GENOME EDITING FOR THE TREATMENT OF HUNTINGTON'S DISEASE
20170224843 · 2017-08-10
Assignee
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N2740/16043
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
A61K38/465
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
A61K48/005
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
International classification
A61K48/00
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
Abstract
A treatment of Huntington's disease (HD) using the Clustered-Regularly Interspaced Short Palindromic Repeats (CRISPR) system. This technology offers the possibility to design a small RNA (sgRNA), which is incorporated into a CRISPR-associated protein (Cas9) to recognize and induce DNA double-strand breaks at a specific target location. In the context of HD, this allows to block the expression of the mutant huntingtin or repair the CAG expansion causing the disease.
Claims
1. A kit for the treatment of Huntington's disease (HD) for allele or non-allele-specific huntingtin (HTT) gene editing or repair comprising: a gene delivery vector consisting of at least one viral vector selected among adeno-associated vector serotypes (AAV) and/or lentiviral vectors (LV); a Cas9 being human codon-optimized or fused to an epitope tag selected among the group of FLAG, His, myc, Tap, HA, V5; at least one artificial single guide RNA (sgRNA) having a total size from 63-115 nucleotides comprising a tracrRNA sequence of 48-85 nucleotides long and a crRNA sequence of 15-30 nucleotides recognizing the sequence of the HTT gene around the expanded CAG repeat mutation (ENSG00000197386, position of the first CAG repeat in exon 1: 3′074′877-3′074′879), and comprising the region upstream of the HTT gene (position 3066800) up to the beginning of intron 2 (position 3087600), wherein said crRNA sequence binds directly upstream of the required 5′-NGG/NAG-3′ protospacer adjacent motif (PAM) and whereas said crRNA sequence base-pairs with the target HTT sequence and Cas9 mediates a double-stranded break (DSB) 3-4 bp upstream of said PAM.
2. The kit for the treatment of Huntington's disease of claim 1, wherein said gene delivery vector contains various expression cassettes comprising promoters and/or miRNA-regulated system so as to modulate transgene expression.
3. The kit for the treatment of Huntington's disease according to claim 1, wherein said AAV is a mutant vector.
4. The kit for the treatment of Huntington's disease according to claim 3, wherein said AAV is the AAV-DJ.
5. The kit for the treatment of Huntington's disease according to claim 1, wherein said Cas9 is mutated to improve the efficiency and safety.
6. The kit for the treatment of Huntington's disease according to claim 5, wherein said mutated Cas9 is a Cas9 nickase.
7. The kit for the treatment of Huntington's disease according to claim 5, wherein said mutated Cas9 is a Cas9-V5.
8. The kit for the treatment of Huntington's disease according to claim 1, wherein said gene delivery vector consists in a single vector or several vectors.
9. The kit for the treatment of Huntington's disease according to claim 1, wherein said kit comprises multiple transcriptionally independent sgRNA targeting the HTT gene.
10. The kit for the treatment of Huntington's disease according to claim 1, wherein said artificial sgRNA comprising a crRNA sequence of 15-30 nucleotides recognizing the HTT gene is human-specific or a conserved sequence between human, rodent and primates with a maximum tolerated number of mismatches between sgRNA and HTT gene of 3 in the first 8 nucleotides of the sgRNA.
11. The kit for the treatment of Huntington's disease according to claim 1, wherein said artificial crRNA sequence of 15-30 nucleotides is encoded by the sequences selected among the group of SEQ ID NO: 4-7 and 13-39.
12. The kit for the treatment of Huntington's disease according to claim 1, further comprising an exogenous DNA template having at least 95% of homology with the homology arms located 10-20 bp away from the double strand break site and with a minimum length of 100 bp and up to 2.5 kb on both side of the double-stranded break (DSB).
13. The kit for the treatment of Huntington's disease according to claim 12, wherein said exogenous DNA template for HR contains or not the HTT transcriptional start sites (TSS)
14. The kit for the treatment of Huntington's disease according to claim 13, wherein said exogenous DNA template for HR does not contain the TSS.
15. The kit for the treatment of Huntington's disease according to claim 12, wherein said exogenous DNA template for HR is selected among the group comprising SEQ ID NO: 42-43.
16. The kit for the treatment of Huntington's disease according to claim 1, for use in a method for non-allele-specific HTT inactivation of the human HTT wild-type and mutant alleles.
17. The kit for the treatment of Huntington's disease according to claim 1, for use in a method for non-allele-specific HTT gene repair based on HR with a DNA template containing a wild-type HTT sequence.
18. The kit for the treatment of Huntington's disease according to claim 1, for use in a method for allele-specific HTT inactivation of the human mutant HTT gene wherein said at least one sgRNA is capable of recognizing SNP sequences located upstream a PAM along the HTT gene with a high frequency of heterozygosity in the human population>5% (according to dbSNP or 1000 Genome Project database).
19. The kit for the treatment of Huntington's disease according to claim 1, for use in a method for mutant HTT gene repair based on HR with a DNA template containing a wild-type HTT sequence, wherein said at least one sgRNA is capable of recognizing SNP sequences located upstream a PAM along the HTT gene with a high frequency of heterozygosity in the human population>5% (according to dbSNP or 1000 Genome Project database).
20. The kit for the treatment of Huntington's disease according to claim 1, further comprising an additional transcriptionally independent artificial sgRNA capable of self-inactivating Cas9 expression after human HTT editing, wherein said additional transcriptionally independent artificial sgRNA comprises a crRNA sequence of 15-30 nucleotides which recognizes key regions driving Cas9 expression selected among the ATG and/or the promoter driving the expression of Cas9.
21. The kit for the treatment of Huntington's disease according to claim 1, for use in a method of treating neuronal and glial cells in a patient in need thereof, wherein said gene delivery vector used to deliver said Cas9 and said at least one artificial single guide RNA (sgRNA) is suitable for a local administration in the human striatum or is engineered to allow diffusion and/or transport from the striatum to the entire of the basal ganglia network of said patient.
22. The kit for use according to claim 21, wherein said gene delivery vector is capable of targeting neurons and/or glial cells.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
BRIEF DESCRIPTION OF THE SEQUENCES
[0028] SEQ ID NO: 1 corresponds to the 82 nucleotides of the artificial chimeric tracrRNA containing the poly-T signal: 5′-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAA AAAGTGGCACCGAGTCGGTGCTTTTTT-3′
[0029] SEQ ID NO: 2 corresponds to the 20 nucleotides of the artificial sgTARGET:
TABLE-US-00001 5′-GGCTGCTGTCAGGGCTAGCA-3′
[0030] SEQ ID NO: 3 corresponds to the 20 nucleotides of the artificial sgGFP:
TABLE-US-00002 5′-GAAGTTCGAGGGCGACACCC-3′
[0031] SEQ ID NO: 4 corresponds to the 20 nucleotides of the sgHTT1 in exon 1, which is conserved between human, Macaca Fascicularis and Mus Musculus HTT gene with one mismatch at position 1 (G/A):
TABLE-US-00003 5′-GACCCTGGAAAAGCTGATGA-3′
[0032] SEQ ID NO: 5 corresponds to the 20 nucleotides of the sgHTT2, which is fully conserved between humans, Macaca Fascicularis, Rattus Norvegicus and Mus Musculus HTT gene:
TABLE-US-00004 5′-GTGGATGACATAATGCTTTT-3′
[0033] SEQ ID NO: 6 corresponds to the 20 nucleotides of the sgHTT3 between exon 1 and between intron 1, which is conserved between humans, Macaca Fascicularis, Rattus Norvegicus and Mus Musculus HTT gene with one mismatch at position 4 (G/A):
TABLE-US-00005 5′-GGAGCCGCTGCACCGACCGT-3′
[0034] SEQ ID NO: 7 corresponds to the 20 nucleotides of the sgHTT4, which is human specific with SNP rs13102260 at position 20 (G/A underline) for allele-specific approaches:
TABLE-US-00006 5′-TGGGACGCAAGGCGCCGTGG-3′
[0035] SEQ ID NO: 8 corresponds to the human codon-optimized Cas9 fused to one nuclear localization signal (NLS coding for: PKKKRKV) at the C-terminus (sequence: https://www.addgene.org/41815, (17)).
[0036] SEQ ID NO: 9 corresponds the artificial HR sequence used in the example 2 containing the end of the mCherry, the corrected target site and the GFP sequence.
[0037] SEQ ID NO: 10 corresponds to the 20 nucleotides of the artificial sgGFP2:
TABLE-US-00007 5′-GCTGAAGGGCATCGACTTCA-3′
[0038] SEQ ID NO: 11 corresponds to the 20 nucleotides of the artificial sgGFP3:
TABLE-US-00008 5′-CAACTACAAGACCCGCGCCG-3′
[0039] SEQ ID NO: 12 corresponds to the lentiviral vector SIN-cPPT-H1-sgGFP1-U6-sgGFP2-7SK-sgGFP3-PGK-mCherry-WPRE for the expression of multiple sgRNA under the control polymerase III promoters (H1, U6, 7SK) and containing a mCherry reporter gene to visualize infected cells.
[0040] SEQ ID NO: 13 corresponds to the 20 nucleotides of the artificial sgHTT24, which is human-specific and containing the human SNP rs9993542 at position 19 (C/T) for allele-specific approaches:
TABLE-US-00009 5′-GGTAATTTGTGTTTGTGTGC-3′
[0041] The sgHTT24 was designed on the complementary strand of the HTT gene, as a consequence the polymorphism of the human SNP rs9993542 at position 19 corresponds to the complementary sequence (G/A underline).
[0042] SEQ ID NO: 14 corresponds to the 20 nucleotides of the artificial sgHTT25, which is human specific with SNP rs762855 at position 18 (A/G) for allele-specific approaches
TABLE-US-00010 5′-GACAGCAGAGAAACAGCTGT-3′
[0043] The sgHTT25 was designed on the complementary strand of the HTT gene, as a consequence the polymorphism of the human SNP rs762855 at position 18 corresponds to the complementary sequence (T/C underline).
[0044] SEQ ID NO: 15 corresponds to the 20 nucleotides of the artificial sgHTT5, which is conserved between human and Macaca Fascicularis with one mismatch at the 11.sup.th position from 5′ (A/G) and containing the human SNP rs762855 at position 11 (A/G) for allele-specific approaches
TABLE-US-00011 5′-GAGAAACAGCTGTTAGTTCC-3′
[0045] The sgHTT5 was designed on the complementary strand of the HTT gene, as a consequence the polymorphism of the human SNP rs762855 at position 11 corresponds to the complementary sequence (T/C underline).
[0046] SEQ ID NO: 16 corresponds to the 20 nucleotides of the artificial sgHTT26, which is human specific with SNP rs9996199 at position 19 (C/G) for allele-specific approaches
TABLE-US-00012 5′-TGGCTAAAGTAGGCTTTACT-3′
[0047] SEQ ID NO: 17 corresponds to the 20 nucleotides of the artificial sgHTT6, which is human specific with SNP rs28431418 at position 19 (T/C underline) for allele-specific approaches
TABLE-US-00013 5′-CAGGGCTGTCCGGGTGAGTA-3′
[0048] SEQ ID NO: 18 corresponds to the 20 nucleotides of the artificial sgHTT7, which is human specific with SNP rs28431418 at position 13 (T/C underline) for allele-specific approaches
TABLE-US-00014 5′-TGTCCGGGTGAGTATGGCTC-3′
[0049] SEQ ID NO: 19 corresponds to the 20 nucleotides of the artificial sgHTT27, which is human specific with SNP rs2857935 at position 20 (G/C/T) for allele-specific approaches
TABLE-US-00015 5′-AGGCCCATGCGGAAAGGATC-3′
[0050] The sgHTT27 was designed on the complementary strand of the HTT gene, as a consequence the polymorphism of the human SNP rs2857935 at position 20 corresponds to the complementary sequence (C/G/A underline).
