Breast Tumor Markers And Methods Of Use Thereof
20170227543 · 2017-08-10
Assignee
Inventors
- Renata Grifantini (Siena, IT)
- Piero Pileri (Siena, IT)
- Susanna Campagnoli (Siena, IT)
- Alberto Grandi (Siena, IT)
- Matteo Parri (Siena, IT)
- Andrea Pierleoni (Siena, IT)
- Renzo Nogarotto (Siena, IT)
Cpc classification
C07K14/4748
CHEMISTRY; METALLURGY
C12N2310/111
CHEMISTRY; METALLURGY
C12N15/1135
CHEMISTRY; METALLURGY
C07K16/44
CHEMISTRY; METALLURGY
International classification
G01N33/50
PHYSICS
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Newly identified proteins as markers for the detection of breast tumors, or as therapeutic targets for treatment thereof; affinity ligands capable of selectively interacting with the newly identified markers, as well as methods for tumor diagnosis and therapy using such ligands.
Claims
1.-12. (canceled)
13. A method of screening a tissue sample, the method comprising: (a) providing a sample of a breast tissue from a human subject; (b) assaying whether the sample of the breast tissue expresses a protein selected from the group consisting of KLRG2, ERMP1, C6orf98, C9orf46, FLJ37107, YIPF2, UNQ6126, TRYX3, DPY19L3, SLC39A10, C14orf135, DENND1B, EMID1, and CRISP3, (c) detecting that the expression of the protein in the sample of the breast tissue is higher than in a non-malignant breast tissue control sample.
14. The method of claim 13, wherein the assaying is performed by immunohistochemical analysis using an antibody that specifically binds to the protein.
15. The method of claim 13, wherein the sample of the breast tissue is assayed for expression of at least one additional protein selected from the group consisting of C6orf98, C9orf46, FLJ37107, YIPF2, UNQ6126, TRYX3, DPY19L3, SLC39A10, C14orf135, DENND1B, EMID1, CRISP3, and ERMP1.
16. The method of claim 13, wherein the sample of the breast tissue is assayed for expression of at least two additional proteins selected from the group consisting of C6orf98, C9orf46, FLJ37107, YIPF2, UNQ6126, TRYX3, DPY19L3, SLC39A10, C14orf135, DENND1B, EMID1, CRISP3, and ERMP1.
17. The method of claim 13, wherein the sample of the breast tissue is assayed for expression of at least three additional proteins selected from the group consisting of C6orf98, C9orf46, FLJ37107, YIPF2, UNQ6126, TRYX3, DPY19L3, SLC39A10, C14orf135, DENND1B, EMID1, CRISP3, and ERMP1.
18. The method of claim 13, wherein the sample of the breast tissue is assayed for expression of at least four additional proteins selected from the group consisting of C6orf98, C9orf46, FLJ37107, YIPF2, UNQ6126, TRYX3, DPY19L3, SLC39A10, C14orf135, DENND1B, EMID1, CRISP3, and ERMP1.
19. The method of claim 13, further comprising administering to the human subject that expresses the protein at a higher level than in the non-malignant breast tissue control sample, a monoclonal antibody that specifically binds to the protein or an siRNA molecule that specifically silences the protein, for treating the breast malignancy.
20. A method for determining whether a human patient has a breast malignancy, the method comprising: (a) providing a sample of a breast tissue from the patient; (b) detecting that the sample of the breast tissue expresses a protein selected from the group consisting of KLRG2, ERMP1, C6orf98, C9orf46, FLJ37107, YIPF2, UNQ6126, TRYX3, DPY19L3, SLC39A10, C14orf135, DENND1B, EMID1, and CRISP3 at a higher level compared to a non-malignant breast tissue control sample, wherein the detecting is performed by immunohistochemical analysis by contacting the sample of the breast tissue with an antibody that specifically binds to the protein; and (c) diagnosing the patient from whom the sample of the breast tissue is obtained as having a breast malignancy.
21. The method of claim 20, wherein the antibody is a monoclonal antibody.
22. The method of claim 21, further comprising administering to the patient from whom the sample of the breast tissue is obtained a monoclonal antibody that specifically binds to the protein for treating the breast malignancy or a siRNA molecule that specifically silences to the protein for treating the breast malignancy.
23. The method of claim 21, wherein the sample of the breast tissue is screened for expression of at least one additional tumor marker selected from the group consisting of C6orf98, C9orf46, FLJ37107, YIPF2, UNQ6126, TRYX3, DPY19L3, SLC39A10, C14orf135, DENND1B, EMID1, CRISP3, and ERMP1.
24. A method of screening a tissue sample, the method comprising: (a) providing a sample of a breast tissue from a human subject; (b) assaying whether the sample of the breast tissue expresses a gene encoding a protein selected from the group consisting of KLRG2, ERMP1, C6orf98, C9orf46, FLJ37107, YIPF2, UNQ6126, TRYX3, DPY19L3, SLC39A10, C14orf135, DENND1B, EMID1, and CRISP3, (c) detecting that the expression of the gene in the sample of the breast tissue is higher than in a non-malignant breast tissue control sample.
25. The method of claim 24, wherein the assaying is performed by a polymerase chain reaction technique.
26. A method of screening a test compound as an anti-breast tumor therapy, the method comprising: contacting breast tumor cells expressing a protein selected from the group consisting of KLRG2, ERMP1, C6orf98, C9orf46, FLJ37107, YIPF2, UNQ6126, TRYX3, DPY19L3, SLC39A10, C14orf135, DENND1B, EMID1, and CRISP3 with the test compound, determining that the test compound binds the protein, and selecting the test compound as an anti-breast tumor therapy.
