APTAMERS FOR BINDING FLAVIVIRUS PROTEINS
20170226511 · 2017-08-10
Assignee
Inventors
- Mah Lee Mary Ng (Singapore, SG)
- Krupakar PARTHASARATHY (Singapore, SG)
- Jin Shun Anthony CHUA (Singapore, SG)
- Hui Yu Haydan YEO (Singapore, SG)
Cpc classification
A61K45/06
HUMAN NECESSITIES
G01N2333/185
PHYSICS
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61K31/713
HUMAN NECESSITIES
C12N2320/50
CHEMISTRY; METALLURGY
A61K31/7115
HUMAN NECESSITIES
International classification
C12N15/115
CHEMISTRY; METALLURGY
A61K45/06
HUMAN NECESSITIES
Abstract
The present invention relates to nucleic acids. In particular, it relates to aptamers capable of binding to a flavivirus structural protein or a flavivirus non-structural protein, useful as therapeutics for preventing, treating and/or diagnosing a flavivirus infection in a patient.
Claims
1. A nucleic acid aptamer comprising a DNA molecule that binds specifically to a flavivirus structural protein or a flavivirus non-structural protein.
2. The aptamer according to claim 1, wherein the flavivirus is selected from the group consisting of West Nile virus, Dengue virus, yellow fever virus, Japanese encephalitis, and tick-borne encephalitis virus.
3. The aptamer according to claim 1, wherein the aptamer binds specifically to a West Nile virus envelope protein.
4. The aptamer according to claim 3, wherein the aptamer binds specifically to Domain III region of the West Nile virus envelope protein.
5. The aptamer according to claim 1, wherein the DNA molecule comprises amino acid side chains.
6. The aptamer according to claim 3, wherein the DNA molecule comprises amino acid side chains and wherein the DNA molecule comprises a sequence selected from the group consisting of: (a) 5′-A_CfGkC_T_GwChC_A_CfAlA_GbT_ChC_T_GwGbT_T_CyChC_T_Gw-3′ (based on modification of SEQ ID No. 1) or its complement; (b) 5′-ChC_T_CyChC_AlA_A_CfAeT_GbT_AsG_AsG_T_CyT_CyA_CfAeT-3′ (based on modification of SEQ ID No. 2) or its complement; and (c) 5′-ChC_AlA_AeT_T_GwChC_GkC_AsG_A_CfT_CyGbT_T_GwT_GwAlA_-3′ (based on modification of SEQ ID No. 3) or its complement, wherein functional groups of side chains are indicated in lowercase (b: Thiophene, e: Glutamic acid, f: Phenylalanine, h: Histidine, k: Lysine, l: Leucine, s: Serine, y: Tyrosine, w: Tryptophan) and unmodified native nucleotides are indicated with an underscore (_).
7. The aptamer according to claim 1, wherein the aptamer binds specifically to a Dengue virus envelope protein.
8. The aptamer according to claim 7, wherein the aptamer binds specifically to Domain III region of the Dengue virus envelope protein.
9. The aptamer according to claim 7, wherein the DNA molecule comprises amino acid side chains.
10. The aptamer according to claim 9, wherein the DNA molecule comprises a sequence selected from the group consisting of: (a) 5′ T-CyA_CfAeT_T_CyAsG_AeT_AeT_GbT_T_GwGbT_T_CyChC_A_Cf-3′ (based on modification of SEQ ID No. 4) or its complement; (b) 5′-T_AkAlA_T_GwT_GwA_CfGbT_T_CyA_CfAsG_A_CfAlA_GbT_ChC_-3′ (based on modification of SEQ ID No. 5) or its complement; and (c) 5′-GkC_T_GwAeT_A_CfA_CfT_GwAlA_GbT_GbT_T_CyT_GwAeT_T_Gw-3′ (based on modification of SEQ ID No. 6) or its complement wherein functional groups of side chains are indicated in lowercase (b: Thiophene, e: Glutamic acid, f: Phenylalanine, h: Histidine, k: Lysine, l: Leucine, s: Serine, y: Tyrosine, w: Tryptophan) and unmodified native nucleotides are indicated with an underscore (_).
11. The aptamer according to claim 1, wherein the DNA molecule further comprises a detectable moiety.
12. The aptamer according to claim 11, wherein the detectable moiety is selected from the group consisting of biotin, enzymes, chromophores, fluorescent molecules, chemiluminescent molecules, phosphorescent molecules, coloured particles, and luminescent molecules.
13. The aptamer according to claim 12, wherein the detectable moiety is biotin.
14. The aptamer according to claim 1, further comprising a drug of interest, wherein the binding of the DNA molecule to a flavivirus structural protein or a flavivirus non-structural protein targets the drug of interest to its intended site of action and/or releases the drug of interest from the aptamer.
15. The aptamer according to claim 14, wherein the drug is selected from the group consisting of a pharmaceutical compound, a nucleotide, an antigen, a steroid, a vitamin, a hapten, a metabolite, a peptide, a protein, a peptidomimetic compound, an imaging agent, an anti-inflammatory agent, a cytokine, and an immunoglobulin molecule or fragment thereof.
16. The aptamer according to claim 1 for use in diagnosis of a flavivirus infection in a patient.
17. The aptamer according to claim 1 for use in therapy.
18. An immunogenic composition or vaccine comprising an aptamer according to claim 1.
19. A composition comprising an aptamer according to claim 1 and an excipient or carrier.
20. A kit comprising an aptamer according to claim 1 and a carrier.
21. A method for diagnosing or detecting a flavivirus infection in a patient, the method comprising: (a) obtaining a biological sample from a patient; (b) contacting the biological sample with an aptamer according to any one of claims 1 to 15; (c) detecting the formation of the binding complex between the aptamer and a flavivirus structural protein and/or a flavivirus non-structural protein, wherein the presence of the binding complex indicates that the patient has a flavivirus infection.
22. The method of claim 21, wherein the biological sample is a blood sample, serum, plasma, saliva or urine.
23. A method for treating or inducing an immune response to a flavivirus infection in a patient, the method comprising administering to the patient a therapeutically effective dose of the composition or vaccine according to claim 18.
24. Use of an aptamer according to claim 1 for treating a flavivirus infection in a patient.
25. Use of an aptamer according to claim 1 in the manufacture of a medicament for treating or preventing a flavivirus infection in a patient.
26. The aptamer according to claim 1, for use in treating or preventing a flavivirus infection in a patient.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070] The present invention aims to develop a new platform using modified aptamers for diagnostic and therapeutic applications to flaviviruses, in particular West Nile and Dengue viruses.
[0071] Advantageously, the present invention utilizes a modified aptamer rather than the conventional DNA or RNA aptamer, whereby the DNA strands contain modified amino acid side-chains. These amino acid side chains form additional intermolecular interactions between the aptamer and target protein, thus resulting in higher affinity interactions. The modified aptamer technology may be used to develop new therapeutics, as well as a new platform for the diagnosis of flavivirus infections.
[0072] As a proof of concept, the West Nile virus and Dengue virus serotype 2 envelope Domain III (DIII) proteins were used as antigens/target proteins for the designing of modified aptamers. For each protein, binding of the protein was screened against a random library of 10.sup.13 aptamers, followed by identifying the specific and strong binding aptamers to each of the proteins. By evaluating the binding characteristics of the selected aptamers with each of the purified DIII protein and the full length E protein in the virus, aptamers that can be utilized for diagnostic and therapeutic applications were identified. Ten potential aptamer candidates for each protein were evaluated and the results are discussed below.
DETAILED DESCRIPTION OF THE INVENTION
[0073] The invention will now be further described with reference to the following non-limiting examples.
Example 1: Evaluation of West Nile Virus (WNV) Envelope DIII Protein Modified Aptamers
[0074] Material and Methods
[0075] Construction of pET28a WNE-BNDIII Plasmid
[0076] WNE-DIII gene (Wengler strain) was sub-cloned from the lab original plasmid which harbors the WN-DIII gene. The DIII gene was previously amplified from cDNA synthesized from West Nile virus Wengler strain. Primers Biotin_F, BiotinWNDIII_F, Biotin_WNDIII_R, and WNDIII_R (Table 1) were used to join the biotinylation signal peptide gene containing an enterokinase cleavage site with the WNEDIII gene via overlap extension PCR (OE-PCR) as shown in
TABLE-US-00001 TABLE 1 List of primers used for cloning of biotinylated WNV DIII proteins. Primers Description Sequence (5′-3′) 1. Biotin_F Forward primer CTAGCTAGCTCCGGCC for priming out TGAACGAC signal peptide (SEQ ID No. 7) with NheI cut site 2. Biotin_ Forward primer for GACGACGACAAGAGCC WDIII_F overlapping signal TGAAGGGAACATATGG peptide and WNV (SEQ ID No. 8) DIII protein 3. Biotin_ Reverse primer for TGTTCCCTTCAGGCTC WDIII_R overlapping signal TTGTCGTCGTC peptide and WNV DIII (SEQ ID No. 9) protein 4. WDIII_R Reverse primer for CCGCTCGAGTTAGCTC priming out CCAGATTTGTGCCA WNV DIII (SEQ ID No. 10) protein from WNV cDNA Letters in BOLD are restriction enzyme recognition sites while underlined letters are overlapping PCR sites.
[0077] Protein Expression and Extraction.
[0078] pET28aBNWNDIII plasmid was transformed into BL-21-DE3 expression competent cells (Agilent Technologies, USA) and grown on Luria-Bertani (LB) agar containing 30 μg/ml kanamycin. Selected clones were cultured in 1 L LB broth (30 μg/ml kanamycin) at 30° C. until an absorbance OD.sub.600 of 0.6. Expression of BN-WNDIII protein was induced with 1 mM isopropyl β-D-thiogalactoside (IPTG) overnight at 16° C. Bacterial cells were pelleted down with centrifugation at 8,000 rpm for 15 mM at 4° C. The protein expressed was targeted to inclusion bodies. In order to isolate the inclusion bodies, the pellet was resuspended in lysis buffer (20 mM Tris pH 8.0, 500 mM NaCl, 10 mM imidazole), followed by sonication in ice bath (15 mM, 10 Amp). The lysate was centrifuged at 12,000 rpm for 15 min at 4° C. A small white translucent pellet of inclusion body was obtained. The inclusion body pellet was then washed with the same lysis buffer followed by incubation with extraction buffer (8 M urea, 20 mM Tris, 300 mM NaCl, 10 mM imidazole, pH 8.0) at room temperature for 30 mM. The lysate was subsequently clarified by centrifugation at 13,500 rpm for 20 min.