[0051] SEQ ID NO: 20 corresponds to the 20 nucleotides of the artificial sgHTT8, which is human specific with SNP rs2857935 at position 8 (G/C/T underline) for allele-specific approaches
TABLE-US-00016 5′-GGCGGGGGATCCTTTCCGCA-3′
[0052] SEQ ID NO: 21 corresponds to the 20 nucleotides of the artificial sgHTT10, which is human specific with SNP rs13122415 at position 17 (C/G) for allele-specific approaches
TABLE-US-00017 5′-GGGGCTCAACGGAGAGGGGA-5′
[0053] The sgHTT10 was designed on the complementary strand of the HTT gene, as a consequence the polymorphism of the human SNP rs13122415 at position 17 corresponds to the complementary sequence (G/C underline)
[0054] SEQ ID NO: 22 corresponds to the 20 nucleotides of the artificial sgHTT28, which is human specific with SNP rs13132932 at position 19 (A/G underline) for allele-specific approaches
TABLE-US-00018 5′-GGCAGAACCTGCGGGGGCAG-3′
[0055] SEQ ID NO: 23 corresponds to the 20 nucleotides of the artificial sgHTT9, which is human specific with SNP rs13132932 at position 15 (A/G underline) for allele-specific approaches
TABLE-US-00019 5′-GAACCTGCGGGGGCAGGGGC-3′
[0056] SEQ ID NO: 24 corresponds to the 20 nucleotides of the artificial sgHTT14, which is human specific with SNP rs34045730 at position 17 (A/T underline) for allele-specific approaches
TABLE-US-00020 5′-ATTTTACCAGTATTCCAGTC-3′
[0057] SEQ ID NO: 25 corresponds to the 20 nucleotides of the artificial sgHTT15, which is human specific with SNP rs28656215 at position 20 (C/T underline) for allele-specific approaches
TABLE-US-00021 5′-CTGTGTGTCGAGTGTACAGT-3′
[0058] SEQ ID NO: 26 corresponds to the 20 nucleotides of the artificial sgHTT16, which is human specific with SNP rs3856973 at position 20 (G/A) for allele-specific approaches
TABLE-US-00022 5′-ATAAAAATAAGTTAACACTC-3′
[0059] The sgHTT16 was designed on the complementary strand of the HTT gene, as a consequence the polymorphism of the human SNP rs3856973 at position 20 corresponds to the complementary sequence (C/T underline).
[0060] SEQ ID NO: 27 corresponds to the 20 nucleotides of the artificial sgHTT17, which is human specific with SNP rs57666989 at position 14 (C/T) for allele-specific approaches
TABLE-US-00023 5′-GCAGGAGAATGGCGTGAACT-3′
[0061] The sgHTT17 was designed on the complementary strand of the HTT gene, as a consequence the polymorphism of the human SNP rs57666989 at position 14 corresponds to the complementary sequence (G/A underline).
[0062] SEQ ID NO: 28 corresponds to the 20 nucleotides of the artificial sgHTT19, which is fully conserved between human and Macaca Fascicularis with human SNP rs61792477 at position 12 (C/T underline) for allele-specific approaches
TABLE-US-00024 5′-ATAATATAGTACGGCCACTC-3′
[0063] SEQ ID NO: 29 corresponds to the 20 nucleotides of the artificial sgHTT20, which is human specific with SNP rs28867436 at position 19 (A/G underline) for allele-specific approaches
TABLE-US-00025 5′-CATAAAACTGAACATACCGT-3′
[0064] SEQ ID NO: 30 corresponds to the 20 nucleotides of the artificial sgHTT21, which is human specific with SNP rs2285087 at position 15 (A/G underline) for allele-specific approaches
TABLE-US-00026 5′-AGCAATTGGGCAACATCGTG-3′
[0065] SEQ ID NO: 31 corresponds to the 20 nucleotides of the artificial sgHTT30, which is human specific with SNP rs2285087 at position 17 (A/G) for allele-specific approaches
TABLE-US-00027 5′-AGACGGGGCCTCACGATGTT-3′
[0066] The sgHTT30 was designed on the complementary strand of the HTT gene, as a consequence the polymorphism of the human SNP rs2285087 at position 17 corresponds to the complementary sequence (T/C underline).
[0067] SEQ ID NO: 32 corresponds to the 20 nucleotides of the artificial sgHTT22, which is human specific with SNP rs2285086 at position 20 (A/G) for allele-specific approaches
TABLE-US-00028 5′-AGAAGGTGCTGCTAGTTCAT-3′
[0068] The sgHTT22 was designed on the complementary strand of the HTT gene, as a consequence the polymorphism of the human SNP rs2285086 at position 20 corresponds to the complementary sequence (T/C underline).
[0069] SEQ ID NO: 33 corresponds to the 20 nucleotides of the artificial sgHTT18, which is human specific with SNP rs61792473 at position 12 (C/T) and rs61792474 at position 14 (C/T) for allele-specific approaches
TABLE-US-00029 5′-TGTGTGTGTGTGTGTATATT-3′
[0070] The sgHTT18 was designed on the complementary strand of the HTT gene, as a consequence the polymorphism of the human SNP SNP rs61792473 at position 12 and rs61792474 at position 14 corresponds to the complementary sequence (G/A underline).
[0071] SEQ ID NO: 34 corresponds to the 20 nucleotides of the artificial sgHTT13, which is human specific with SNP rs58870770 at position 19 (−/A) (−=deletion of one nucleotide) for allele-specific approaches
TABLE-US-00030 5′-GTTGTGGTTGCCAAGTAAAG-3′
[0072] SEQ ID NO: 35 corresponds to the 20 nucleotides of the artificial sgHTT12, which is human specific with SNP rs150577220 at position 14 (−/A) (−=deletion of one nucleotide) for allele-specific approaches
TABLE-US-00031 5′-GGAGTGGCGGGGCAGGGGGG-3′
[0073] SEQ ID NO: 36: corresponds to the 20 nucleotides of the human-specific artificial sgHTT31:
TABLE-US-00032 5′-CGGGACGGGTCCAAGATGGA-3′
[0074] SEQ ID NO 37: corresponds to the 20 nucleotides of the human-specific artificial sgHTT35, which is fully conserved human and Macaca Fascicularis
TABLE-US-00033 5′-GGGCTGTCAATCATGCTGGC-3′
[0075] SEQ ID NO: 38: corresponds to the 20 nucleotides of the artificial sgHTT33, which is fully conserved between human and Macaca Fascicularis:
TABLE-US-00034 5′-CTTTTCCAGGGTCGCCATGG-3′
[0076] SEQ ID NO: 39: corresponds to the 20 nucleotides of the artificial sgHTT34, which is fully conserved between human and Macaca Fascicularis:
TABLE-US-00035 5′-GACAATATGTGAAAACATAG-3′
[0077] SEQ ID NO: 40 corresponds to the 20 nucleotides of the artificial sgCas9:
TABLE-US-00036 5′-AATGGAGTACTTCTTGTCCA-3′
[0078] SEQ ID NO: 41 Cas9-V5 corresponds to the human codon-optimized Cas9 fused to one nuclear localization signal and V5 epitope at the C-terminus of Cas9 to visualize the protein.
[0079] SEQ ID NO: 42 human HTT with the TSS corresponds to one exogenous DNA template used for HR.
[0080] SEQ ID NO: 43 human HTT HR without the TSS corresponds to one exogenous DNA template used for HR.
DETAILED DESCRIPTION OF THE INVENTION
[0081] Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. The publications and applications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. In addition, the materials, methods, and examples are illustrative only and are not intended to be limiting.
[0082] In the case of conflict, the present specification, including definitions, will control. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in art to which the subject matter herein belongs. As used herein, the following definitions are supplied in order to facilitate the understanding of the present invention.
[0083] The term “comprise” is generally used in the sense of include, that is to say permitting the presence of one or more features or components.
[0084] As used in the specification and claims, the singular forms “a”, “an” and “the” include plural references unless the context clearly dictates otherwise.
[0085] As used herein the terms “subject” or “patient” are well-recognized in the art, and, are used interchangeably herein to refer to a mammal, including dog, cat, rat, mouse, monkey, cow, horse, goat, sheep, pig, camel, and, most preferably, a human. In some embodiments, the subject is a subject in need of treatment or a subject with a disease or disorder. However, in other embodiments, the subject can be a normal subject. The term does not denote a particular age or sex. Thus, adult and newborn subjects, whether male or female, are intended to be covered.
[0086] The term “an effective amount” refers to an amount necessary to obtain a physiological effect. The physiological effect may be achieved by one application dose or by repeated applications.
[0087] The dosage administered may, of course, vary depending upon known factors, such as the physiological characteristics of the particular composition; the age, health and weight of the subject; the nature and extent of the symptoms; the kind of concurrent treatment; the frequency of treatment; and the effect desired and can be adjusted by a person skilled in the art.
[0088] The terms “nucleic acid,” “polynucleotide,” and “oligonucleotide” are used interchangeably and refer to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation, and in either single- or double-stranded form. For the purposes of the present disclosure, these terms are not to be construed as limiting with respect to the length of a polymer. The terms can encompass known analogues of natural nucleotides, as well as nucleotides that are modified in the base, sugar and/or phosphate moieties (e.g. phosphorothioate backbones). In general, an analogue of a particular nucleotide has the same base-pairing specificity; i.e., an analogue of A will base-pair with T.
[0089] The terms “polypeptide,” “peptide” and “protein” are used interchangeably to refer to a polymer of amino acid residues. The term also applies to amino acid polymers in which one or more amino acids are chemical analogues or modified derivatives of a corresponding naturally-occurring amino acids.
[0090] “Recombination” refers to a process of exchange of genetic information between two polynucleotides. For the purposes of this disclosure, “homologous recombination (HR)” refers to the specialized form of such exchange that takes place, for example, during repair of double-strand breaks in cells via homology-directed repair mechanisms. This process requires nucleotide sequence homology, uses a “donor” molecule to template repair of a “target” molecule (i.e. the one that experienced the double-strand break), and is variously known as “non-crossover gene conversion” or “short tract gene conversion,” because it leads to the transfer of genetic information from the donor to the target. Without wishing to be bound by any particular theory, such transfer can involve mismatch correction of heteroduplex DNA that forms between the broken target and the donor, and/or “synthesis-dependent strand annealing,” in which the donor is used to resynthesize genetic information that will become part of the target, and/or related processes. Such specialized HR often results in an alteration of the sequence of the target molecule such that part or all of the sequence of the donor polynucleotide is incorporated into the target polynucleotide.
[0091] A “reporter gene” or “reporter sequence” refers to any sequence that produces a protein product that is easily measured, preferably although not necessarily in a routine assay. Suitable reporter genes include, but are not limited to, sequences encoding proteins that mediate antibiotic resistance (e.g., ampicillin resistance, neomycin resistance, G418 resistance, puromycin resistance), sequences encoding colored or fluorescent or luminescent proteins (e.g., green fluorescent protein, enhanced green fluorescent protein, red fluorescent protein, luciferase), and proteins which mediate enhanced cell growth and/or gene amplification (e.g., dihydrofolate reductase).
[0092] The term “Tag” refers to short amino acid sequences constituting an epitope recognized by an antibody. Epitope tags are added at the N- or C-terminus of a protein to facilitate visualization by immunohistochemistry. Epitope tags include, for example, one or more copies of FLAG, His, myc, Tap, HA, V5 or any detectable amino acid sequence. Cas9 has been previously fused to FLAG tags however; Applicants preferably use the V5 tag to localize Cas9 protein in the present experiments. “Expression tags” include sequences that encode reporters that may be operably linked to a desired gene sequence in order to monitor expression of the gene of interest.
[0093] “The CRISPR” (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 (CRISPR Associated) nuclease system is a recently engineered nuclease system based on a bacterial system that can be used for genome engineering. It is based on part of the adaptive immune response of many bacteria and archea. When a virus or plasmid invades a bacterium, segments of the invader's DNA are converted into CRISPR RNAs (crRNA) by the ‘immune’ response. This crRNA then associates, through a region of partial complementarity, with another type of RNA called tracrRNA to guide the Cas9 nuclease to a region homologous to the crRNA in the target DNA called a “protospacer.” Cas9 cleaves the DNA to generate blunt ends at the DSB at sites specified by a 20-nucleotide guide sequence contained within the crRNA transcript. Cas9 requires both the crRNA and the tracrRNA for site-specific DNA recognition and cleavage. This system has now been engineered such that the crRNA and tracrRNA can be combined into one molecule (the “single guide RNA”), and the crRNA equivalent portion of the single guide RNA can be engineered to guide the Cas9 nuclease to target any desired sequence (9, 18). Thus, the CRISPR/Cas9 system can be engineered to create a DSB at a desired target in a genome, and repair of the DSB can be influenced by the use of repair inhibitors to cause an increase in error prone repair.
[0094] As used herein the term “selectivity of an sgRNA” relates to the ability for an sgRNA sequence and Cas9 complex, to recognize a particular allele of a target gene (i.e. mutant vs WT allele of HTT).