27. An antibody or antigen-binding fragment thereof which is able to specifically recognize and bind to a protein selected from the group consisting of KLRG2, ERMP1, C6orf98, C9orf46, FLJ37107, YIPF2, UNQ6126, TRYX3, DPY19L3, SLC39A10, C14orf135, DENND1B, EMID1, and CRISP3.
28. A diagnostic kit comprising an antibody or antigen-binding fragment of claim 27 and reagents to carry out an immunoassay.
29. A siRNA molecule comprising a nucleic acid sequence complementary to one of SEQ ID NOs: 89-94.
Description
DESCRIPTION OF THE FIGURES
[0086]
[0087] Left panel: Comassie staining of purified His-tag C6orf98 fusion protein separated by SDS-PAGE; Right panel: WB on the purified recombinant protein stained with anti-C6orf98 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
[0088]
[0089] Examples of TMA of tumor (lower panel) and normal tissue samples (upper panel) stained with anti-C6orf98 antibodies. The antibody-stains specifically tumor cells (in dark gray);
[0090]
[0091] Left panel: Comassie staining of purified His-tag C9orf46 fusion protein separated by SDS-PAGE; Right panel: WB on the C9orf46 protein stained with anti-C9orf46 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
[0092]
[0093] Examples of TMA of tumor (lower panel) and normal tissue samples (upper panel) stained with anti-C9orf46 antibodies. The antibody stains specifically tumor cells (in dark gray).
[0094]
[0095] Western blot analysis of C9orf46 expression in total protein extracts from: A) BT549 (line1) and MCF-7 (line2) breast tumor cells (corresponding to 2×10.sup.5 cells); B) HeLa cells (corresponding to 2×10.sup.5 cells) transfected with the empty pcDNA3 vector (lane 1) or with the plasmid construct encoding the C9orf46 gene (lane 2); C) Normal (lane 1=Pt#1; lane 2=Pt#2) or cancerous breast tissues from patients (lane 3=Pt#1; lane 4=Pt#2); stained with anti-C9orf46 antibody. Arrow marks the expected C9orf46 band. Molecular weight markers are reported on the left.
[0096]
[0097] Left panel: Comassie staining of purified His-tag FLJ37107 fusion protein separated by SDS-PAGE; Right panel: WB on the recombinant FLJ37107 protein stained with anti-FLJ37107 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
[0098]
[0099] Examples of TMA of tumor (lower panel) and normal tissue samples (upper panel) stained with anti-FLJ37107 antibodies. The antibody stains specifically tumor cells (in dark gray).
[0100]
[0101] Left panel: Comassie staining of purified His-tag YIPF2 fusion protein separated by SDS-PAGE; Right panel: WB on the purified protein stained with anti-YIPF2 antibody. Arrow marks the protein band of the expected size.
[0102] Molecular weight markers are reported on the left.
[0103]
[0104] Examples of TMA of tumor (lower panel) and normal tissue samples (upper panel) stained with anti-YIPF2 antibodies. The antibody stains specifically tumor cells (in dark gray).
[0105]
[0106] Left panel: Comassie staining of purified His-tag UNQ6126 fusion protein separated by SDS-PAGE; Right panel: WB on the purified recombinant protein stained with anti-UNQ6126 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
[0107]
[0108] Examples of TMA of tumor (lower panel) and normal tissue samples (upper panel) stained with anti-UNQ6126 antibodies. The antibody stains specifically tumor cells (in dark gray).
[0109]
[0110] Left panel: Comassie staining of purified His-tag TRYX3 fusion protein separated by SDS-PAGE; Right panel: WB on the purified recombinant protein stained with anti-TRYX3 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
[0111]
[0112] Examples of TMA of tumor (lower panel) and normal tissue samples (upper panel) stained with anti-TRYX3 antibodies. The antibody stains specifically tumor cells (in dark gray).
[0113]
[0114] Left panel: Comassie staining of purified His-tag DPY19L3 fusion protein separated by SDS-PAGE; Right panel: WB on the purified protein stained with anti-DPY19L3 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
[0115]
[0116] Examples of TMA of tumor (lower panel) and normal tissue samples (upper panel) stained with anti-DPY19L3 antibodies. The antibody stains specifically tumor cells (in dark gray).
[0117]
[0118] Panel A: Western blot analysis of DPY19L3 expression in total protein extracts separated by SDS-PAGE from: MCF-7 (lane 1), MDA-MB231 (lane 2), SKBR-3 (lane 3), breast derived tumor cells; Arrow marks the protein band of the expected size.
[0119] Molecular weight markers are reported on the left.
[0120] Panel B: Flow cytometry analysis of DPY19L3 cell surface localization in MCF-7 and SKBR-3 cells stained with a negative control antibody (filled curve) or with anti-DPY19L3 antibody (empty curve). X axis, Fluorescence scale; Y axis, Cells (expressed as % relatively to major peaks).
[0121]
[0122] Left panel: Comassie staining of purified His-tag SLC39A10 protein separated by SDS-PAGE; Right panel: WB on the recombinant protein stained with anti-SLC39A10 antibody. The low molecular weight bands correspond to partially degraded forms of SLC39A10 protein. Molecular weight markers are reported on the left.
[0123]
[0124] Examples of TMA of tumor (lower panel) and normal tissue samples (upper panel) stained with anti-SLC39A10 antibodies. The antibody stains specifically tumor cells (in dark gray).
[0125]
[0126] HeLa cells transfected with the empty pcDNA3 vector (upper panels) or with the plasmid construct encoding the SLC39A10 gene (lower panels) stained with secondary antibodies (left panels) and with anti-SLC39A10 antibodies (right panels). Arrowheads mark surface specific localization.
[0127]
[0128] Flow cytometry analysis of SLC39A10 cell surface localization SKBR3 tumor cells stained with a negative control antibody (filled curve or with anti-SLC39A10 antibody (empty curve). X axis, Fluorescence scale; Y axis, Cells (expressed as percentage relatively to major peaks).
