss through transpiration (Khurana et al., 2008; Yang et al., 2011). EVR1 over-expressing plants have a smaller leaf size; have thicker and curly leaves than wild-type plants, which all can contribute to the amount of water loss through transpiration.
(61) As already described, a functional fragment or a functional homologue of EVR1 is a fragment or homologue that is capable of providing at least partial resistance or increasing resistance in a plant against a fungal or bacterial infection, more particularly, an infection of Verticillium, Fusarium or Ralstonia.
(62) Means to test the functionality of a functional fragment or a functional homologue of EVR1 have been provided above.
(63) Based on the herein described nucleic acid sequences, the invention also provides probes and primers (i.e. oligonucleotide sequences complementary to one of the (complementary) DNA strands as described herein). Probes are for example useful in Southern or northern analysis and primers are for example useful in PCR analysis. Primers based on the herein described nucleic acid sequences are very useful to assist plant breeders active in the field of classical breeding and/or breeding by genetic modification of the nucleic acid content of a plant (preferably said plant is a Brassicaceae plant) in selecting a plant that is capable of expressing for example EVR1 or a functional fragment or functional homolog thereof.
(64) Hence, in a further embodiment, the invention provides a binding molecule capable of binding to a nucleic acid encoding EVR1 or a functional fragment or functional homolog thereof as described herein or its complementary nucleic acid. In a preferred embodiment, said binding molecule is a primer or a probe. As mentioned, such a binding molecule is very useful for plant breeders and hence the invention further provides a method for selecting a plant or plant material or progeny thereof for its susceptibility or resistance to fungal or bacterial infection. Preferably, the nucleic acid of a plant to be tested is isolated from said plant and the obtained isolated nucleic acid is brought in contact with one or multiple (preferably different) binding molecule(s). One can for example use a PCR analysis to test plants for the presence of absence of EVR1 in the plant genome. Such a method would be especially preferable in marker-free transformation protocols, such as described in WO 03/010319.
(65) The herein described EVR1 protein can also be used to elicit antibodies by means known to the skilled person. The invention thus also provides an antibody that (specifically) binds to the protein encoded by the herein described isolated or recombinant nucleic acid (for example the nucleic acid sequence of
(66) Based on the herein provided nucleic acid sequences, the invention also provides the means to introduce or increase resistance against a fungal or bacterial infection in a plant, more particularly infection with Verticillium, specifically V. dahliae, V. albo-atrum or V. longisporum, Fusarium, more particularly F. oxysporum, and Ralstonia, more particularly R. solanocearum. The invention therefore also provides a method for providing at least partial resistance or increasing resistance in a plant against a fungal or bacterial infection comprising providing a plant or a part thereof with: an isolated or recombinant nucleic acid sequence comprising a nucleic acid sequence encoding the EVR1 amino acid sequence of
(67) Such a method for providing at least partial resistance or increasing resistance in a plant against a fungal or bacterial infection may be based on classical breeding, departing from a parent plant that already contains the EVR1 gene or a functional homolog thereof, or it involves the transfer of DNA into a plant, i.e., involves a method for transforming a plant cell comprising providing said plant cell with a nucleic acid as described herein or a vector as described herein or a host cell as described herein.
(68) Further, the invention comprises a method of conferring drought resistance to a plant by providing said plant with: an isolated or recombinant nucleic acid sequence comprising a nucleic acid sequence encoding the EVR1 amino acid sequence of
(69) There are multiple ways in which a recombinant nucleic acid can be transferred to a plant cell, for example Agrobacterium mediated transformation. However, besides by Agrobacterium infection, there are other means to effectively deliver DNA to recipient plant cells when one wishes to practice the invention. Suitable methods for delivering DNA to plant cells are believed to include virtually any method by which DNA can be introduced into a cell, such as by direct delivery of DNA such as by PEG-mediated transformation of protoplasts, by desiccation/inhibition-mediated DNA uptake (Potrykus et al., Mol. Gen. Genet., 199:183-188, 1985), by electroporation (U.S. Pat. No. 5,384,253), by agitation with silicon carbide fibers (Kaeppler et al., 1990; U.S. Pat. No. 5,302,523; and U.S. Pat. No. 5,464,765), and by acceleration of DNA coated particles (U.S. Pat. No. 5,550,318; U.S. Pat. No. 5,538,877; and U.S. Pat. No. 5,538,880). Through the application of techniques such as these, cells from virtually any plant species may be stably transformed, and these cells may be developed into transgenic plants.