[0095] The term “specificity of an sgRNA” relates to the ability for a given sgRNA sequence and Cas9 complex to recognize a given target i.e., the HTT gene.
[0096] The term “haplotype” relates to the ordered, linear combination of polymorphisms (e.g., SNPs) in the sequence of each form of a gene (on individual chromosomes) that exists in the population.
[0097] The term “small insertions-deletions (indels)” relates to small insertion or deletions in genomic DNA due to cellular DNA repair following DSB by non-homologous end joining (NHEJ).
[0098] The term “allele” relates to a particular form of a genetic locus, distinguished from other forms by its specific nucleotide sequence.
[0099] A “Single Nucleotide Polymorphism” (SNP) refers to a single base (nucleotide) difference in a specific location in the DNA sequence among individuals in a population. A subset of SNPs gives rise to changes in the encoded amino acid sequence; these are referred to as coding SNPs, or cSNPs.
[0100] The term “allele-specific” when used in reference to nucleic acid sequences, such as oligonucleotides, primers, sgRNA, means that a particular position of the nucleic acid sequence is complementary with an allele of a target polynucleotide sequence. Allele-specific sgRNA are capable of discriminating between different alleles of a target polynucleotide.
[0101] The term “vector”, as used herein, refers to a DNA or RNA molecule such as a plasmid, virus or other vehicle, which contains one or more heterologous or recombinant DNA sequences and is designed for transfer between different host cells. The terms “expression vector” and “gene therapy vector” refer to any vector that is effective to incorporate and express heterologous DNA fragments in a cell. A cloning or expression vector may comprise additional elements, for example, post-transcriptional regulatory elements. Any suitable vector can be employed that is effective for introduction of nucleic acids into cells, e.g. a viral vector. The terms “heterologous DNA” refer to a “heterologous coding or non-coding sequence” or a “transgene”.
[0102] The term “homology” between two sequences is determined by sequence identity. If two sequences, which are to be compared with each other differ in length, sequence identity preferably relates to the percentage of the nucleotide residues of the shorter sequence which are identical with the nucleotide residues of the longer sequence. Sequence identity can be determined conventionally with the use of computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive Madison, Wis. 53711). Bestfit utilizes the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2 (1981), 482-489, in order to find the segment having the highest sequence identity between two sequences. When using Bestfit or another sequence alignment program to determine whether a particular sequence has for instance 95% identity with a reference sequence of the present invention, the parameters are preferably so adjusted that the percentage of identity is calculated over the entire length of the reference sequence and that homology gaps of up to 5% of the total number of the nucleotides in the reference sequence are permitted. When using Bestfit, the so-called optional parameters are preferably left at their preset (“default”) values. The deviations appearing in the comparison between a given sequence and the above-described sequences of the invention may be caused for instance by addition, deletion, substitution, insertion or recombination. Such a sequence comparison can preferably also be carried out with the program “fasta20u66” (version 2.0u66, September 1998 by William R. Pearson and the University of Virginia; see also W. R. Pearson (1990), Methods in Enzymology 183, 63-98, appended examples and http://workbench.sdsc.edu/). For this purpose, the “default” parameter settings may be used.
[0103] It is one object of the invention to provide a kit for the treatment of Huntington's disease (HD) for allele or non-allele-specific huntingtin (HTT) gene editing or repair comprising: [0104] a gene delivery vector consisting of at least one viral vector selected among adeno-associated vector serotypes (AAV) and/or lentiviral vectors (LV); [0105] a Cas9 being human codon-optimized or fused to an epitope tag selected among the group of FLAG, His, myc, Tap, HA, V5. Preferably Cas9 is fused to an epitope tag (e.g V5 tag). [0106] at least one artificial single guide RNA (sgRNA) having a total size from 63-115 nucleotides comprising a tracrRNA sequence of 48-85 nucleotides long (preferably 82 bp) and a crRNA sequence of 15-30 nucleotides (preferably 20 bp) recognizing the sequence of the HTT gene around the expanded CAG repeat mutation (ENSG00000197386, position of the first CAG repeat in exon 1: 3′074′877-3′074′879), and comprising the region upstream of the HTT gene (position 3066800) up to the beginning of intron 2 (position 3087600), wherein said crRNA sequence binds directly upstream of the required 5′-NGG/NAG-3′ protospacer adjacent motif (PAM) and whereas said crRNA sequence base-pairs with the target HTT sequence and Cas9 mediates a double-stranded break (DSB) 3-4 bp upstream of said PAM.
[0107] In particular, the region around the expanded CAG repeat mutation in the HTT gene includes:
[0108] the promoter (Ensembl accession number: ENSG00000197386; positions 3066800 to 3074509),
[0109] exon 1 of the HTT gene including the 5′UTR the transcription and translation start sites (TSS and ATG; Ensembl accession number: ENSG00000197386: positions 3074510 to 3075088),
[0110] intron 1 of the HTT (Ensembl accession number: ENSG00000197386: positions 3075089 to 3086939),
[0111] exon 2 (Ensembl accession number: ENSG00000197386: positions 3086940 to 3087023),
[0112] and 5′ end on intron 2 (Ensembl accession number: ENSG00000197386: positions 3087024 to 3087600).
[0113] Preferably, the gene delivery vector contains various expression cassettes comprising promoters and/or miRNA-regulated system so as to modulate transgene expression.
[0114] In a preferred mode of the invention, the AAV is a mutant vector and preferably the AAV-DJ for HR.
[0115] In another embodiment, of the invention, the Cas9 is mutated to improve the efficiency and safety. Preferably said mutated Cas9 is a Cas9 nickase or a Cas9-V5.
[0116] In another embodiment of the invention the gene delivery vector consist in a single vector or several gene delivery vectors.
[0117] According to a preferred mode of the invention, the kit comprises multiple transcriptionally independent sgRNA targeting the HTT gene.
[0118] In particular, said artificial sgRNA comprises a sequence (crRNA) recognizing a target site of 15-30 nucleotides, preferably 20 nt, recognizing the HTT gene is human-specific or a conserved sequence between human, rodent and primates with a maximum tolerated number of mismatches between sgRNA and HTT gene of 3 in the first 8 nucleotides of the sgRNA.
[0119] According to a preferred mode, said artificial crRNA sequence of 15-30 nucleotides is encoded by the sequences selected among the group of SEQ ID NO: 4-7, SEQ ID NO: 13-39 and/or biological active fragments, variants or mutants thereof being able to recognize the HTT gene.
[0120] In another embodiment of the invention, the kit further comprises an exogenous DNA template sharing homology around the DSB target site for homologous recombination (HR). Said exogenous DNA template having at least 95% of homology (preferably 98%) with the homology arms located 10-20 bp away from the double strand break site and with a minimum length of 100 bp and up to 2 kb on both side of the double-stranded break (DSB).
[0121] In such embodiment, the exogenous DNA template for HTT HR contains or does not contain the transcriptional start sites (TSS) and said exogenous DNA template may be selected among the group comprising SEQ ID NO: 42-43. Preferably said exogenous DNA template for HR does not contain the TSS such as SEQ ID NO: 43.
[0122] It is another object of the invention to provide a kit for the treatment of Huntington's disease, for use in a method for non-allele-specific HTT inactivation of the human (or other species having a conserved sequences) HTT WT (wild type) and mutant alleles by preferentially targeting the region upstream of the HTT gene (position 3066800) up to the beginning of intron 2 (position 3087600). As exemplified in SEQ ID NO: 4-6 and SEQ ID NO: 15, 28, 37-39 or SEQ ID NO 7, 13-14, 16-27, 29-35, if the SNP is homozygous (i.e. WT and mutant HTT alleles have the same sequence at the SNP considered) in the treated HD patients.
[0123] Another object of the invention is to provide a kit for the treatment of Huntington's disease, for use in a method for non-allele-specific HTT gene repair based on HR with a DNA template containing a WT HTT sequence, as exemplified in SEQ ID NO: 42-43.
[0124] A further object of the invention is to provide a kit for the treatment of Huntington's disease, for use in a method for allele-specific HTT inactivation of the human mutant HTT gene wherein the sgRNA of said kit is capable of recognizing SNP sequences located upstream a PAM along the HTT gene with a high frequency of heterozygosity in the human population at least >5% (according to dbSNP or 1000 Genome Project database), preferably more than >15%, even more than >20% and most preferably >30% according to dbSNP; http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?geneId=3064 or 1000 Genome Project database). This is exemplified for example by SEQ ID NO: 7, SEQ ID NO: 13-38.
[0125] The invention also provides a kit for the treatment of Huntington's disease, for use in a method for mutant HTT gene repair based on HR with a DNA template containing a WT HTT sequence wherein the sgRNA of said kit is capable of recognizing SNP sequences located upstream a PAM along the HTT gene with a high frequency of heterozygosity in the human population at least >5% (according to dbSNP or 1000 Genome Project database), preferably more than >15%, even more than >20% and most preferably >30% according to dbSNP; http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?geneId=3064 or 1000 Genome Project database). This is exemplified for example by SEQ ID NO: 7, SEQ ID NO: 13-38.
[0126] A frequency of heterozygosity in the human population at least >5%, means that, on average, >5% of the human population will have a different sequence (heterozygous SNP) on the WT and mutant HTT allele at the SNP considered and >5% of the population would be eligible for an allele-specific strategy. As a consequence, the other <95% of the human population will have the same sequence (homozygous SNP) on the WT and mutant HTT alleles and would be eligible for a non-allele specific HTT gene editing. SNP with high frequency of heterozygosity would greatly facilitate allele-specific therapeutic strategies, because a limited number of products need to be developed to treat a great majority of the HD patients.
[0127] Permanent expression of Cas9 after target sequence editing could raise potential adverse effects through off-target mutagenesis.
[0128] In a preferred embodiment of the invention, the kit for the treatment of Huntington's disease further comprises an additional transcriptionally independent artificial sgRNA capable of self-inactivating Cas9 expression after human HTT editing, wherein said additional transcriptionally independent artificial sgRNA comprises a crRNA sequence of 15-30 nucleotides which recognizes key regions driving Cas9 expression selected among the ATG and/or the promoter driving the expression of Cas9.
[0129] In particular said additional transcriptionally independent artificial single guide RNA (sgRNA) has a total size from 63-115 nucleotides, preferably 102 nucleotides, comprising a tracrRNA sequence of 48-85 nucleotides long (preferably 82 bp) and a crRNA sequence of 15-30 nucleotides, preferably 20 nt, recognizing key regions driving Cas9 expression (ATG and/or vector promoter) in order to self-inactivating Cas9 expression after human HTT editing (SEQ ID NO: 40). Weak polymerase III promoters, with for example the 7SK promoter are used to express sgCas9, while strong polymerase III promoters (H1 and U6) are used to express the sgHTT. This ensures a rapid cleavage of the human HTT gene and then a progressive induction of DSB in Cas9 (self-cleavage by the sgCas9). Because of Cas9 gene disruption, the expression of the protein is blocked thus, preventing potential adverse effects associated with long-term and uncontrolled Cas9 expression.
[0130] In a yet further embodiment, the kit for the treatment of Huntington's disease according to the present invention, is suitable for use in a method of treating neuronal and glial cells in a patient in need thereof, wherein the gene delivery vector used to deliver said (CRISP system) Cas9 and said at least one artificial single guide RNA (sgRNA) is suitable for a local administration in the human striatum or is engineered to allow diffusion and/or transport from the striatum to the entire of the basal ganglia network of said patient. This is achieved through the combined use of cell-type specific promoters, microRNA regulatory mechanisms, LV pseudotypes with various envelopes or AAV serotypes.
[0131] Besides, diffusion and/or transport may be carried out through the use of specific envelopes including the VSV-G-rabies chimeric envelops for the pseudotyping of LV or use of specific AAV serotypes (19, 20).
[0132] Preferably the gene delivery vector is capable of targeting neurons and/or glial cells.
[0133] Huntington's disease is a neurodegenerative disorder characterized by a selective vulnerability of the striatum in the first stages of the pathology, followed by a more global degeneration throughout the brain, in particular in the basal ganglia network. The invention provides the use of a kit containing viral vectors expressing the CRISPR system after injection into the striatum. Applicants also provide engineered viral vectors with the capacity to diffuse and/or being transported trans-synaptically for infection of cells along the basal ganglia network.
