PROKARYOTIC 2-COMPONENT SIGNALING PATHWAYS FOR USE AS LOGIC GATES IN MAMMALIAN CELLS

Abstract

The invention relates to mammalian cells comprising at least one prokaryotic two-component signaling (TCS) pathway comprised of an activator protein A, a response regulator (RR) protein B activated by said protein A, such activation leading to an activated RR protein B, and an output gene C operably linked to a promoter. Transcription from said promoter is activated by activated RR protein B, and the expression of output gene C defines at least a first state (0, no transcription) and a second state (1, detectable transcription). The invention further relates to logic gates designed from such cells, and methods for integrating a plurality of output signals based on the cells and logic gates of the invention.

Claims

1. A mammalian cell comprising at least one prokaryotic two-component signaling (TCS) pathway comprised of i. an activator protein A, ii. a response regulator (RR) protein B activated by said protein A, such activation leading to an activated RR protein B, and iii. an output gene C operably linked to a promoter, wherein transcription (of transcription apparatus in said mammalian cell) from said promoter is activated by activated RR protein B, and the expression of output gene C defines at least a first state (0, no transcription) and a second state (1, detectable transcription).

2. The mammalian cell according to claim 1, wherein the activator protein A is a histidine kinase molecule selected from envZ, NarX, DcuS and examples from FIG. 5.

3. The mammalian cell according to claim 1, wherein the RR protein B is a transcriptional regulator selected from ompR, NarL, DcuR and examples from FIG. 5.

4. The mammalian cell according to claim 1, wherein the output gene C encodes a fluorescent reporter, a protein or microRNA that affects the cell function or internal state.

5. The mammalian cell according to claim 1, wherein the output gene C is s amcyan.

6. The mammalian cell according to claim 1, wherein the activator protein A can be constitutively active or activated by input signals.

7. The mammalian cell according to claim 1, wherein the input signals are selected from: quinones, nitrate, nitrite, citrate, isocitrate, fumarate, succinate, malate, indole, serine, aspartate, chemoattractants, oxygen, carbon monoxide, nitrous oxide, blue light, vancomycin, potassium, quorum sensing molecules, temperature change, sulfate ions, nicotinic acid, changes in osmolarity, toluene, O-xylene, glutamine, 2-ketoglutarate, magnesium.

8. An engineered biological logic AND gate comprising the mammalian cell according to claim 1, wherein input 1 activates said activator protein A, input 2 activates said response regulator protein B and the output is the expression state of said output gene C.

9. The engineered biological logic AND gate according to claim 8, wherein input 2 activates a second activator protein A′, which is able to activate a second RR protein B′ that enables transcription of the first response regulator protein B.

10. The engineered biological logic AND gate according to claim 8, wherein input 1 and input 2 can be stimuli selected from: quinones, nitrate, nitrite, citrate, isocitrate, fumarate, succinate, malate, indole, serine, aspartate, chemoattractants, oxygen, carbon monoxide, nitrous oxide, blue light, vancomycin, potassium, quorum sensing molecules, temperature change, sulfate ions, nicotinic acid, changes in osmolarity, toluene, O-xylene, glutamine, 2-ketoglutarate, magnesium or stimuli controlling expression of the components selected from transcription factors or microRNAs.

11. An engineered biological logic OR gate comprising the mammalian cell according to claim 1, wherein input 1 activates said activator protein A, input 2 activates a second activator protein A′ able to activate the same RR protein B as activator protein A and the output is the expression state of said output gene C.

12. An engineered biological logic NOR gate comprising the mammalian cell according to claim 1, wherein input 1 is an inhibitor A- of said activator protein A, input 2 is an inhibitor B- of said RR protein B and the output is the expression state of said output gene C.

13. An engineered biological logic NAND gate comprising the mammalian cell according to claim 1, wherein input 1 is an inhibitor A- of said activator protein A, input 2 is an inhibitor A′- of said activator protein A′ and the output is the expression state of said output gene C.

14. A method for integrating a plurality of input signals and transducing them into an output signal comprising at least one of the engineered biological logic gates according to claim 8.

15. The method according to claim 14, wherein the input signals are selected from: i. a biological agent, ii. a chemical agent, iii. a metal ion, iv. a toxin, and v. a pollutant.

16. The method according to claim 14, wherein said output signal changes its state if said plurality of signals is specific for: i. an environmental condition, ii. a pollutant, iii. a pharmaceutical substance or prodrug, and iv. a disease state.