[0079] Purification.
[0080] The extracted inclusion body containing the BN-WNDIII protein was incubated with nickel-nitrilotriacetic acid (Ni-NTA) resin (Bio-Rad, USA) for binding in a chromatography column overnight at 4° C. Ten column volumes of wash buffer (8 M urea, 20 mM Tris, 300 mM NaCl, 20 mM imidazole, pH 8.0) was used to wash away non-specific binding proteins. BN-WNDIII protein was eventually eluted out with elution buffer (8 M urea, 20 mM Tris, 300 mM NaCl, 500 mM Imidazole, pH 8.0) in six fractions. Next, all eluates were combined for refolding. Briefly, eluates were pooled into a SnakeSkin dialysis membrane tubing (Thermo Scientific, USA) and 0.5% of Tween-20 was added into the samples. The dialysis tubing was incubated in 1 L of 6 M urea for 6-12 hrs at 4° C., and 250 ml of 25 mM Tris (pH 8.0) was added into the solution every 6-12 hrs. When the final volume reached 3 L, the dialysis tubing was transferred into 2 L of 25 mM Tris and 150 mM NaCl (pH 8.0) for 6 hr. Refolded WNDIII protein was collected from the dialysis tubing. Fractions containing the protein-of-interest were injected into a FPLC machine and further purified via size-exclusion chromatography in PBS.
[0081] Protein Identity Analysis.
[0082] Samples collected from the flow through, wash, and eluates were analyzed by SDS-PAGE and Western blot. 12% Tris-tricine polyacrylamide denaturing gel was used to separate proteins in the samples and it was subsequently stained with Coomassie blue for protein detection. The presence of biotinylated WNDIII protein was confirmed by Western blot via two different approaches. First, the identity of WNDIII protein was determined with anti-His antibody. Briefly, separated proteins were transferred from the polyacrylamide gel onto a PVDF membrane using iBlot® Dry Blotting System (Life Technologies, USA). Blocking was done with 5% BSA for 1 hr at room temperature. Next, the membrane was incubated with 0.1 μg/ml mouse anti-His antibody (Qiagen, Germany) overnight at 4° C. The membrane was then washed with 1×TBST and incubated with 0.1 μg/ml goat anti-mouse secondary antibody conjugated with HRP (Thermo Scientific, USA) for 1 hr at room temperature. After washing with 1×TBST, the membrane was developed using SuperSignal® West Pico chemiluminescent substrate (Thermo Scientific, USA). For the second approach, WNDIII protein was detected directly using streptavidin conjugated with HRP. After transferring the samples onto a PVDF membrane, it was blocked with 4% BSA for 1 hr at room temperature. Then, the membrane was incubated with HRP-conjugated streptavidin (Millipore, USA) for another hour at room temperature. Subsequently, the membrane was washed thoroughly with 1×PBST for 1 hr at room temperature and developed with chemiluminescent substrate. A similar purification procedure was used for the production of non-biotinylated WNDIII.
[0083] Sample Preparation for Mass Spectrometry.
[0084] Purified protein (BN-WNDIII and WNDIII) was electrophoresed through SDS-PAGE using 12% Tris-tricine polyacrylamide denaturing gel and stained with Coomassie blue. The background of Coomassie-stained gel was removed with destaining solution (40% methanol, 10% glacial acetic acid, 50% distilled H.sub.2O). The BN-WNDIII protein-corresponding band was excised from the gel and kept in eppendorf tube containing distilled water. Samples were submitted to Protein and Proteomics Centre, Department of Biological Sciences, NUS for mass spectrometry analysis.
[0085] Enzyme Linked Immunosorbent Assay (ELISA) for Biotinylation.
[0086] Samples and standards were added into the wells of a MaxiSorp plate (eBioscience, USA) in triplicate. The plate was covered with aluminum foil and incubated for 2 hrs. All incubating and washing steps were carried out at room temperature. After washing with 1×PBST, blocking buffer was added into each well and incubated for another hour. Next, streptavidin-HRP enzyme conjugates was added and incubated for 1 hr. The plate was washed with 1×PBST to remove unbound conjugates and then substrate solution, tetramethyl benzidine (TMB), was added for development. The reaction was stopped by adding 0.5 M H.sub.2SO.sub.4 solution. The absorbance was measured immediately at 450 nm. Every batch of FPLC purified BN-WNDIII protein was tested by ELISA to ensure that the protein is biotinylated.
[0087] Biotinylated Protein Binding Assay.
[0088] The binding affinity of purified biotinylated WNDIII protein was tested using streptavidin magnetic beads (GE Healthcare, UK) according to manufacturer's protocol. Briefly, samples were mixed with streptavidin magnetic beads and incubated for 30 min with gentle mixing. Unbound proteins were removed with wash buffer while biotinylated proteins were eluted out with elution buffer provided in the kit. Eluted proteins were analyzed by Western blot and ELISA.
[0089] Selex procedure for aptamer designing: Apta Biosciences Pte Ltd, (Adaptamer Biosolutions) www.aptabiosciences.com, 31 Biopolis Way, #02-25 Nanos, Singapore 138669, Phone: +65-3109-0178, Fax: +65-6779-6584, Mobile+65-9184-7323) formerly known as Fujitsu Biolaboratories. Bio-laboratories, R&D Division, (Fujitsu Asia Pte Ltd, Fujitsu Laboratories Ltd., Nanotechnology Business Creation Initiative, 31 Biopolis Way, #02-25 Nanos, Singapore).
[0090] Aptamer designing and synthesis: Fujitsu, Biolaboratories, Singapore.
[0091] Surface Plasma Resonance (SPR) Analysis using BN-WNDIII protein: Fujitsu (
[0092] SPR analysis using WNDIII for affinity calculation: Fujitsu (Table 2)
[0093] Ten aptamers received from Fujitsu for evaluation are as follows:
[0094] Non-Biotinylated aptamers: N03, N66, N67, N71, N73, N74, N76, N79, N97, N99
[0095] Biotinylated aptamers: B03, B66, B67, B71, B73, B74, B76, B79, B97, B99
TABLE-US-00002 TABLE 2 List of aptamers chosen for further evaluation after measurement of their affinities using SPR. KD at pH KD at pH Aptamer ID 5.5 (nM) 5.0 (nM) WNDIII-003 8.5 11.4 WNDIII-066 15.2 12.6 WNDIII-067 16.0 9.6 WNDIII-071 32.0 9.9 WNDIII-073 23.8 12.7 WNDIII-074 25.6 10.9 WNDIII-076 25.0 13.9 WNDIII-079 23.4 14.2 WNDIII-097 30.9 10.7 WNDIII-099 25.8 8.8
[0096] Enzyme Linked Modified Aptamer Sorbent Assay (ELMASA) for Surface Screening.
[0097] The modified aptamers consist of amino acid side-chains incorporated into the DNA backbone in order to enhance the binding of the aptamer molecule to the target protein. In order to select the suitable surface for the analysis of the modified aptamer, four different ELISA surfaces were tested. (Nunc-Multisorp, Polysorp, Medisorp and Maxisorp). Briefly, 50 ng of biotinylated aptamer and different concentrations of BN-WNDIII proteins were added to each well and incubated at 4° C. overnight. Blocking with 4% BSA was carried out after overnight incubation, followed by washing with PBS. Then, 1:2000 dilution of streptavidin-HRP enzyme conjugates was added and incubated for 1 hr. The plate was washed 6 times with 1×PBST to remove unbound conjugates. Then, tetramethyl benzidine (TMB) substrate solution was added for development and incubated for 15 min at room temperature. 0.5 M H.sub.2SO.sub.4 solution was added to stop the reaction. The absorbance was measured immediately at 450 nm.
[0098] Protein Coated Enzyme Linked Modified Aptamer Sorbent Assay for Affinity Screening.
[0099] 100 ng of purified non-biotinylated WNDIII protein was coated on maxisorp plate overnight at 4° C. Following the coating, the ELISA plate was washed three times with PBS and incubated for 1 hour with different concentrations (1.65 nM to 26 nM/well) of biotinylated aptamers solubilized in RNase free TE buffer (Invitrogen). Then, 1:2000 dilution of streptavidin-HRP enzyme conjugates was added and incubated for 1 hr following the standard procedure as mentioned above.
[0100] Virus Coated Enzyme Linked Modified Aptamer Sorbent Assay.
[0101] Instead of using DIII protein, West Nile virus Wengler strain was coated onto the ELISA plate. Briefly, 1000 PFU of virus was coated in each well followed by overnight incubation at 4° C. The wells were washed with 1× PBST followed by blocking with 4% BSA. Following this step, the wells were incubated with different concentrations (0.3 nM to 26 nM/well) of biotinylated aptamers (1-10) for 1 hr. Then, 1:2000 dilution of streptavidin-HRP enzyme conjugates was added and incubated for 1 hr following the standard procedure as mentioned earlier. Coating, Washing, aptamer addition and developing were carried out in the BSC class 2.
[0102] Plaque Reduction Neutralization Test (PRNT).