[0134] Mutant HTT exerts numerous molecular adverse effects leading to the degeneration of neurons of the striatum (medium-sized spiny neurons or MSN), but also other brain regions at later stages. If neurons are dying, glial cells, in particular astrocytes, are also vulnerable to mHTT and their dysfunctions exacerbate neuronal deficits. Whether treating neurons in HD patients will be sufficient to solve the pathology has not been fully addressed. In the present invention, Applicants provide a kit containing viral vectors expressing the CRISPR system being engineered to target neurons or glial cells or both neuronal and glial cells in HD patients.
[0135] Also provided is a pharmaceutical composition comprising the gene delivery vector of the invention in combination with a pharmaceutically acceptable carrier. The above detailed description disclosing the kit of the present invention is incorporated herein by reference in its entirety for a full disclosure of the pharmaceutical composition comprising the gene delivery vector of the present invention. Namely, the pharmaceutical composition comprises the gene delivery vector consisting of at least one viral vector selected among adeno-associated vector serotypes (AAV) and/or lentiviral vectors (LV);
[0136] a Cas9 being human codon-optimized or fused to an epitope tag selected among the group of FLAG, His, myc, Tap, HA, V5;
[0137] at least one artificial single guide RNA (sgRNA) having a total size from 63-115 nucleotides comprising a tracrRNA sequence of 48-85 nucleotides long and a crRNA sequence of 15-30 nucleotides recognizing the sequence of the HTT gene around the expanded CAG repeat mutation (ENSG00000197386, position of the first CAG repeat in exon 1: 3′074′877-3′074′879), and comprising the region upstream of the HTT gene (position 3066800) up to the beginning of intron 2 (position 3087600), wherein said crRNA sequence binds directly upstream of the required 5′-NGG/NAG-3′ protospacer adjacent motif (PAM) and whereas said crRNA sequence base-pairs with the target HTT sequence and Cas9 mediates a double-stranded break (DSB) 3-4 bp upstream of said PAM.
[0138] Preferably, the pharmaceutical composition of the invention further comprises pharmaceutically acceptable diluents, or excipients that are well known to the skilled in the art.
[0139] Applicants propose to use gene editing with the CRISPR system approach for HD. It concerns a new therapy for a fatal neurodegenerative disorder with no available treatment. This represents the first attempt of in vivo gene editing and repair for a CNS disorder.
[0140] Contrary to WO 2014/093701 (Feng Zhang, MIT, USA), if a gene editing strategy has been proposed for HD, the target sequence is limited to:
[0141] 1) a mutant HTT allele specific guide RNA: “nucleotide sequences unique to the mutant HTT allele (CAG repeats) and its use to design guide RNA. Authors ensure that the mutant base is located within the last 9 bp of the guide RNA (which Authors have ascertained it has the ability to discriminate between single DNA base mismatches between the target size and the guide RNA)” or alternatively
[0142] 2) “Authors use Cas9 nickases in combination with pairs of guide RNAs to generate DNA double strand breaks with defined overhangs. It is stated that when two pairs of guide RNAs are used, it is possible to excise an intervening DNA fragment”.
[0143] The present invention is based on entirely new and innovative strategies for allele or non-allele-specific HTT editing and which is also capable of gene repair strategies targeting the promoter, transcription and/or translation start sites and/or SNP in the HTT gene. HTT gene disruption based on sgRNA targeting the CAG expansion or double-strand break with overhang (2-4 sgRNA and Cas nickase) are not considered in the present invention.
[0144] Applicants strategy is not based on repressors to inhibit mHTT expression (WO 2013/130824 & Garriga-Canut et al. 2012 (7)) but will address the possibility to perform gene editing to inactivate mutant HTT and DNA repair to restore WT HTT expression using DNA-targeted nucleases. In particular, one will use the recently described CRISPR system to induce mHTT double-strand break for permanent mHTT knock-out or repair.
[0145] One important prerequisite for the development of in vivo gene repair strategy in the CNS is an efficient delivery system. Applicants have integrated the CRISPR system in lentiviral vectors (LV expressing Cas9 and the sgRNA) and adeno-associated virus (AAV containing the donor DNA for HR or expressing Cas9 and the sgRNA), which have been widely used in vitro but also for in vivo gene delivery in the CNS.
[0146] As a first step toward the establishment of an in vitro gene editing system for mHTT, Applicants performed experiments with reporter genes in HEK 293T cells. For this, a sequence containing the mCherry fluorescent protein followed by the CRISPR target sequence containing a STOP codon and the GFP gene was integrated in the genome of HEK 293T cells using LV (Examples 1-2). mCherry-positive cells were then infected with LV expressing Cas9 (SEQ ID NO: 8) and an sgRNA recognizing the target sequence close to the stop codon were designed (sgTARGET, SEQ ID NO: 2;
[0147] Applicants evaluated the efficiency of the CRISPR system in the mouse brain to disrupt eGFP sequence (Example 5). Applicants have injected AAV (
[0148] Applicants engineered a new Cas9 sequence fused to a V5-tag allowing the visualization of Cas9 protein by immunohistochemistry (Example 1, SEQ ID NO: 41). The V5-tag has been added at the 3′ end of the Cas9 gene just after the nuclear localisation signal (NLS). Expression of the Cas9-V5 tag (cloned in AAV or LV backbones) in HEK-293T cells reveal that the most of the staining is located in the cytoplasm, with some molecules are present in the nucleus (
[0149] Applicants used gene editing with the CRISPR system as therapeutic strategy for HD. One important prerequisite for the development of in vivo gene editing/repair strategy in the CNS is an efficient delivery system. Applicants use reporter genes to develop and validate VSV-G pseudotyped LV (but other envelopes might be considered) and AAV vectors (AAV2/5, AAV2/6 and AAV-DJ, but other serotypes or chimeric AAV variants might be considered, including AAV1, 9, 10) (21). The AAV-DJ has been shown to increase spontaneous HR efficiency (22) and combined with the CRISPR system is increasing HTT editing efficiency. These gene transfer systems are suitable for in vitro and in vivo delivery (intraparenchymal or intraventricular or peripheral administrations) of the CRISPR system (data not shown). To optimize HTT gene editing, various vectors and expression cassettes were produced and tested (choice of the promoters driving the expression of the transgenes, ratio between Cas9 and sgRNA, integration of multiple sgRNA, integration of the CRISPR system in a single vector or in two separate vectors, choice of LV pseudotyping and AAV serotypes to ensure large diffusion and retrograde/anterograde transport in large areas of the CNS).
[0150] To block mutant HTT (mHTT) expression, Applicants did not use repressors (ZFN or TALEN) (WO 2013/130824) but disrupt the HTT gene (non allele- or allele-specific targeting) using DNA-targeted nucleases (CRISPR). In particular, Applicants use the recently described CRISPR system to induce mHTT double-strand break (DSB) around the transcription start site (TSS) or translation initiation codon (ATG) of the HTT gene for permanent and irreversible mHTT inactivation (Examples 3-4,
[0151] The sgHTT targeting regions around of ATG or the TSS were transfected in 293T cells (SEQ NO 4, 36). Gene editing efficiencies reaching 17-45% were observed on endogenous HTT locus (
[0152] The feasibility and efficacy of the approach was further validated in post-mitotic primary neuronal and astrocytic cultures infected with an LV expressing the first 171 amino acids of human HTT with 82 CAG and LV expressing Cas9 and the sgHTT1 (full homology for human HTT and one mismatch at the 5′ end of sgRNA with endogenous mouse HTT,
[0153] For allele-specific inactivation, Applicants selected single-nucleotide polymorphisms (SNP) located the HTT gene with high frequency of heterozygosity in the human population (>5%, preferably >15%, more preferably >20% and even more preferably >30%) (http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?geneId=3064) with a preference for SNP located near the TSS/ATG and HD mutation and designed sgRNA targeting the disease isoform of heterozygous single-nucleotide polymorphisms (SNP;
[0154] As a second strategy for the allele-specific gene editing of mutant HTT gene, Applicants use two sgRNAs, one targeting a SNP located close to the TSS/ATG and HD mutation of the HTT gene and a second sgRNA targeting the disease isoform of heterozygous single-nucleotide polymorphisms (SNP) located after the CAG expansion and preferentially in an intron (
[0155] For non-allele-specific or allele-specific DNA repair strategy, an sgRNA targeting any sequence located after the CAG expansion, preferentially in intron 1 of the HTT gene has been used to induce DSB and a donor sequence containing the WT human HTT exon1 and flanking sequences was used to induce homologous recombination (SEQ ID NO: 42-43). To avoid potential expression of a short HTT fragment in the recombination vector (HR donor template), the HR sequence is preferably excluding the TSS/ATG sites. For the allele-specific repair of mHTT, Applicants used sgRNA targeting the disease isoform of heterozygous single-nucleotide polymorphisms (SNP) located after the CAG expansion and preferentially in an intron (
[0156] Finally, as a first strategy to transiently express Cas9 protein, Applicants design an sgRNA targeting the Cas9 gene (Example 1, SEQ ID NO 40). Eliminating Cas9, should further improve the biosafety of the proposed approach. Weak promoters should be favored to favor genome editing at the beginning of the treatment and then progressively inactivating Cas9 protein.
[0157] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications without departing from the spirit or essential characteristics thereof. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features. The present disclosure is therefore to be considered as in all aspects illustrated and not restrictive, the scope of the invention being indicated by the appended Claims, and all changes which come within the meaning and range of equivalency are intended to be embraced therein.
[0158] Various references are cited throughout this specification, each of which is incorporated herein by reference in its entirety.
[0159] The foregoing description will be more fully understood with reference to the following Examples. Such Examples, are, however, exemplary of methods of practicing the present invention and are not intended to limit the scope of the invention.
EXAMPLES
Example 1: Development of a Viral-Based Delivery System for the CRISPR System
[0160] Material and Methods
[0161] Plasmid Construction
[0162] The pcDNA3.3-TOPO-CMV-hCas9 plasmid contains the human codon-optimized Cas9 (hCas9, SEQ ID NO: 8) sequence fused to a nuclear localization signal expressed under the CMV promoter (Addgene, Cambridge Mass., USA). The hCas9 gene was excised from the plasmid using PmeI and NcoI (Roche Diagnostics GmbH, Mannheim, Germany) restriction sites and inserted into a pENTR-dual plasmid (Invitrogen, Life Technologies, Regensburg, Germany) digested with NcoI and EcoRV (Roche Diagnostics GmbH, Mannheim, Germany) (pENTR-dual-hCas9). Finally, a site-specific recombination was performed with the gateway system (Invitrogen, Regensburg, Germany; (5)) and the destination vector SIN-cPPT-PGK-RFA-WPRE, SIN-cPPT-CMV-RFA-WPRE, SIN-cPPT-gfaABC1D(b)3-RFA-WPRE, pAAV2ss-ITR-CBA-RFA-WPRE-bGHpolyA-ITR and pAAV2ss-ITR-PGK-RFA-WPRE-bGHpolyA-ITR (23) to produce the SIN-cPPT-PGK-hCas9-WPRE, SIN-cPPT-CMV-hCas9-WPRE, SIN-cPPT-gfaABC1D(b)3-hCas9-WPRE, pAAV2ss-ITR-CBA-hCas9-WPRE-bGHpolyA-ITR and pAAV2ss-ITR-PGK-hCas9-WPRE-bGHpolyA-ITR.
[0163] The pMA-T-hCas9frag-V5 containing the last 692 bp of hCas9 including the V5-tag (SEQ ID NO 8, 41, GeneArt, Invitrogen, Life Technologies, Regensburg, Germany) was digested with XhoI and XbaI and inserted in the pENTR-dual-hCas9 to replace the 3′ last nucleotides of hCas9 between the XhoI and XbaI sites (pENTR-dual-hCas9-V5, Roche Diagnostics GmbH, Mannheim, Germany). Then, a site-specific recombination was performed with the gateway system (Invitrogen, Regensburg, Germany; (5)) and the destination vector SIN-cPPT-PGK-RFA-WPRE, SIN-cPPT-CMV-RFA-WPRE, pAAV2ss-ITR-CBA-RFA-WPRE-bGHpolyA-ITR and pAAV2ss-ITR-PGK-RFA-WPRE-bGHpolyA-ITR (23) to produce the SIN-cPPT-PGK-hCas9-V5-WPRE, SIN-cPPT-CMV-hCas9-V5-WPRE, pAAV2ss-ITR-CBA-hCas9-V5-WPRE-bGHpolyA-ITR and pAAV2ss-ITR-PGK-hCas9-V5-WPRE-bGHpolyA-ITR.