(70) In case Agrobacterium mediated transfer is used, it is preferred to use a substantially virulent Agrobacterium such as A. tumefaciens, as exemplified by strain A281 or a strain derived thereof or another virulent strain available in the art. These Agrobacterium strains carry a DNA region originating from the virulence region of the Ti plasmid pTiBo542, which coordinates the processing of the T-DNA and its transfer into plant cells. Agrobacterium-based plant transformation is well known in the art (as e.g. described in, for example by Komari, T. et al.: Plant Transformation Technology: Agrobacterium-Mediated Transformation, in: Handbook of Plant Biotechnology, Eds. Christou, P. and Klee, H., John Wiley & Sons, Ltd, Chichester, UK 2004, pp. 233-262). Preferably a marker-free transformation protocol is used, such as described in WO 03/010319.
(71) Alternatively, the nucleic acid of the EVR1 gene or a functional homolog thereof may be introduced into a plant by crossing. Such a crossing scheme starts off with the selection of a suitable parent plant. This may for instance be an original Brassica variety or a plant that has obtained the desired nucleic acid by genetic engineering as described above.
(72) Any suitable method known in the art for crossing selected plants may be applied in the method according to the invention. This includes both in vivo and in vitro methods. A person skilled in the art will appreciate that in vitro techniques such as protoplast fusion or embryo rescue may be applied when deemed suitable.
(73) Selected plants that are used for crossing purposes in the methods according to the invention may have any type of ploidy. However, only plants with the same ploidy level can be crossed. Methods for increasing the ploidy of a plant are well known in the art and can be readily applied by a person skilled in the art. For example, ploidy of a diploid plant for crossing purposes can be increased by using 2N gametes of said diploid plant. Ploidy can also be increased by inhibiting chromosome segregation during meiosis, for example by treating a diploid plant with colchicine. By applying such methods on a diploid plant, embryos or gametes are obtained that comprise double the usual number of chromosomes. Such embryos or gametes can then be used for crossing purposes. In the same way also hexaploid and octaploid plants can be made. For potatoes a resistant tetraploid plant is preferred, since tetraploid plants are known to have higher yields of tubers.
(74) Since the resistance characteristic has appeared to be a dominant trait, it is sufficient if only one allele with the functional gene is present.
(75) Preferably, selected plants are crossed with each other using classical in vivo crossing methods that comprise one or more crossing steps including selfing. By applying such classical crossing steps characteristics of both the parents can be combined in the progeny. For example, a plant that provides a high yield can be crossed with a plant that contains large amounts of a certain nutrient. Such a crossing would provide progeny comprising both characteristics, i.e. plants that not only comprise large amounts of the nutrient but also provide high yields.
(76) When applying backcrossing, F1 progeny is crossed with one of its high-yielding parents P to ensure that the characteristics of the F2 progeny resemble those of the high-yielding parent. Selected plants, either parent or progeny, are then crossed with themselves to produce inbred varieties for breeding. For example, selected specimens from the above mentioned F1 progeny are crossed with themselves to provide an F2 progeny from which specimens can be selected that have an increased level of resistance.