[0103] Baby hamster kidney (BHK) cells were seeded in a 24-well plate overnight before use. Frozen virus stocks were carefully thawed and diluted to 1000 PFU/ml. To 50 PFU/50 μl West Nile virus Wengler strain, various concentrations (1.25 nM, 2.5 nM, 5 nM, 10 nM, 20 nM, 40 nM, 80 nM, 165 nM, 330 nM, 660 nM, 13.33 μM, 5 μM and 10 μM/well) of non biotinylated aptamers were added in duplicates and allowed to incubate for 1.5 hrs for binding. Cell growth medium was removed from the 24-well plate, the cell monolayers briefly washed with 2% RPMI and then infected with 100 μl of the aptamer+virus incubated mixture. The plate was incubated at 37° C. and 5% CO.sub.2 for 1 hr with constant rocking of the plate at every 15 min interval. The inoculum was aspirated, briefly washed with 2% RPMI and each well overlaid with 1 ml overlay medium. The plate was incubated at 37° C. and 5% CO.sub.2 for 4.5 days until plaques were formed. The cell monolayer was stained with a solution of 0.1% crystal violet in PBS for 24 hrs. The crystal violet solution was removed, the plates washed in distilled water and plaques were counted.
[0104] Aptamer Stability Assay:
[0105] Stability of the aptamers was tested by incubating a fixed concentration (400 ng/ml) of aptamer at three different temperatures (−20° C., room temperature and 37° C.) for 1 to 5 days. After each time point, the integrity of the aptamers was analysed by running a 1.5% agarose gel which was premixed with GEL-RED. The sample was ran 40 V for 4 hr and viewed on a Gel-doc under ultraviolet (UV) light.
[0106] ApoTox-Glo Triple Assay.
[0107] The assay was performed using ApoTox-Glo Triple Assay kit (Promega) and readings were taken using Glomax Instrument. Briefly, BHK cells were seeded in a 96-well assay plate with cell density of 5000 cells/well (5000 cells/0.1 ml) and cultured overnight. After 24 hrs, cells were treated with aptamers (3.3 to 26 nM concentration/well) and positive controls for cytotoxicity (digitonin detergent, MPER, membrane protein extraction reagent). At day 1 and day 4, the cells were incubated with 20 μl of Viability/Cytotoxicity Reagent. The plate was briefly mixed by orbital shaking at 300 rpm for 30 seconds and incubated at 37° C. for 30 min. Fluorescence was measured at two wavelength sets, 400.sub.Ex/505.sub.Em (Viability) and 485.sub.Ex/520.sub.Em (Cytotoxicity). For luminescence reading, the plate was inoculated with 100 μl of Capase-Glo 3/7 Reagent in each well. The plate was briefly mixed by orbital shaking at 300 rpm for 30 sec and incubated at room temperature for 30 min.
[0108] Alamar Blue Viability Assay.
[0109] The assay was performed using alamarBlue Cell Viability Assay (Invitrogen) and readings were taken using Glomax Instrument. BHK cells were seeded in a 96-well assay plate with cell density of 5000 cells/well (5000 cells/0.1 ml) and cultured overnight. After 24 hrs, cells were treated with aptamers (3.3 to 26 nM concentration), and positive controls for cytotoxicity (digitonin detergent, MPER, membrane protein extraction reagent). At day 1, 2, 3 and 4, the cells were incubated with 10 μl of alamar Blue reagent. The plate was briefly mixed by orbital shaking at 300 rpm for 30 sec and incubated at 37° C. for 1-4 hrs, protected from direct light. Fluorescence of the plate was measured at 570.sub.Ex/585.sub.Em.
[0110] Determination of Stability of the Modified Aptamers in Serum by ELISA Method:
[0111] Known amount (40 ng/well) of biotinylated aptamers were coated on the Maxisorp plate and incubated at RT for 2 hours. Then the plates were incubated with and without 100% and 20% serum for varying time points (1, 20, 48 and 120 hours). Positive controls (Just aptamer) were incubated with 4% Bovine serum albumin (BSA). At the end of each time point the serum and BSA were removed. Streptavidin-HRP enzyme conjugates (1:5000 dilution) was added and incubated for 1 hr. The plate was washed 6 times with 1×PBST to remove unbound conjugates. Then, tetramethyl benzidine (TMB) substrate solution was added for development and incubated for 15 min at room temperature. 0.5 M H.sub.2SO.sub.4 solution was added to stop the reaction. The absorbance was measured immediately at 450 nm. As a negative control the aptamer (303) was boiled at 95° C. for 48 hours. If the aptamer is degraded by the serum or heating, then the aptamer will not be detected by the streptavidin-HRP.
Results
Construction of WNE-BNrDIII Plasmid
[0112] To obtain the biotinylated protein of West Nile virus envelope protein domain III (WNE-BNrDIII) for aptamer screening, a new plasmid construct was designed by engineering in the biotinylation acceptor peptide (BAP) on the N-terminus, and an enterokinase cleavage site between the BAP and the WNDIII gene. The DNA sequence corresponding to the BAP was chemically synthesized (Cull et al., 2000), whereas the WNDIII sequence was obtained from the previous construct, which was derived from the cDNA of WNV Wengler strain. Later, the BAP sequence with the enterokinase cleavage site was linked to WNDIII at the 5′ end through overlapping extension PCR (OE-PCR) as illustrated in
Expression of WNE-BNrDIII Plasmid
[0113] To express the recombinant protein, the engineered plasmid was transformed into a commercial E. coli strain AVB-100 obtained from Genecopoeia. The AVB 100 E. coli strain has been incorporated with an overexpressing BR A (Biotin ligase) gene within the genomic DNA. This enzyme specifically adds a biotin molecule to the lysine residue of the BAP. Initially, the protein (BAP-WNDIII) of interest was not expressed in E. coli K12 AVB-100 (
Screening of Biotinylated Proteins:
[0114] As the attempt to express the construct in K12 Strain AVB100 was unsuccessful, in vitro biotinylation using Bir-A enzyme was carried out. In vitro biotinylated WNDIII was tested using ELISA, and the result shows absorbance at 450 nm, indicating that the recombinant protein was biotinylated and binds to streptavidin-HRP conjugate in both experimental conditions (1 hr and overnight reaction set up). Interestingly, the control experiment, i.e. the sample without Bir A enzyme, also showed high absorbance at 450 nm, indicating that it also binds to the streptavidin-HRP conjugate (
Endogenous Biotinylation:
[0115] After it has been proved that the BAP containing WNDIII protein was endogenously in vivo biotinylated during the expression of the protein itself, there was an interest to understand how the biotinylation could have taken place endogenously, and where is the source for the biotin in the cell for the biotinylation. A bioinformatics search for the Bir A enzyme in the genomic DNA sequence of E. coli BL 21(DE3) was carried out and it was discovered that the gene encoding Bir A was found in the E. coli strain, which have been used for expression. In addition, biotin has been found to be present in the medium, which has been used to cultivate the bacterial cells (Tolaymat et al., 1989). Thus, the protein is endogenously biotinylated by the Biotin ligase enzyme already present in the cell, utilizing the biotin in the culture medium. Therefore, attaching a BAP to a gene-of-interest and expressing it in E. coli BL 21 (DE3) will result in the production of biotinylated protein endogenously, hence eliminating the need for a commercial expression strain or in vitro biotinylation. Thus, a platform to obtain endogenously biotinylated, purified protein for biological applications, like aptamer screening, has been established. Every batch of purified protein for biotinylation was checked and was found to be consistent. It was also tested to determine whether endogenous biotinylation is universal for other proteins by cloning the BAP for dengue virus capsid protein and it was confirmed that the capsid protein was found to be endogenously biotinylated. This showed that this platform can be potentially extended to other biotinylated proteins, which have commercial applications in diagnostics and drug development. This has been filed as a provisional patent by Exploit Technologies (Singapore Patent Application No. 201208602-1, Entitled: Biotinylated Protein, Filing Date: 22 Nov. 2012, contents of which are incorporated herein by reference).
Evaluation of Modified Aptamers
Surface Selection.
[0116] In order to test the binding efficiency of aptamers, suitability of the four different surfaces were tested by coating with 50 ng biotinylated modified aptamers (1 to 10) followed by detection with streptavidin-HRP conjugate. Similarly, varying concentrations of biotinylated WNDIII (10, 25, 50 and 100 ng/well) protein was also coated. The results are shown in the
Protein-Coated Enzyme Linked Modified Aptamer Sorbent Assay for Affinity Screening.
[0117] In order to evaluate specific binding of aptamers to WNDIII protein, protein-coated ELISA was carried out for the ten aptamers. WNDIII protein (100 ng/well) was coated overnight and incubated with biotinylated aptamers of various concentrations (0 to 26 nM), followed by probing with streptavidin-HRP conjugate. If an aptamer were to bind to the WNDIII protein, it would be detected through the enzyme substrate reaction. In this case, it was observed that aptamers B03, B79 and B99 bound to the WNDIII protein as their absorbance were significantly higher when compared to the control and the other aptamers (
Virus-Coated Enzyme Linked Modified Aptamer Sorbent Assay.
[0118] Once it had been confirmed that a modified aptamer was able to bind to purified WNDIII protein, it was evaluated whether the aptamer could bind to the West Nile envelope protein if the whole virus was coated. West Nile virus Wengler strain (1000 PFU/well) was coated in the ELISA plate overnight, followed by incubating with different concentrations of aptamers. It was still observed that the aptamers B03, B79 and B99 bind specifically to domain III in the native envelope protein present on the virus (
Neutralization of West Nile Virus by Modified Aptamers.
[0119] As it has been established that the modified aptamers were able to bind to purified WNDIII and native DIII in the envelope protein of wildtype West Nile virus, the ability of the aptamers to neutralize WNV was then tested. The virus was incubated with different concentrations of aptamers followed by infecting BHK cells with the aptamer-treated or untreated virus. Both the treated and untreated virus were removed after an hour. The plate was stained on day 4 after the infection and formation of plaques were observed. In the lower concentrations of aptamer treatment, there was no neutralizing activity. There was visible reduction in the number of plaques in the 5 μM and 10 μM aptamer treatment.
Viability Assay for Modified Aptamers
[0120] As the possibility for aptamers to be developed for therapeutics is very high, it was tested whether treating mammalian cells with the modified aptamers causes cytotoxicity to the cells. In order to check the outcome of cell viability during aptamer treatment, two different sets of viability experiments were performed. The first involved the use of the apotox-glo triple assay while the second involved the use of the alamar blue viability assay. The cells were treated with different concentrations of aptamers followed by testing the viability at various time points (24, 36, 48 and 60 hours post-treatment). The results obtained by the two methods are shown in
Aptamer Stability Assay:
[0121] The stability of the aptamers were tested by incubating them at three different temperatures (−20° C., room temperature and 37° C.) for different periods of time (1 to 5 days), followed by checking the integrity of the modified aptamers in a gel-red stained agarose gel.