[0164] The sgRNA are expressed under the control of the H1, U6 or 7SK polymerase III promoters. The H1-sgTARGET (targeting the mCherry-target-GFP sequence, SEQ ID NO 2;
[0165] The plasmid containing the three sgGFP under independent polymerase III promoters was ordered from GeneArt (pENTR221-H1-sgGFP1-U6-sgGFP2-7SK-sgGFP3, GeneArt, Invitrogen, Life Technologies, Regensburg, Germany, SEQ ID NO 3,10-12). Restriction enzyme cutting were performed to produce pENTR221-H1-sgGFP1, pENTR221-H1-sgGFP1-U6-sgGFP2, pENTR221-H1-sgGFP1-7SK-sgGFP3, pENTR221-U6-sgGFP2, pENTR221-U6-sgGFP2-7SK-sgGFP3 and pENTR221-7SK-sgGFP3 (pENTR221-polIII). sgHTT2-sgHTTn were synthesized as phosphorylated oligonucleotides (MicrosynthAG, Balgachm, Switzerland) and annealed in a thermocycler (BioLabo, Chatel-Saint-Denis, Switzerland) or ordered directly as small double-stranded DNA blocks (gBlocks, Integrated DNA Technology, (IDT), Leuven, Belgium). Cloning of various sgHTT in pENTR221-polIII was done using the appropriate restriction enzyme depending on the promoter of choice (SEQ ID NO 4-7, 13-39).
[0166] A gateway reaction was used to insert each sgRNA in the transfer vectors for LV production (SIN-H1-gateway cassette-WPRE, SIN-cPPT-PGK-tdTomato-WPRE-LTR-TREtight-H1-gateway cassette, and SIN-cPPT-gateway cassette-PGK-mCherry-WHV) (5, 23, 24). For AAV, a unique Asp718 restriction site between the 5′ITR and CBA promoter of a pAAV2ss-ITR-CBA-mCherry-WPRE-bGHpolyA-ITR plasmid was digested and blunted to insert the sgRNA of choice from the pENTR221-polIII to generate the final pAAV2ss-ITR-polIII-sgRNA-CBA-mCherry-WPRE-bGHpolyA-ITR vector.
[0167] Plasmid coding for the mCherry-target-GFP sequence was designed, synthesized and cloned in pDONR221 vector (GeneArt, Invitrogen, Life Technologies, Regensburg, Germany) (pDONR221-mCherry-target-GFP) (
[0168] To evaluate NHEJ with sgRNA targeting the human HTT, a plasmid encoding the mutant HTT (first 171 amino acids of the human HTT with 82 CAG repeats; was fused to the eGFP (Clontech, Saint-Germain-en-Laye, France) containing 5 copies of myc tag epitope (EQKLISEEDL). This fusion construct was cloned in a third generation LV transfer vector (25) under a CMV promoter (pRRL-cPPT-CMV-Htt171-82Q-5×Myc-GFP-WPRE). The same construct without eGFP was used to generate the SIN-cPPT-PGK-Htt171-82Q-WPRE for mHTT editing in neurons. To identify infected cells in vivo, a LV transfer vector encoding the red monomer fluorescent protein mCherry was used (SIN-cPPT-PGK-mCherry-WPRE).
[0169] Cell Culture
[0170] HEK-293T cells (LGC, Wesel, Germany; human embryonic kidney cell line immortalized by the adenoviral E1A/E1B protein and expressing the SV40 large T antigen) were cultured in DMEM-Glutamax supplemented with 10% FBS and 1% Penicillin/Streptomycin (Gibco, Life Technologies, Zug, Switzerland). Cells were passed every three days using Trypsin for dissociation (Gibco, Life Technologies, Zug, Switzerland). For transfection experiments, 300′000 cells were plated in corresponding wells (6-wells; Vitaris, Baar, Switzerland) the day before transfection. Transfections were done using calcium-phosphate method. Up to 4 μg total of plasmids for 9.5 cm2 plate (6 well) were mixed in equal amount of H.sub.2O and CaCl.sub.2 and then added drop by drop in HEPES (Sigma-Aldrich, Buchs, Switzerland, ratio plasmid-H.sub.2O—CaCl.sub.2: HEPES=1:1). Mixture was incubated at RT for 5 minutes and then added to the corresponding cultures drop by drop. Medium was completely changed 6 hours post-transfection.
[0171] LV Production and Titration
[0172] LV were produced in HEK-293T cells with the four-plasmid system, as described previously (24). The HIV-1 vectors were pseudotyped with the VSV-G envelope and concentrated by ultracentrifugation and resuspended in phosphate-buffered saline (PBS, Gibco, Life Technologies, Zug, Switzerland) with 1% bovine serum albumin (BSA, Sigma-Aldrich, Buchs, Switzerland). The viral particle content of each batch was determined by p24 antigen enzyme-linked immunosorbent assay (p24 ELISA, RETROtek; Kampenhout, Belgium). The stocks were finally stored at −80° C. until use.
[0173] AAV Production
[0174] The AAV recombinant genome contains the transgene under the control of mammalian promoters, the WPRE, and the bovine hormone (bGH) gene polyadenylation signal, flanked by AAV2 ITRs. This expression cassette was encapsidated in an AAV-5, 6, DJ capsid as described previously (22, 26, 27). For this, the plasmids coding for the transgene, the capsid and Ad helper were transfected by calcium phosphate precipitation in HEK-293T cells. Cells and supernatant were harvested 3 days post-transfection and centrifuged at 300 g for 10 minutes at 4° C. Supernatant was supplemented with 8% PEG (Sigma-Aldrich, Buchs, Switzerland, 2.5M NaCl, Merck, Nottingham, UK) and was kept at 4° C. for at least 2 hours. Cell pellets were pooled and incubated in lysis buffer (NaCl 0.15M, Merck, Nottingham, UK, Tris-HCl 50 mM, pH 8.5, Sigma-Aldrich, Buchs, Switzerland) for 3 consecutive freeze/thaw cycles (30 minutes in dry ice/ethanol followed by 30 minutes at 37° C.). PEG-containing supernatant was centrifuged at 4′000 g for 20 minutes at 4° C. after the 2 hours incubation and supernatant was discarded. Cell lysate was added to the pellets and the mixture was incubated at 37° C. for 1 hour to ensure full homogenization of pellets. Lysate was then treated with benzonase (0.15 units, Sigma-Aldrich, Buchs, Switzerland) in filtered MgCl.sub.2 1M at 37° C. for 30 minutes (Sigma-Aldrich, Buchs, Switzerland). Treated lysate was clarified by centrifugation at 4′000 g for 20 minutes at 4° C. AAV were separated using iodixanol (AxonLab, Le Mont sur Lausanne, Switzerland) gradient ultracentrifugation at 59′000 rpm (70Ti rotor, Beckman-Coulter, Nyon, Switzerland) for 90 minutes at 20° C. as previously described. Phase containing AAV was harvested and loaded on an Amicon Ultra-15 PL 100 (Millipore, Zug, Switzerland) with 0.001% Pluronic F68 D-PBS (Gibco, Life Technologies, Zug, Switzerland) for iodixanol cleaning and viral particles concentration. Tubes were first centrifuged at 4′000 g at 4° C. until the totality of solution has passed through the column. Two additional wash with 0.001% Pluronic F68 D-PBS were done and AAV were finally resuspended in 250-500 μL 0.001% Pluronic F68 D-PBS. AAV were kept at −80° C. until the use. Titration was performed by qPCR as previously described (28).
[0175] Results
[0176] To validate and assess the efficacy of the CRISPR system, two sgRNAs targeting the mCherry-target-GFP (sgTARGET) and GFP (sgGFP1, 2, 3) sequences were designed (
Example 2: CRISPR Optimization for DSB and HR
[0177] Material and Methods
[0178] Cell Culture
[0179] HEK-293T cell culture was performed as described in the example 1. An LV-SIN-cPPT-mCherry-target-GFP-WPRE containing a target sequence and a GFP fluorescent protein (
[0180] Evaluation of the functionality of hCas9-V5 was done by transfection as described in example 1. Plasmids encoding hCas9-V5 in AAV (pAAV2ss-ITR-CBA-hCas9-V5-WPRE-bGHpolyA-ITR and pAAV2ss-ITR-PGK-hCas9-V5-WPRE-bGHpolyA-ITR) and LV backbones (SIN-cPPT-PGK-hCas9-V5-WPRE and SIN-cPPT-CMV-hCas9-V5-WPRE) were used. As a positive control for immunohistochemistry, SIN-cPPT-PGK-Tau-V5-WHV was used as previously described (29). Comparison of hCas9 and hCas9-V5 editing efficiency was done by transfecting SIN-cPPT-PGK-GFP-WHV and SIN-cPPT-PGK-Tomato-WHV-LTR-TREtight-H1-sgGFP1 and SIN-cPPT-CMV-hCas9-V5-WPRE (Cas9-V5 group) or SIN-cPPT-CMV-hCas9-WPRE (Cas9 group) in HEK-293T cells. Additive effect of multiple independent sgRNA was evaluated with SIN-cPPT-PGK-GFP-WHV, SIN-cPPT-CMV-hCas9-WPRE and SIN-cPPT-H1-sgGFP1-U6-sgGFP2-7SK-sgGFP3-PGK-mCherry-WHV (CRISPR-poly-sgGFP) or SIN-cPPT-PGK-Tomato-WHV-LTR-TREtight-H1-sgGFP1 (CRISPR-GFP).
[0181] FACS
[0182] HEK-TARGET cells were harvested and processed for FACS analysis 3-5 weeks post-infection. The cells were washed and resuspended in small volume of sterile PBS to ensure high cell concentration (1-10×10.sup.6/ml). For each sample, 50′000 events were analyzed. mCherry-positive cells were sorted with a Beckman-Coulter system and were grown on 96-well plates. Based on mCherry fluorescence, four distinct cell populations were isolated: cells with low copy number of target sequence (populations 1 and 10) and cells with high copy number of target sequence (populations 50 and 100).
[0183] qPCR
[0184] HEK-TARGET cells were passed and resuspended in PBS. Genomic DNA (gDNA) was extracted from 1.10.sup.6 cells with Trizol Reagent and resuspended at a concentration of 50 ng/μL in DNAse-free water. Provirus copy number was determined by SYBRgreen qPCR (KapaBiosystems, Le Mont sur Lausanne, Switzerland) and the primers HIV-1F-TGTGTGCCCGTCTGTTGTTGT and HIV-2R-GAGTCCTGCGTCGAGAGAGC. qPCR with primers targeting the endogenous human HTT were used as genomic standard (HTT-21F-ATGGACGGCCGCTCAGGTTCT, HTT-68R-GCTCAGCACCGGGGCAATGAA). Serial dilutions of gDNA from each population were performed and compared to the standard curve of HTT. Provirus number per cell was quantified based on the Lenti-X provirus quantitation kit (Clontech, Saint-Germain-en-Laye, France).
[0185] Primary Neuronal Cultures
[0186] Timed-pregnant FVB mice were killed by CO.sub.2 inhalation and Ell embryos were collected in Petri dish containing HBSS. Cortex were dissected in corresponding medium containing H.sub.2O, Na.sub.2SO.sub.4 1M, K.sub.2SO.sub.4 0.5M, MgCl.sub.2 1M, CaCl.sub.2 1M, HEPES 1M pH 7.3-7.4, Glucose 2.5M, Phenol red 0.5%, NaOH 1N pH 7.4 (Sigma-Aldrich, Buchs, Switzerland) and Ky/Mg (1 mM kynurenic acid/10 mM MgCl.sub.2, Sigma-Aldrich, Buchs, Switzerland) and kept on ice in a 15 mL Falcon. Dissection medium was removed and structures were enzymatically dissociated in dissection medium containing 1 mg/mL L-cysteine and 0.125 mg/mL papain (Sigma-Aldrich, Buchs, Switzerland). Mixture was incubated at 37° C. for 10 minutes, solution was removed and the operation was repeated a second time. After the final incubation, all the papain/cysteine solution was removed and lysates were washed 3 times in dissection medium. Washed lysates were then incubated in dissection medium containing 10 mg/mL of trypsin inhibitor containing solution for 7 minutes 30 seconds at 37° C. During wash steps, overnight incubated wells in poly-D-lysine (0.019 μg/μL, Becton Dickinson, Allschwill, Switzerland) and laminin (0.027 μg/μL, Life Technologies, Zug, Switzerland) with or without glass coverslips were washed three times with H.sub.2O and then incubated in Neurobasal supplemented with 2% B27, 1% penicillin/Streptamycin and 1% Glutamax (Gibco, Life Technologies, Zug, Switzerland) until cells plating. Lysates were then washed 3 times in dissection medium and 3 times in Opti-MEM-Glucose 2.5M (Gibco, Life Technologies, Zug, Switzerland) solution after final dissociation in Neurobasal supplemented with 2% B27, 1% penicillin/Streptamycin and 1% Glutamax (Gibco, Life Technologies, Zug, Switzerland) using Paster pipettes. Fully dissociated cells were pooled in the same tube and counted. The cells were platted at a density of 1.5×10.sup.5 cells per cm2 in multi-wells dishes in Neurobasal supplemented with 2% B27, 1% penicillin/Streptamycin and 1% Glutamax (Gibco, Life Technologies, Zug, Switzerland).
