Method for preventing or treating diseases associated with a reduced density of interferon receptors

Abstract

The invention relates to medicine, in particular, to a method for preventing and/or treating a disease associated with a reduced density of interferon receptors, the method comprising administering an effective amount of glutaryl histamine or a pharmaceutically acceptable salt thereof. Said disease may be hepatitis B, herpes, papilloma virus infection, or multiple sclerosis. The invention also relates to a pharmaceutical composition for prevention and/or treatment of diseases associated with a reduced density of interferon receptors, wherein the composition comprises an effective amount of glutaryl histamine or a pharmaceutically acceptable salt thereof. The invention solves a problem of providing a novel agent effective for overcoming a resistance to interferon therapy in diseases selected from the group including hepatitis B, herpes, papilloma virus infection, or multiple sclerosis.

Claims

1. A method for increasing the density of interferon receptors upon treating a disease associated with a reduced density of interferon receptors, the method comprising administering an effective amount of glutaryl histamine or a pharmaceutically acceptable salt thereof.

2. The method of claim 1, wherein said disease is selected from the group consisting of hepatitis B, herpes, papilloma virus infection, and multiple sclerosis.

3. The method of claim 1, wherein said increase of the density of interferon receptors overcomes a resistance to therapy with interferon and/or compensates for a reduced expression level of interferon receptors in a long-term therapy with interferon.

4. The method of claim 1, wherein said disease is an immunosuppression from tobacco smoking, wherein the immunosuppression is associated with a degradation of interferon receptors in smokers.

5. The method of claim 1, wherein the interferon receptors are interferon α (IFNα) and/or interferon β (IFNβ) receptors.

6. The method of claim 1, wherein glutaryl histamine is administered in a solid dosage form, and a duration of the administration of glutaryl histamine is from 5 days to 12 months.

7. The method of claim 1, wherein the dose of glutaryl histamine or a pharmaceutically acceptable salt thereof is from 0.1 to 100 mg/kg of human body weight per day.

8. The method of claim 1, wherein a single dose of glutaryl histamine is 100 mg.

9. A method for increasing the density of interferon receptors upon treating a disease selected from the group consisting of hepatitis B, herpes, papilloma virus infection, and multiple sclerosis, the method comprising administering an effective amount of glutaryl histamine or a pharmaceutically acceptable salt thereof.

10. The method of claim 9, wherein glutaryl histamine is administered in a solid form, and a duration of the administration of glutaryl histamine is from 5 days to 12 months.

11. The method of claim 9, wherein the dose of glutaryl histamine or a pharmaceutically acceptable salt thereof is from 0.1 to 100 mg/kg of human body weight per day.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a diagram illustrating an increase in the synthesis of the mRNA subunits of interferon receptors under action of glutaryl histamine in epithelial cells A549.

(2) FIG. 2 is a diagram illustrating an increase in the protein amount of the interferon receptor subunits under action of glutaryl histamine on the surface of a primary culture of human macrophages.

(3) FIG. 3 is an immunoblot photograph demonstrating an effect of sensitization of glutaryl histamine-treated cells to low concentrations of interferon.

EMBODIMENTS OF THE INVENTION

(4) The invention is described below in more details with examples supporting the efficiency of glutaryl histamine for prevention and treatment of diseases according to the present invention, wherein the disclosed examples are not intended to limit the scope of the invention.

Example 1

Level of mRNA Synthesis of Interferon Receptors Under Action of Glutaryl Histamine

(5) A continuous cell line A-549 was treated with glutaryl histamine at a concentration of 100 ng/mL. The amount of messenger RNA copies of interferon receptors was determined by Real Time PCR analysis 16 hours after the treatment. The RNAs were isolated by using RNEASY® Kit (Qiagen). The RNA preparation was treated with DNAase (RNase-free DNaseI (Ambion). Reverse transcription was performed by using THERMOSCRIPT™ RT-PCR System (Invitrogen). Quantitative PCR was carried out with the primers:

(6) TABLE-US-00001 Ifnar1 (forward)  5′ CACTGACTGTATATTGTGTGAAAGCCAGAG 3′, (reverse) 5′ CATCTATACTGGAAGAAGGTTTAAGTGATG 3′; Ifnar2 (forward) 5′ ATTTCCGGTCCATCTTATCAT 3′, (reverse) 5′ACTGAACAACGTTGTGTTCC 3′.

(7) Results. As can be seen on the graph (see FIG. 1), the treatment of cells with glutaryl histamine resulted at least in a two-folded increase in the mRNA synthesis of subunit IFNAR1 and a three-fold increase in the amount of the mRNA of subunit IFNAR2 of type I interferon receptor.

Example 2

Effect of Glutaryl Histamine on the Density of Interferon Receptors on the Surface of Primary Human Macrophages

(8) A 10-day primary culture of human macrophages in 96-well plates was incubated for 24 hours in the presence of glutaryl histamine at concentrations: 0.1, 1.0, 10 or 100 ng/mL or without it. Then, the cells were fixed with a paraformaldehyde solution (without permeabilization), the fixed cells were washed off with a detergent-containing buffer solution (PBS-Tween), blocked with a solution of bovine serum albumin, and incubated with antibodies to the interferon receptor subunits IFNAR1 or IFNAR2. The preparation was visualized by staining with horseradish peroxidase-labeled secondary antibodies and adding a substrate. Optical density was measured using an ELISA spectrophotometer.

(9) As can be seen from this example (see FIG. 2), the treatment of macrophages with glutaryl histamine increased the density of two chains of interferon receptors on the cell surface, which is reflected in a noticeably increased level of the signal in staining with antibodies specific to IFNAR2 and IFNAR1.