Aptamer Stability in Human Serum:
[0122] Testing the stability of the modified aptamers was extended in the presence of serum as a initial step towards the exploring the possibility of these aptamers for therapeutic application. The biotinylated aptamer was coated followed by incubating the human serum for different time points (1, 20, 48 and 120 hours).
Concluding Remarks:
[0123] 1. A new plasmid construct was designed for the production of biotinylated WNDIII for the first time. The biotin acceptor peptide (BAP) was engineered with the WNDIII gene for biotinylation. This construct can be utilized for both in vivo and in vitro biotinylation. In addition, the thrombin and enterokinase cleavage sites enable the removal of purification tags to yield the native protein after purification. [0124] 2. It was discovered that the BAP-WNDIII plasmid construct expressed in E. coli BL 21 (DE3) produces endogenously biotinylated protein. This endogenous biotinylation was confirmed by ELISA and Western Blot. [0125] 3. The endogenous biotinylation is not specific to WNDIII protein and is applicable to any protein-of-interest. This was also tested by cloning the BAP with the dengue virus capsid protein, and discovered that both the capsid and Dengue 2 envelope DIII protein were endogenously biotinylated via ELISA and Western blot. [0126] 4. A platform to obtain endogenously biotinylated, purified protein for biological applications like aptamer screening and studying protein-protein interaction, has been established. [0127] 5. The biotinylated proteins can be used in the development of diagnostics and therapeutics for Flaviviruses, and can be extended to other medically important pathogens. [0128] 6. As a proof-of-concept, the biotinylated WNDIII protein was used for screening and selection of modified aptamers by Fujitsu Laboratories. [0129] 7. Initial screening has resulted in the selection of ten aptamers from the library, which binds to WNDIII protein, by surface plasmon resonance. After the sequences were identified, Fujitsu scientists synthesized the ten aptamers (biotinylated and non-biotinylated aptamers) for evaluation. [0130] 8. The ten aptamers were evaluated against WNDIII protein and West Nile virus for binding and neutralization. The aptamers were also evaluated for any cytotoxic effect and their stabilities. [0131] 9. Initial evaluation was done for the surface of the ELISA plate. The Maxisorp plate was selected as a good surface for coating aptamers as well as the WNDIII protein for further evaluation. [0132] 10. Protein-coated enzyme linked modified aptamer sorbent assay for affinity screening revealed that aptamers B03, B79 and B99 bind to the WNDIII protein significantly when compared to other aptamers. [0133] 11. Virus-coated enzyme linked modified aptamer sorbent assay showed that aptamers B03, B79 and B99 bind specifically to the domain III of the native envelope protein present on the wildtype virus at even lower concentrations of aptamers. [0134] 12. Aptamers B03, B67, B73 and B99 bind significantly at concentrations higher than 3.3 nM to the Sarafend strain of WNV while aptamers B03, B66, B67, B73 and B79 bind significantly at the concentrations higher than 3.3 nM to the Kunjin strain. This indicated that the modified aptamers developed can be used for detection of different strains of West Nile viruses. [0135] 13. Based on the above evaluations, these aptamers can be developed into a diagnostic tool for West Nile virus detection, and also be extended to other flaviviruses including Dengue and Japanese encephalitis and other pathogens. Furthermore, the aptamers can also be used to develop molecular probes for the detection of virus in academic research. [0136] 14. Virus neutralization assay showed that 5 μM treatment of aptamers N03, N71, N79 and N99 resulted in about 30-35% neutralization, whereas the other aptamers showed less than 30% neutralization. When aptamer treatment concentration was at 10 μM, N03 and N99 showed neutralization higher than 50%. These results showed that N03 and N99 have the potential to be developed as a therapeutic against West Nile virus. [0137] 15. Viability assay results indicated that under the test conditions of 3.3 to 26 nM of aptamers treatment, the cells were viable for at least 60 hrs, similar to that of the untreated cells. [0138] 16. Stability assay showed that when aptamers were incubated for 5 days at room temperature and 37° C., the aptamers were stable and intact, and the bands could be detected by gel red. [0139] 17. Serum stability experiments showed that the aptamers are stable in 100% serum until 120 hours (5 days) at RT as detected by ELISA. [0140] 18. A complete platform for the production of BN-WNDIII protein and evaluation of the aptamers against the WNDIII protein is illustrated in
TABLE-US-00003 TABLE 3 Aptamer sequences of the top three anti-WNDIII A-Daptamers A-Daptamer Aptamer ID ID sequence of variable region anti- WNDIII- 5′-A_CfGkC_T_GwChC_A_CfAlA_GbT_ WNDIII- 003 ChC_T_GwGbT_T_CyChC_T_Gw-3′ 1-01 (based on modification of SEQ ID No. 1) anti- WNDIII- 5′-ChC_T_CyChC_AlA_A_CfAeT_GbT_ WNDIII- 067 AsG_AsG_T_CyT_CyA_CfAeT_-3′ 1-02 (based on modification of SEQ ID No. 2) anti- WNDIII- 5′-ChC_AlA_AeT_T_GwChC_GkC_AsG_ WNDIII- 099 A_CfT_CyGbT_T_GwT_GwAlA_-3′ 1-03 (based on modification of SEQ ID No. 3) 1. Backbone nucleotides are indicated in uppercase; A: Adenine, G: Guanine, C: Cytosine, T: Thymine 2. Functional groups of side chains are indicated in lowercase; b: Thiophene, e: Glutamic acid, f: Phenylalanine, h: Histidine, k: Lysine, l: Leucine, s: Serine, y: Tyrosine, w: Tryptophan 3. Native nucleotides are indicated with an underscore (_).
The following Example evaluates the stability and functionality of the modified aptamers for WNV DIII in the human and fetal bovine serum. Comparison studies with other modified and unmodified aptamers, and commercially available aptamer and antibody have also been carried out.
Example 2: Evaluation of Stability and Functionality of WNDIII Aptamers in Serum
Stability of Aptamers in Human Serum.
[0142] In order to test the stability of the modified aptamers by ELISA, biotinylated WNDIII aptamers (B03, B66, B71, B73, B74, B76 and B79 obtained from, Apta Biosciences Pte Ltd www.aptabiosciences.com, 31 Biopolis Way, #02-25 Nanos, Singapore 138669, Phone: +65-3109-0178, Fax: +65-6779-6584, Mobile: +65-9184-7323) formerly known as Fujitsu Biolaboratories) were coated on a maxisorp plate (40 ng/well) followed by incubation with human serum for different durations. If the aptamer was unstable, it would degrade and be removed during washing. Otherwise, the stable modified aptamer would remain bound to the maxisorp plate. The presence of the biotinylated aptamer would then be detected by a streptavidin-HRP conjugate, thereby resulting in TMB substrate conversion. The serum stability of the modified aptamers was monitored for up to 14 days, and was found to vary between 50% and 90% when compared to their respective serum-free controls as shown in
[0143] Based on results from the stability studies of aptamers in human serum, the modified aptamers could be classified into Type 1: Moderately stable (B74), Type 2: Highly stable (B03, B66, B71, B73, B76 and Type 3: Very highly stable—(B79). This implied that the backbone of modified aptamer B79 can be used as the starting template to generate highly stable aptamers in the future. Although modified aptamer B79 was shown to have the highest stability, as can be seen from
[0144] Comparison on the stability of modified aptamer B03 in fetal bovine serum (FBS) for 5 days was also made.
Functionality Test of Modified Aptamers in Human Serum
Binding of Aptamers to WNV DIII and WNV in Human and Fetal Bovine Serum.
[0145] Using ELISA as the platform, maxisorp plates were coated with either WNV DIII protein or WNV. Different concentrations of biotinylated WNV DIII modified aptamer B03 was then added and incubated for 2 hours to allow the modified aptamer to bind to the target. Neat human serum or FBS was subsequently added and incubated for different durations. After incubation, the presence of modified aptamers was probed with streptavidin-HRP conjugate, followed by TMB substrate development.
Evaluation of Unmodified Aptamers for Stability and Functionality by ELISA
[0146] Polynucleotides corresponding to the DNA backbone of the WNV DIII modified aptamers B03 and B99 (i.e. unmodified aptamers) were synthesized (Sigma Aldrich, USA) for comparison with the modified aptamers (which have peptide side chains) in terms of stability and functionality. The nucleotide sequences corresponding to the DNA backbone of the WNV DIII modified aptamers B03 and B99 are listed below.
TABLE-US-00004 BN-B03-DNA BN-5′GAAGGTGAAGGTCGGCTGAAGCATTAG ACCTAAGCACGCTGCCACAAGTCCTGGTTCCC TGGCTTAGGTCTAATGC ACCATCATCACCAT CTTC 3′(SEQ ID No. 11) BN-B99-DNA BN-5′GAAGGTGAAGGTCGGCTGAAGCATCA GACCTAAGCCCAAATTGCCGCAGACTCGTTGT GAAGCTTAGGTCTAATGC ACCATCATCACCA TCTTC-3′ (SEQ ID No. 12)
[0147] For the stability comparison study, known amounts of unmodified DNA aptamers were incubated at room temperature (RT) for varying durations in human serum or FBS. Their stability was then determined through detection using streptavidin-HRP conjugate in ELISA.
[0148] Based on the stability study as shown in
Comparison of Aptamer Binding with WNV DIII Commercial Antibody
[0149] Using the ELISA platform, the same concentration (33 nM) of aptamers (B03, B79, B99, B66, B67, B71) and WNV-specific antibody (Millipore MAB8151) were coated onto a maxisorp plate to capture biotinylated WNV DIII protein.