[0187] Different AAV serotypes were compared to determine the best delivery system for the DNA template in vitro. One day post-seeding of HEK-293T cells, 1×10.sup.7 Vg of AAV2/5, AAV2/6 and 5.5×10.sup.6 Vg AAV2/DJ-ITR-CBA-GFP-WPRE-ITR were incubated on cells. The cultures were fixed 2 weeks post-infection in 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield) at room temperature (RT) for 10 minutes, washed 3 times in PBS and analyzed for direct GFP fluorescence.
[0188] Cortical neurons were infected with 20 ng/wells of LV-cPPT-PGK-GFP-WHV (LV-PGK-GFP) at DIV1. Cells were then infected with LV-cPPT-PGK-Tomato-WHV-LTR-TREtight-H1-sgGFP1 (LV-Tomato-sgGFP1, 15 ng) and LV-cPPT-CMV-hCas9-WHV (LV-hCas9, 15 ng, Cas9 group) or LV-cPPT-CMV-hCas9-V5-WHV (LV-hCas9-V5, 15 ng, Cas9-V5 group). Cells were kept in culture until DIV25.
[0189] Stereotaxic Surgery
[0190] Concentrated viral stocks were thawed on ice and resuspended by repeated pipetting. AAV were diluted in D-PBS 1× (Gibco, Life Technologies, Zug, Switzerland) to inject 9.5×10.sup.7 Vg in 2 μL.
[0191] Mice were anesthetized by intraperitoneal injection of a mixture of 100 mg/kg ketamine (Ketasol, Graeub, Bern, Switzerland) and 10 mg/kg xylazine (Rompun, Bayer Health Care, Uznach, Switzerland). Suspensions of AAV were injected into the mouse striatum with a 34-gauge blunt-tip needle linked to a Hamilton syringe by a polyethylene catheter. Stereotaxic coordinates were: anteroposterior +1 mm from bregma; mediolateral +/−1.5 mm and dorsoventral −3.5 mm from the skull, with the tooth bar set at −3.3 mm. Mice received a total volume of 3 μl of the vector preparation, administered at a rate of 0.2 μl/min. At the end of injections, needles were left in place for 5 min before being slowly removed. The skin was sutured with 6-0 Prolene suture (B-Braun Mediacal SA, Sempach, Switzerland) and mice were allowed to recover on a heating mat.
[0192] DNA, RNA and Proteins Extractions
[0193] DNA, RNA and proteins were extracted from the same sample with the Trizol reagent according to the manufacturer's protocol (Invitrogen, Life Technologies, Zug, Switzerland). Briefly, cells were washed in PBS (Gibco, Life Technologies, Zug, Switzerland) and lysed in Trizol. DNA and RNA were resuspended in RNAse-DNAse sterile water (Gibco, Life Technologies, Zug, Switzerland) whereas proteins were resuspended in 1% SDS, 10% Urea solution (Sigma-Aldrich, Buchs, Switzerland). RNA were kept at −80° C., proteins were kept at −20° C. and DNA diluted to 100 ng/μL were conserved at 4° C.
[0194] Genomic DNA from primary cultures was extracted using the QuickExtract DNA Extraction Solution 1.0 (Epicentre, Offenbach, Germany) following the manufacturer's instructions. Culture medium were removed and cells were incubated in Trypsin at 37° C. for 10 minutes. Cells were resuspended, diluted in 5004 of 1×PBS/well and centrifuged at 300 g for 5 minutes. Supernatant was removed, cells were resuspended in 504 of lysis buffer, each tube was vortexed for 15 secondes and incubated at 65° C. for 15 minutes with agitation. Each tube was then vortexed 15 secondes and lysis buffer was inactivated at 98° C. for 2 minutes. Genomic DNA concentration was quantified with Nanodrop (Thermo Scientific, Reinach, Switzerland) using lysis buffer as blank solution before conservation at −20° C.
[0195] Surveyor Analysis
[0196] DSB formation was evaluated using the surveyor mutation detection kit, which detects mutations and polymorphisms in DNA (Transgenomic Inc, Glasgow, UK) (30). Briefly, forward (TARGET-1F: ACGGCGAGTTCATCTACAAGGTGAAGCTGC, GFP-1F: TGACAAATGGAAGTAGCACG) and reverse oligonucleotides (TARGET-2R: TTGTACTCCAGCTTGTGCCCCAGGATGTTG, GFP-2R: GAGATGAGTTTTTGTTCGAAGGG) complementary to a region located around the target sequence in the genomic DNA (100 ng) are used with the Taq polymerase (Roche Diagnostics GmbH, Mannheim, Germany) to perform a PCR reaction. The concentration of the amplified fragment is evaluated by agarose gel electrophoresis using the GeneRuller 1 kb DNA ladder (Thermo Scientific, Reinach, Switzerland). Three hundred nanograms of PCR product is incubated at 95° C. in a thermocycler and subjected to the surveyor nuclease according to the manufacturer's protocol. Migration of the digested products is done on 10% TBE polyacrylamide precast gels (BioRad, Reinach, Switzerland). DNA is stained using SYBR gold (Molecular Probes, Life Technologies, Zug, Switzerland). The percentage of indels is determined by quantifying band intensities with Image J software (http://rsb.info.nih.gov/ij/, NIH, Bethesda) as described by Ran and collaborators (31).
[0197] Restriction Fragment Length Polymorphism (RFLP)
[0198] RFLP analysis exploits DNA variations and in particular restriction enzymes. The DNA sample is digested and the resulting restriction fragments are separated according to their lengths by gel electrophoresis. In the specific example described here, Applicants used 300-500 ng of PCR product and digest it with the restriction enzyme NcoI for 2 h at 37° C. (New England Biolabs, Allschwill, Switzerland). The resulting products were analyzed on a 10% TBE polyacrylamide precast gel (BioRad, Reinach, Switzerland) and stained in SYBR gold (Molecular Probes, Life Technologies, Zug, Switzerland). The Image J software was used to quantify the bands intensities and determine the percentage of RFLP (31).
[0199] Western Blot Analysis
[0200] Two days after transfection, the 293T cells were harvested and lysed Trizol. Protein concentration was determined by the Bradford method (Thermo Scientific, Reinach, Switzerland). Twenty micrograms of proteins were run on 12% SDS-polyacrylamide gels, and transferred to nitrocellulose membranes in 0.025M Tris, 0.192M glycine, and 20% ethanol (6). The membranes were washed 3×10 minutes in PBS and blocked 1 hour in 33% LI-COR blocking buffer in 1% PBS-Tween20 (blocking, LI-COR, Bad Homburg, Germany) at RT under agitation. Primary antibodies were incubated in blocking solution overnight at 4° C. under agitation. The following antibodies were used: anti-mCherry antibody (mCherry, 1/1000, SicGen, Lisboa, Portugal), goat anti-HTT antibody (HTT, 1/1000, SicGen, Lisboa, Portugal) and rabbit anti-Actin antibody (Actin, 1/1000, Abcam, Cambridge, UK). Membranes were rinsed 3×10 minutes in PBS-Tween20 and incubated with the following secondary antibodies in blocking for 1 hour at RT under agitation: donkey anti-goat IgG IRdye 800 (1/7000, LI-COR, Bad Homburg, Germany) and donkey anti-rabbit IgG IRdye 680 (1/7000, LI-COR, Bad Homburg, Germany). Membranes were rinsed 3×10 minutes in 1% PBS-Tween20 and 3×10 minutes in PBS before scanning on Odyssey system (LI-COR, Bad Homburg, Germany). Band intensities were determined using ImageJ software as described previously.
[0201] Immunohistochemistry
[0202] Three days post-transfection, HEK-293T cells were washed in 1×PBS and fixed in 4% PFA for 15 minutes at room temperature. Immunohistochemistry was performed as described in example 4. Mouse anti-V5 primary antibody (Invitrogen, Life Technologies, Zug, Switzerland) and goat anti-mouse 594 secondary antibody (Invitrogen, Life Technologies, Zug, Switzerland) were used.
[0203] Image Acquisitions
[0204] Pictures were acquired on a Zeiss Axiovision microscope using 20-40× objectives (Carl Zeiss Microscopy GmBH, Göttingen, Germany). Constant exposure time was used to compare fluorescence of control and treated groups.
[0205] Results
[0206] To produce cells with an integrated target sequence, HEK-293T Cells were infected with increasing doses of LV-cPPT-PGK-mCherry-target-GFP-WPRE (MOI 1, 10, 50 and 100) and selected by FACS. Based on mCherry fluorescence, four independent populations with increasing number of integrated provirus were selected (HEK-TARGET;
[0207] Applicants have evaluated the delivery of the DNA template using viral vectors in mouse primary neuronal cultures. Applicants used GFP fluorescence to assess the efficiency of gene delivery in those cells. Applicants compared AAV2/5, AAV2/6 and AAV2/DJ-ITR-CBA-GFP-WPRE-bGH polyA-ITR. Direct GFP fluorescence reveals that AAV2/5 serotype is less efficient than AAV2/6 and AAV2/DJ in vitro (data not shown). Only mild differences were observed between AAV2/6 and AAV2/DJ in both HEK-293T cells and primary neurons, revealing that these two serotypes are suitable for in vitro HR experiments. For in vivo HR experiments, AAV2/5-ITR-CBA-GFP-WPRE-bGHpolyA-ITR was injected in C57Bl/6 mice striatum based on previous studies (27). Direct fluorescence reveals strong GFP signal and large diffusion of the virus, confirming that this serotype is a potent gene transfer system for in vivo HR (data not shown).
[0208] Finally, Applicants fused the hCas9 sequence to a V5-tag to enable hCas9 labeling by immunohistochemistry (
Example 3: CRISPR System Efficiency in Primary Neurons and Astrocytes
[0209] Material and Methods
[0210] Primary Neuronal Cultures
[0211] Mouse cortical neurons were cultured as described in Example 2.
[0212] Primary Astrocytic Cultures
[0213] Before dissection, overnight-incubated wells in poly-D-lysine (15 μg/mL, Becton Dickinson, Allschwill, Switzerland) with or without glass coverslips were washed three times with 1×PBS (Gibco, Life Technologies, Zug, Switzerland) and then incubated in 1×PBS until cells plating. P1 mouse cortex were killed by decapitation and dissected in DMEM High Glucose medium (Sigma-Aldrich, Buchs, Switzerland) dissolved in autoclaved nanopure water and supplemented with antibiotic/antimycotic (diluted 10×, Sigma-Aldrich, Buchs, Switzerland) and 3.7 g/L of sodium bicarbonate at pH 7.2 (Merck, Zug, Switzerland, DMEM-astro). Dissected cortexes were passed in 19G, 21G and 25G needle with syringe 3 times each to dissociate the structures. Cells were counted and platted in DMEM-astro at a density of 50′000 cells per cm.sup.2.
[0214] Primary Culture Infections
[0215] Cortical neurons were infected with 20 ng/wells of LV-cPPT-PGK-GFP-WHV (LV-PGK-GFP) at DIV1. Cells were then infected with LV-cPPT-CMV-hCas9-WHV (LV-hCas9, 15 ng) and LV-cPPT-PGK-Tomato-WHV-LTR-TREtight-H1-sgGFP1 (LV-Tomato-sgGFP1, 15 ng, CRISPR-GFP group) or LV-hCas9 (15 ng) and LV-cPPT-PGK-mCherry-WHV (LV-mCherry, 15 ng, hCas9 group) or LV-Tomato-sgGFP1 (15 ng, sgGFP group). Cells were kept in culture until DIV25.