[0129]
[0130] Left panel: Comassie staining of purified His-tag C14orf135 fusion protein expressed in E. coli separated by SDS-PAGE; Right panel: WB on the recombinant protein stained with anti-C14orf135 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
[0131]
[0132] Examples of TMA of tumor (lower panel) and normal tissue samples (upper panel) stained with anti-C14orf135 antibodies. The antibody stains specifically tumor cells and their secretion products (in dark gray). Moreover antibody stain also accumulated at the plasma membrane of tumor cells (boxed image, marked by arrows).
[0133]
[0134] Left panel: Comassie staining of purified His-tag DENND1B fusion protein separated by SDS-PAGE; Right panel: WB on the purified DENND1B protein stained with anti-DENND1B antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
[0135]
[0136] Examples of TMA of tumor (lower panel) and normal tissue samples (upper panel) stained with anti-DENND1B antibodies. The antibody stains specifically tumor cells (in dark gray).
[0137]
[0138] Left panel: Comassie staining of purified His-tag EMID1 fusion protein separated by SDS-PAGE; Right panel: WB on the recombinant protein stained with anti-EMID1 antibody. Arrow marks the protein band of the expected size. The high molecular weight bands are consistent with multimers of the protein as defined by Mass spectromic analysis. Molecular weight markers are reported on the left.
[0139]
[0140] Examples of TMA of tumor (lower panel) and normal tissue samples (upper panel) stained with anti-EMID1 antibodies. The antibody specifically stains secretion products of tumor cells (in dark gray).
[0141]
[0142] Left panel: Comassie staining of purified His-tag ERMP1 fusion protein separated by SDS-PAGE; Right panel: WB on the recombinant protein stained with anti-ERMP1 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
[0143]
[0144] Examples of TMA of tumor (lower panel) and normal tissue samples (upper panel) stained with anti-ERMP1 antibodies. The antibody stains specifically tumor cells (in dark gray).
[0145]
[0146] Panel A:
[0147] Western blot analysis of ERMP1 expression in total protein extracts separated by SDS-PAGE from HEK-293T cells (corresponding to 1×10.sup.6 cells) transfected with the empty pcDNA3 vector (lane 1) or with the plasmid construct encoding the ERMP1 gene (lane 2);
[0148] Panel B:
[0149] Western blot analysis of ERMP1 expression in total protein extracts separated by SDS-PAGE from MCF-7 (lane 1) and SKBR-3 (lane 2) tumor cells (corresponding to 2×10.sup.5 cells). Arrow marks the expected ERMP1 band. Molecular weight markers are reported on the left.
[0150] Panel C:
[0151] Flow cytometry analysis of ERMP1 cell surface localization in SKBR-3 tumor cells stained with a negative control antibody (filled curve or with anti-ERMP1 antibody (empty curve). X axis, Fluorescence scale; Y axis, Cells (expressed as % relatively to major peaks).
[0152]
[0153] the proliferation and the invasiveness properties of the MCF7 cell line were assessed after transfection with ERMP1-siRNA and a scramble siRNA control using the MTT and the Boyden in vitro invasion assays, respectively.
[0154] Panel A.
[0155] Cell migration/invasiveness measured by the Boyden migration assay. The graph represents the reduced migration/invasiveness of MCF7 treated with the ERMP1-specific siRNA. Small boxes under the columns show the visual counting of the migrated cells.
[0156] Panel B.
[0157] Cell proliferation determined by the MTT incorporation assay. The graph represents the reduced proliferation of the MCF7 tumor cells upon treatment with ERMP1-siRNA, as determined by spectrophotometric reading.
[0158]
[0159] Left panel: Comassie staining of purified His-tag CRISP3 fusion protein separated by SDS-PAGE; Right panel: WB on the purified recombinant CRISP3 protein stained with anti-CRISP3 antibody. Arrow marks the protein band of the expected size. The high molecular weight bands are consistent with protein dimers as defined by Mass spectromic analysis. Molecular weight markers are reported on the left.
[0160]
[0161] Examples of TMA of breast tumor (lower panel) and normal tissue samples (upper panel) stained with anti-CRISP3 antibodies. The antibody stains specifically tumor cells (in dark gray).
[0162]
[0163] Left panel: Comassie staining of purified His-tag KLRG2 fusion protein expressed in E. coli separated by SDS-PAGE; Right panel: WB on the purified recombinant protein stained with anti-KLRG2 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
[0164]
[0165] Examples of TMA of tumor (lower panel) and normal tissue samples (upper panel) stained with anti-KLRG2 antibodies. The antibody-stains specifically tumor cells (in dark gray).
[0166]
[0167] Panel A:
[0168] Western blot analysis of KLRG2 expression in total protein extracts separated by SDS-PAGE from HeLa cells (corresponding to 1×10.sup.6 cells) transfected with the empty pcDNA3 vector (lane 1), with the plasmid construct encoding the isoform 2 of the KLRG2 gene (lane 2); or with the plasmid construct encoding the isoform1 of the KLRG2 gene (lane 3); Arrows mark the expected KLRG2 bands.
[0169] Panel B:
[0170] Western blot analysis of KLRG2 expression in total protein extracts separated by SDS-PAGE from normal breast tissues (1=Pt#1; 2=Pt#2; 3=Pt#3; 4=Pt#4) or from breast cancer tissues 5=Pt#1; 6=Pt#2; 7=Pt#3; 8=Pt#4); stained with anti-KLRG2 antibody. Arrow marks one of the expected KLRG2 band. Molecular weight markers are reported on the right.
[0171] Panel C:
[0172] Flow cytometry analysis of KLRG2 cell surface localization in SKBR-3 cells stained with a negative control antibody (filled curve or with anti-KLRG2 antibody (empty curve). X axis, Fluorescence scale; Y axis, Cells (expressed as % relatively to major peaks).