Concluding Remarks:
[0150] 1. Stability of modified aptamers in human serum varies between 50% and 90% for up to 14 days, and varies between individual aptamer. The modified aptamers can be classified according to their stability in human serum into type 1: Moderately stable (B74), type 2: Highly stable (B03, B66, B71, B73 and B76) and type 3: Very highly stable (B79). [0151] 2. Modified aptamer (B03) was able to bind to WNV DIII protein and wildtype WNV for up to 24 and 48 hours in human serum, respectively. [0152] 3. The stability and functionality results indicated that modified aptamers were functional in human serum, a property essential for modified aptamers to be developed as a diagnostic tool or therapeutic candidate. [0153] 4. Comparison studies on the stability between side-chain modified WNV DIII aptamers B03 and B99, and their unmodified DNA counterparts indicated that modified aptamers B03 and B99 were highly stable whereas their unmodified DNA counterparts became unstable after 24 hours of incubation in human serum and FBS. [0154] 5. Comparison studies on the functionality between side-chain modified WNV DIII aptamers B03 and B99, and their unmodified DNA counterparts indicated that modified aptamers B03 and B99 could bind to WNV DIII protein whereas their unmodified DNA counterparts could not. [0155] 6. Both the modified aptamers and antibody were able to bind WNV DIII protein at the same concentration. Binding of modified aptamer B99 to WNV DIII protein was the strongest and was comparable to that of the antibody, followed by modified aptamers B03, B79, B66 and B67.
Example 3: Evaluation of Dengue Virus Serotype 2 (DENV2) Modified Aptamers
[0156] The following Example evaluates the binding characteristics of a separate set of selected modified aptamers (generated by Adaptamer Solutions, www.aptabiosciences.com, Apta Biosciences Pte Ltd, 31 Biopolis Way, #02-25 Nanos, Singapore 138669, Phone: +65-3109-0178, Fax: +65-6779-6584, Mobile: +65-9184-7323) against purified DENV2 DIII protein and the native envelope protein on wildtype DENV. The best aptamer which can be utilized for diagnostic and therapeutic applications was then identified. Ten potential aptamer candidates against DENV2 DIII protein were evaluated and the results are also discussed.
Materials and Methods
Cloning and Expression of DENV1-4 Biotinylated Recombinant Envelope Domain III (DENV1-4 BN-rEDIII) Protein
[0157] Overlapping Extension-Polymerase Chain Reaction (OE-PCR).
[0158] Two fragments were used in the cloning of DENV1-4 BN-rEDIII protein. The biotin acceptor peptide (BAP) (Fragment 1) was synthesized chemically. Domain III of the envelope glycoprotein (Fragment 2) of each DENV serotypes was derived from the cDNA of DENV1-4, respectively.
TABLE-US-00005 TABLE 4 The list of forward and reverse primers used in OE-PCR to join Fragment 1 (BAP) and Fragment 2 (DIII gene) for all four DENV serotypes. DENV1 Primer A (BAP Forward): 5′CTAGCTAGCTCCGG BN-rEDIII CCTGAACGAC NheI (SEQ ID No. 13) Primers for Primer B (BAP Reverse): Bacterial 5′ATATGACATCCCTTTTAAGCTCTTGTCGTCGTC expression (SEQ ID No. 14) Primer C (D1-DIII Forward): 5′GACGACGACAAGAGCTTAAAAGGGATGTCATAT (SEQ ID No. 15) Primer D (D1-DIII Reverse): 5′CCGCTCGAGT TAGCTTCCCTTCTTGAA XhoI (SEQ ID No. 16) DENV2 Primer A (BAP Forward): 5′CTAGCTAGCTCCGG BN-rEDIII CCTGAACGAC NheI (SEQ ID No. 17) Primers for Primer B (BAP Reverse): Bacterial 5′GTATGACATTCCTTTGAGGCTCTTGTCGTCGTC expression (SEQ ID No. 18) Primer C (D2-DIII Forward): 5′GACGACGACAAGAGCCTCAAAGGAATGTCATAC (SEQ ID No. 19) Primer D (D2-DIII Reverse): 5′CCGCTCGAGT TAACTTCCTTTCTT XhoI (SEQ ID No. 20) DENV3 Primer A (BAP Forward): 5′CTAGCTAGCTCCGG BN-rEDIII CCTGAACGAC NheI (SEQ ID No. 21) Primers for Primer B (BAP Reverse): Bacterial 5′ATAGCTCATCCCCTTGAGGCTCTTGTCGTCGTC expression (SEQ ID No. 22) Primer C (D3-DIII Forward): 5′GACGACGACAAGAGCCTCAAGGGGATGAGCTAT (SEQ ID No. 23) Primer D (D3-DIII Reverse): 5′CCGCTCGAGTTAGCTCCCCTTCTTGTA XhoI (SEQ ID No. 24) DENV4 Primer A (BAP Forward): 5′CTAGCTAGCTCCGG BN-rEDIII CCTGAACGAC NheI (SEQ ID No. 25) Primers for Primer B (BAP Reverse): Bacterial 5′GTATGACATTCCCTTGATGCTCTTGTCGTCGTC expression (SEQ ID No. 26) Primer C (D4-DIII Forward): 5′GACGACGACAAGAGCATCAAGGGAATGTCATAC (SEQ ID No. 27) Primer D (D4-DIII Reverse): 5′CCGCTCGAGTTAACTCCCTTTCCTGAA XhoI (SEQ ID No. 28)
[0159] Protein Expression and Extraction.
[0160] pET28a-DENV2 BN-rEDIII plasmid was transformed into BL-21-DE3 expression competent cells (Agilent Technologies, USA) and grown in Luria-Bertani (LB) agar containing 30 μg/ml kanamycin. Selected clones were cultured in 1 L LB broth (30 μg/ml kanamycin) at 30° C. until an OD.sub.600 of 0.6. Expression of DENV2 BN-rEDIII protein was induced with 1 mM isopropyl β-D-thiogalactoside (IPTG) for 6 hours. Bacterial cells were pelleted down with centrifugation at 8,000 rpm for 15 min at 4° C. The protein expressed was targeted to inclusion bodies (IB). IBs were isolated in the subsequent steps. The bacterial cell pellet was first resuspended in lysis buffer (20 mM Tris pH 8.0, 500 mM NaCl, 10 mM imidazole), followed by sonication in ice bath (10 min, 10 Amp). The lysate was then centrifuged at 12,000 rpm for 15 min at 4° C. to obtain a small white translucent pellet of inclusion body. The inclusion body pellet was then washed with the same lysis buffer, incubated in extraction buffer (8 M urea, 20 mM Tris, 300 mM NaCl, 10 mM imidazole, pH 8.0) at room temperature for 30 min, and its extract clarified by centrifugation at 13,500 rpm for 20 min.
[0161] Immobilised Metal Ion Affinity Chromatography (IMAC) Purification of BN-rEDIII Protein.
[0162] The inclusion body extract containing DENV2 BN-rEDIII protein was incubated with nickel-nitrilotriacetic acid (Ni-NTA) resin (Bio-Rad, USA) for binding in a chromatography column overnight at 4° C. Five column volume of wash buffer (8 M urea, 20 mM Tris, 300 mM NaCl, 20 mM imidazole, pH 8.0) was used to remove non-specific binding proteins. BN-D2DIII protein was then eluted out with elution buffer (8 M urea, 20 mM Tris, 300 mM NaCl, 500 mM Imidazole, pH 8.0) in eight 1.5-ml fractions. All the eluates were pooled into a SnakeSkin dialysis membrane tubing (Thermo Scientific, USA) and 0.05% of Tween-20 was added to the samples. The dialysis tubing was incubated in 4 M urea for 6-12 hrs at 4° C., and the urea diluted stepwise to 0.5M. The refolded DENV2 BN-rEDIII protein was finally collected from the dialysis tubing and injected into a FPLC machine to be further purified via size-exclusion chromatography into PBS. DENV1, 3 and 4 BN-rEDIII proteins were also purified in a similar manner.
[0163] Protein Identity Analysis.
[0164] The flow through, wash, and eluates from the IMAC purification were analyzed by SDS-PAGE and Western blot. 12% Tris-tricine polyacrylamide denaturing gel was used to separate proteins and was subsequently stained with Coomassie blue for protein detection. For Western blotting, proteins were transferred from the polyacrylamide gel onto a PVDF membrane using iBlot® Dry Blotting System (Life Technologies, USA). Blocking was done with 5% BSA overnight in 4° C. The membrane was then incubated with streptavidin conjugated-HRP to detect for DENV BN-rEDIII for 2 hours at room temperature. The membrane was washed thoroughly with 1×PBST for 1 hour at room temperature and developed with SuperSignal® West Pico chemiluminescent substrate (Thermo Scientific, USA). A schematic flowchart representing the expression, purification and evaluation of recombinant purified DENV1-4 BN-rEDIII proteins is shown in
[0165] Protein-Coated Enzyme-Linked Modified Aptamer Sorbent Assay (ELMASA) for Affinity screening.
[0166] 100 ng of purified non-biotinylated DENV2 rEDIII protein was coated onto each well of a maxisorp plate overnight at 4° C. On the following day, the ELISA plate was washed three times with Phosphate-buffered saline (PBS) and incubated for 1 hour with different concentrations (1 to 32 nM/well) of biotinylated (DENV) aptamers solubilized in RNase free TE buffer (Invitrogen) in triplicates. Blocking with 4% BSA in PBS was then carried out overnight, followed by washing with PBS. 1:2000 (v/v) dilution of streptavidin-HRP enzyme conjugate (Millipore) was subsequently added and the plate was incubated for 1 hour. The plate was washed 6 times with 1×PBST, before 50 μl of tetramethyl benzidine (TMB) substrate solution was added and incubated for 15 min at room temperature. Finally, 50 μl of 0.5 M H.sub.2SO.sub.4 solution was added to stop the reaction and absorbance was measured immediately at 450 nm.
[0167] Virus-Coated ELMASA.
[0168] Instead of using DENV2 rEDIII protein, 1,000 PFU of DENV2 wildtype virus was coated onto the ELISA plate and incubated overnight at 4° C. The wells were washed with 1×PBST followed by blocking with 4% BSA. Following this step, the wells were incubated with different concentrations (1 to 32 nM) of biotinylated aptamers (1-10) for 1 hour. 1:2000 (v/v) dilution of streptavidin-HRP enzyme conjugate was then added and the rest of the experiment was performed as described in the protein-coated ELMASA above. All procedures were carried out in a class 2 Biological Safety Cabinet (BSC).