Description

SHORT DESCRIPTION OF THE FIGURES

[0032] FIG. 1 shows the schematics of native and transplanted two-component signaling pathways. A, The native pathway architecture consists of a receptor protein, which senses and propagates a signal to a cognate response regulator that activates gene expression. B, The envisioned adaptation to the mammalian host exemplified with EnvZ-OmpR pathway.

[0033] FIG. 2 shows basic characterization of the transplanted two-component pathways. A, Component requirements for response element activation. Each component combination is accompanied by representative microscopy pictures with red pseudocolor indicating the expression of DsRed transfection marker, and cyan pseudocolor indicating the expression of the AmCyan pathway output. The bar charts display AmCyan level in a.u. as mean±SD of independent biological triplicates. B, Cross-talk of HK::RR pairs with non-cognate response elements. C, Cross-talk of non-cognate HKs with RR::RE pairs, indicating that DcuS phosphorylates OmpR. D, Detailed look into the DcuS-OmpR cross-talk. DcuS-OmpR interaction is displayed using blue markers and cognate DcuS-DcuR is shown with red markers. Each data point is the average of independent duplicate measurement. E, The relationship between the amounts of HKs and RRs and the intensity of a reporter gene expression. For each surface plot, all pairwise combinations of HK and RR were measured with HK added at 0, 5, 50 and 150 ng per transfection in a 12-well plate and RR added at 0, 10, 30, 100 and 300 ng. Filler DNA was added to keep the total DNA amount constant. All data points are duplicate averages.

[0034] FIG. 3 shows complex control of gene expression with TCS pathways using antibiotic-controlled HK and RR genes. Circuit schematics are shown on the left and quantitative data for NarXL and DcuSR pathways are on the right. CMV-driven PIT2 and ET proteins activate HK and RR via pPIR and pETR promoters, respectively. The final concentration of PI and ET was 10 μg/ml and 4 μg/ml, respectively. The resultant data are presented as mean±SD of biological triplicates. Microscopy images are shown with red pseudocolor indicating the expression of DsRed transfection marker, and cyan pseudocolor indicating the expression of the AmCyan pathway output.

[0035] FIG. 4 shows utilization of TCS pathways and individual components for mammalian gene expression. A, Gene expression controlled by an OR gate configuration. Top, schematic representation of an OR gate using the presence of NarX and NarQ as inputs. Bottom, the quantification of the gate shown as mean±SD of biological triplicates with representative microscopy photos. The images are shown with red pseudocolor indicating the expression of DsRed transfection marker (top panel), and cyan pseudocolor indicating the expression of the AmCyan pathway output (lower panel). B, Activity of various mutant TCS components. Full-length, truncated and mutant TCS genes are represented with each protein domain color-coded and labeled. Experimental data are shown on the right. Each bar represents mean±SD of a biological triplicate. The output values for NarX+NarL and NarL were taken from the experiment in panel A; their results are again displayed in panel B merely for side-by-side comparison.

[0036] FIG. 5 shows examples of two-component signaling pathways in bacteria.

EXAMPLES

[0037] Signaling pathway engineering is a route toward synthetic biological circuits. Histidine-aspartate phosphorelays are thought to have evolved in prokaryotes where they form the basis for two-component signaling. Tyrosine-serine/threonine phosphorelays, exemplified by MAP kinase cascades, are predominant in eukaryotes. Rational re-wiring of these pathway families are known in the art. One example known in the art is the implementation of a prokaryotic two-component pathway in a plant species to sense environmental TNT. In this invention the inventors disclose the “transplantation” of two-component pathways into mammalian cells to provide an orthogonal and diverse toolkit for a variety of signal processing tasks. The inventors use two-component pathways in mammalian cell culture and use them for programmable control of gene expression. Therefore, coding sequences of histidine kinase (HK) and response regulator (RR) components were codon-optimized for human cells, while the RRs were fused with a transactivation domain. Responsive promoters were furnished by fusing DNA binding sites in front of a minimal promoter. The inventors disclose examples that co-expression of HKs and their cognate RRs in cultured mammalian cells are sufficient to strongly induce gene expression even in the absence of pathways' chemical triggers. Mutants that were constitutive in the native setting showed similar behavior in mammalian cells. The inventors further used the TCS pathways to implement two-input logical AND, NOR and OR gene regulation using inducible promoters to drive HKs and RRs. Thus, two component systems can be applied in different capacities in mammalian cells and their components can be utilized for large-scale synthetic gene circuits.