[0173]
[0174] The proliferation and the migration/invasiveness phenotypes of MCF7 cell line were assessed after transfection with KLRG2-siRNA and a scramble siRNA control using the MTT and the Boyden in vitro invasion assay, respectively.
[0175] Panel A.
[0176] Cell migration/invasiveness measured by the Boyden migration assay. The graph represents the reduced migration/invasiveness of MCF7 treated with the KLRG2 specific siRNA. Small boxes under the columns show the visual counting of the migrated cells.
[0177] Panel B.
[0178] Cell proliferation determined by the MTT incorporation assay. The graph represents the reduced proliferation of the MCF7 tumor cells upon treatment with KLRG2-siRNA, as determined by spectrophotometric reading.
[0179] The following examples further illustrate the invention.
EXAMPLES
Example 1. Generation of Recombinant Human Protein Antigens and Antibodies to Identify Tumor Markers
[0180] Methods
[0181] The entire coding region or suitable fragments of the genes encoding the target proteins, were designed for cloning and expression using bioinformatic tools with the human genome sequence as template (Lindskog M et al (2005). Where present, the leader sequence for secretion was replaced with the ATG codon to drive the expression of the recombinant proteins in the cytoplasm of E. coli. For cloning, genes were PCR-amplified from templates derived from Mammalian Gene Collection (http://mgc.nci.nih.gov/) clones using specific primers. Clonings were designed so as to fuse a 10 histidine tag sequence at the 5′ end, annealed to in house developed vectors, derivatives of vector pSP73 (Promega) adapted for the T4 ligation independent cloning method (Nucleic Acids Res. 1990 October 25; 18(20): 6069-6074) and used to transform E. coli NovaBlue cells recipient strain. E. coli tranformants were plated onto selective LB plates containing 100 μg/ml ampicillin (LB Amp) and positive E. coli clones were identified by restriction enzyme analysis of purified plasmid followed by DNA sequence analysis. For expression, plasmids were used to transform BL21-(DE3) E. coli cells and BL21-(DE3) E. coli cells harbouring the plasmid were inoculated in ZYP-5052 growth medium (Studier, 2005) and grown at 37° C. for 24 hours. Afterwards, bacteria were collected by centrifugation, lysed into B-Per Reagent containing 1 mM MgCl2, 100 units DNAse I (Sigma), and 1 mg/ml lysozime (Sigma). After 30 min at room temperature under gentle shaking, the lysate was clarified by centrifugation at 30.000 g for 40 min at 4° C. All proteins were purified from the inclusion bodies by resuspending the pellet coming from lysate centrifugation in 40 mM TRIS-HCl, 1 mM TCEP {Tris(2-carboxyethyl)-phosphine hydrochloride, Pierce} and 6M guanidine hydrochloride, pH 8 and performing an IMAC in denaturing conditions. Briefly, the resuspended material was clarified by centrifugation at 30.000 g for 30 min and the supernatant was loaded on 0.5 ml columns of Ni-activated Chelating Sepharose Fast Flow (Pharmacia). The column was washed with 50 mM TRIS-HCl buffer, 1 mM TCEP, 6M urea, 60 mM imidazole, 0.5M NaCl, pH 8. Recombinant proteins were eluted with the same buffer containing 500 mM imidazole. Proteins were analysed by SDS-Page and their concentration was determined by Bradford assay using the BIORAD reagent (BIORAD) with a bovine serum albumin standard according to the manufacturer's recommendations. The identity of recombinant affinity purified proteins was further confirmed by mass spectrometry (MALDI-TOF), using standard procedures.
[0182] To generate antisera, the purified proteins were used to immunize CD1 mice (6 week-old females, Charles River laboratories, 5 mice per group) intraperitoneally, with 3 protein doses of 20 micrograms each, at 2 week-interval. Freund's complete adjuvant was used for the first immunization, while Freund's incomplete adjuvant was used for the two booster doses. Two weeks after the last immunization animals were bled and sera collected from each animal was pooled.
[0183] Results
[0184] Gene fragments of the expected size were obtained by PCR from specific clones of the Mammalian Gene Collection or, alternatively, from cDNA generated from pools of total RNA derived from Human testis, Human placenta, Human bone marrow, Human fetal brain, using primers specific for each gene.
[0185] For the C6orf98 gene, a fragment corresponding to nucleotides 67 to 396 of the transcript ENST00000409023 and encoding a protein of 110 residues, corresponding to the amino acid region from 22 to 132 of ENSP00000386324 sequence was obtained.
[0186] For the C9orf46 gene, a fragment corresponding to nucleotides 439 to 663 of the transcript ENST00000107020 and encoding a protein of 75 residues, corresponding to the amino acid region from 73 to 147 of ENSP00000223864 sequence was obtained.
[0187] For the FLJ37107 gene, a fragment corresponding to nucleotides 661-972 of the transcript gi158218993|ref|NM_001010882.1 and encoding a protein of 104 residues, corresponding to the amino acid region from 1 to 104 of gi|58218994|ref|NP_001010882.1 sequence was obtained.
[0188] For the YIPF2 gene, a fragment corresponding to nucleotides 107 to 478 of the transcript ENST00000393508 and encoding a protein of 124 residues, corresponding to the amino acid region from 1 to 124 of ENSP00000377144 sequence was obtained.
[0189] For the UNQ6126 gene, a fragment corresponding to a fragment corresponding to nucleotides 88 to 471 of the transcript gi|169216088|ref|XM_001719570.1| and encoding a protein of 128 residues, and encoding an amino acid region from 30 to 147 of sp|Q6UXV3|YV010 sequence was obtained.