(77) After transfer of a nucleic acid into a plant or plant cell, it must be determined which plants or plant cells have been provided with said nucleic acid. When selecting and crossing a parental genotype in a method according to the invention, a marker is used to assist selection in at least one selection step. It is known in the art that markers, indicative for a certain trait or condition, can be found in vivo and in vitro at different biological levels. For example, markers can be found at peptide level or at gene level. At gene level, a marker can be detected at RNA level or DNA level. Preferably, in the present invention the presence of such a marker is detected at DNA level, using the above described primers and/or probes. Alternatively, proper expression of the EVR1 protein or a functional homolog thereof can be assessed in plant parts by performing an immunoassay with an antibody that specifically binds the protein. Next to the primers and probes according to the invention, use can also be made of specific markers that are to be found in the vicinity of the coding sequence.
(78) In case of transgenic approaches selecting a transformed plant may be accomplished by using a selectable marker or a reporter gene. Among the selective markers or selection genes that are most widely used in plant transformation are the bacterial neomycin phosphotransferase genes (nptI, nptII and nptIII genes) conferring resistance to the selective agent kanamycin, suggested in EP131623 and the bacterial aphIV gene suggested in EP186425 conferring resistance to hygromycin. EP 275957 discloses the use of an acetyl transferase gene from Streptomyces viridochromogenes that confers resistance to the herbicide phosphinotricin. Plant genes conferring relative resistance to the herbicide glyphosate are suggested in EP218571. Suitable examples of reporter genes are beta-glucuronidase (GUS), beta-galactosidase, luciferase and green fluorescent protein (GFP).
(79) In a preferred embodiment, the invention provides a method for providing at least partial resistance or increasing resistance in a plant against infection with Verticillium, Fusarium and/or Ralstonia, more particularly. V. dahliae, F. oxysporum and/or R. solanacearum, comprising providing a plant or a part thereof with:
(80) an isolated or recombinant nucleic acid sequence comprising a nucleic acid sequence encoding the EVR1 amino acid sequence of
(81) an isolated or recombinant nucleic acid sequence as depicted in
(82) a vector comprising the herein described nucleic acid sequences, or
(83) a host cell as described herein,
(84) preferably wherein said plant comprises a plant from the Brassicaceae or Solanaceae family, preferably a Brassica, potato or tomato plant.
(85) The invention also provides a plant that is obtainable by using a method for providing at least partial resistance or increasing resistance in a plant against infection with Verticillium, Fusarium and/or Ralstonia.
(86) A preferred plant is a plant from the Brassicaceae or Solanaceae family. Many plants that are regularly cultured as crops fall within these families, such as rapeseed, canola, mustard, cauliflower, broccoli, cabbage, Brussels sprouts, rucola, cress, (horse)radish, potato, tomato, tomatillo, tobacco, bell pepper, chilli pepper, antroewa, eggplant, etc. The invention thus also provides a plant that has been provided with a nucleic acid encoding en EVR1 protein or a functional fragment or a functional homologue thereof.
(87) The invention further provides a plant part or progeny of a plant according to the invention comprising a nucleic acid encoding the EVR1 amino acid sequence of
(88) The invention further provides use of an isolated or recombinant nucleic acid sequence comprising a nucleic acid sequence encoding the EVR1 amino acid sequence of
(89) In yet another embodiment, the invention provides a method for producing EVR1 protein or a functional fragment or a functional homologue thereof comprising functionally linking a nucleic acid as described herein to a regulatory sequence and allowing said nucleic acid to be expressed in a host cell. Examples of a regulatory sequence are a promoter and/or terminator sequence. Further, it is preferred that the EVR1 sequence is expressed under control of its own promoter and terminator. The skilled person is very well capable of cloning (part of) said regulatory sequences and testing their efficiency in transcription. It is further submitted that preferably a truncated promoter, i.e. a promoter containing less than 1000, preferably not more than 900 base pairs upstream of the gene sequence, is used.