[0216] Cortical astrocytes were infected with 20 ng/wells of LV-cPPT-CMV-GFP-WHV (LV-CMV-GFP) at DIV7. Cells were then infected with LV-hCas9, (15 ng) and LV-Tomato-sgGFP1 (15 ng, CRISPR-GFP group) or LV-Tomato-sgGFP1 (15 ng, sgGFP group). Cells were kept in culture until DIV56.
[0217] DNA Extraction
[0218] Genomic DNA from HEK-293T cells was extracted with the Trizol Reagent as described in example 2. Genomic DNA from primary cultures was extracted using the QuickExtract DNA Extraction Solution 1.0 (Epicentre, Offenbach, Germany) following the manufacturer's instructions. Culture medium were removed and cells were incubated in Trypsin at 37° C. for 10 minutes. Cells were resuspended, diluted in 500 μL of 1×PBS/well and centrifuged at 300 g for 5 minutes. Supernatant was removed, cells were resuspended in 50 μL of lysis buffer, each tube was vortexed for 15 secondes and incubated at 65° C. for 15 minutes with agitation. Each tube was then vortexed 15 secondes and lysis buffer was inactivated at 98° C. for 2 minutes. Genomic DNA concentration was quantified with Nanodrop (Thermo Scientific, Reinach, Switzerland) using lysis buffer as blank solution before conservation at −20° C.
[0219] Surveyor Analysis
[0220] DSB formation was evaluated using the surveyor mutation detection kit, which detects mutations and polymorphisms in DNA (Transgenomic Inc, Glasgow, UK) (30). Briefly, forward (GFP-1F: TGACAAATGGAAGTAGCACG) and reverse oligonucleotides (GFP-2R: GAGATGAGTTTTTGTTCGAAGGG) complementary to a region located around the target sequence in the genomic DNA (100 ng) are used with the Kapa HiFi Hotstart polymerase (KapaBiosystems, Le Mont sur Lausanne, Switzerland) to perform a PCR reaction. For each PCR, a negative sample containing water was used. PCR products were purified with the Qiaquick PCR purification kit (Qiagen) and eluted in RNAse-DNAse free water. PCR product concentration was measured with Nanodrop (Thermo Scientific, Reinach, Switzerland) using RNAse-DNAse free water as blank. For each sample, the detected concentration in negative PCR reaction (water) was subtracted to correct for remaining oligonucleotides purification. The presence of a single PCR product was verified for each sample before further Surveyor processing. Three hundred nanograms of PCR product is incubated at 95° C. in a thermocycler and subjected to the surveyor nuclease according to the manufacturer's protocol. Migration of the digested products is done on 10% TBE polyacrylamide precast gels (BioRad, Reinach, Switzerland). DNA is stained using SYBR gold (Molecular Probes, Life Technologies, Zug, Switzerland). The percentage of indels is determined by quantifying band intensities with Image J software (http://rsb.info.nih.gov/ij/, NIH, Bethesda) as described by Ran and collaborators (31).
[0221] Image Acquisitions
[0222] Neuronal cultures were fixed in 4% paraformaldehyde (PFA) for 15 minutes at room temperature. Cells were washed 3 times with 1×PBS and coverslips were mounted on microscope slides. Pictures were acquired on a Zeiss Axiovision microscope using 20-40× objectives (Carl Zeiss Microscopy GmBH, Göttingen, Germany). Constant exposure time was used to compare fluorescence of control and treated groups.
[0223] Results
[0224] The efficiency of CRISPR system was evaluated both in cultured cortical neurons and astrocytes. Three weeks post-infection with the CRISPR vectors, genomic DNA was extracted and subjected to Surveyor assay to detect the presence of indels in the target sequence. Quantifications reveal around 45% and 30% of gene disruption in the GFP gene in neurons and astrocytes, respectively (
Example 4: Delivery and Efficacy of the CRISPR System In Vivo
[0225] Material and Methods
[0226] Animals
[0227] Adult females C57Bl/6 (Janvier, Le Genest Saint Isle, France) and males and females BAC GLT1-eGFP (kindly provided by Pr. J. Rothstein, Baltimore, Md., USA) of 10-weeks old transgenic mice expressing GFP specifically in astrocytes were used for in vivo experiments. The animals were housed in a temperature-controlled room (22° C.+−1° C.) and maintained on a 12 h light/night cycle. Food and water were available ad libitum. All experimental procedures were performed in strict accordance with the recommendations of the European Community directive (86/609/EEC) and Swiss legislation about the care and use of laboratory animals. Sample size was chosen to take into account statistical variability due to surgical procedure based on previous studies (5).
[0228] Stereotaxic Surgery
[0229] Stereotaxic surgery was performed according to procedure described in the example 2
[0230] Concentrated viral stocks were thawed on ice and resuspended by repeated pipetting. 100 ng of LV-PGK-GFP, 100 ng of LV-hCas9 and 100 ng of LV-Tomato-sgGFP1 (CRISPR-GFP group) were injected in the mouse striatum. As negative controls, 100 ng of LV-PGK-GFP and 100 ng of LV-Tomato-sgGFP1 (sgGFP group) were used. For AAV editing, the same experimental design was used except that LV-GFP was replaced by an AAV2/5-CBA-GFP-WHV-bGHpolyA (1.10.sup.7 vg/site).
[0231] For GFP editing in astrocytes, BAC GLT1-eGFP mice were injected with 100 ng of LV-cPPT-gfaABC1D(b)3-hCas9-WHV (LV-gfaABC1D(b)3-hCas9) and 100 ng of LV-Tomato-sgGFP1 (CRISPR-GFP group). Mice injected only with 100 ng of LV-Tomato-sgGFP1 were used as negative controls (sgGFP group).
[0232] Brain Processing
[0233] Three weeks post-lentiviral injection, the animals were killed by an overdose of sodium pentobarbital (NaCl, B-Braun, Sampach, Germany; Esconarkon, Streuli, Uznach, Germany) and transcardially perfused with a 4% PFA (Electron Microscopy Sciences, Hatfield). The brains were removed and post-fixed in 4% PFA for 12 h and then cryoprotected in 20% sucrose/PBS for 3 h and in 30% sucrose/PBS for 24 h. A sledge microtome with a freezing stage at −30° C. (Leica SM2010R, Biosystems Switzerland, Nunningen, Switzerland) was used to cut coronal sections between 20 μm thickness. Slices throughout the entire striatum were collected and stored in tubes as free-floating sections in anti-freeze solution (18% sucrose, 25% sodium azide, ethylene glycol and sodium phosphate 50 mM, pH=7.4). Slices were then stored at −20° C.
[0234] Mice used for Surveyor analysis were killed by an overdose of sodium pentobarbital (NaCl, B-Braun, Sampach, Germany; Esconarkon, Streuli, Uznach, Germany) and directly decapitated. Tomato-positive infected area was dissected under an inverted fluorescent microscope for direct genomic DNA extraction.
[0235] DNA Extraction
[0236] Genomic DNA was extracted using the QuickExtract DNA Extraction Solution 1.0 (Epicentre, Offenbach, Germany) following the manufacturer's instructions. Dissected striatum was disrupted in 50 μL of lysis buffer with an automated disruptor, each tube was vortexed for 15 seconds and incubated at 65° C. for 15 minutes with agitation. Each tube was then vortexed 15 seconds and lysis buffer was inactivated at 98° C. for 2 minutes. Genomic DNA concentration was quantified with Nanodrop (Thermo Scientific, Reinach, Switzerland) using lysis buffer as blank solution before conservation at −20° C.
[0237] Surveyor Analysis
[0238] Surveyor assay against the GFP target sequence were performed as described in the Example 3 with the same primers.
[0239] Immunohistochemistry
[0240] The following primary antibodies were used: rabbit polyclonal anti-DARPP-32 antibody (DARPP-32, 1/1000, Cell Signaling, Allschwill, Switzerland) and rabbit anti-NeuN antibody (Millipore, Schaffhausen, Switzerland). Free floating slices were rinsed 3×10 minutes in PBS (Laboratorium Dr Bichsel AG, Interlaken, Switzerland), followed by the saturation of non-specific sites in PBS containing 10% BSA or 5% NGS (Sigma-Aldrich, Buchs, Switzerland) and 0.1% Triton X100 (Fluka, Sigma-Aldrich, Buchs, Switzerland) for 1 h at room temperature (RT) under agitation. Primary antibodies were incubated overnight at 4° C. under agitation. Slices were rinsed 3×10 minutes in PBS and incubated with the secondary antibodies for 1 h at room temperature under agitation. The following secondary antibody was used: goat anti-rabbit IgG AlexaFluor 488 (1/1000, Invitrogen, Life Technologies, Zug, Switzerland). Slices were then rinsed 3×10 minutes in PBS, followed by mounting with Vectashield mounting medium for fluorescence with DAPI (Vector Lab Inc, Burlingame). For in vitro experiments, fixed cells were rinsed 3×1 minute in PBS after fixation and incubated in blocking solution (5% PBS-BSA, 0.2% Triton X100) for 20 minutes at RT. Primary antibody were incubated on cells for 1 hours at RT. Cells were washed 3×1 minutes in PBS and incubated in secondary antibody for 30 minutes at RT. The following secondary antibodies were used: donkey anti-goat IgG AlexaFluor 488 (1/1000, Invitrogen, Life Technologies, Zug, Switzerland) and goat anti-mouse IgG AlexaFluor 594 (1/1000, Invitrogen, Life Technologies, Zug, Switzerland). Coverslips were then washed 3×1 minute in PBS, incubated in DAPI for 5 minutes at RT, washed 3×1 minute in PBS and then mounted on a microscope slice in FluorSafe (Calbiochem, Allschwill, Switzerland) medium.
[0241] Image Acquisitions
[0242] Mosaics were acquired on a Zeiss Axiovision microscope using 20-40× objectives (Carl Zeiss Microscopy GmBH, Göttingen, Germany). Constant exposure time was used to compare fluorescence of control and treated groups. Acquisitions for direct GFP mean fluorescence intensity quantifications were performed with a Zeiss LSM 510 confocal at 63× magnification (Carl Zeiss Microscopy GmBH, Göttingen, Germany). Cell-by-cell analysis was done with the Image J software (http://rsb.info.nih.gov/ij/, NIH, Bethesda). The cytoplasm of each Tomato-positive neuron was manually contoured and GFP intensity was measured.
[0243] Results
[0244] Lentiviral vectors coding for hCas9 and the Tomato-sgGFP were injected separately in C57Bl/6 mice to evaluate toxicity of the system. LV-PGK-mCherry was co-injected to visualize the infected area and was used as an indirect marker of neuronal toxicity. NeuN and DARPP-32 immunoreactivity, respectively two markers of neuronal survival and functionality, were not altered in the mCherry positive area 3 weeks post-injection of sgGFP or hCas9, suggesting the absence of sgRNA or hCas9 toxicity in the mouse brain. GFP editing of genomic integrated target (LV-PGK-GFP experiment) or extrachromosomal episomes (AAV-GFP experiment) resulted in a lot of Tomato-positive cells that are GFP-negative after infection with the CRISPR system (
Example 5: Human HTT Disruption with the CRISPR System
[0245] Selection of sgRNA Targeting the HTT Gene
[0246] The sgHTT were designed around the HTT mutation (Ensembl accession number: ENSG00000197386, position of the first CAG repeat in exon 1: 3′074′877-3′074′879), and comprising the region upstream of the HTT gene (positions 3066800) up to the beginning of intron 2 (position 3087600). For the non-allele-specific gene editing approaches, three specific regions of interest were used for the selection of the sgRNA. Region upstream of the HTT gene including the promoter (Ensembl accession number: ENSG00000197386; positions 3066800 to 3074509), exon 1 of the HTT gene including the 5′UTR the transcription and translation start sites (TSS and ATG; Ensembl accession number: ENSG00000197386: positions 3074510 to 3075088), intron 1 of the HTT (Ensembl accession number: ENSG00000197386: positions 3075089 to 3086939), exon 2 (Ensembl accession number: ENSG00000197386: positions 3086940 to 3087023) and 5′ end on intron 2 (Ensembl accession number: ENSG00000197386: positions 3087024 to 3087600).
[0247] Cell Culture
[0248] HEK-293T cells culture, transfection and infection were performed as described in example 1 and 2.
[0249] DNA and Proteins Extraction
[0250] DNA and proteins extractions using the Trizol reagent were done as described in the example 2.