[0169] Virus Blocking Assay.
[0170] BHK cells were seeded in a 24-well plate overnight at 50000 cells/well. 50 μl of 2 μM aptamers solubilized in RNase-free TE buffer (Invitrogen) were added to 50 PFU/50 μl DENV2 in triplicates. The mixture was incubated for 1.5 hrs for binding (final aptamer working concentration is 1 μM/well). A negative control was set up similarly without any virus. Following which, growth medium was removed from the 24-well plate, and the cell monolayer in each well was washed with RPMI containing 2% FCS and infected with the 100 μl of aptamer-virus mixture. The plate was incubated at 37° C. and 5% CO.sub.2 for 1 hour, with constant rocking at 15-min interval. The inoculum was removed, the cell monolayer washed with RPMI containing 2% FCS, and 1 ml of CMC overlay medium wad added to each well. The plate was incubated at 37° C. and 5% CO.sub.2 for 4.5 days until plaques were formed. The remaining cells were finally stained with crystal violet and the unstained plaques were counted.
Results
Construction of DENV1-4 BN-rEDIII Plasmids
[0171] To obtain DENV1-4 BN-rEDIII proteins for aptamer screening, new expression plasmids were designed by engineering in a biotinylation acceptor peptide (BAP), followed by an enterokinase cleavage site, at the N-terminus of the DENV1-4 envelope DIII gene. The DNA sequence corresponding to the BAP was chemically synthesized (Kaur et al., 2013), whereas the DENV1-4 envelope DIII DNA sequences were derived from the cDNA of DENV1-4, respectively. The BAP sequence with the enterokinase cleavage site was linked upstream of DIII through overlapping extension PCR (OE-PCR) as illustrated in
Expression and Purification of DENV1-4 BN-rEDIII Proteins
[0172] The DENV1-4 BN-rEDIII proteins were expressed in E. coli BL21 (DE3). After DENV1-4 BN-rEDIII protein expression was confirmed via Western blotting using an anti-His antibody, expression was scaled up to produce large amounts of DENV1-4 BN-rEDIII proteins. Crude protein was extracted from the inclusion bodies and subjected to IMAC affinity purification, refolding, and size exclusion chromatography as explained in Materials and Methods. The representative FPLC-SEC profile for DENV2 BN-rEDIII protein is shown in
Aptamer Screening:
Aptamer Designing and Synthesis:
Identification of DENV2 BN-rEDIII Protein-Binding Modified Aptamer Candidates
[0173] DENV2 BN-rEDIII protein immobilized on monomeric avidin-agarose resin was incubated with a library solution of modified aptamers. The resin was then washed repeatedly to remove weakly bound modified aptamers before the modified aptamer: DENV2 BN-rEDIII complexes were eluted from the resin using a biotin solution. The eluted complexes were treated with alkali to remove the side chains and liberate the DNA aptamer backbone for PCR, sequencing, and subsequent cloning to allow determination of the DNA sequence of the bound aptamers. DNA sequences of 136 DENV2 BN-rEDIII modified aptamer candidates were obtained and these modified aptamers were synthesized by a DNA synthesizer. Screening of DENV2 BN-rEDIII modified aptamer candidates was repeated by applying them to DENV2 BN-rEDIII protein immobilized on a CM5 Biacore sensor chip by amine-coupling. The top 10 DENV2 BN-rEDIII modified aptamer candidates were selected for further analysis.
SPR Analysis Using DENV2 rEDIII Protein:
[0174] For K.sub.D measurement, each of the ten DENV2 BN-rEDIII modified aptamer candidates was biotinylated and immobilized on a Biacore SA chip separately. Their individual K.sub.D was determined for various concentrations of DENV2 rEDIII protein in MES buffer at pH 5.5 (see
TABLE-US-00006 TABLE 5 List of aptamers chosen for further evaluation after measurement of their affinities using SPR. Screening K.sub.D at pH Aptamer ID (RU) 5.5 (nM) D2ED3-002 251 53.1 D2ED3-006 306 16.8 D2ED3-012 316 18.3 D2ED3-016 300 23.0 D2ED3-027 317 33.1 D2ED3-060 341 27.7 D2ED3-113 358 7.1 D2ED3-118 314 15.8 D2ED3-121 305 13.9 D2ED3-128 331 21.2
DENV2 BN-rEDIII Coated ELMASA for Affinity Screening of Modified Aptamers.
[0175] In order to evaluate the binding of the 10 selected modified aptamers to DENV2 rEDIII protein, DENV2 rEDIII protein coated ELMASA was carried out using biotinylated modified aptamers of various concentrations (0 to 32 nM). It was observed that modified aptamers B002, B006, B027 and B128 bound most efficiently to DENV2 rEDIII protein although modified aptamers B012, B060, B113, B118 and B121 also bound significantly to the DENV2 rEDIII proteins at all concentrations tested. The binding of the modified aptamers against rEDIII protein of DENV1, 3 and 4 were evaluated, and the results were shown in
Virus-Coated ELMASA.
[0176] Binding of the modified aptamers to purified DENV2 rEDIII protein was further confirmed using wildtype virus. DENV2 (1000 PFU/well) was coated on the ELISA plate overnight, followed by incubation with different concentrations of aptamers. It was still observed that modified aptamers B060, B118, B121 and B128 bound significantly to DENV2 as compared with the control (
Neutralization of DENV2 by Modified Aptamers
[0177] After establishing that the modified aptamers were able to bind to purified DENV2 rEDIII protein and native envelope DIII protein on wildtype DENV2, their ability to neutralize DENV2 was evaluated. Prior incubation of viruses with different concentrations of modified aptamers, followed by infection of BM cells was carried out. There was a reduction in the number of virus-induced plaques when DENV2 was pretreated with 1 μM of modified aptamer. The results showed that pretreatment with 1 μM of modified aptamers B060 and B118 resulted in more than 60% neutralization, whereas neutralization by the other modified aptamers varied between 40% and 58%. Thus, modified aptamers B060 and B118 had the potential to be developed into therapeutics against DENV2.
Cross Reactivity of DENV2 DIII Modified Aptamers with Other Flavivirus Envelope Protein:
[0178] In order to evaluate potential non-specific and cross-reactive binding of the modified aptamers to other flavivirus envelope protein, protein coated ELMASA was performed using the envelope or DIII proteins of West Nile virus (WNV), tick-borne encephalitis virus (TBEV) (ProSpecbio, USA) and Japanese Encephalitis Virus (JEV) (ProSpecbio, USA). No significant binding to the envelope or DIII proteins of all three viruses above was detected at all the modified aptamer concentrations tested (see
[0179] TBE-281:
[0180] Tick-borne encephalitis is caused by tick-borne encephalitis virus (TBEV), a member of the virus family Flaviviridae. TBE-281 is the E. coli derived recombinant protein comprising residues 95 to 229 of the Tick-borne Encephalitis Virus envelope glycoprotein.
[0181] JEV-290:
[0182] Japanese encephalitis previously known as Japanese B encephalitis is a virus from the virus family Flaviviridae. It is closely related to WNV and St. Louis encephalitis virus. JEV-290 protein is the 50-kDa full length Japanese Encephalitis virus envelope protein expressed in E. coli and is fused to a 6× histidine tag.
Comparison of Binding for the DENV2 DIII Modified Aptamers of the Present Invention and Other Commercial Aptamer to DENV2 rEDIII Protein.