[0190] For the TRYX3 gene, a fragment corresponding to nucleotides 230 to 781 of the transcript ENST00000304182 and encoding a protein of 184 residues, corresponding to the amino acid region from 41 to 224 of ENSP00000307206 sequence was obtained.
[0191] For the DPY19L3 gene, a fragment corresponding to nucleotides 158 to 463 of the transcript ENST00000392250 and encoding a protein of 102 residues, corresponding to the amino acid region from 1 to 102 of ENSP00000376081 sequence was obtained.
[0192] For the SLC39A10 gene, a DNA fragment corresponding to nucleotides 154-1287 of the transcript ENST00000359634 and encoding a protein of 378 residues, corresponding to the amino acid region from 26 to 403 of ENSP00000352656 sequence was obtained.
[0193] For the C14orf135 gene, a fragment corresponding to nucleotides 2944 to 3336 of the transcript ENST00000317623 and encoding a protein of 131 residues, corresponding to the amino acid region 413 to 543 of ENSP00000317396 sequence was obtained.
[0194] For the DENND1B gene, a fragment corresponding to nucleotides 563 to 1468 of the transcript ENST00000235453 and encoding a protein of 302 residues, corresponding to the amino acid region from 95 to 396 of ENSP00000235453 sequence was obtained.
[0195] For the EMID1 gene, a fragment corresponding to nucleotides 203-670 of the transcript OTTHUMT00000075712 and encoding a protein of 156 residues, corresponding to the amino acid region from 33 to 188 of OTTHUMP00000028901 sequence was obtained.
[0196] For the ERMP1 gene, a fragment corresponding to nucleotides 55-666 of the transcript ENST00000339450 and encoding a protein of 204 residues, corresponding to the amino acid region from 1 to 204 of ENSP00000340427 sequence was obtained.
[0197] For the CRISP3 gene, a fragment corresponding to nucleotides 62-742 of the transcript ENST00000393666 and encoding a protein of 227 residues, corresponding to the amino acid region from 19 to 245 of ENSP0000037727 sequence was obtained.
[0198] For the KLRG2 gene, a fragment corresponding to nucleotides 70 to 849 of the transcript ENST00000340940 and encoding a protein of 260 residues, corresponding to the amino acid region from 1 to 260 of ENSP00000339356 sequence was obtained.
[0199] A clone encoding the correct amino acid sequence was identified for each gene/gene-fragment and, upon expression in E. coli, a protein of the correct size was produced and subsequently purified using affinity chromatography (
[0200] Antibodies generated by immunization specifically recognized their target proteins in Western blot (WB) (
Example 2. Tissue Profiling by Immune-Histochemistry
[0201] Methods
[0202] The analysis of the antibodies' capability to recognize their target proteins in tumor samples was carried out by Tissue Micro Array (TMA), a miniaturized immuno-histochemistry technology suitable for HTP analysis that allows to analyse the antibody immuno-reactivity simultaneously on different tissue samples immobilized on a microscope slide.
[0203] Since the TMAs include both tumor and healthy tissues, the specificity of the antibodies for the tumors can be immediately appreciated. The use of this technology, differently from approaches based on transcription profile, has the important advantage of giving a first hand evaluation on the potential of the markers in clinics. Conversely, since mRNA levels not always correlate with protein levels (approx. 50% correlation), studies based on transcription profile do not provide solid information regarding the expression of protein markers.
[0204] A tissue microarray was prepared containing formalin-fixed paraffin-embedded cores of human tissues from patients affected by breast cancer and corresponding normal tissues as controls and analyzed using the specific antibody sample. In total, the TMA design consisted in 10 tumor breast tumor samples and 10 normal tissues from 5 well pedigreed patients (equal to two tumor samples and 2 normal tissues from each patient) to identify promising target molecules differentially expressed in cancer and normal cells. The direct comparison between tumor and normal tissues of each patient allowed the identification of antibodies that stain specifically tumor cells and provided indication of target expression in breast tumor.
[0205] To further confirm the association of each protein with breast tumors a tissue microarray was prepared containing 100 formalin-fixed paraffin-embedded cores of human breast tissues from 50 patients (equal to two tissue samples from each patient).
[0206] All formalin fixed, paraffin embedded tissues used as donor blocks for TMA production were selected from the archives at the TEO (Istituto Europeo Oncologico, Milan). Corresponding whole tissue sections were examined to confirm diagnosis and tumour classification, and to select representative areas in donor blocks. Normal tissues were defined as microscopically normal (non-neoplastic) and were generally selected from specimens collected from the vicinity of surgically removed tumors. The TMA production was performed essentially as previously described (Kononen J et al (1998) Nature Med. 4:844-847; Kallioniemi O P et al (2001) Hum. MoI. Genet. 10:657-662). Briefly, a hole was made in the recipient TMA block. A cylindrical core tissue sample (1 mm in diameter) from the donor block was acquired and deposited in the recipient TMA block. This was repeated in an automated tissue arrayer “Galileo TMA CK 3500” (BioRep, Milan) until a complete TMA design was produced. TMA recipient blocks were baked at 42<0>C for 2 h prior to sectioning. The TMA blocks were sectioned with 2-3 mm thickness using a waterfall microtome (Leica), and placed onto poly-L-lysinated glass slides for immunohistochemical analysis. Automated immunohistochemistry was performed as previously described (Kampf C. et al (2004) Clin. Proteomics 1:285-300). In brief, the glass slides were incubated for 30′ min in 60° C., de-paraffinized in xylene (2×15 min) using the Bio-Clear solution (Midway. Scientific, Melbourne, Australia), and re-hydrated in graded alcohols. For antigen retrieval, slides were immersed 0.01 M Na-citrate buffer, pH 6.0 at 99° C. for 30 min Slides were placed in the Autostainer® (DakoCytomation) and endogenous peroxidase was initially blocked with 3% H2O2, for 5 min. Slides were then blocked in Dako Cytomation Wash Buffer containing 5% Bovine serum albumin (BSA) and subsequently incubated with mouse antibodies for 30′ (dilution 1:200 in Dako Real™ dilution buffer). After washing with DakoCytomation wash buffer, slides were incubated with the goat anti-mouse peroxidase conjugated Envision® for 30 min each at room temperature (DakoCytomation). Finally, diaminobenzidine (DakoCytomation) was used as chromogen and Harris hematoxylin (Sigma-Aldrich) was used for counterstaining. The slides were mounted with Pertex® (Histolab).