(90) Alternatively, the gene encoding the EVR1 protein is placed under the control of a pathogen-inducible promoter. Pathogen-inducible promoters are known in the art and are responsive to a large number of pathogens and to aspecific elicitors produced by these pathogens. Examples of such pathogen inducible promoters are: the prp1 promoter (Martini, N., et al., Mol. Gen. Genet. 236, 179-186, 1993), the Fis1 promoter (WO 96/34949), the Bet v 1 promoter (Swoboda, I., et al., Plant, Cell and Env. 18, 865-874, 1995), the Vst1 promoter (Fischer, R., Dissertation, Univ. of Hohenheim, 1994; Schubert, R., et al. Plant Mol. Biol. 34, 417-426, 1997), the sesquiterpene cyclase promoter (Yin, S., et al., Plant Physiol. 115, 437-451, 1997), the MS-59 promoter (WO 99/50428), the ICS promoter from Catharantus roseus (WO 99/50423), the #488 promoter from Arabidopsis thaliana (WO 00/60086) and the gstA1 promoter (Mauch, F. and Dudler, R., Plant Physiol. 102, 1193-1201, 1993). Several other promoters are known in the art and can be used to drive expression of the nucleotide sequences of this invention.
(91) The invention will be explained in more detail in the following, non-limiting examples.
EXAMPLES
(92) Cultivation of Plants and Microorganisms.
(93) Arabidopsis thaliana plants were soil-grown in either the greenhouse or a growth chamber. In the greenhouse, the conditions were 21 and 19° C. during the 16-h day and 8-h night period, respectively; 70% relative humidity (RH); and 100 W/m.sup.2 supplemental light when the intensity dropped below 150 W/m.sup.2. In the climate chamber, the conditions were 21 and 19° C. during the 14-h day and 10-h night period, respectively; 70% RH; and a light intensity of 150 W/m2.
(94) Verticillium spp. and Alternaria brassicicola were cultivated on potato dextrose agar, B. cinerea and P. cucumerina on malt extract agar, and F. oxysporum f. sp. raphani on Czapek-Dox agar, all at room temperature. Pseudomonas syringae pv. Tomato DC3000 and R. solanacearum strains were cultivated as described (Deslandes et al. 1998; van Esse et al. 2008).
(95) Plant Inoculations
(96) Verticillium inoculations were performed as previously described (Ellendorff et al. 2009; van Esse et al. 2008) with the modification that roots were dipped in the conidial suspension for 5 min. F. oxysporum f. sp. raphani budcell inoculum was prepared as described (Diener and Ausubel 2005), and inoculation was performed as with Verticillium spp. Inoculations with B. cinerea, Plectosphaerella cucumerina (both at 106 conidia/ml), and Pseudomonas syringae p. v. tomato DC3000 were performed as previously described (van Esse et al. 2008). A. brassicicola was inoculated as with Plectosphaerella cucumerina. At 3 and 5 dpi, pictures were taken of all inoculated plants and lesion diameters were measured using ImageJ software. Inoculation with R. solanacearum was performed as described (Deslandes et al. 1998).
(97) Determination of the Activation-Tag Insertion Site
(98) The activation-tag insertion site in mutant A2 (the mutant Arabidopsis plant as identified and defined in Yadeta et al. 2011) was determined using thermal asymmetric interlaced PCR (TAIL-PCR) (Liu and Whittier, 1995). The PCR was performed with a combination of nested primers (Marsch-Martinez et al., 2002) and 10-mer random primers (Terauchi and Kahl, 2000). The secondary and tertiary TAIL-PCRs were separated on 1.2% agarose gel, stained with ethidium bromide, and visualized using the ChemiDoc XRS system (Bio-Rad). Specific product, judged based on the size differences generated by the nested primers, was excised, cleaned using the QIAquick Gel Extraction Kit (QIAGEN), cloned into the pGEM-T Easy Vector (Invitrogen), and sequenced. Blastn search of the TAIR database using the PCR sequences was performed to identify the genomic insertion site. Based on the putative insertion site, the primer pair MPR15F and MPR15R were designed and used to amplify the flanking genomic region. By sequencing this region in the wild-type and the mutant A2, the exact insertion site was determined.