[0183] The functionality of the DENV2 DIII modified aptamers of the present invention was compared to that of commercially available aptamers against DENV2 DIII (D2A) (OTC Biotech, USA). The commercial aptamer was evaluated in a similar manner as the DENV2 DIII modified aptamers. As illustrated in
Concluding Remarks:
[0184] 1. A plasmid construct was designed for production of biotinylated DENV1-4 rEDIII proteins for the screening of modified aptamers. A biotin acceptor peptide (BAP) has been engineered into the genes of DENV1-4 rEDIII for biotinylation. This construct can be utilized for both in vivo and in vitro biotinylation. The insertions of thrombin and enterokinase cleavage sites further enable the removal of tags to yield native proteins after purification. [0185] 2. A platform has been established to obtain biotinylated, purified DENV 1-4 DIII for applications such as aptamer screening and studying of protein-protein interactions. [0186] 3. Biotinylated DENV2 rEDIII protein was used for screening and selection of modified aptamers by Adaptamer Solutions. [0187] 4. Initial screening has resulted in the selection of ten modified aptamers, which bind to DENV2 rEDIII protein, by surface plasmon resonance from the library. After the sequences were identified, Adaptamer Solutions scientists synthesized the ten modified aptamers (biotinylated aptamers) for evaluation. [0188] 5. The ten biotinylated modified aptamers were evaluated against DENV2 rEDIII protein and DENV2 for binding and neutralization, respectively. [0189] 6. Protein-coated ELMASA for modified aptamer affinity screening revealed that modified aptamers B002, B118 and B128 bound to DENV2 rEDIII protein specifically. [0190] 7. Virus-coated ELMASA showed that modified aptamers B118, B121 and B128 bound specifically to the native envelope protein present on wildtype DENV2 even at low concentrations. Based on the above evaluations, these aptamers can be developed into a diagnostic tool for DENV detection. These aptamers can also be developed into molecular probes for the detection of virus for academic research. [0191] 8. Virus neutralization assay showed that treatment using 1 μM of modified aptamers B060 and B118 resulted in more than 60% neutralization of DENV2 virus. The other modified aptamers resulted in virus neutralization varying between 40% and 58%. This implied that modified aptamers B060 and B118 have the potential to be developed into therapeutics to treat DENV2 infection. [0192] 9. Comparison studies for the binding of the modified aptamers (DENV2 rEDIII aptamers) with the other flavivirus envelope proteins (WNV EDIII, TBEV and JEV) shows insignificant binding and is very specific to DENV2 rEDIII. [0193] 10. Comparison of the binding of modified aptamer is very high and significant to the DENV2 rEDIII to that of the aptamer obtained from the commercial source. [0194] 11. A complete platform for the evaluation of aptamers against DENV2 rEDIII protein is illustrated in
TABLE-US-00007 TABLE 6 Sequences of modified aptamers against DENV2 DIII. Product Adaptamer code ID Sequence of variable region Anti-D2ED3- D2ED3-002 5′ T- 01 CyA_CfAeT_T_CyAsG_AeT_AeT_ GbT_T_GwGbT_T_CyChC_A_Cf-3′ (based on modification of SEQ ID No. 4) Anti-D2ED3- D2ED3-118 5′-T_AkAlA_T_GwT_GwA_CfGbT_ 02 T_CyA_CfAsG_A_CfAlA_GbT_ ChC_-3′(based on modification of SEQ ID No. 5) Anti-D2ED3- D2ED3-128 5′-GkC_T_GwAeT_A_CfA_ 03 CfT_GwAlA_GbT_GbT_T_CyT_ GwAeT_T_Gw-3′ (based on modification of SEQ ID No. 6) 1. Backbone nucleotides shown in upper case A: Adenine, G: Guanine, C: Cytosine, T: Thymine 2. Functional groups of side chains shown in lower case: b: Thiophene, e: Glutamic acid, f: Phenylalanine, h: Histidine k: Lysine, l: Leucine, s: Serine, y: Tyrosine, w: Tryptophan 3. Native nucleotides with no side chains shown with an underscore (_)
REFERENCES
[0196] Bhardwaj, S., Holbrook, M., Shope, R. E., Barrett, A. D. and Watowich, S. J. (2001). Biophysical characterization and vector-specific antagonist activity of domain III of the tick-borne flavivirus envelope protein. J Virol 75, 4002-4007. [0197] Bhatt, S., Gething, P. W., Brady, O. J., Messina, J. P., Farlow, A. W., Moyes, C. L., et al. (2013). The global distribution and burden of dengue. Nature. [0198] Bigham, A. W., Buckingham, K. J., Husain, S., Emond, M. J., Bofferding, K. M., Gildersleeve, H., et al. (2011). Host genetic risk factors for West Nile virus infection and disease progression. PloS one 6, e24745. [0199] Chavez, J. H., Silva, J. R., Amarilla, A. A. and Moraes Figueiredo, L. T. (2010). Domain III peptides from flavivirus envelope protein are useful antigens for serologic diagnosis and targets for immunization. Biologicals: journal of the International Association of Biological Standardization 38, 613-618. [0200] Chin, J. F., Chu, J. J. and Ng, M. L. (2007). The envelope glycoprotein domain III of dengue virus serotypes 1 and 2 inhibit virus entry. Microbes Infect 9, 1-6. [0201] Cho, S. J., Woo, H. M., Kim, K. S., Oh, J. W. and Jeong, Y. J. (2011). Novel system for detecting SARS coronavirus nucleocapsid protein using an ssDNA aptamer. J Biosci Bioeng 112, 535-540. [0202] Chu, J. J., Rajamanonmani, R., Li, J., Bhuvanakantham, R., Lescar, J. and Ng, M. L. (2005). Inhibition of West Nile virus entry by using a recombinant domain III from the envelope glycoprotein. J Gen Virol 86, 405-412. [0203] Clyde, K., Kyle, J. L. and Harris, E. (2006). Recent advances in deciphering viral and host determinants of dengue virus replication and pathogenesis. J Virol 80, 11418-11431. [0204] Cohen, C., Forzan, M., Sproat, B., Pantophlet, R., McGowan, I., Burton, D. and James, W. (2008). An aptamer that neutralizes R5 strains of HIV-1 binds to core residues of gp120 in the CCR5 binding site. Virology 381, 46-54. [0205] Crill, W. D. and Roehrig, J. T. (2001). Monoclonal antibodies that bind to domain III of dengue virus E glycoprotein are the most efficient blockers of virus adsorption to Vero cells. J Virol 75, 7769-7773. [0206] Cull, M. G. and Schatz, P. J. (2000). Biotinylation of proteins in vivo and in vitro using small peptide tags. Method Enzymol 326, 430-440. [0207] Dey, A. K., Griffiths, C., Lea, S. M. and James, W. (2005a). Structural characterization of an anti-gp120 RNA aptamer that neutralizes R5 strains of HIV-1. Rna 11, 873-884. [0208] Dey, A. K., Khati, M., Tang, M., Wyatt, R., Lea, S. M. and James, W. (2005b). An aptamer that neutralizes R5 strains of human immunodeficiency virus type 1 blocks gp120-CCR5 interaction. J Virol 79, 13806-13810. [0209] Duan, T., Ferguson, M., Yuan, L., Xu, F. and Li, G. (2009). Human Monoclonal Fab Antibodies Against West Nile Virus and its Neutralizing Activity Analyzed in Vitro and in Vivo. Journal of antivirals & antiretrovirals 1, 36-42. [0210] Fujita, S., Arinaga, K., Fujihara, T., Aki, M. and Kichise, T. (2012). Novel Protein Detection System Using DNA as Constituent Material. Fujitsu Sci Tech 0.148, 237-243. [0211] Giver, L., Bartel, D. P., Zapp, M. L., Green, M. R. and Ellington, A. D. (1993). Selection and Design of High-Affinity Rna Ligands for Hiv-1 Rev. Gene 137, 19-24. [0212] Gopinath, S. C. B., Hayashi, K. and Kumar, P. K. R. (2012). Aptamer That Binds to the gD Protein of Herpes Simplex Virus 1 and Efficiently Inhibits Viral Entry. J Virol 86, 6732-6744. [0213] Gromowski, G. D. and Barrett, A. D. (2007). Characterization of an antigenic site that contains a dominant, type-specific neutralization determinant on the envelope protein domain III (ED3) of dengue 2 virus. Virology 366, 349-360. [0214] James, W. (2007). Aptamers in the virologists' toolkit. J Gen Virol 88, 351-364. [0215] James, W., Moore, M. D., Bunka, D. H. J., Stockley, P. G., Spear, P. G., Cookson, J., et al. (2011). The Development of Aptamers as Candidate Antiviral Agents: Towards a Polyvalent Microbicide. Nucleic Acid Ther 21, A56-A56. [0216] Keefe, A. D., Pai, S. and Ellington, A. (2010). Aptamers as therapeutics. Nat Rev Drug Discov 9, 537-550. [0217] Lisova, O., Hardy, F., Petit, V. and Bedouelle, H. (2007). Mapping to completeness and transplantation of a group-specific, discontinuous, neutralizing epitope in the envelope protein of dengue virus. J Gen Virol 88, 2387-2397. [0218] Liu, Y., Tuleouva, N., Ramanculov, E. and Revzin, A. (2010). Aptamer-Based Electrochemical Biosensor for Interferon Gamma Detection. Anal Chem 82, 8131-8136. [0219] Modis, Y., Ogata, S., Clements, D. and Harrison, S. C. (2004). Structure of the dengue virus envelope protein after membrane fusion. Nature 427, 313-319. [0220] Moore, M. D., Bunka, D. H. J., Forzan, M., Spear, P. G., Stockley, P. G., McGowan, I. and James, W. (2011). Generation of neutralizing aptamers against herpes simplex virus type 2: potential components of multivalent microbicides. J Gen Virol 92, 1493-1499. [0221] Mukhopadhyay, S., Kuhn, R. J. and Rossmann, M. G. (2005). A structural perspective of the flavivirus life cycle. Nat Rev Microbiol 3, 13-22. [0222] Noda, M., Masrinoul, P., Punkum, C., Pipattanaboon, C., Ramasoota, P., Setthapramote, C., et al. (2012). Limited cross-reactivity of mouse monoclonal antibodies against Dengue virus capsid protein among four serotypes. Biologics: targets & therapy 6, 409-416. [0223] Pan, W. H., Craven, R. C., Qiu, Q., Wilson, C. B., Wills, J. W., Golovine, S. and Wang, J. F. (1995). Isolation of Virus-Neutralizing Rnas from a Large Pool of Random Sequences. P Natl Acad Sci USA 92, 11509-11513. [0224] Park, J. H., Jee, M. H., Kwon, O. S., Keum, S. J. and Jang, S. K. (2013). Infectivity of hepatitis C virus correlates with the amount of envelope protein E2: Development of a new aptamer-based assay system suitable