[0207] The staining results have been evaluated by a trained pathologist at the light microscope, and scored according to both the percentage of immunostained cells and the intensity of staining. The individual values and the combined score (from 0 to 300) were recorded in a custom-tailored database. Digital images of the immunocytochemical findings have been taken at a Leica DM LB light microscope, equipped with a Leica DFC289 color camera.
[0208] Results
[0209] A TMA design was obtained, representing tumor tissue samples and normal tissues, derived from patients affected by breast tumor. The results from tissue profiling showed that the antibodies specific for the recombinant proteins (see Example 1) are strongly immunoreactive on breast tumor cancer tissues, while no or poor reactivity was detected in normal tissues, indicating the presence of the target proteins in breast tumors. Based on this finding, the detection of target proteins in tissue samples can be associated with breast tumor. In some cases immunoreactivity accumulated at the cell membrane of tumor cells providing a first-hand indication on the surface localization of the target proteins.
[0210] The capability of target-specific antibodies to stain breast tumor tissues is summarized in Table I. Representative examples of microscopic enlargements of tissue samples stained by each antibody are reported in
[0211] Table reports the percentage of positive breast tumor tissue samples after staining with the target specific antibodies.
TABLE-US-00002 Percentage of Breast tumor tissues showing Marker name positive IHC staining C6orf98 80 C9orf46 20 FLJ37107 60 YIPF2 40 UNQ6126 82 TRYX3 40 DPY19L3 83 SLC39A10 27 C14orf135 20* DENND1B 20 EMID1 20* ERMP1 45** CRISP3 40 KLRG2 34** *The antibody stains both breast tumor cells and secretion products indicating that the corresponding proteins are specifically released by tumor cells. **The antibody stains the cell membrane of tumor cells
Example 3. Expression and Localization of Target Protein in Transfected Mammalian Cells
[0212] Methods
[0213] The specificity of the antibodies for each target proteins was assessed by Western blot analysis on total protein extracts from eukaryotic cells transiently transfected with plasmid constructs containing the complete sequences of the genes encoding the target proteins. Where indicated, expression and localization of target proteins were investigated by confocal microscopy analysis of transfected cells. Examples of this type of experiments are represented for C9orf46 (corresponding to Transcript ID ENST00000223864), KLRG2 (cloned sequences corresponding to Transcripts ENST00000340940 and ENST00000393039, corresponding to two transcript variants), ERMP1 (cloned sequence corresponding to Transcripts ENST00000339450), SLC39A10 (cloned sequence corresponding to Transcript ENST00000359634).
[0214] For clonings, cDNA were generated from pools of total RNA derived from Human testis, Human placenta, Human bone marrow, Human fetal brain, in reverse transcription reactions and the entire coding regions were PCR-amplified with specific primers pairs. PCR products were cloned into plasmid pcDNA3 (Invitrogen). HeLa or Hek-293T cells were grown in DMEM-10% FCS supplemented with 1 mM Glutamine were transiently transfected with preparation of the resulting plasmids and with the empty vector as negative control using the Lipofectamine-2000 transfection reagent (Invitrogen). After 48 hours, cells were collected and analysed by Western blot or confocal microscopy. For Western blot, cells were lysed with PBS buffer containing 1% Triton X100 and total cell extracts (corresponding to 2×10.sup.5 cells) were separated on pre-cast SDS-PAGE gradient gels (NuPage 4-12% Bis-Tris gel, Invitrogen) under reducing conditions, followed by electro-transfer to nitrocellulose membranes (Invitrogen) according to the manufacturer's recommendations. The membranes were blocked in blocking buffer composed of 1×PBS-0.1% Tween 20 (PBST) added with 10% dry milk, for 1 h at room temperature, incubated with the antibody diluted 1:2500 in blocking buffer containing 1% dry milk and washed in PBST-1%. The secondary HRP-conjugated antibody (goat anti-mouse immunoglobulin/HRP, Perkin Elmer) was diluted 1:5000 in blocking buffer and chemiluminescence detection was carried out using a Chemidoc-IT UVP CCD camera (UVP) and the Western Lightning™ cheminulescence Reagent Plus (Perkin Elmer), according to the manufacturer's protocol.
[0215] For confocal microscopy analysis, the cells were plated on glass cover slips and after 48 h were washed with PBS and fixed with 3% p-formaldheyde solution in PBS for 20 min at RT. For surface staining, cells were incubated overnight at 4° C. with polyclonal antibodies (1:200). The cells were then stained with Alexafluor 488-labeled goat anti-mouse antibodies (Molecular Probes). DAPI (Molecular Probes) was used to visualize nuclei; Live/Dead® red fixable (Molecular Probes) was used to visualize membrane. The cells were mounted with glycerol plastine and observed under a laser-scanning confocal microscope (LeicaSP5).