(99) EVR1 Over-Expression
(100) The EVR1 CDS was amplified with the primer pair dMRP15-F1 and dMRP15-R1 that contain BamHI and AscI restriction sites, respectively, using Pfu DNA polymerase (Promega). The amplicon was cloned into the BamHI- and AscI-pre-digested binary vector pmk40, a variant of the vector pmog800 (Honée et al., 1998; Fradin et al., 2009). The resulting P35S:EVR1 vector construct was transformed into A. tumefaciens strain GV3101 and eventually in to Ws and Col-0 Arabidopsis ecotypes using the floral dip technique (Clough and Bent, 1998).
(101) Cloning of EVR1 Homologs
(102) Primer pair EVR1H-BrF0 and EVR1H-BrR1 was used to amplify BoEVR1 from genomic DNA (gDNA) of Brassica oleracea (Brussels sprout). The PCR product was excised from the gel, cleaned (GE Healthcare) and cloned into the pGMET-easy vector (Promega) and sequenced. Based on the sequence alignment of the PCR sequence and the B. rapa sequence in the database, primer EVR1H-BrR3 was designed and used in combination with EVR1H-BrF0 to amplify the predicted full length CDS of BoEVR1 from B. oleracea cDNA. As a control, the same primer combination was used to amplify BoEVR1 from gDNA. The PCR fragments were sequenced to confirm the full length CDS. To generate an BoEVR1 over-expression construct, the full length CDS of BoEVR1 was amplified from cDNA using primer pair EVR1H-BaF1 and EVR1H-AsR1 containing BamHI and AscI custom restriction sites, respectively, and cloned into BamHI and AscI pre-digested binary vector pB7K40 (Yadeta et al., 2011). Subsequently, the binary vector construct was transformed into A. tumefaciens (strain GV3101) and eventually into Arabidopsis ecotypes Ws and Col-0.
(103) Expression of EVR1 Homologs in N. benthamiana
(104) In order to test whether expression of AtEVR1 and BoEVR1 results in Verticillium wilt resistance in non-Brassicaceae plants as well, the binary vectors containing AtEVR1 or BoEVR1 were transformed into N. benthamiana, a Solanaceae family member, following a standard N. benthamiana transformation protocol (Wang, 2006).
(105) Pathogen Quantification in Planta
(106) Real-time PCR was used for quantification of pathogen colonization in planta using an ABI7300 PCR machine (Applied Biosystems) in combination with the qPCR Core kit for SYBR Green I (Eurogentec, Maastricht, The Netherlands) and analyzed using the 7300 System SDS software (Applied Biosystems). Unless described otherwise, the primer pair AtRub-F4 and AtRub-R4 targeting the gene encoding the large subunit of RuBisCo was used as endogenous control. Verticillium colonization was assessed as previously described (Ellendorff et al., 2009; Yadeta et al., 2011).
(107) Expression Analysis
(108) Both reverse transcription PCR and real-time PCR were used to analyze gene expression. Unless described otherwise, the primer pair Act2-F2 and Act2-R2 targeting the Arabidopsis Actin 2 gene was used as endogenous control. A list of primers used in this study and their targets is presented in Table S1. The real-time PCR conditions consisted of 2 min incubation at 50° C. and 10 min at 95° C. followed by 40 cycles of 95° C. for 15 sec. and 60° C. for 1 min.
(109) TABLE-US-00001 TABLE 1 Analysis of the genes flanking the activation-tag insertion site in mutant A2 Verticillium Gene Annotation Knock-out allele Expression.sup.1 phenotype.sup.2 At3g13405/03 MicroRNA SALK_113174C Not tested Similar At3g13410 Unknown protein None available Similar Similar At3g13420 Zinc finger family SALK_041147C Similar Similar At3g13430 Zinc finger family SALK_135697 Similar Similar At3g13432 Unknown protein None available Similar Similar At3g13435 Unknown protein SALK_091102 Induced in Similar A2 mutant At3g13437 Unknown protein SALK_139498C Induced in Enhanced A2 mutant susceptibility At3g13440 Methyltransferase/nucleic SALK_020621 Similar Similar acid binding protein At3g13445 TATA binding protein SALK_084279C Induced in Similar A2 mutant At3g13450 Alpha-keto acid SALK_042796C Similar Similar dehydrogenase E1 At3g13460 ECT2 like (Physically SALK_002225C Similar Similar interacts with CIPK1) .sup.1Gene expression in mutant A2 relative to the expression in wild-type. .sup.2Phenotype of knock-out alleles upon V. dahliae inoculation when compared to wild-type plants.