for measuring the infectious titer of HCV. Virology 439, 13-22. [0225] Rajamanonmani, R., Nkenfou, C., Clancy, P., Yau, Y. H., Shochat, S. G., Sukupolvi-Petty, S., et al. (2009). On a mouse monoclonal antibody that neutralizes all four dengue virus serotypes. J [0226] Gen Virol 90, 799-809. [0227] Rey, F. A. (2003). Dengue virus envelope glycoprotein structure: New insight into its interactions during viral entry. P Natl Acad Sci USA 100, 6899-6901. [0228] Rey, F. A., Heinz, F. X., Mandl, C., Kunz, C. and Harrison, S. C. (1995). The envelope glycoprotein from tick-borne encephalitis virus at 2 A resolution. Nature 375, 291-298. [0229] Roh, C. and Jo, S. K. (2011). Quantitative and sensitive detection of SARS coronavirus nucleocapsid protein using quantum dots-conjugated RNA aptamer on chip. J Chem Technol Biot 86, 1475-1479. [0230] Saxena, D., Parida, M., Rao, P. V. and Kumar, J. S. (2013). Cloning and expression of an envelope gene of West Nile virus and evaluation of the protein for use in an IgM ELISA. Diagnostic microbiology and infectious disease 75, 396-401. [0231] Silva, M. S. E., Ellis, A., Karaca, K., Minke, J., Nordgren, R., Wu, S. X. and Swayne, D. E. (2013). Domestic goose as a model for West Nile virus vaccine efficacy. Vaccine 31, 1045-1050. [0232] Song, K. M., Lee, S. and Ban, C. (2012). Aptamers and Their Biological Applications. Sensors—Basel 12, 612-631. [0233] Teoh, E. P., Kukkaro, P., Teo, E. W., Lim, A. P., Tan, T. T., Yip, A., et al. (2012). The structural basis for serotype-specific neutralization of dengue virus by a human antibody. Science translational medicine 4, 139ra183. [0234] Tolaymat, N. and Mock, D. M. (1989). Biotin analysis of commercial vitamin and other nutritional supplements. The Journal of nutrition 119, 1357-1360. [0235] Tuerk, C., Macdougal, S. and Gold, L. (1992). Rna Pseudoknots That Inhibit Human-Immunodeficiency-Virus Type-1 Reverse-Transcriptase. P Natl Acad Sci USA 89, 6988-6992. [0236] Wang, P., Yang, Y., Hong, H., Zhang, Y., Cai, W. and Fang, D. (2011). Aptamers as Therapeutics in Cardiovascular Diseases. Curr Med Chem 18, 4169-4174. [0237] Zhang, Z. S., Yan, Y. S., Weng, Y. W., Huang, H. L., Li, S. Q., He, S. and Zhang, J. M. (2007). High-level expression of recombinant dengue virus type 2 envelope domain III protein and induction of neutralizing antibodies in BALB/C mice. J Virol Methods 143, 125-131. [0238] Gromowski G D, Barrett A D. Characterization of an antigenic site that contains a dominant, type-specific neutralization determinant on the envelope protein domain III (ED3) of dengue 2 virus. Virology. 2007; 366(2):349-60. Epub 2007/08/28. [0239] Crill W D, Roehrig J T. Monoclonal antibodies that bind to domain III of dengue virus E glycoprotein are the most efficient blockers of virus adsorption to Vero cells. J Virol. 2001; 75(16):7769-73. Epub 2001/07/20. [0240] Lisova O, Hardy F, Petit V, Bedouelle H. Mapping to completeness and transplantation of a group-specific, discontinuous, neutralizing epitope in the envelope protein of dengue virus. J Gen Virol. 2007; 88(Pt 9):2387-97. Epub 2007/08/19. [0241] Rajamanonmani R, Nkenfou C, Clancy P, Yau Y H, Shochat S G, Sukupolvi-Petty S, et al. On a mouse monoclonal antibody that neutralizes all four dengue virus serotypes. J Gen Virol. 2009; 90(Pt 4):799-809. Epub 2009/03/07. [0242] Rey F A. Dengue virus envelope glycoprotein structure: New insight into its interactions during viral entry. Proceedings of the National Academy of Sciences of the United States of America. 2003; 100(12):6899-901. [0243] Clyde K, Kyle J L, Harris E. Recent advances in deciphering viral and host determinants of dengue virus replication and pathogenesis. J Virol. 2006; 80(23):11418-31. Epub 2006/08/25. [0244] Modis Y, Ogata S, Clements D, Harrison S C. Structure of the dengue virus envelope protein after membrane fusion. Nature. 2004; 427(6972):313-9. Epub 2004/01/23. [0245] Mukhopadhyay S, Kuhn R J, Rossmann M G. A structural perspective of the flavivirus life cycle. Nat Rev Microbiol. 2005; 3(1):13-22. Epub 2004/12/21. [0246] Rey F A, Heinz F X, Mandl C, Kunz C, Harrison S C. The envelope glycoprotein from tick-borne encephalitis virus at 2 A resolution. Nature. 1995; 375(6529):291-8. Epub 1995/05/25. [0247] Bhardwaj S, Holbrook M, Shope R E, Barrett A D, Watowich S J. Biophysical characterization and vector-specific antagonist activity of domain III of the tick-borne flavivirus envelope protein. J Virol. 2001; 75(8):4002-7. Epub 2001/03/27. [0248] Chin J F, Chu J J, Ng M L. The envelope glycoprotein domain III of dengue virus serotypes 1 and 2 inhibit virus entry. Microbes Infect. 2007; 9(1):1-6. Epub 2007/01/02. [0249] Chu J J, Rajamanonmani R, Li J, Bhuvanakantham R, Lescar J, Ng M L. Inhibition of West Nile virus entry by using a recombinant domain III from the envelope glycoprotein. J Gen Virol. 2005; 86(Pt 2):405-12. Epub 2005/01/22. [0250] Zhang Z S, Yan Y S, Weng Y W, Huang H L, Li S Q, He S, et al. High-level expression of recombinant dengue virus type 2 envelope domain III protein and induction of neutralizing antibodies in BALB/C mice. J Virol Methods. 2007; 143(2):125-31. Epub 2007/05/29. [0251] Teoh E P, Kukkaro P, Teo E W, Lim A P, Tan T T, Yip A, et al. The structural basis for serotype-specific neutralization of dengue virus by a human antibody. Science translational medicine. 2012; 4(139):139ra83. Epub 2012/06/23. [0252] Noda M, Masrinoul P, Punkum C, Pipattanaboon C, Ramasoota P, Setthapramote C, et al. Limited cross-reactivity of mouse monoclonal antibodies against Dengue virus capsid protein among four serotypes. Biologics: targets & therapy. 2012; 6:409-16. Epub 2012/12/05. [0253] Bhatt S, Gething P W, Brady O J, Messina J P, Farlow A W, Moyes C L, et al. The global distribution and burden of dengue. Nature. 2013. Epub 2013/04/09. [0254] Tuerk C, Macdougal S, Gold L. Rna Pseudoknots That Inhibit Human-Immunodeficiency-Virus Type-1 Reverse-Transcriptase. P Natl Acad Sci USA. 1992; 89(15):6988-92. [0255] Giver L, Bartel D P, Zapp M L, Green M R, Ellington A D. Selection and Design of High-Affinity Rna Ligands for Hiv-1 Rev. Gene. 1993; 137(1):19-24. [0256] Cohen C, Forzan M, Sproat B, Pantophlet R, McGowan I, Burton D, et al. An aptamer that neutralizes R5 strains of HIV-1 binds to core residues of gp120 in the CCR5 binding site. Virology. 2008; 381(1):46-54. [0257] Dey A K, Khati. M, Tang M, Wyatt R, Lea S M, James W. An aptamer that neutralizes R5 strains of human immunodeficiency virus type 1 blocks gp120-CCR5 interaction. J Virol. 2005; 79(21): 13806-10. [0258] Dey A K, Griffiths C, Lea S M, James W. Structural characterization of an anti-gp120 RNA aptamer that neutralizes R5 strains of HIV-1. Rna. 2005; 11(6):873-84. [0259] Pan W H, Craven R C, Qiu Q, Wilson C B, Wills J W, Golovine S, et al. Isolation of Virus-Neutralizing Rnas from a Large Pool of Random Sequences. P Natl Acad Sci USA. 1995; 92(25): 11509-13. [0260] Cho S J, Woo H M, Kim K S, Oh J W, Jeong Y J. Novel system for detecting SARS coronavirus nucleocapsid protein using an ssDNA aptamer. J Biosci Bioeng. 2011; 112(6):535-40. [0261] Park J H, Jee M H, Kwon O S, Keum S J, Jang S K. Infectivity of hepatitis C virus correlates with the amount of envelope protein E2: Development of a new aptamer-based assay system suitable for measuring the infectious titer of HCV. Virology. 2013; 439(1):13-22. Epub 2013/03/15. [0262] Wang P, Yang Y, Hong H, Zhang Y, Cai W, Fang D. Aptamers as Therapeutics in Cardiovascular Diseases. Curr Med Chem. 2011; 18(27):4169-74. [0263] Keefe A D, Pai S, Ellington A. Aptamers as therapeutics. Nat Rev Drug Discov. 2010; 9(7):537-50. [0264] Roh C, Jo S K. Quantitative and sensitive detection of SARS coronavirus nucleocapsid protein using quantum dots-conjugated RNA aptamer on chip. J Chem Technol Biot. 2011; 86(12): 1475-9. [0265] Song K M, Lee S, Ban C. Aptamers and Their Biological Applications. Sensors-Basel. 2012; 12(1):612-31. [0266] Liu Y, Tuleouva N, Ramanculov E, Revzin A. Aptamer-Based Electrochemical Biosensor for Interferon Gamma Detection. Anal Chem. 2010; 82(19):8131-6. [0267] Gopinath S C B, Hayashi K, Kumar P K R. Aptamer That Binds to the gD Protein of Herpes Simplex Virus 1 and Efficiently Inhibits Viral Entry. J Virol. 2012; 86(12):6732-44. [0268] James W, Moore M D, Bunka D H J, Stockley P G, Spear P G, Cookson J, et al. The Development of Aptamers as Candidate Antiviral Agents: Towards a Polyvalent Microbicide. Nucleic Acid Ther. 2011; 21(5):A56-A. [0269] Moore M D, Bunka D H J, Forzan M, Spear P G, Stockley P G, McGowan I, et al. Generation of neutralizing aptamers against herpes simplex virus type 2: potential components of multivalent microbicides. J Gen Virol. 2011; 92:1493-9. [0270] James W. Aptamers in the virologists' toolkit. J Gen Virol. 2007; 88:351-64. [0271] Fujita S, Arinaga K, Fujihara T, Aki M, Kichise T. Novel Protein Detection System Using DNA as Constituent. Material. Fujitsu Sci Tech J. 2012; 48(2):237-43. [0272] Kaur H, Li J J, Bay B H, Yung L Y. Investigating the antiproliferative activity of high affinity DNA aptamer on cancer cells. PloS one. 2013; 8(1):e50964. Epub 2013/01/24. [0273] Peng C G, Damha M J. G-quadruplex induced stabilization by 2′-deoxy-2′-fluoro-D-arabinonucleic acids (2′F-ANA). Nucleic acids research. 2007; 35(15):4977-88. Epub 2007/07/20. [0274] Mallikaratchy P R, Ruggiero A, Gardner J R, Kuryavyi V, Maguire W F, Heaney M L, et al. A multivalent DNA aptamer specific for the B-cell receptor on human lymphoma and leukemia. Nucleic acids research. 2011; 39(6):2458-69. Epub 2010/10/30.
[0275] All references herein mentioned are hereby incorporated by reference.