[0216] Results
[0217] The selected coding sequences for C9orf46, SLC39A10, KLRG2 and ERMP1 were cloned in a eukaryotic expression vector and the derived plasmids were used for transient transfection of HeLa or HEK293T cells. Expression of target proteins Corf46 and KLRG2 was detected by Western blot in total protein extracts from HeLa, while expression of ERMP1 was analysed in transfected HEK-293T cells. Overall the data confirmed that the marker-specific antibodies recognized specifically their target proteins. Concerning C9orf46, a band of the expected size was visible in HeLa cells transfected with the C9orf46-expressing plasmid while the same band was either not visible or very faintly detected in HeLa cells transfected with the empty pcDNA3 plasmid (
[0218] This indicates that this target protein is localized on the extracellular plasma membrane, accessible to the external environment.
Example 4. Detection of Target Protein in Tumor Tissue Homogenates
[0219] The presence of protein bands corresponding to the marker proteins was also investigated in tissue homogenates of breast tumor biopsies as compared to normal tissues from patients. Homogenates were prepared by mechanic tissue disruption in buffer containing 40 mM TRIS-HCl, 1 mM TCEP {Tris(2-carboxyethyl)-phosphine hydrochloride, Pierce} and 6M guanidine hydrochloride, pH 8. Western blot was performed by separation of the total protein extracts (20 μg/lane) proteins were detected by specific antibodies.
[0220] Results
[0221] An example of this type of experiments is represented for protein C9orf46 and KLRG2. Antibodies specific C9orf46 and KLRG2 detected a specific protein band in breast tumor homogenates, while no or very faint bands were detected in normal breast homogenates, confirming the presence of the marker proteins in breast tumor. Results are reported in
Example 5. Expression of Target Protein in Tumor Cell Lines
[0222] Expression of target proteins was also assessed by WB and/or Flow cytometry on total extracts from breast tumor cell lines, including BT549, MCF7, MDA-MB231 and SKBR-3.
[0223] In each analysis, cells were cultured in under ATCC recommended conditions, and sub-confluent cell monolayers were detached with PBS-0.5 mM EDTA. For Western blot analysis, cells were lysed by several freeze-thaw passages in PBS-1% Triton. Total protein extracts were loaded on SDS-PAGE (2×10.sup.5 cells/lane), and subjected to WB with specific antibodies as described above.
[0224] For flow cytometry analysis, cells (2×10.sup.4 per well) were pelletted in 96 U-bottom microplates by centrifugation at 200×g for 5 min at 4° C. and incubated for 1 hour at 4° C. with the appropriate dilutions of the marker-specific antibodies. Cells were washed twice in PBS-5% FCS and incubated for 20 min with the appropriate dilution of R-Phycoerythrin (PE)-conjugated secondary antibodies (Jackson Immuno Research, PA, USA) at 4° C. After washing, cells were analysed by a FACS Canto II flow cytometer (Becton Dickinson). Data were analyzed with FlowJo 8.3.3 program.
[0225] Results
[0226] Example of the expression analysis is represented for C9orf46, DPY19L3, ERMP1 and SLC39A10.
[0227] Western blot analysis of C9orf46 showed that a protein band of the expected sizes was detected in total protein extracts of breast tumor cell lines (BT549, MCF7), confirming its expression in breast tumor cell lines derived from breast tumor (
Example 6. Expression of the Marker Proteins Confers Malignant Cell Phenotype
[0228] To verify that the proteins included in the present invention can be exploited as targets for therapeutic applications, the effect of marker depletion was evaluated in vitro in cellular studies generally used to define the role of newly discovered proteins in tumor development. Marker-specific knock-down and control tumor cell lines were assayed for their proliferation and the migration/invasiveness phenotypes using the MTT and the Boyden in vitro invasion assay, respectively.
[0229] Method
[0230] Expression of marker genes were silenced in tumor cell lines by the siRNA technology and the influence of the reduction of marker expression on cell parameters relevant for tumor development was assessed in in vitro assays. The expression of marker genes was knocked down in a panel of epithelial tumor cell lines previously shown to express the tumor markers using a panel of marker-specific siRNAs (whose target sequences are reported in the Table II) using the HiPerfect transfection reagent (QIAGEN) following the manufacturer's protocol. As control, cells treated with irrelevant siRNA (scrambled siRNA) were analysed in parallel. At different time points (ranging from 24 to 72 hours) post transfection, the reduction of gene transcription was assessed by quantitative RT-PCR (Q-RT-PCR) on total RNA, by evaluating the relative marker transcript level, using the beta-actin, GAPDH or MAPK genes as internal normalization control. Afterwards, cell proliferation and migration/invasiveness assays were carried out to assess the effect of the reduced marker expression. Cell proliferation was determined using the MTT assay, a colorimetric assay based on the cellular conversion of a tetrazolium salt into a purple colored formazan product. Absorbance of the colored solution can be quantified using a spectrophotometer to provide an estimate of the number of attached living cells. Approximately 5×10.sup.3 cells/100 μl were seeded in 96-well plates in DMEM with 10% FCS to allow cell attachment. After overnight incubation with DMEM without FCS, the cells were treated with 2.5% FBS for 72 hours. Four hours before harvest 15 μL of the MTT dye solution (Promega) were added to each well. After 4-hour incubation at 37° C., the formazan precipitates were solubilized by the addition of 100 μL of solubilization solution (Promega) for 1 h at 37° C. Absorbance at 570 nm was determined on a multiwell plate reader (SpectraMax, Molecular Devices).
[0231] Cell migration/invasiveness was tested using the Boyden in vitro invasion assay, as compared to control cell lines treated with a scramble siRNA. This assay is based on a chamber of two medium-filled compartments separated by a microporous membrane. Cells are placed in the upper compartment and are allowed to migrate through the pores of the membrane into the lower compartment, in which chemotactic agents are present. After an appropriate incubation time, the membrane between the two compartments is fixed and stained, and the number of cells that have migrated to the lower side of the membrane is determined. For this assay, a transwell system, equipped with 8-μm pore polyvinylpirrolidone-free polycarbonate filters, was used. The upper sides of the porous polycarbonate filters were coated with 50 μg/cm.sup.2 of reconstituted Matrigel basement membrane and placed into six-well culture dishes containing complete growth medium. Cells (1×10.sup.4 cells/well) were loaded into the upper compartment in serum-free growth medium. After 16 h of incubation at 37° C., non-invading cells were removed mechanically using cotton swabs, and the microporous membrane was stained with Diff-Quick solution. Chemotaxis was evaluated by counting the cells migrated to the lower surface of the polycarbonate filters (six randomly chosen fields, mean±SD).