TCS is Partially Functional in Mammalian Cells

[0038] Transplanting prokaryotic TCS pathways to mammalian cell lines requires a number of necessary adaptations (FIG. 1B). Each gene coding for a TCS protein was codon-optimized to confer to human codon usage; furthermore they were placed under constitutive CMV immediate early promoter. The basic amino acid sequence of each HK and RR was preserved, while the RR sequences were augmented with 3×minimal VP16 transactivating domain at the C-terminus. (Note that nuclear localization signal was not fused to RRs.) Finally, the responsive promoter driving a fluorescent reporter AmCyan was created by fusing DNA binding sites of different RRs in front of a mammalian minimal promoter.

[0039] Three TCS pathways from E. Coli were selected and adapted to mammalian cells, including EnvZ-OmpR, NarXL and DcuSR. The design of adapted HKs and RRs was performed as described above, while the design of responsive promoters varied from case to case. For the OmpR response element (OmpR-RE), a consensus sequence ATTTACATTTTGAAACATCTA was used. Two copies of this sequence were separated by 10-bp spacer and inserted 18 bp upstream of the TATA box in the Core Minimal Promoter. For NarL response element (NarL-RE), a consensus sequence TACCCCTATAGGGGTA was used; two copies separated by 10 bp were used identically to the OmpR-RE above. Finally, for the DcuRsensitive promoter, DcuR response element was constructed using a single inverted repeat sequence TGATTAAAACTTTAAA-AAGTGCTG identified in the dctA gene promoter region. The aforementioned regulated promoters were cloned upstream from the fluorescent protein AmCyan.

[0040] First the inventors inquired whether coexpression of the pathway genes in cultured human cells would result in gene activation. They performed transient transfections into HEK293 cells with (i) none of the TCS expression cassettes; (ii) HK or RR cassettes alone and (iii) both HK and RR. All three pathways elicit strong expression of the reporter gene when both the HK and RR are present but not when either components is missing (FIG. 2A). The induction with DcuSR was weaker, perhaps due to having a single rather than a double DNA binding site in the promoter. These results indicates that major features of the pathways, such as protein folding, phosphorelay, and differential DNA binding and transactivation, are operational in human cells. At the same time, gene induction occurs in the absence of cognate external stimulus. While EnvZ-OmpR and NarXL pathways respond to generic inputs that could be present in the medium, DcuSR is responsive to fumarate. We performed fumarate titration and did not find clear evidence for pathway induction as most of the activity was already present at zero fumarate. Intermediate levels of fumarate seem to increase the output modestly, but even higher levels were inhibitory. Additionally, the RRs do not seem to be phosphorylated by the native kinases of HEK293 cells, as evidenced by low output expression level in the presence of RR alone.

TCS Orthogonality and Crosstalk in Human Cells

[0041] Multiple TCS function without extensive crosstalk in their endogenous milieu. Being able to operate multiple pathways in parallel would allow facile scaling up of genetic circuits. First, the canonical HK::RR pairs were kept together but the response elements were varied (FIG. 2B). The activation is highly-specific to the correct responsive promoter. In the second experiment, the RRs were combined with their cognate responsive promoter and the upstream HK was varied. In one case the inventors observed that an HK DcuS activates a non-cognate RR OmpR while in all other cases the phosphorelay is specific (FIG. 2C). The dose-response of the cognate as well as non-cognate DcuS activity was further investigated (FIG. 2D). The result shows markedly distinct behavior between the two cases. The correctly-assembled pathway exhibits sharp dose-response that decreases upon further increase in DcuS. At the same time, the cross-reactivity shows a monotonous and slow increase. Indeed, operating at the optimal level of humanized DcuS would result in high selectivity toward the cognate pathway.

[0042] Next the input-output relationship of the transplanted pathways was mapped. Therefore the amount of the response plasmid were fixed and the amounts of both HK and RR—encoding plasmids was varied (FIG. 2E). All pathways show marked sensitivity to the amount of HK, which is unsurprising given its enzymatic nature. The dependency on the amount of RR is gradual; however half the maximum induction is reached with very low amounts of both HK and RR relative to the response gene. The input-output map of DcuSR pathway reproduces the non-monotonous behavior observed in FIG. 2D. The possible reason for this behavior is that the dephosphorylated form of DcuS acts as a phosphatase for DcuR-P, similar to other histidine kinases.