(110) Supplementary Data
(111) TABLE-US-00002 TABLE S1 Primers used in this study Primer code sequence (5′ to 3′) purpose MPR15F ACCTTGTCTTTTGTATTCACTG Confirmation of activation tag (SEQ ID 7) insertion site MPR15R AAGTTTGGAACGAGGCAG Confirmation of activation tag (SEQ ID 8) insertion site MPR15-F1 GGAGTTTTGTACTTTGCGACG Confirmation of activation tag (SEQ ID 9) insertion site MPR15-R1 AGTTTGGAACGAGCAGC Confirmation of activation tag (SEQ ID 10) insertion site dMRP15-2F1 GCATCACATTTTCCAATTCGAC AtEVR1 expression analysis (RT-PCR) (SEQ ID 11) dMRP15-2R1 CATTGCAACAAATCCAGC AtEVR1 expression analysis (RT-PCR) (SEQ ID 12) dMRP15-F1 GGATCCATGAGTCTCAAGTTCATTC AtEVR1 over-expression construct (SEQ ID 13) (BAMHI) dMRP15-R1 GGCGCGCCTTAATCATTGCAACAAATCC AtEVR1 over-expression construct (SEQ ID 14) (AscI) ITS1-F AAAGTTTTAATGGTTCGCTAAGA Verticillium quantification (SEQ ID 15) (Ellendorf et al., 2009) St-Ve1-R CTTGGTCATTTAGAGGAAGTAA Verticillium quantification (SEQ ID 16) (Ellendorf et al., 2009) AtRub-F4 GCAAGTGTTGGGTTCAAAGCTGG Verticillium quantification (SEQ ID 17) (Yadeta et al., 2011) AtRub-R4 AACGGGCTCGATGTGGTAGC Verticillium quantification (SEQ ID 18) (Yadeta et al., 2011) EVR1-F ATGAGTCTCAAGTTCATTCTTATAGC gfp fusion construct (SEQ ID 19) EVR1-R ATCATTGCAACAAATCCAGCC gfp fusion construct (SEQ ID 20) EVR1-F1 GTATCACACCAACTGTAATGAGAACG T-DNA insertion check (SEQ ID 21) EVR1-R1 TTAATCATTGCAACAAATCCAG T-DNA insertion check (SEQ ID 22) EVR1-eF1 CGGTATGAATTCcatcatcatcatcatcatcc AtEVR1 protein expression cgactacaaggacgacgatgacaagACCGTCG (His6-FLAG-AtEVR1-.sup.Sp) TTCCTTTTTCC (SEQ ID 23) EVR1-nR1 CGTCTAGCGGCCGCTTAATCATTGCAACAAAT AtEVR1 protein expression in P. CC pastoris (His6-FLAG-AtEVR1-.sup.Sp) (SEQ ID 24) EVR1-F2 CGGTATGAATTCACCGTCGTTCCTTTTTCC Y2H (SEQ ID 25) EVR1-R2 AGTCTCGTCGACTTAATCATTGCAACAAATCC Y2H (SEQ ID 26) EVR1H-BrF0 ATGAGTCTCAAGTTCATT Cloning BsEVR1 (SEQ ID 27) EVR1H-BrR1 CAGAGCTTCTTTTAATCATTGC Cloning BsEVR1 (SEQ ID 28) EVR1H-BrR3 TTAATCATTGCAGCAATT Cloning BsEVR1 (SEQ ID 29) EVR1H-BaF1 GCAGGATCCATGAGTCTCAAGTTCATT