[0232] Results
[0233] Examples of this analysis are reported for ERMP1 and KLRG2 in the breast tumor cell line MCF7. Gene silencing experiments with marker-specific siRNA reduced the marker transcripts (approximately 30-40 fold reduction), as determined by Q-RT_PCR. T II reports the sequences targeted by the siRNA molecules. The reduction of the expression of either of the two genes significantly impairs the proliferation and the invasiveness phenotypes of the MCF7 breast tumor cell line (
TABLE-US-00003 TABLE II NCBI gene siRNA Target Sequence KLRG2 CGAGGACAATCTGGATATCAA CTGGAGCCCTCGAGCAAGAAA ERMP1 CCCGTGGTTCATCTGATATAA AAGGACTTTGCTCGGCGTTTA TACGTGGATGTTTGTAACGTA CTCGTATTGGCTCAATCATAA
REFERENCES
[0234] 1) Anderson, L., and Seilhamer, J. (1997). A comparison of selected mRNA and protein abundances in human liver. Electrophoresis 18, 533-537; [0235] 2) Chen, G., Gharib, T. G., Wang, H., Huang, C. C., Kuick, R., Thomas, D. G., Shedden, K. A., Misek, D. E., Taylor, J. M., Giordano, T. J., Kardia, S. L., Iannettoni, M. D., Yee, J., Hogg, P. J., Orringer, M. B., Hanash, S. M., and Beer, D. G. (2003) Protein profiles associated with survival in lung adenocarcinoma. Proc. Natl. Acad. Sci. U.S.A 100, 13537-13542; [0236] 3) Ginestier, C., Charafe-Jauffret, E., Bertucci, F., Eisinger, F., Geneix, J., Bechlian, D., Conte, N., Adelaide, J., Toiron, Y., Nguyen, C., Viens, P., Mozziconacci, M. J., Houlgatte, R., Birnbaum, D., and Jacquemier, J. (2002) Distinct and complementary information provided by use of tissue and DNA microarrays in the study of breast tumor markers. Am. J. Pathol. 161, 1223-1233; [0237] 4) Gygi, S. P., Rochon, Y., Franza, B. R., and Aebersold, R. (1999) Correlation between protein and mRNA abundance in yeast. Mol. Cell. Biol. 19, 1720-1730; Nishizuka, S., Charboneau, L., Young, L., Major, S., Reinhold, W. C., Waltham, M., Kouros-Mehr, H., Bussey, K. J., Lee, J. K., Espina, V., Munson, P. J., Petricoin, E., III, Liotta, L. A., and Weinstein, J. N. (2003) Proteomic profiling of the NCI-60 cancer cell lines using new high-density reverse-phase lysate microarrays. Proc. Natl. Acad. Sci. U. S. A 100, 14229-14234; [0238] 5) Tyers, M., and Mann, M. (2003) From genomics to proteomics. Nature 422, 193-197; [0239] 6) Kagara N, Tanaka N, Noguchi S, Hirano T. (2007) Zinc and its transporter ZIP10 are involved in invasive behavior of breast cancer cells. Cancer Sci. 98:692-697; [0240] 7) Kasper G, Weiser A A, Rump A, Sparbier K, Dahl E, Hartmann A, Wild P, Schwidetzky U, Castaños-Velez E, Lehmann K. (2005) Expression levels of the putative zinc transporter LIV-1 are associated with a better outcome of breast cancer patients. Int J Cancer. 117:961-973; [0241] 8) Nguyen S T, Hasegawa S, Tsuda H, Tomioka H, Ushijima M, Noda M, Omura K, Miki Y, (2007) Identification of a predictive gene expression signature of cervical lymph node metastasis in oral squamous cell carcinoma., Cancer Sci. 98:740-746; [0242] 9) Garcia-Rudaz, C., Luna, F., Tapia, V., Kerr, B., Colgin, L., Galimi, F., Dissen, G. A., Rawlings, N. D. and Ojeda, S. R. (2007) Fxna, a novel gene differentially expressed in the rat ovary at the time of folliculogenesis, is required for normal ovarian histogenesis. Development. 134, 945-957; [0243] 10) Kratzschmar J, Haendler B, Eberspaecher U, Roosterman D, Donner P, Schleuning WD. (1996) The human cysteine-rich secretory protein (CRISP) family. Primary structure and tissue distribution of CRISP-1, CRISP-2 and CRISP-3. Eur J Biochem. 236:827-836 [0244] 11) Bjartell, A., Johansson, R., Bjork, T., adaleanu, V., Lundwall, A., Lilja, H., Kjeldsen, L. and Udby, L. (2006) Immunohistochemical detection of cysteine-rich secretory protein 3 in tissue and in serum from men with cancer or benign enlargement of the prostate gland, Prostate. 66: 591-603; [0245] 12) Bjartell, A. S., Al-Ahmadie, H., Serio, A. M., Eastham, J. A., Eggener, S. E., Fine, S. W., Udby, L., Gerald, W. L., Vickers, A. J., Lilja, H., Reuter, V. E. and Scardino, P. T. (2007), Association of cysteine-rich secretory protein 3 and beta-microseminoprotein with outcome after radical prostatectomy. Clin. Cancer Res. 13: 4130-4138.