TCSs as Building Blocks for Genetic Logic Circuits

[0043] The experiments above show that the response requires expression of both pathway components. Such mode of operation is often described as an AND logic with the inputs in this case being the expression of HK and RR, respectively. Controlling these genes with external stimuli will generate additional logic behaviors. To exemplify this possibility, the inventors cloned the components of NarXL and DcuSR pathways in vectors controlled by engineered transactivators PIT2 (Fussenegger et al., Nat Biotech 200, 18(11), 1203-1208) and ET (Weber et al., Nat Biotech, 20(9), 901-907). This allowed for antibiotics erythromycin (ET) and pristinamycin 1A (PI) to control the circuit output. Since both cofactors are inhibitors of DNA binding of their cognate transactivators, the underlying AND logic translates into NOR logic when the antibiotics comprise the external inputs (FIG. 3). The resultant logic behavior is consistent with expectation (highest output in the absence of both inputs, low output otherwise). The NarXL pathway displays the largest dynamic range, while with DcuSR pathway the leakage in one of the OFF states is likely due to very high sensitivity of this pathway to minute amounts of the DcuS HK and residual expression of DcuS in the presence of PI. The low level of induction in the ON state is due to multiple plasmid cotransfection.

[0044] In addition to linear pathways that enable AND gates in human cells, natural TCS crosstalk provides additional types of logic control. For example, HK NarQ is capable of activating NarL almost as efficiently as NarX. Therefore a pathway in which humanized NarL is controlled by both NarX and NarQ was constructed and the response measured as the function of NarX and NarQ presence (FIG. 4A). Indeed, an almost perfect OR behavior is observed. The results indicate that complex logic is possible with naturally interacting pathways.

Known Mutant Behaviors are Recapitulated in the Mammalian Host

[0045] TCS research uncovered a large number of mutants that possess certain qualities that could be of use in synthetic pathways. For example, it is known that cytoplasmic domains of HKs result in constitutive signaling. A cytoplasmic domain of EnvZ (EnvZ cyt) was constructed and found that it supports constitutive signal transduction via OmpR. A mutant RR OmpR D55E is known to be a constitutive activator in bacteria, and its humanized version functions as a constitutive activator as well. Likewise, C-terminal domain of NarL (NarLc) is constitutive in bacteria and it remains a very strong inducer of NarL-RE in mammalian cells. This suggest that the findings made in the native prokaryotic setting translate into the humanized system, and that humanized pathways operate along the same mechanistic principles as they do in prokaryotes. They also illustrate that TCS-encoding genes and their variants can be used as a huge source of “biological parts” for mammalian gene circuits.

DISCUSSION

[0046] Histidine-aspartate phosphorelay is absent from vertebrate cells while it is found in plants, yeast, lower eukaryotes and most commonly in prokaryotes. The lack of homologous genes in vertebrates suggested prokaryotic TCS pathways as orthogonal signal processing modules in mammalian cells for circuit engineering. However, the preservation of the basic biochemical processes during mammalian “transplantation” was by no means guaranteed, as it required three conditions. First, the internal operation of a pathway has to be preserved as much as possible. Second, the pathway components should not affect the host nonspecifically. Third, the host should not interfere with the pathway components.

[0047] The inventors disclose herein that the phosphorelays between HK and RR, and differential DNA binding by the RR followed by gene induction, occur in mammalian cells. The presence of a cognate ligand does not seem to be necessary even though it modestly modulates pathway activity, at least in the case of DcuSR. However, the fact that full-length HK genes were functional suggests that they were properly folded and associated with a membrane. With respect to pathway effect on the host cells, no gross adverse effects were observed. The DNA binding sequences of the different RR are long and are not expected to occur frequently in the human genome. Finally, the response elements were silent in HEK293 cells on their own, meaning that no endogenous activator bound to these sites. RRs in combination with REs generated only low background expression, likely due to residual DNA binding of the non-phosphorylated RRs rather than due to phosphoryl transfer to the RR by endogenous kinases.

[0048] Among themselves, the pathways exhibited impressive lack of cross-reactivity. One unexpected interaction was uncovered between DcuS and OmpR. This cross-talk assay presents an attractive approach to study TCS biochemistry in vivo on the clean background devoid of interference. Even in the absence of response to external ligands, TCS can support complex logic signal integration in mammalian cells. Examples of AND, NOR and OR gates using constitutive and inducible HKs and RRs are disclosed in this invention. Given the difficulty to implement AND-like gene activation in mammalian cells, adapted TCS pathways are an attractive new source of such control elements. In addition, constitutive mutants act consistently with their behavior in prokaryotes; these mutants can be a rich source of simple and mutually-orthogonal building blocks in large gene circuits.