Making BsEVR1 over expression (SEQ ID 30) construct EVR1H-AsR1 ACTGGCGCGCCTTAATCATTGCAGCAATT Making BsEVR1 over expression (SEQ ID 31) construct Act2-F2 TAACTCTCCCGCTATGTATGTCGC Arabidopsis act2 gene (Endogenous (SEQ ID 32) control) Act2-R2 GAGAGAAACCCTCGTAGATTGGC Arabidopsis act2 gene (Endogenous (SEQ ID 33) control) EVR1-FJ ATACTGGATCCATGAGTCTCAAGTTCATTCTT ΔAtEVR1C68C69 (SEQ ID 34) EVR1-CC-R TATATGGCGCGCCTTAATCATTAGCAGCAA ΔAtEVR1C68C69 TCCAGCCTTT (SEQ ID 35) EVR1- TATATGGCGCGCCTTAATCATTGCAACAAAT ΔAtEVR1C68C69 AKG-R CCAAGCAGCTGCAGGAGGCGAACGGCT (SEQ ID 36) EVR1- TATATGGCGCGCCTTAATCATTGCAACAAAT ΔAtEVR1C68C69 SRSP-R CCAGCCTTTTGCAGGAGCAGCAGCAGCGA CTTTTACGGTGAT (SEQ ID 37) EVR1- TATATGGCGCGCCTTAATCATTGCAACAAAT ΔAtEVR1C68C69 VKV-R CCAGCCTTTTGCAGGAGGCGAACGGCTAGC AGCAGCGGTGATCTTCTTTCCTTT (SEQ ID 38) AtEVR1- TGCATCACATTTTCCAATTCGATTGACATTC AtEVR1 truncation OLF ACAAAGGAAAG (SEQ ID 39) AtEVR1- CTTTCCTTTGTGAATGTCAATCGAATTGGAA OLR AATGTGATGCA (SEQ ID 40) AtEVR1- GGCGCGCCTTACTCTCTACCTTCTTCTTC NtR (SEQ ID 41) dMRP15- GAATTGGAAGTTGGTTTTGC Expression analysis 1F1 (SEQ ID 42) dMRP15- AGAAATGATCTTCGGTGG Expression analysis 1R1 (SEQ ID 43) dMRP15- GCATCACATTTTCCAATTCGAC Expression analysis 2F1 (SEQ ID 44) dMRP15- CATTGCAACAAATCCAGC Expression analysis 2R1 (SEQ ID 45) dMRP15- AGAGAGTAATCCAATGGACC Expression analysis 3F1 (SEQ ID 46) dMRP15- GATGTCTCTTTGTCCTGG Expression analysis 3R1 (SEQ ID 47) dMRP15- GATTGGAAGGGAGTAATCC Expression analysis 4F1 (SEQ ID 48) dMRP15- TCTGAATTCCGAGAGCAC Expression analysis 4R1 (SEQ ID 49) uMRP15- GTTCTGTTTGATTGCTTCCC Expression analysis 1F1 (SEQ ID 50) uMRP15- CTGAATTTGGACTTGCGG Expression analysis 1R1 (SEQ ID 51) uMRP15- CATCAGAGACTAGCTACTGG Expression analysis 2F1 (SEQ ID 52) uMRP15- GTTCGAACTTGAGTCTGG Expression analysis 2R1 (SEQ ID 53) uMRP15- GCTTTGTGTTTCGTTACG Expression analysis 3F1 (SEQ ID 54) uMRP15- AAGACCTGTGTTGCATTG Expression analysis 3R1 (SEQ ID 55) uMRP15- GTGTTTCTATCTGTGGCC Expression analysis 4F1 (SEQ ID 56) uMRP15- GAATCTTGAGGAGTCTCG Expression analysis 4R1 (SEQ ID 57)