Example 3

Effect of Glutaryl Histamine on Cell Sensitivity to Interferon

(10) An increase in the density of interferon receptors on a cell surface must result in an increased sensitivity of cells to weak signals of endogenous interferon under conditions when its signaling is suppressed by a viral infection. In order to demonstrate an effect of sensitization of cells to interferon signals, cells A-549 were treated with glutaryl histamine at a concentration of 100 ng/mL and incubated for 8 or 24 hours before the cells were undergone to lysis in the presence or absence of 1 IU interferon-alpha (IFNα: ROFERON-A3®, Roche Molecular Biochemicals, Mannheim). Cell lysates were undergone to the procedure of immunoblot analysis (western blotting) by using monoclonal antibodies against to protein MxA (sc-50509, Santa Cruz Biotechnology) to stain membranes by a chemiluminescence method using a substrate (chemiluminescent reagent SUPER SIGNAL® West Femto Chemiluminescent Substrate (Thermo Fisher Scientific)). The protein MxA was selected as an indicator product that is indicative of the expression of interferon-stimulated genes (ISGs) when the cells are treated with interferon.

(11) As can be seen from this example see FIG. 3), glutaryl histamine did not cause the accumulation of the antiviral M×A protein (lines 1, 2, and 3) in the cells that were not treated with interferon. Interferon, at a low concentration of 1 IU, also did not induce the synthesis of the M×A protein (line 4). At the same time, the cells that were treated with both glutaryl histamine and interferon showed an increased synthesis of the M×A protein already 8 hours after the incubation (line 5) and 24 after the beginning of the treatment of cells (line 6). Thus, the treatment of cells with glutaryl histamine resulted in an increased interferon signaling and, as a consequence, to an increased biosynthesis of antiviral effector molecules.

Example 4

Therapeutic Efficiency of Glutaryl Histamine in a Murine Model of Herpes Meningoencephaltitis

(12) Mice were intracerebrally infected with herpes simplex virus HSV-1/CL and HSV-2/VN in a dose of 30 μl comprising 10 LD.sub.50.

(13) A therapeutic effect of glutaryl histamine was studied by once-daily oral administration of 200 μl of the drug to the infected mice at a dose of 30 mg/kg 24, 48, 72, 96, and 120 hours after infection with the virus. Mice of the control group were administered placebo under the same conditions (200 ml of a physiological solution). The animals were monitored for 14 days after infection, and fatal cases among mice from herpes meningocephalitis were registered in the treated and control groups. Activity of the drug was evaluated by comparing mortality rates of animals treated with glutaryl histamine relative to animals of the control group. A reduction in the mortality rate of the treated animals relative to the control was expressed in percentage.

(14) Indexes of death protection and life expectancy of the treated, control (infected animals untreated with glytaryl histamine), and intact (negative control) mice are given in Table 1.

(15) The treatment of HSV-1/CL viral infection with glutaryl histamine showed a statistically significant reduction (p=0.02) in the mortality rate (from 95% down to 65%) and an increase in the average life expectancy (from 4.8 up to 8.1 days). Similarly, the treatment of HSV-2/VN-infected mice with glutaryl histamine led to a statistically significant reduction (p=0.008) in the mortality rate (from 85% down to 45%) and an increase in the average life expectancy (from 6.1 up to 10.2 days). The statistical significance was estimated by a Log-rank Mantel-Cox test. Thus, it has been shown that glutaryl histamine is therapeutically effective in the treatment of herpes infection in mice.

(16) TABLE-US-00002 TABLE 1 Life expectancy, Mortality Protection days Experimental group rate, % index, % M ± σ HSV-1, strain CL glutaryl histamine (30 mg/mL) 65.0* 31.6 8.1 ± 4.9 Control for HSV-1/CL 95.0 0.0 4.8 ± 3.1 HSV-2, strain KN glutaryl histamine, (30 mg/ml) 45.0** 47.1 10.2 ± 4.8  Control for HSV-2/KN 85.0 0.0 6.1 ± 4.3 Negative control 0.0 100.0  14 ± 0.0 *P = 0.02 **P = 0.008

Example 5

Preparation of Glutaryl Histamine Dosage Forms

(17) Dosage forms of glutaryl histamine used according to the present invention are prepared by standard methods, such as, for example, processes of mixing, granulating, forming pills, dissolving and lyophilizing.

(18) Tablet Form

(19) A tablet form is prepared by using the following ingredients:

(20) TABLE-US-00003 Glutaryl histamine or a pharmaceutically acceptable 1-100 mg salt thereof Potato starch 20-50 mg Magnesium stearate 3 mg Aerosil 1 mg Lactose up to 300 mg

(21) The ingredients are mixed and compressed to form tablets weighing 300 mg

(22) Gelatinous Capsules

(23) TABLE-US-00004 Glutaryl histamine or a pharmaceutically 90 mg acceptable salt thereof Lactose (milk sugar), potato starch, colloidal amount required silica (aerosi), magnesium stearate for a 220 mg capsule

(24) The above-mentioned ingredients are mixed and granulated, the resulting granules are placed into solid gelatinous capsules in an amount of 220 mg.

(25) Suppositories

(26) Example of the formulation of a suppository

(27) TABLE-US-00005 Glutaryl histamine or a pharmaceutically 1-100 mg acceptable salt thereof Cacao oil amount required for a suppository

(28) Rectal, vaginal, and urethral suppositories can be optionally prepared with corresponding excipients.

(29) Solution for Injection

(30) Example of the formulation of a solution for injections:

(31) TABLE-US-00006 Glutaryl histamine or a pharmaceutically acceptable 1-100 mg salt thereof Water for injection 2 ml

(32) A solution for injections can be prepared by using, as a diluent, a 0.9% sodium chloride solution, distilled water, or a novocain solution. Product forms are ampules, flasks, syringe-tubes, and “inserts”.