[0251] Surveyor Analysis
[0252] Concentration of the extracted DNA was measured using nanodrop (Thermo Scientific, Reinach, Switzerland). Hundred nanograms of genomic DNA from HEK-293T was PCR-amplified using Kapa HiFi polymerase (KapaBiosystems, Le Mont sur Lausanne, Switzerland) with oligonucleotides located around exon 1 of the human HTT gene (HTT-1F: TTGCTGTGTGAGGCAGAACCTGCGG, HTT-2R: TGCAGCGGCTCCTCAGCCAC, HTT-3F: CACTTCACACACAGCTTCGC, HTT-4R: TGCTGCTGGAAGGACTTGAG). The PCR products were purified on column with the High Pure PCR product purification Kit (Roche Diagnostics GmbH, Mannheim, Germany) and eluted in 10-20 μL elution buffer. The Surveyor analysis was performed as described in example 3.
[0253] Western Blots
[0254] Western blot analysis was performed according to procedure described in the example 2.
[0255] Mutant HTT Aggregates Imaging
[0256] HEK-293T Cell cultures (24 wells plates; LGC, Wesel, Germany) were grown and transfected on coverslips. Cells were fixed in 4% PFA for 10 minutes at RT, washed 2 times in PBS and mounted on microscope slides. Pictures were acquired on a Zeiss Axiovision microscope using a 10× objective and FITC channel (Carl Zeiss Microscopy GmBH, Göttingen, Germany). Constant exposure time was used to compare fluorescence of control and treated groups.
[0257] Results
[0258] Applicants first targeted the endogenous human HTT gene in HEK-293T cells using the CRISPR system. Applicants co-transfected plasmids coding for hCas9 and the sgHTT1 (CRISPR-HTT1,
Example 6: Mutant HTT Editing with the CRISPR System in Neurons
[0259] Primary Neuronal Cultures
[0260] Mouse cortical neurons were cultured as described in the Example 2.
[0261] Primary Culture Infections
[0262] Cortical neurons were infected with LV-cPPT-CMV-hCas9-WHV (LV-hCas9, 15 ng) and LV-cPPT-H1-sgHTT1 (LV-sgHTT1, 15 ng, CRISPR-HTT group) at DIV1. Neurons infected with LV-hCas9 (15 ng) and LV-Tomato-sgGFP1 (15 ng, CRISPR-GFP) or LV-sgHTT1 alone (15 ng, sgHTT1) were used as negative controls. All wells were then infected with 15 ng of LV-cPPT-PGK-Htt171-82Q-WHV (LV-mHTT) at DIV4. Cells were kept in culture until DIV25.
[0263] DNA Extraction
[0264] Genomic DNA extractions were performed as described in example 3
[0265] Surveyor Analysis
[0266] Surveyor assay was performed as described in example 3. Primers for PCR amplification of human HTT were: hHTT-1F: TGACAAATGGAAGTAGCACG, hHTT-2R: GAGATGAGTTTTTGTTCGAAGGG. Primers for PCR amplification of mouse HTT were: mmHTT-1F: CCTCCTCACTTCTTTTCTATCG, mmHTT-2R: AGCATTATGTCATCCACTACC.
[0267] Animals
[0268] Adult females C57Bl/6 (Janvier, Le Genest Saint Isle, France) of 10-weeks old were used for in vivo experiments. The animals were housed in a temperature-controlled room (22° C.+−1° C.) and maintained on a 12 h light/night cycle. Food and water were available ad libitum. All experimental procedures were performed in strict accordance with the recommendations of the European Community directive (86/609/EEC) and Swiss legislation about the care and use of laboratory animals. Sample size was chosen to take into account statistical variability due to surgical procedure based on previous studies (5).
[0269] Stereotaxic Surgery
[0270] Stereotaxic surgery was performed according to procedure described in the example 3. Concentrated viral stocks were thawed on ice and resuspended by repeated pipetting. 100 ng of LV-mHTT, 100 ng of LV-hCas9 and 100 ng of LV-cPPT-H1-sgHTT1-PGK-mCherry-WHV (LV-sgHTT1-mCherry, CRISPR-HTT group) were injected in the mouse striatum. As negative controls, 100 ng of LV-mHTT, 100 ng of LV-hCas9 and 100 ng of LV-Tomato-sgGFP1 (CRISPR-GFP group) were used.
[0271] Brain Processing and Culture Neurons Fixation
[0272] Three weeks post-lentiviral injection, the animals were killed by an overdose of sodium pentobarbital (NaCl, B-Braun, Sampach, Germany; Esconarkon, Streuli, Uznach, Germany) and transcardially perfused with a 4% PFA (Electron Microscopy Sciences, Hatfield). The brains were removed and post-fixed in 4% PFA for 12 h and then cryoprotected in 20% sucrose/PBS for 3 h and in 30% sucrose/PBS for 24 h. A sledge microtome with a freezing stage at −30° C. (Leica SM2010R, Biosystems Switzerland, Nunningen, Switzerland) was used to cut coronal sections between 20 μm thickness. Slices throughout the entire striatum were collected and stored in tubes as free-floating sections in anti-freeze solution (18% sucrose, 25% sodium azide, ethylene glycol and sodium phosphate 50 mM, pH=7.4). Slices were then stored at −20° C.
[0273] Neuronal cultures were fixed in 4% paraformaldehyde (PFA, Electron Microscopy Sciences, Hatfield) for 15 minutes at room temperature. Cells were washed 3 times with 1×PBS (Gibco, Life Technologies, Zug, Switzerland) and coverslips were mounted on microscope slides.
[0274] Immunohistochemistry
[0275] The following primary antibodies was used: goat polyclonal anti-HTT (1/1000, SicGen, Lisboa, Portugal). Free floating slices were rinsed 3×10 minutes in PBS (Laboratorium Dr Bichsel AG, Interlaken, Switzerland), followed by the saturation of non-specific sites in PBS containing 5% BSA (Sigma-Aldrich, Buchs, Switzerland) and 0.1% Triton X100 (Fluka, Sigma-Aldrich, Buchs, Switzerland) for 1 h at room temperature (RT) under agitation. Primary antibodies were incubated overnight at 4° C. under agitation. Slices were rinsed 3×10 minutes in PBS and incubated with the secondary antibodies for 2 h at room temperature under agitation. The following secondary antibody was used: donkey anti-goat IgG AlexaFluor 488 (1/500, Invitrogen, Life Technologies, Zug, Switzerland). Slices were then rinsed 3×10 minutes in PBS, followed by mounting with Vectashield mounting medium for fluorescence with DAPI (Vector Lab Inc, Burlingame).
[0276] Image Acquisitions
[0277] Mosaics and in vitro aggregates imaging were acquired on a Zeiss Axiovision microscope using 20-40× objectives (Carl Zeiss Microscopy GmBH, Göttingen, Germany). Constant exposure time was used to compare fluorescence of control and treated groups.
[0278] Results
[0279] Mutant HTT editing with the sgHTT1 was first evaluated in mouse cortical neurons. Three weeks post-infection with the LV-mHTT vector, genomic DNA was extracted for Surveyor assay. Quantifications reveal around 35% of human mutant HTT disruption in neurons (
REFERENCES
[0280] 1. Vonsattel J P & DiFiglia M (1998) Huntington disease. J Neuropath Exp Neurol 57:369-384. [0281] 2. Zuccato C, Valenza M, & Cattaneo E (2010) Molecular mechanisms and potential therapeutical targets in Huntington's disease. Physiol Rev 90(3):905-981. [0282] 3. Ross C A & Tabrizi S J (2011) Huntington's disease: from molecular pathogenesis to clinical treatment. Lancet Neurol 10(1):83-98. [0283] 4. Fiszer A & Krzyzosiak W J (2014) Oligonucleotide-based strategies to combat polyglutamine diseases. Nucleic Acids Res 42(11):6787-6810. [0284] 5. Drouet V, et al. (2009) Sustained effects of nonallele-specific Huntingtin silencing. Ann Neurol 65(3):276-285. [0285] 6. Drouet V, et al. (2014) Allele-specific silencing of mutant huntingtin in rodent brain and human stem cells. PLoS One 9(6):e99341. [0286] 7. Garriga-Canut M, et al. (2012) Synthetic zinc finger repressors reduce mutant huntingtin expression in the brain of R6/2 mice. Proc Natl Acad Sci USA 109(45):E3136-3145. [0287] 8. Cong L, et al. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339(6121):819-823. [0288] 9. Jinek M, et al. (2013) RNA-programmed genome editing in human cells. eLife 2:e00471. [0289] 10. Sternberg S H, Redding S, Jinek M, Greene E C, & Doudna J A (2014) DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature 507(7490):62-67. [0290] 11. Merienne N, Le Douce J, Faivre E, Deglon N, & Bonvento G (2013) Efficient gene delivery and selective transduction of astrocytes in the mammalian brain using viral vectors. Front Cell Neurosci 7:106. [0291] 12. Simonato M, et al. (2013) Progress in gene therapy for neurological disorders. Nat Rev Neurol 9(5):277-291. [0292] 13. Cartier N, et al. (2009) Hematopoietic stem cell gene therapy with a lentiviral vector in X-linked adrenoleukodystrophy. Science 326(5954):818-823. [0293] 14. Palfi S, et al. (2014) Long-term safety and tolerability of ProSavin, a lentiviral vector-based gene therapy for Parkinson's disease: a dose escalation, open-label, phase 1/2 trial. Lancet 383(9923):1138-1146. [0294] 15. Weinberg M S, Samulski R J, & McCown T J (2013) Adeno-associated virus (AAV) gene therapy for neurological disease. Neuropharmacology 69:82-88. [0295] 16. Naldini L, et al. (1996) In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272(5259):263-267. [0296] 17. Mali P, et al. (2013) RNA-guided human genome engineering via Cas9. Science 339(6121):823-826. [0297] 18. Jinek M, et al. (2012) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337(6096):816-821. [0298] 19. Hirano M, et al. (2013) Highly efficient retrograde gene transfer into motor neurons by a lentiviral vector pseudotyped with fusion glycoprotein. PLoS One 8(9):e75896. [0299] 20. Castle M J, Gershenson Z T, Giles A R, Holzbaur E L, & Wolfe J H (2014) Adeno-Associated Virus Serotypes 1, 8, and 9 Share Conserved Mechanisms for Anterograde and Retrograde Axonal Transport. Hum Gene Ther 25(8):705-720. [0300] 21. Grimm D, et al. (2008) In vitro and in vivo gene therapy vector evolution via multispecies interbreeding and retargeting of adeno-associated viruses. J Virol 82(12):5887-5911. [0301] 22. Melo S P, et al. (2014) Somatic Correction of Junctional Epidermolysis Bullosa by a Highly Recombinogenic AAV Variant. Mol Ther 22(4):725-733. [0302] 23. Deglon N, et al. (2000) Self-inactivating lentiviral vectors with enhanced transgene expression as potential gene transfer system in Parkinson's disease. Hum Gene Ther 11(1):179-190. [0303] 24. Hottinger A F, Azzouz M, Deglon N, Aebischer P, & Zurn A D (2000) Complete and long-term rescue of lesioned adult motoneurons by lentiviral-mediated expression of glial cell line-derived neurotrophic factor in the facial nucleus. J Neurosci 20(15):5587-5593. [0304] 25. Dull T, et al. (1998) A third-generation lentivirus vector with a conditional packaging system. J Virol 72(11):8463-8471. [0305] 26. Low K, Aebischer P, & Schneider B L (2013) Direct and retrograde transduction of nigral neurons with AAV6, 8, and 9 and intraneuronal persistence of viral particles. Hum Gene Ther 24(6):613-629. [0306] 27. Drinkut A, Tereshchenko Y, Schulz J B, Bahr M, & Kugler S (2012) Efficient gene therapy for Parkinson's disease using astrocytes as hosts for localized neurotrophic factor delivery. Mol Ther 20(3):534-543. [0307] 28. Aurnhammer C, et al. (2012) Universal real-time PCR for the detection and quantification of adeno-associated virus serotype 2-derived inverted terminal repeat sequences. Hum Gene Ther Methods 23(1):18-28. [0308] 29. Dujardin S, et al. (2014) Ectosomes: a new mechanism for non-exosomal secretion of tau protein. PLoS One 9(6):e100760. [0309] 30. Qiu P, et al. (2004) Mutation detection using Surveyor nuclease. Biotechniques 36(4):702-707. [0310] 31. Ran F A, et al. (2013) Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8(11):2281-2308.